scalable statistical inference for massive health science datawgs covers 100% of the genome rare...
TRANSCRIPT
![Page 1: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/1.jpg)
Scalable Statistical Inference for Massive Health Science Data
Xihong Lin
Department of Biostatistics and Department of Statistics
Harvard University
![Page 2: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/2.jpg)
Examples of Genome, Exposome and Phenome
Smartphone DataWhole Genome Sequencing
Electronic Medical Records
Genome
ExposomePhenome
![Page 3: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/3.jpg)
Our Niche in Big Data Era: Scalable Statistical Inference
Data KnowledgeScalable
ActionsStatistical Inference
Broader
Partnership
Goal: To solve big problems
![Page 4: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/4.jpg)
Whole Genome Sequencing Studies (2015-)
CCGATCCAAGTCCATATATACCGATTTAACCGAA
CCGATCCAAGTCCATATATACCAATTTAACCGAA
CCGATCCAAGTCCATACATACCGATTTAACCGAACCGATCCAAGTCCATACATACCGATTTAACCGAA
CCAATCCAAGTTCATATATACCGATTTGACCGAA
CCGATCTAAGTCCATATATACCGATTTAACCGAA
CCGATCCAAGTCCATACATACCGATTTAACCGAA
![Page 5: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/5.jpg)
WGS Covers 100% of the Genome
Rare Variants
>97%
GWAS Common Variants <3%
Rare variants are more likely to cause diseases and their coded proteins are more likely to be drug targets.
TOPMed Freeze 5 (n=54,000): 430M Variants (97% are rare variants)
![Page 6: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/6.jpg)
1000 Genomes N=1000
GSP(NHGRI)N=200,000
2008
2015
2016
TOPMed(NHLBI)
N=150,000
Large Scale WGS Timeline2018
Biobanks(N=millions)
![Page 7: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/7.jpg)
First Goal of WGS Analysis:Signal Detection
Scan the genome to identify genomic regions associated with diseases/traits
![Page 8: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/8.jpg)
Challenges in Rare Variant Analysis of WGS Data
• Simple single SNP analysis does not work
• Need to perform SNP-set analysis
• Estimation is very difficult
APOE Promoter
LDL= 𝐆𝐆𝐆𝐆 + 𝐞𝐞
![Page 9: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/9.jpg)
Sequencing Kernel Association Test (SKAT)• Wu, et al, 2011, AJHG.
(Citations=1400)• SMMAT• STAAR
Generalized Higher Criticism (GHC) /Generalized Berk-Jones (GBJ)/ACAT
• Murkerjee, et al, Ann. Stat, 2015
• Barnett, et al 2017 (GHC), JASA
• Sun and Lin (GBJ), 2017
• Liu, et al (ACAT), 2018
Model:
Sparse AlternativeDense Alternative
Test for Dense & Sparse High-Dimensional Alternatives
𝐘𝐘 = 𝐆𝐆𝐆𝐆 + 𝐞𝐞
![Page 10: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/10.jpg)
Model and Hypothesis
Yi is phenotype (outcome) (i = 1, · · · , n)
Xi contains q covariates
Gi contains p SNPs (AA, AB, BB=0,1,2) in a SNV set, e.g.,variants in the promoter region of APOE.
α and β contain regression coefficients.
µi = E (Yi |Gi ,Xi)
Model
h(µi) = XTi α +G
Ti β
Hypothesis of no gene/network effect (p might be large):
H0 : β = 0 and H1 : β 6= 0 (weak).
March 8, 2019 1 / 23
![Page 11: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/11.jpg)
• 𝑝𝑝 = dim(𝜷𝜷) might not be small
• Full GLMs hard to fit due to rare variants
• Solution:
• Use score statistics 𝑍𝑍𝑗𝑗 = ∑𝑖𝑖=1𝑛𝑛 𝐺𝐺𝑖𝑖𝑗𝑗(𝑌𝑌𝑖𝑖 − �𝜇𝜇𝑖𝑖𝑖)
• Scability: Fit the null same null model 𝑔𝑔 𝜇𝜇𝑖𝑖 = 𝑿𝑿𝒊𝒊′𝜶𝜶 only once
when scanning the genome
Challenges Addressed in Scalable Inference for WGS Data
![Page 12: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/12.jpg)
Dense/Sparse Alternatives
Unknown Truth: k = p1−α of βj ’s 6= 0
Hypothesis
H0 : β = 0H1 : Some βj 6= 0
Dense alternative (α < 1/2):
Ex: p = 100, α = 0.4⇒ k = 16
Sparse alternative (α > 1/2):
Ex: p = 100, α = 0.6⇒ k = 7
March 8, 2019 2 / 23
![Page 13: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/13.jpg)
Difficulties in Testing
No global optimal most powerful test exists.
