www.fems-microbiology.org

FEMS Microbiology Letters 237 (2004) 393–398

Saprolegnia multispora, a new oomycete isolated from watersamples taken in a river in the Burgundian region of France

Bernard Paul a,*, Monica M. Steciow b

a Laboratoire des Sciences de la Vigne, Institut Jules Guyot, Universite de Bourgogne, BP 138, 27877, 21078 Dijon, Franceb Instituto de Botanica Spegazzini, 53 No. 477, (1900) La Plata, Buenos Aires, Argentina

Received 28 June 2004; accepted 2 July 2004

First published online 24 July 2004

Abstract

Saprolegnia multispora is described from water and floating organic matter taken in the Tille River, in the Burgundian region of

France. The new species is illustrated and compared with other species of the genus. Distinguishing characteristics of S. multispora

are the production of smooth-walled oogonia containing many subcentric oospores which are (1�) 11–70 (�100) per oogonium. The

antheridial branches supplying the oogonia are predominantly diclinous, but at times these may be monoclinous and androgynous.

Morphological features of the oomycete and the sequence of the ITS region of its rDNA as well as their comparison with related

species are discussed in this article.

� 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Oomycetes; Saprolegnia; Antheridia; Oogonia; Oospores; rDNA; ITS region

1. Introduction

The members of the genus Saprolegnia are ubiquitous

oomycetes that form a group of aquatic fungi-like or-

ganisms possessing coenocytic mycelium and cellulosetype cell walls. Septation of the mycelium occurs to de-

limit reproductive and assimilative portions of the thal-

lus. These are mostly saprophytes but some are known

to be fish parasites. Unlike most of the eumycetes, the

members of this group remain diploid throughout their

life cycles with meiosis occurring in the gametangia be-

fore fertilization [1]. The asexual reproduction is by bi-

flagellated zoospores formed in the sporangium.Sexual reproduction is through ‘‘gametangial copula-

tion’’ in which motile male gametes (sperms) are absent.

These are replaced by male nuclei which are directly in-

jected from the antheridium into the oospheres present

0378-1097/$22.00 � 2004 Federation of European Microbiological Societies

doi:10.1016/j.femsle.2004.07.006

* Corresponding author. Tel./fax: +33-3-80396326/8039341.

E-mail address: bernard.paul@u-bourgogne.fr (B. Paul).

in the oogonium. The character combination of cellulose

cell wall, biflagellated zoospores, gametangial copula-

tion and modern molecular and biochemical analyses

suggest that the oomycetes are closer to algae (Phae-

ophyta and Chrysophyta) and higher plants. At presentthe oomycetes are no longer considered to be true fungi

and are now classified amongst ‘‘Stramenopiles’’, one of

the eukaryotic Kingdoms which includes water molds

and brown algae. The position of the oomycetes as a un-

ique lineage of stramenopile eukaryotes, unrelated to

true fungi but closely related to heterokont ( brown) al-

gae, has been well established using molecular phyloge-

nies that are based on ribosomal RNA (rRNA)sequences [2–4]. Surprisingly, botanists of the mid-

1800s had classified Saprolegniaceous organisms within

the algal groups and Saprolegniaceae (Saprolegnia, Ach-

lya, Pythium) was given an equal status to the algal fam-

ily of Oedogoniaceae [5].

The taxonomy of the genus Saprolegnia is mainly

based on the morphological descriptions and the keys

. Published by Elsevier B.V. All rights reserved.

394 B. Paul, M.M. Steciow / FEMS Microbiology Letters 237 (2004) 393–398

provided by Coker [6], Sparrow [7], Seymour [8] and the

monumental (and freely available on the internet) work

of Johnson et al. [5] are indispensable. However the

morphological observations are now being supplemented

with molecular characteristics. The polymerase chain re-

action coupled with restriction fragment length poly-morphism analysis (PCR-RFLP) has become a useful

tool in taxonomy and is currently used to identify differ-

ent species of oomycetes [9,10]. Amplification of the ri-

bosomal gene is used for the genetic identification of

many organisms because they comprise both highly con-

served sequences during evolution and highly variable

sequences among species and even within species. The

ribosomal nuclear DNA consists of transcribed andnon-transcribed regions [10]. The ITS1 and ITS2 regions

(internal transcribed spacer) are non-conserved and

have been amplified with the PCR method using univer-

sal primers ITS1 and ITS4.

