saprolegnia multispora, a new oomycete isolated from water samples taken in a river in the...
TRANSCRIPT
![Page 1: Saprolegnia multispora, a new oomycete isolated from water samples taken in a river in the Burgundian region of France](https://reader030.vdocuments.us/reader030/viewer/2022020223/575066bc1a28ab0f07a84a97/html5/thumbnails/1.jpg)
www.fems-microbiology.org
FEMS Microbiology Letters 237 (2004) 393–398
Saprolegnia multispora, a new oomycete isolated from watersamples taken in a river in the Burgundian region of France
Bernard Paul a,*, Monica M. Steciow b
a Laboratoire des Sciences de la Vigne, Institut Jules Guyot, Universite de Bourgogne, BP 138, 27877, 21078 Dijon, Franceb Instituto de Botanica Spegazzini, 53 No. 477, (1900) La Plata, Buenos Aires, Argentina
Received 28 June 2004; accepted 2 July 2004
First published online 24 July 2004
Abstract
Saprolegnia multispora is described from water and floating organic matter taken in the Tille River, in the Burgundian region of
France. The new species is illustrated and compared with other species of the genus. Distinguishing characteristics of S. multispora
are the production of smooth-walled oogonia containing many subcentric oospores which are (1�) 11–70 (�100) per oogonium. The
antheridial branches supplying the oogonia are predominantly diclinous, but at times these may be monoclinous and androgynous.
Morphological features of the oomycete and the sequence of the ITS region of its rDNA as well as their comparison with related
species are discussed in this article.
� 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
Keywords: Oomycetes; Saprolegnia; Antheridia; Oogonia; Oospores; rDNA; ITS region
1. Introduction
The members of the genus Saprolegnia are ubiquitous
oomycetes that form a group of aquatic fungi-like or-
ganisms possessing coenocytic mycelium and cellulosetype cell walls. Septation of the mycelium occurs to de-
limit reproductive and assimilative portions of the thal-
lus. These are mostly saprophytes but some are known
to be fish parasites. Unlike most of the eumycetes, the
members of this group remain diploid throughout their
life cycles with meiosis occurring in the gametangia be-
fore fertilization [1]. The asexual reproduction is by bi-
flagellated zoospores formed in the sporangium.Sexual reproduction is through ‘‘gametangial copula-
tion’’ in which motile male gametes (sperms) are absent.
These are replaced by male nuclei which are directly in-
jected from the antheridium into the oospheres present
0378-1097/$22.00 � 2004 Federation of European Microbiological Societies
doi:10.1016/j.femsle.2004.07.006
* Corresponding author. Tel./fax: +33-3-80396326/8039341.
E-mail address: [email protected] (B. Paul).
in the oogonium. The character combination of cellulose
cell wall, biflagellated zoospores, gametangial copula-
tion and modern molecular and biochemical analyses
suggest that the oomycetes are closer to algae (Phae-
ophyta and Chrysophyta) and higher plants. At presentthe oomycetes are no longer considered to be true fungi
and are now classified amongst ‘‘Stramenopiles’’, one of
the eukaryotic Kingdoms which includes water molds
and brown algae. The position of the oomycetes as a un-
ique lineage of stramenopile eukaryotes, unrelated to
true fungi but closely related to heterokont ( brown) al-
gae, has been well established using molecular phyloge-
nies that are based on ribosomal RNA (rRNA)sequences [2–4]. Surprisingly, botanists of the mid-
1800s had classified Saprolegniaceous organisms within
the algal groups and Saprolegniaceae (Saprolegnia, Ach-
lya, Pythium) was given an equal status to the algal fam-
ily of Oedogoniaceae [5].
The taxonomy of the genus Saprolegnia is mainly
based on the morphological descriptions and the keys
. Published by Elsevier B.V. All rights reserved.
![Page 2: Saprolegnia multispora, a new oomycete isolated from water samples taken in a river in the Burgundian region of France](https://reader030.vdocuments.us/reader030/viewer/2022020223/575066bc1a28ab0f07a84a97/html5/thumbnails/2.jpg)
394 B. Paul, M.M. Steciow / FEMS Microbiology Letters 237 (2004) 393–398
provided by Coker [6], Sparrow [7], Seymour [8] and the
monumental (and freely available on the internet) work
of Johnson et al. [5] are indispensable. However the
morphological observations are now being supplemented
with molecular characteristics. The polymerase chain re-
action coupled with restriction fragment length poly-morphism analysis (PCR-RFLP) has become a useful
tool in taxonomy and is currently used to identify differ-
ent species of oomycetes [9,10]. Amplification of the ri-
bosomal gene is used for the genetic identification of
many organisms because they comprise both highly con-
served sequences during evolution and highly variable
sequences among species and even within species. The
ribosomal nuclear DNA consists of transcribed andnon-transcribed regions [10]. The ITS1 and ITS2 regions
(internal transcribed spacer) are non-conserved and
have been amplified with the PCR method using univer-
sal primers ITS1 and ITS4.