Test optimality depends on
Genotype matrix(G ) : Sparsity, LD (correlation)
Signals β: Sparsity, strength, and sign
Distribution of Y
March 8, 2019 3 / 23
![Page 14: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/14.jpg)
• Burden(B) (if all variants are causal with effects (β’s) in the same direction)
𝐵𝐵 = �𝑗𝑗
𝑝𝑝
𝑤𝑤𝑗𝑗𝑍𝑍𝑗𝑗
2
• SKAT (if there are neural variants and/or with effects (β’s) in different directions)
𝑆𝑆 = �𝑗𝑗
𝑝𝑝
𝑤𝑤𝑗𝑗𝑍𝑍𝑗𝑗2
Dense Regime
![Page 15: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/15.jpg)
Sparse Regime: Higher Criticism (HC) (Tukey,1976)
Let
S(t) =
p∑j=1
1{|Zj |≥t}
Assumes Σ = Ip or sparse (G is a low coherence matrix)
The HC test statistic is (Ingster, 1998; Donoho and Jin, 2003;Arias-Castro, et al, 2011)
HC = supt>0
{S(t)− 2pΦ(t)√
2pΦ(t)(1− 2Φ(t))
}
March 8, 2019 5 / 23
![Page 16: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/16.jpg)
The Higher Criticism
−4 −2 0 2 4
0.00
0.10
0.20
0.30
Histogram of the Zi
t
Den
sity
argmax{HC(t)}
March 8, 2019 6 / 23
![Page 17: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/17.jpg)
Linear Regression: Existing Results on DetectionBoundary
Dense Regime (α ≤ 12) Sparse Regime (α > 1
2)
A �√
pα− 12
n⇒ all tests
powerless.A <
√2t log p
n, t <
ρ∗gaussian(α) ⇒ all tests pow-erless.
A �√
pα− 12
n⇒ SKAT pow-
erfulA >
√2t log p
r, t >
ρ∗gaussian(α) ⇒ HC powerful.
Setting
Low coherence matrix G (sparse correlation Σ)
A=signal strength of β.
Sparsity index: k = p1−α
March 8, 2019 7 / 23
![Page 18: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/18.jpg)
The results for binary regression are different fromlinear regression (Mukherjee, et al, 2015, Ann Stat)
If design matrices are too sparse, then signal detection isimpossible no matter how strong signals are.
Two point detection boundary: Maximal Sparsity of G andMinimal Signal Strength β.
March 8, 2019 8 / 23
![Page 19: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/19.jpg)
Asymptotic p-values for HC Does Not Work Wellfor Finte p
The supremum of this standardized empirical process follows aGumbel distribution asymptotically.
Jaeschke (1979) shows that this converges in distribution at anabysmal rate of O{(log p)−1/2}
March 8, 2019 9 / 23
![Page 20: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/20.jpg)
Slow Convergence to Asymptotic Distribution of HC
0 1 2 3 4
0.0
0.2
0.4
0.6
0.8
1.0
x
CD
F(x
)
Theoretical; p=∞ Empirical; p=102 Empirical; p=106
In genetic studies, gene and network sizes
(p=# of SNPs=dozens to thousands)
March 8, 2019 10 / 23
![Page 21: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/21.jpg)
Analytic p-values for HC for Finite p(Barnett and Lin, Biometrika, 2015)
Letting h be the observed HC statistic:
p-value = pr
(supt>0
{S∗(t)− 2pΦ(t)√2pΦ(t)(1− 2Φ(t))
}≥ h
)There exists 0 < t1 < · · · < tp, such that
p-value = 1− pr
(p⋂
k=1
{S∗(tk) ≤ p − k}
)
Then apply the chain rule of conditioning to get a product ofbinomial probabilities.