During a survey of zoosporic organisms occurring in

the Burgundian region of France, a new species, Sapro-

legnia multispora (F-1247), has been isolated from water

samples taken in the river Tille. The new oomycete isclosely related to S. diclina and S. parasitica as far as

its morphological and molecular characteristics are con-

cerned; however, the oomycetes have their own distinc-

tive features which separates them from other known

oomycetes. S. multispora was isolated five times from

water samples taken at different places in the Tille river.

The isolate F-1247 produces antheridia and oogonia

plentifully, hence it is considered as the type specimen.The morphological characteristics of this oomycetes,

the sequence of the ITS region of its rDNA, and com-

parison with related species are discussed in this article.

2. Materials and methods

2.1. Fungal and oomyceteous material

Baiting methods [5,11] were used to isolate the zoosp-

oric organisms. Water samples together with some de-

caying organic matter were collected from the river

Tille and were brought to the laboratory in sterile screw

capped plastic bottles. These samples were placed in

sterilised Petri dishes containing several halves of hemp

seeds (Cannabis sativa) and incubated at room tempera-ture (15–20 �C). After growth of the oomycete on the

seeds was observed, some hyphae were aseptically taken

out with the help of sterile needles and transferred to

Cornmeal Agar plates (CMA). After seven days of

growth on the CMA plates, a block of agar from the

edge of each colony was cut off and placed in sterilised

Petri dishes containing sterile river water mixed wth ster-

ile distilled water (1:1) and hemp-seed halves were float-ed in order to obtain new colonies. All morphological

characteristics, measurements and observations were

taken from the colonies obtained in water on the hemp

seed halves. The CMA plates were incubated at 5, 10,

and 25 �C to observe the possible effect of temperature

on the variations of sexual structures. Diameters of fun-

gus colonies, diameters of oogonia, number of oospores

per oogonia, and diameters of oospores were calculatedfrom 50 counts of each of three replicates. Measure-

ments and observations were made using an Olympus

BX 40 microscope (Olympus Optical CO., LTD, Tokyo,

Japan) equipped with phase contrast optics.The type

specimen is deposited in the mycological herbarium of

the ‘‘Institut Jules Guyot’’ at the Universite de Bourgo-

gne, Dijon (France).

2.2. DNA isolation and PCR

A small block of CMA plates with the oomycetous

isolates were aseptically introduced and grown in PDB

(potato dextrose broth). The culture conditions, DNA

isolation and the PCR of the internal transcribed spacer

(ITS) of the ribosomal nuclear DNA was done using the

procedures described earlier [12,13]. Universal primersITS1 (TCC GTA GGT GAA CCT GCG G) and ITS4

(TCC TCC GCT TAT TGA TAT GC) were synthesised

and the DNA sequence was realised by Oligo Express

(Paris). ITS1 is at the 3 0 end of the 18S rDNA gene

and ITS4 is at the 5 0 end of the 28S rDNA gene. The se-

quences obtained were compared with the ITS1 sequences

of related species of Saprolegnia: S. parasitica (GenBank

Accession No. AY455776), S. longicaulis (AY270032),S. bulbosa (AY267011), S. oliviae (AY270031), S. diclina

(AY455775) and Achlya papillosa (AF218161). The se-

quence of the ITS region of the nuclear ribosomal

DNA of S. multispora (F-1247) has been deposited to

the GenBank.

3. Results

3.1. Morphological descriptions

3.1.1. S. multispora (Paul and Steciow, Figs. 1–3)

Mycelium densum, cultura in seminibus Cannabis sa-

tivae 2–4.0 cm diam. Hyphae ramosa, pleraque 24–63

lm late diam. ad basim. Sporangia in culturis juvenili-

bus, fusiformia, filiform, clavata vel naviculata, (97�)121–485 lm larga et 19–50 lm lata, renovata per prolife-

rationem internam. Ejecto sporarum pro genus typica,

zoospori incystatis globosi 9–12 lm. Gemmae frequen-

tis. Oogonia copiosa, pyriformia vel sphaerica, (29�)

60–111 (�136) lm diam. Paries oogonia laevis, ramulus

lateralibus provenientia, 19–582 lm. Oospori (1�) 11–

70 (�100) per oogonium, subcentrici, (10�) 12–20

(�25) lm diam. Ramulus antheridiales diclina, ramosus,plerumque origine diclina sed interdum monoclina et

androgyna.