During a survey of zoosporic organisms occurring in
the Burgundian region of France, a new species, Sapro-
legnia multispora (F-1247), has been isolated from water
samples taken in the river Tille. The new oomycete isclosely related to S. diclina and S. parasitica as far as
its morphological and molecular characteristics are con-
cerned; however, the oomycetes have their own distinc-
tive features which separates them from other known
oomycetes. S. multispora was isolated five times from
water samples taken at different places in the Tille river.
The isolate F-1247 produces antheridia and oogonia
plentifully, hence it is considered as the type specimen.The morphological characteristics of this oomycetes,
the sequence of the ITS region of its rDNA, and com-
parison with related species are discussed in this article.
2. Materials and methods
2.1. Fungal and oomyceteous material
Baiting methods [5,11] were used to isolate the zoosp-
oric organisms. Water samples together with some de-
caying organic matter were collected from the river
Tille and were brought to the laboratory in sterile screw
capped plastic bottles. These samples were placed in
sterilised Petri dishes containing several halves of hemp
seeds (Cannabis sativa) and incubated at room tempera-ture (15–20 �C). After growth of the oomycete on the
seeds was observed, some hyphae were aseptically taken
out with the help of sterile needles and transferred to
Cornmeal Agar plates (CMA). After seven days of
growth on the CMA plates, a block of agar from the
edge of each colony was cut off and placed in sterilised
Petri dishes containing sterile river water mixed wth ster-
ile distilled water (1:1) and hemp-seed halves were float-ed in order to obtain new colonies. All morphological
characteristics, measurements and observations were
taken from the colonies obtained in water on the hemp
seed halves. The CMA plates were incubated at 5, 10,
and 25 �C to observe the possible effect of temperature
on the variations of sexual structures. Diameters of fun-
gus colonies, diameters of oogonia, number of oospores
per oogonia, and diameters of oospores were calculatedfrom 50 counts of each of three replicates. Measure-
ments and observations were made using an Olympus
BX 40 microscope (Olympus Optical CO., LTD, Tokyo,
Japan) equipped with phase contrast optics.The type
specimen is deposited in the mycological herbarium of
the ‘‘Institut Jules Guyot’’ at the Universite de Bourgo-
gne, Dijon (France).
2.2. DNA isolation and PCR
A small block of CMA plates with the oomycetous
isolates were aseptically introduced and grown in PDB
(potato dextrose broth). The culture conditions, DNA
isolation and the PCR of the internal transcribed spacer
(ITS) of the ribosomal nuclear DNA was done using the
procedures described earlier [12,13]. Universal primersITS1 (TCC GTA GGT GAA CCT GCG G) and ITS4
(TCC TCC GCT TAT TGA TAT GC) were synthesised
and the DNA sequence was realised by Oligo Express
(Paris). ITS1 is at the 3 0 end of the 18S rDNA gene
and ITS4 is at the 5 0 end of the 28S rDNA gene. The se-
quences obtained were compared with the ITS1 sequences
of related species of Saprolegnia: S. parasitica (GenBank
Accession No. AY455776), S. longicaulis (AY270032),S. bulbosa (AY267011), S. oliviae (AY270031), S. diclina
(AY455775) and Achlya papillosa (AF218161). The se-
quence of the ITS region of the nuclear ribosomal
DNA of S. multispora (F-1247) has been deposited to
the GenBank.
3. Results
3.1. Morphological descriptions
3.1.1. S. multispora (Paul and Steciow, Figs. 1–3)
Mycelium densum, cultura in seminibus Cannabis sa-
tivae 2–4.0 cm diam. Hyphae ramosa, pleraque 24–63
lm late diam. ad basim. Sporangia in culturis juvenili-
bus, fusiformia, filiform, clavata vel naviculata, (97�)121–485 lm larga et 19–50 lm lata, renovata per prolife-
rationem internam. Ejecto sporarum pro genus typica,
zoospori incystatis globosi 9–12 lm. Gemmae frequen-
tis. Oogonia copiosa, pyriformia vel sphaerica, (29�)
60–111 (�136) lm diam. Paries oogonia laevis, ramulus
lateralibus provenientia, 19–582 lm. Oospori (1�) 11–
70 (�100) per oogonium, subcentrici, (10�) 12–20
(�25) lm diam. Ramulus antheridiales diclina, ramosus,plerumque origine diclina sed interdum monoclina et
androgyna.