March 8, 2019 11 / 23
![Page 22: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/22.jpg)
Simulation Study of Type I error rates of HC:Analytic(Exact) vs Asymptotic
p
α 10 50
1·0 9·92× 10−1(7·31× 10−1) 1·01(1·59× 10−1)
1·0× 10−1 1·01× 10−1(6·03× 10−2) 9·75× 10−2(4·90× 10−3)
1·0× 10−2 1·12× 10−2(7·30× 10−3) 9·80× 10−3(4·00× 10−4)
March 8, 2019 12 / 23
![Page 23: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/23.jpg)
Need to account for Correlation among SNPs (LD))
CHRNA3-5 Gene Region
March 8, 2019 13 / 23
![Page 24: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/24.jpg)
Accounting for correlation: Innovated HC (iHC)(Hall and Jin, 2011)
Letting UUT = Cov(Z ) = Σ
Define the transformed (decorrelated) test statistics:
Z∗ = U
−1Z
L−−−→n→∞
MVN(0, Ip)
Set
S∗(t) =
p∑j=1
1{|Z∗j |≥t}
The innovated Higher Criticism test (iHC) statistic is:
iHC = supt>0
{S∗(t)− 2pΦ(t)√2pΦ(t)(1− 2Φ(t))
}
March 8, 2019 14 / 23
![Page 25: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/25.jpg)
Decorrelating using dampens true signals and causesiHC to lose power: CGEM Breast Cancer GWAS:FGFR2 gene
Fre
quen
cy
02
46
8Z
Marginal test statistics
Fre
quen
cy
−4 −2 0 2 4
02
46
8
Z*
March 8, 2019 15 / 23
![Page 26: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/26.jpg)
Generalized Higher Critcism (GHC) (Barnett, et al,2016, JASA)
Recall
S(t) =
p∑j=1
1{|Zj |≥t}
Now we allow Σ to have arbitrary correlation structure.
S(t) is no longer binomial. Instead we approximate withBeta-binomial, matching on first two moments.
The Generalized Higher Criticism (GHC) test statistic is:
GHC = supt>0
S(t)− 2pΦ(t)√Var(S(t))
GHC achieves the same as detection boundary as HC .
March 8, 2019 16 / 23
![Page 27: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/27.jpg)
The variance estimator Var(S(t))
Let rn = 2p(1−p)
∑1≤k<l≤p(Σkl)
n and let Hi(t) be the Hermite
polynomials: H0(t) = 1, H1(t) = t, H2(t) = t2 − 1 and so on. Then
Cov
(S(tk), S(tj)
)= p[2Φ(max{tj , tk})− 4Φ(tj)Φ(tk)]
+4p(p − 1)φ(tj)φ(tk)∞∑i=1
H2i−1(tj)H2i−1(tk)r 2i
(2i)!
March 8, 2019 17 / 23
![Page 28: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/28.jpg)
Analytic p-values for the GHC
Letting h be the observed GHC statistic:
p-value = pr
supt>0
S(t)− 2pΦ(t)√Var(S(t))
≥ h
There exists 0 < t1 < · · · < tp, such that
p-value = 1− pr
(p⋂
k=1
{S(tk) ≤ p − k}
)
March 8, 2019 18 / 23
![Page 29: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/29.jpg)
Generalized Berk-Jones
Motivation: GHC works well in the very sparse signal case butless well in the moderately sparse signal case in finite samples.
Let s be the realized value of S(t).
Berk-Jones (Sup LR test):
BJ = maxt>0
log
{Pr [S(t) = s|π = s/p]
Pr [S(t) = s|π = π0]
}1
{π0 <
s
p
}Generalized Berk-Jones (Account for correlation):
GBJ = maxt>0
log
{Pr [S(t) = s|π = s/p, cor(Z) = Σ]
Pr [S(t) = s|π = π0, cor(Z) = Σ]
}1
{π0 <
s
p
}
March 8, 2019 20 / 23
![Page 30: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/30.jpg)
Inference using Generalized Higher Criticism andGeneralized Berk-Jones
The distribution of S(t) is over-dispersed binomial and its exactdistribution is hard to calculate.
Approximate the distribution of S(t) using extendedbeta-binomial.
The sups in GHC and GBJ are achieved at the design points andboth GHC/GBJ and their distributions are calculated analyticallyusing approximations.