B. Paul, M.M. Steciow / FEMS Microbiology Letters 237 (2004) 393–398 395

The oomycete grows luxuriantly on hemp-seed halves

in water and on CMA. In water, the mycelium is exten-

sive, denser near substratum, and a two week-old colony

on hemp seed measures 2–4.0 cm in diameter. The main

hyphae are stout, sparingly branched, and measure 24–

63 lm diameter at the base (Fig. 1(a)).Asexual reproduction is abundant. Zoosporangia

are often fusiform, filiform, clavate or rarely navicu-

late, measuring (97�) 121–485 X 19–50 lm; straight

or bent, usually terminal (Fig. 1(b)–(d)). Zoospore dis-

charge is typically saprolegnoid. Encysted zoospores

are globose and measure 9–12 lm diameter (Fig.

1(e)). Sporangial renewal is usually by internal prolifer-

Fig. 1. Saprolegnia multispora asexual reproduction. (a) Stout hyphae em

zoosporangia, (c)–(d) formation and saprolegnoid discharge of zoospores, (e)

proliferation, (g) gemmae, (h) zoospore formation within gemmae. a,b,e,g: S

ation (Fig. 1(f)). Gemmae are also formed plentifully in

water cultures. These are spherical, pyriform, clavate or

irregular, simple or catenulate, and function as zoosp-

orangia, with one–several papillae of discharge (Fig.

1(g)–(h)).

Sexual reproduction is oogamous by gametangialcopulation. Both male and female gametangia are

formed within one week of culture in water on the

hemp-seeds. Oogonia are abundant, terminal, lateral

or frequently intercalary; mainly pyriform, but also

spherical, obovate, cylindrical, rarely naviculate or rarely

irregular, doliform when intercalary, and measure (29�)

60–111 (�136) lm in diameter (Fig. 2(a)–(c)).

erging out of hemp seeds in water culture, (b) mature and emptied

encysted and germinating zoospores, (f) sporangial renewal by internal

cale bar = 100 lm and c,d,f,h: bar = 50 lm.

Fig. 2. Saprolegnia multispora sexual reproduction. (a) Terminal oogonia with diclinous antheridia, (b) intercalary oogonia, (c) intercalary oogonia

with diclinous antheridia, (d) terminal oogonia with monoclinous antheridia, (e)–(h) oogonia wrapped around with diclinous antheridia, containing

multiple oospores. (a) scale bar = 100 lm, (b)–(h) bar = 50 lm.

396 B. Paul, M.M. Steciow / FEMS Microbiology Letters 237 (2004) 393–398

Oogonial walls are smooth and pitted. These are borne

on oogonial stalks which are stout and tapering towardsthe end, or slender; straight or bent, sometimes

branched; 19–582 lm long. After fertilization, (1�)

11–70 (�100) oospores are formed in the oogonia

(Fig. 2(d)–(h)). These are subcentric, type I, generally

filling the oogonium; spherical or ellipsoid; maturing,

and measuring (10�) 12–20 (�25) lm diam. Antheridia

are present. Almost all the oogonia are supplied by one

to many antheridia. These branches are principally dicl-inous (Fig. 2(a), (c), (f)–(h)), rarely monoclinous (Fig.

2(d)) or androgynous. Antheridial cells are simple or

branched; attached by projections or laterally appressed

(Fig. 2(e)–(h)). Fertilization tubes are conspicuous.HOLOTYPE: F-1247, Isolated from the Tille river at

‘‘Arc sur Tille’’ near the city of Dijon in Burgundy

(France) and maintained at the ‘‘Institut Jules Guyot’’

Universite de Bourgogne, Dijon, France, and also at

the Instituto de Botanica Spegazzini, 53 No. 477,

(1900) La Plata, Buenos Aires, Argentina LPS No.