![Page 3: Saprolegnia multispora, a new oomycete isolated from water samples taken in a river in the Burgundian region of France](https://reader030.vdocuments.us/reader030/viewer/2022020223/575066bc1a28ab0f07a84a97/html5/thumbnails/3.jpg)
B. Paul, M.M. Steciow / FEMS Microbiology Letters 237 (2004) 393–398 395
The oomycete grows luxuriantly on hemp-seed halves
in water and on CMA. In water, the mycelium is exten-
sive, denser near substratum, and a two week-old colony
on hemp seed measures 2–4.0 cm in diameter. The main
hyphae are stout, sparingly branched, and measure 24–
63 lm diameter at the base (Fig. 1(a)).Asexual reproduction is abundant. Zoosporangia
are often fusiform, filiform, clavate or rarely navicu-
late, measuring (97�) 121–485 X 19–50 lm; straight
or bent, usually terminal (Fig. 1(b)–(d)). Zoospore dis-
charge is typically saprolegnoid. Encysted zoospores
are globose and measure 9–12 lm diameter (Fig.
1(e)). Sporangial renewal is usually by internal prolifer-
Fig. 1. Saprolegnia multispora asexual reproduction. (a) Stout hyphae em
zoosporangia, (c)–(d) formation and saprolegnoid discharge of zoospores, (e)
proliferation, (g) gemmae, (h) zoospore formation within gemmae. a,b,e,g: S
ation (Fig. 1(f)). Gemmae are also formed plentifully in
water cultures. These are spherical, pyriform, clavate or
irregular, simple or catenulate, and function as zoosp-
orangia, with one–several papillae of discharge (Fig.
1(g)–(h)).
Sexual reproduction is oogamous by gametangialcopulation. Both male and female gametangia are
formed within one week of culture in water on the
hemp-seeds. Oogonia are abundant, terminal, lateral
or frequently intercalary; mainly pyriform, but also
spherical, obovate, cylindrical, rarely naviculate or rarely
irregular, doliform when intercalary, and measure (29�)
60–111 (�136) lm in diameter (Fig. 2(a)–(c)).
erging out of hemp seeds in water culture, (b) mature and emptied
encysted and germinating zoospores, (f) sporangial renewal by internal
cale bar = 100 lm and c,d,f,h: bar = 50 lm.
![Page 4: Saprolegnia multispora, a new oomycete isolated from water samples taken in a river in the Burgundian region of France](https://reader030.vdocuments.us/reader030/viewer/2022020223/575066bc1a28ab0f07a84a97/html5/thumbnails/4.jpg)
Fig. 2. Saprolegnia multispora sexual reproduction. (a) Terminal oogonia with diclinous antheridia, (b) intercalary oogonia, (c) intercalary oogonia
with diclinous antheridia, (d) terminal oogonia with monoclinous antheridia, (e)–(h) oogonia wrapped around with diclinous antheridia, containing
multiple oospores. (a) scale bar = 100 lm, (b)–(h) bar = 50 lm.
396 B. Paul, M.M. Steciow / FEMS Microbiology Letters 237 (2004) 393–398
Oogonial walls are smooth and pitted. These are borne
on oogonial stalks which are stout and tapering towardsthe end, or slender; straight or bent, sometimes
branched; 19–582 lm long. After fertilization, (1�)
11–70 (�100) oospores are formed in the oogonia
(Fig. 2(d)–(h)). These are subcentric, type I, generally
filling the oogonium; spherical or ellipsoid; maturing,
and measuring (10�) 12–20 (�25) lm diam. Antheridia
are present. Almost all the oogonia are supplied by one
to many antheridia. These branches are principally dicl-inous (Fig. 2(a), (c), (f)–(h)), rarely monoclinous (Fig.