March 8, 2019 21 / 23
![Page 31: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/31.jpg)
Rejection Boundary Comparisons: GHC vs GBJ
20 SNPs, 100% correlated with ρ=0.3
2 4 6 8 10 12 14 16 18 20
01
23
4
Bo
un
da
ry
Ordered Magnitudes of Test Statistics, |Z|(j)
BJ
GBJ
HC
GHC
Note how we gain ’volume’ in the rejection region near the expectedsignals.
March 8, 2019 22 / 23
![Page 32: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/32.jpg)
Simulation (Main advantage of GBJ: Power gain infinite sample for moderate sparsity)
200 SNPs, ρ1=0.3, ρ2=0, ρ3=0, R2=0.01
2 4 6 8 10 12 14
00.2
0.4
0.6
0.8
1
Pow
er
Number of causal SNPs
GBJ
GHC
MinP
SKAT
OMNI
Extremely sparse regime: 1-3 causal. Moderately sparse regime: 4-13causal. Dense regime: 14+ causal.
March 8, 2019 23 / 23
![Page 33: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/33.jpg)
Key features:
• A general method for combining p-values.• Super fast computation under arbitrary correlation and robust to
correlation. • Powerful when signals are sparse.• Can be used for constructing robust test.
Sparse Regime: ACAT: Aggregated Cauchy Association Test
Yaowu Liu, et al (JASA 2018, AJHG, 2019)
![Page 34: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/34.jpg)
𝑇𝑇𝐴𝐴𝐴𝐴𝐴𝐴𝐴𝐴 = �𝑖𝑖=1
𝑑𝑑
𝑤𝑤𝑖𝑖 tan 0.5 − 𝒑𝒑𝒊𝒊 𝜋𝜋
Transform p-value to Cauchy
Weights
Aggregated Cauchy Association Test (ACAT)
![Page 35: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/35.jpg)
Dense signals Sparse signals
Alternative
Neutral variantCausal variant
SlowFastComputation
SKAT / Burden MinP/GHC/GBJ Tests
No prior knowledge about the sparsity of signals. Need robust test.
Existing SNV-set tests
![Page 36: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/36.jpg)
Assumptions: 𝐼𝐼. 𝑝𝑝𝑖𝑖 |𝑍𝑍𝑖𝑖| (z-score) 𝐼𝐼𝐼𝐼. ∀𝑖𝑖, 𝑗𝑗, 𝑍𝑍𝑖𝑖 ,𝑍𝑍𝑗𝑗 ~𝑁𝑁2 0,Θ𝑖𝑖𝑗𝑗Theorem: For any Σ ≥ 0, we have
lim𝑡𝑡→+∞
𝑃𝑃{𝑇𝑇𝐴𝐴𝐴𝐴𝐴𝐴𝐴𝐴 > 𝑡𝑡}𝑃𝑃{Cauchy 0,1 > 𝑡𝑡}
= 1.
P-value calculation:p − value ≈ 1/2 − {𝑎𝑎𝑎𝑎𝑎𝑎𝑡𝑡𝑎𝑎𝑛𝑛(𝑇𝑇𝐴𝐴𝐴𝐴𝐴𝐴𝐴𝐴)}/π
Correlation of p-values Not required Super fast
Tail is Cauchy
Theory about ACAT
![Page 37: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/37.jpg)
IndependentPerfectly dependent
Sample mean ( �𝑋𝑋 = 1
𝑑𝑑∑𝑖𝑖=1𝑑𝑑 𝑋𝑋𝑖𝑖)
𝑋𝑋𝑖𝑖 ~ Cauchy(0,1)
𝑋𝑋𝑖𝑖 ~ Normal(0,1) �𝑋𝑋 ~ N(0,1/d)
�𝑋𝑋 ~ Cauchy(0,1)�𝑋𝑋 ~ Cauchy(0,1)
�𝑋𝑋 ~ N(0,1)
≈Cauchy(0,1)
General Dependency
Heavy tail makes Cauchy distribution insensitive to correlation
Some insights
![Page 38: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/38.jpg)
P-values
0.35 0.510.25 1.000.15 1.960.05 6.31
0.45 0.16
2e-03 159 5e-03 63.7
Cauchy values
233
ACAT uses a few smallest p-values to represent the significance.