45856; culture collection No. 767 (LPSC).

ETYMOLOGY: S. multispora refers to the presenceof one to many (up to hundred) subcentric oospores

inside the oogonia of this new species.

Fig. 3. CLUSTAL W, multiple sequence alignment of ITS1 regions of the rDNA of Saprolegnia multisporum, S. diclina, S. oliviae, S. bulbosa,

S. longicaulis, S. pararsitica, and Achlya papillosa.

B. Paul, M.M. Steciow / FEMS Microbiology Letters 237 (2004) 393–398 397

3.2. Internal transcribed spacer region

The GenBank Accession of ITS sequence of the

rDNA of S. multispora strain F-1247, is AY197329. It

is comprised of 581 bases:

1 acctgcggaa ggatcattac cacaccaaaa aacaccccac gtgaacg-

tac tctttatgag

61 gctttgcgct gcccttgtgg cagctagccg aaggtttcgc ag-

gaagccga tgtcaatttg

121 aatccttttt aaacaacgac tgatcaaaac tgcagataga aa-

tgtctgca tgcaattgaa

181 atacaacttt caacagtgga tgtctaggct cgcacaccga tgaa-gaacgc tgcgaactgc

241 gatacgtaat gcgaattgca gaattcagtg agtcatcaaa at-

tttgaacg catattgcac

301 ttccgggtta gtcctgggag tatgtttgta tcagtgtccg tgaa-

cacaac cttgtttcat

361 tccttgatgg tttggagcag actttgaagg tcttgcactt

gcaagtcctt ttaaacgatg

421 gtacctatgc gtcctcgtga gatgtattat ttaaaggtatgcctgcgctc ctttcgagag

481 tcttgtgtgg cggcacacag cattcaaaga gagagcaaat

cgcggtagtt ttgcttgggc

541 ttcggtacga gtggacatat attgcttttt gtgatttcgg c

bases 10–19 = 18S gene, partial sequence (in bold), 20–

183 = ITS1 (complete sequence), 184–342 = 5.8 S gene,

complete sequence (in bold), 343–581 = ITS 2, partialsequence.

The comparison of the ITS1 sequences of S. multis-

pora and related species is given in Fig. 3 in the form

of CLUSTAL multiple alignments.

4. Discussion

Morphologically, S. multispora Paul and Steciow has

close affinities with S. diclina Humphrey and S. australis

Elliott in having mainly diclinous antheridial branches,which are at times monoclinous or androgynous and

subcentric oospores. However, the oospores in S. diclina

are predominantly centric. The number of oospores per

oogonium are higher in S. multispora ((1�) 11–70

(�100) instead of only (1) 8–12 (28) in the case of S. di-

clina and (1) 6–12 (30) in S. australis). Moreover the oo-

spores of S. australis may or may not mature, or the

oospores may develop and then abort [5,8], which isnot the case of the oospores of the new species. Recently

Johnson et al. [5] mentioned that S. diclina can develop a

mean number of 8–16 oospores but can reach a higher

number of 100 oospores. However the oogonial wall is

unpitted and the oospore size is much bigger: (12) 18–

26 (44) lm diam. in the case of S. diclina as compared

to the pitted oogonial walls containing smaller oospores:

(10�) 12–20 (�25) lm of S. multispora. Moreover in S.

diclina the oogonia are sparse often appearing in culture

only after prolonged incubation or they can be altogether

absent which is not the case of S. multispora.