2(d)) or androgynous. Antheridial cells are simple or
branched; attached by projections or laterally appressed
(Fig. 2(e)–(h)). Fertilization tubes are conspicuous.HOLOTYPE: F-1247, Isolated from the Tille river at
‘‘Arc sur Tille’’ near the city of Dijon in Burgundy
(France) and maintained at the ‘‘Institut Jules Guyot’’
Universite de Bourgogne, Dijon, France, and also at
the Instituto de Botanica Spegazzini, 53 No. 477,
(1900) La Plata, Buenos Aires, Argentina LPS No.
45856; culture collection No. 767 (LPSC).
ETYMOLOGY: S. multispora refers to the presenceof one to many (up to hundred) subcentric oospores
inside the oogonia of this new species.
![Page 5: Saprolegnia multispora, a new oomycete isolated from water samples taken in a river in the Burgundian region of France](https://reader030.vdocuments.us/reader030/viewer/2022020223/575066bc1a28ab0f07a84a97/html5/thumbnails/5.jpg)
Fig. 3. CLUSTAL W, multiple sequence alignment of ITS1 regions of the rDNA of Saprolegnia multisporum, S. diclina, S. oliviae, S. bulbosa,
S. longicaulis, S. pararsitica, and Achlya papillosa.
B. Paul, M.M. Steciow / FEMS Microbiology Letters 237 (2004) 393–398 397
3.2. Internal transcribed spacer region
The GenBank Accession of ITS sequence of the
rDNA of S. multispora strain F-1247, is AY197329. It
is comprised of 581 bases:
1 acctgcggaa ggatcattac cacaccaaaa aacaccccac gtgaacg-
tac tctttatgag
61 gctttgcgct gcccttgtgg cagctagccg aaggtttcgc ag-
gaagccga tgtcaatttg
121 aatccttttt aaacaacgac tgatcaaaac tgcagataga aa-
tgtctgca tgcaattgaa
181 atacaacttt caacagtgga tgtctaggct cgcacaccga tgaa-gaacgc tgcgaactgc
241 gatacgtaat gcgaattgca gaattcagtg agtcatcaaa at-
tttgaacg catattgcac
301 ttccgggtta gtcctgggag tatgtttgta tcagtgtccg tgaa-
cacaac cttgtttcat
361 tccttgatgg tttggagcag actttgaagg tcttgcactt
gcaagtcctt ttaaacgatg
421 gtacctatgc gtcctcgtga gatgtattat ttaaaggtatgcctgcgctc ctttcgagag
481 tcttgtgtgg cggcacacag cattcaaaga gagagcaaat
cgcggtagtt ttgcttgggc
541 ttcggtacga gtggacatat attgcttttt gtgatttcgg c
bases 10–19 = 18S gene, partial sequence (in bold), 20–
183 = ITS1 (complete sequence), 184–342 = 5.8 S gene,
complete sequence (in bold), 343–581 = ITS 2, partialsequence.
The comparison of the ITS1 sequences of S. multis-
pora and related species is given in Fig. 3 in the form
of CLUSTAL multiple alignments.
4. Discussion
Morphologically, S. multispora Paul and Steciow has
close affinities with S. diclina Humphrey and S. australis
Elliott in having mainly diclinous antheridial branches,which are at times monoclinous or androgynous and
subcentric oospores. However, the oospores in S. diclina
are predominantly centric. The number of oospores per
oogonium are higher in S. multispora ((1�) 11–70
(�100) instead of only (1) 8–12 (28) in the case of S. di-
clina and (1) 6–12 (30) in S. australis). Moreover the oo-
spores of S. australis may or may not mature, or the
oospores may develop and then abort [5,8], which isnot the case of the oospores of the new species. Recently
Johnson et al. [5] mentioned that S. diclina can develop a
mean number of 8–16 oospores but can reach a higher
number of 100 oospores. However the oogonial wall is
unpitted and the oospore size is much bigger: (12) 18–
26 (44) lm diam. in the case of S. diclina as compared
to the pitted oogonial walls containing smaller oospores:
(10�) 12–20 (�25) lm of S. multispora. Moreover in S.
diclina the oogonia are sparse often appearing in culture
only after prolonged incubation or they can be altogether
absent which is not the case of S. multispora.