ACAT is powerful against sparse alternatives
![Page 39: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/39.jpg)
…………MAC<10 MAC>=10
SNVs in a region
Burden 𝑝𝑝0 𝑝𝑝1 𝑝𝑝2 𝑝𝑝3 𝑝𝑝𝑘𝑘……
𝑇𝑇
P-value ≈ 1 − 𝐹𝐹𝑐𝑐𝑐𝑐𝑐𝑐𝑐𝑐𝑐𝑐𝑐(𝑇𝑇) Super fastAccurate
𝑤𝑤𝑖𝑖,𝐴𝐴𝐴𝐴𝐴𝐴𝐴𝐴−𝑉𝑉 = 𝑤𝑤𝑖𝑖,𝑆𝑆𝑆𝑆𝐴𝐴𝐴𝐴 × )𝑀𝑀𝑀𝑀𝐹𝐹𝑖𝑖(1 −𝑀𝑀𝑀𝑀𝐹𝐹𝑖𝑖
Saddlepoint method (Dey, et al, 2017)
ACAT-V for testing a SNV-set
![Page 40: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/40.jpg)
Key features:
• Boost RV analysis power by optimally combining statistical evidence of MAFs (default in SKAT), functional annotations, and phenotypic information
• Computationally scalable
• Applicable to any given variant-set
STAAR: variant-Set Test for Association using Annotation infoRmation
Xihao Li and Zilin Li
![Page 41: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/41.jpg)
Optimal weighting: True effect sizes (unknown)
Signal Regions (Effect Sizes (𝜷𝜷)) in the Genome
![Page 42: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/42.jpg)
Question: Which functional scores to use boost power of RV association analysis in a variant-Set
Use Functional Annotations to Prioritize Variants in a Variant-Set
![Page 43: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/43.jpg)
Functional Annotation Database
WGSA
Annovar
CADD
ENCODE
EPIGENOME
Individual Scores
Choosing Weights 𝒘𝒘𝒋𝒋 to Empower WGS Association Analysis
>260 annotations
15 Types of Annotations
80% built on hg38
Genome Functional Variant Annotations (GSP+TOPMED) Hufeng Zhou)
Dynamically incorporate multiple annotation weights in RV Tests
![Page 44: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/44.jpg)
Coding Variants Non-coding Variants
Existing Integrative Annotation Scores are Mainly Driven by Protein and Conservation Scores with Little Correlation with Epigenetic Scores
![Page 45: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/45.jpg)
• APC1: Epigenetics• APC2: Conservation• APC3: Protein Function• APC4: Negative Selection• APC5: Distance to Coding• APC6: Mutation Density• APC7: Transcription Factor• APC8: MapAbility• APC9: Distance to TEE/TSE• APC10: MicroRNA
Correlation Heatmap with Annotation PCs (GSP Freeze 1, hg38)
![Page 46: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/46.jpg)
STAAR: Incorporate Multiple Functional Scores to Boost Power of RV Association Analysis Using ACAT
![Page 47: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/47.jpg)
Type I Error Rates Using STAAR are Protected: Simulated WGS data Using COSI (n = 10,000)
𝜶𝜶 = 𝟏𝟏𝟎𝟎−𝟔𝟔 Continuous Traits Dichotomous Traits
STAAR-B 1.1 × 10−6 1.0 × 10−6
STAAR-S 9.9 × 10−7 7.8 × 10−7
STAAR-O 9.3 × 10−7 1.0 × 10−6
STAAR-O uses ACAT to combine STAAR-B and STAAR-O
![Page 48: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/48.jpg)
ARIC WGS data of LPA (AA, n=1800): Significant 4KB Sliding Windows in Chr 6
![Page 49: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/49.jpg)
LPA (AA): Significant 4KB Sliding Windows in Chr 6
![Page 50: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/50.jpg)
Area 1 and Area 2: Weights
![Page 51: Scalable Statistical Inference for Massive Health Science DataWGS Covers 100% of the Genome Rare Variants >97% GWAS Common Variants](https://reader034.vdocuments.us/reader034/viewer/2022051905/5ff80f554d447c088a2b3a75/html5/thumbnails/51.jpg)
• Scalable statistical inference is a critical niche for analysis of big data.
• It is important to integrate domain science and computational science in scalable statistical inference to accelerate statistical science and scientific discovery.
• “Optimal” statistical inference needs to context-specific, e.g., dense and sparse regimes for high-dimensional hypothesis testing
• Asymptotic and finite sample results are both important.
Final Remarks