The subcentric oospores of S. multispora also relates

it to S. parasitica Coker. However there are many differ-

ences between these two species: the conspicuous pitted

oogonial wall, origin of antheridial branches, and the

presence of up to 100 oospores in S. multispora separatesit from S. parasitica, which has unpitted oogonial wall,

diclinous antheridial branches, and lesser number of oo-

spores (2) 14–23 (40). This species has recently been re-

duced to synonymy with S. diclina [5]. Some species of

398 B. Paul, M.M. Steciow / FEMS Microbiology Letters 237 (2004) 393–398

Saprolegnia described from Argentina like, S. longicaulis

Steciow, S. oliviae Steciow and S. variabilis Steciow et

Elıades are also related to S. multispora in having sub-

centric oospores and diclinous antheridial branches,

however, these differ from the latter in their oogonial,

antheridial and oosporal characters [14–16].A BLAST search with the sequence of the ITS region

of the rDNA of S. multispora gives close homologies

(95.9%) with the S. parasitica (GenBank Accession

No. AY455776), S. longicaulis (AY270032) and S. bul-

bosa (AY267011), 95.6% with (AY270031), 95.4% with

S. diclina (AY455775), and only 79.2% with Achlya pap-

illosa (AF218161). These similarities are not in contra-

diction with the morphological characters of the newoomycete.

The oomycete isolated in the river Tille in the Bur-

gundian region of France belongs, undoubtedly, to the

genus Saprolegnia. Its specific morphological and molec-

ular characteristics justify the creation of the new taxon

of S. multispora.

References

[1] Levesque, C.A., Harlton, C.E. and de Cock, A.W.A.M. (1998)

Identification of some oomycetes by reverse dot blot hybridisa-

tion. Phytopathology 88, 213–222.

[2] Kumar, C. and Rzhetsky, A. (1996) Evolutionary relationships of

eukaryotic kingdoms. J. Mol. Evol. 42, 183–193.

[3] Van de Peer, Y. and De Wachter, R. (1997) Evolutionary

relationships among the eukaryotic crown taxa taking into

account site-to-site rate variation in 18S rRNA. J. Mol. Evol.

45, 619–630.

[4] Paquin, B., Laforest, M.J., Forget, L., Roewer, I., Wang, Z.,

Longcore, J. and Lang, B.F. (1997) The fungal mitochondrial

genome project: evolution of fungal mitochondrial genomes and

their gene expression. Curr. Genet. 31, 380–395.

[5] Johnson Jr. , T.W., Seymour, R.L. and Padgett, D.E. (2002)

Biology and systematics of the Saprolegniaceae. On-line publica-

tion: http://www.ilumina-dlib.org. 1028p.

[6] Coker, W.C. (1923) The Saprolegniaceae with notes on other

water molds. University of North Carolina Press, Chapel

Hill.

[7] Sparrow, F.K. (1960) Aquatic Phycomycetes, 2nd ed.. University

of Michigan Press, Ann Arbor, MI.

[8] Seymour, R.L. (1970) The genus Saprolegnia. Nova Hedwigia 19,

1–124.

[9] Chen, W., Hoy, J.W. and Schneider, R.W. (1992) Species-specific

polymorphisms in transcribed ribosomal DNA of five Pythium

species. Exp. Mycol. 16, 22–34.

[10] Chen, W., Schneider, R.W. and Hoy, J.W. (1992) Taxonomic and

phylogenetic analyses of ten Pythium species using isozyme

polymorphisms. Phytopathology 82, 1234–1244.

[11] Middleton, J.T. (1943) The taxonomy, host range, and geograph-

ical distribution of the genus Pythium. Mem. Torrey Bot. Club 20,

1–171.

[12] Paul, B., Galland, D. and Masih, I. (1999) Pythium prolatum

isolated from soil in the Burgundy region: A new record for

Europe. FEMS Microbiol. Lett. 173, 69–75.

[13] Paul, B. (2001) ITS region of the rDNA of Pythium longandrum, a

new species; its taxonomy and its comparison with related species.

FEMS Microbiol. Lett. 202, 239–242.

[14] Steciow, M.M. (2001) Saprolegnia longicaulis (Saprolegniales,

Straminipila), a new species from an Argentine stream. N. Z. J.

Botany 39, 483–488.

[15] Steciow, M.M. (2003) Saprolegnia oliviae sp. nov. isolated from

an Argentine river (Tierra del fuego Province, Argentina). FEMS

Microbiol. Lett. 219, 253–259.

[16] Steciow, M.M. and Eliades, L.A. (2002) A new species of

Saprolegnia (Saprolegniales, Straminipila), from a polluted Ar-

gentine channel. N. Z. J. Botany 40, 679–685.