The subcentric oospores of S. multispora also relates
it to S. parasitica Coker. However there are many differ-
ences between these two species: the conspicuous pitted
oogonial wall, origin of antheridial branches, and the
presence of up to 100 oospores in S. multispora separatesit from S. parasitica, which has unpitted oogonial wall,
diclinous antheridial branches, and lesser number of oo-
spores (2) 14–23 (40). This species has recently been re-
duced to synonymy with S. diclina [5]. Some species of
![Page 6: Saprolegnia multispora, a new oomycete isolated from water samples taken in a river in the Burgundian region of France](https://reader030.vdocuments.us/reader030/viewer/2022020223/575066bc1a28ab0f07a84a97/html5/thumbnails/6.jpg)
398 B. Paul, M.M. Steciow / FEMS Microbiology Letters 237 (2004) 393–398
Saprolegnia described from Argentina like, S. longicaulis
Steciow, S. oliviae Steciow and S. variabilis Steciow et
Elıades are also related to S. multispora in having sub-
centric oospores and diclinous antheridial branches,
however, these differ from the latter in their oogonial,
antheridial and oosporal characters [14–16].A BLAST search with the sequence of the ITS region
of the rDNA of S. multispora gives close homologies
(95.9%) with the S. parasitica (GenBank Accession
No. AY455776), S. longicaulis (AY270032) and S. bul-
bosa (AY267011), 95.6% with (AY270031), 95.4% with
S. diclina (AY455775), and only 79.2% with Achlya pap-
illosa (AF218161). These similarities are not in contra-
diction with the morphological characters of the newoomycete.
The oomycete isolated in the river Tille in the Bur-
gundian region of France belongs, undoubtedly, to the
genus Saprolegnia. Its specific morphological and molec-
ular characteristics justify the creation of the new taxon
of S. multispora.
References
[1] Levesque, C.A., Harlton, C.E. and de Cock, A.W.A.M. (1998)
Identification of some oomycetes by reverse dot blot hybridisa-
tion. Phytopathology 88, 213–222.
[2] Kumar, C. and Rzhetsky, A. (1996) Evolutionary relationships of
eukaryotic kingdoms. J. Mol. Evol. 42, 183–193.
[3] Van de Peer, Y. and De Wachter, R. (1997) Evolutionary
relationships among the eukaryotic crown taxa taking into
account site-to-site rate variation in 18S rRNA. J. Mol. Evol.
45, 619–630.
[4] Paquin, B., Laforest, M.J., Forget, L., Roewer, I., Wang, Z.,
Longcore, J. and Lang, B.F. (1997) The fungal mitochondrial
genome project: evolution of fungal mitochondrial genomes and
their gene expression. Curr. Genet. 31, 380–395.
[5] Johnson Jr. , T.W., Seymour, R.L. and Padgett, D.E. (2002)
Biology and systematics of the Saprolegniaceae. On-line publica-
tion: http://www.ilumina-dlib.org. 1028p.
[6] Coker, W.C. (1923) The Saprolegniaceae with notes on other
water molds. University of North Carolina Press, Chapel
Hill.
[7] Sparrow, F.K. (1960) Aquatic Phycomycetes, 2nd ed.. University
of Michigan Press, Ann Arbor, MI.
[8] Seymour, R.L. (1970) The genus Saprolegnia. Nova Hedwigia 19,
1–124.
[9] Chen, W., Hoy, J.W. and Schneider, R.W. (1992) Species-specific
polymorphisms in transcribed ribosomal DNA of five Pythium
species. Exp. Mycol. 16, 22–34.
[10] Chen, W., Schneider, R.W. and Hoy, J.W. (1992) Taxonomic and
phylogenetic analyses of ten Pythium species using isozyme
polymorphisms. Phytopathology 82, 1234–1244.
[11] Middleton, J.T. (1943) The taxonomy, host range, and geograph-
ical distribution of the genus Pythium. Mem. Torrey Bot. Club 20,
1–171.
[12] Paul, B., Galland, D. and Masih, I. (1999) Pythium prolatum
isolated from soil in the Burgundy region: A new record for
Europe. FEMS Microbiol. Lett. 173, 69–75.
[13] Paul, B. (2001) ITS region of the rDNA of Pythium longandrum, a
new species; its taxonomy and its comparison with related species.
FEMS Microbiol. Lett. 202, 239–242.
[14] Steciow, M.M. (2001) Saprolegnia longicaulis (Saprolegniales,
Straminipila), a new species from an Argentine stream. N. Z. J.
Botany 39, 483–488.
[15] Steciow, M.M. (2003) Saprolegnia oliviae sp. nov. isolated from
an Argentine river (Tierra del fuego Province, Argentina). FEMS
Microbiol. Lett. 219, 253–259.
[16] Steciow, M.M. and Eliades, L.A. (2002) A new species of
Saprolegnia (Saprolegniales, Straminipila), from a polluted Ar-
gentine channel. N. Z. J. Botany 40, 679–685.