saint cecilia churchthe perpetual cycle of pain and anguish must end. ... water for you from the...
TRANSCRIPT
![Page 1: Saint Cecilia ChurchThe perpetual cycle of pain and anguish must end. ... water for you from the flinty rock and fed you in the desert with manna, a food unknown to your fathers.”](https://reader034.vdocuments.us/reader034/viewer/2022042414/5f2e0fcea71bd81cb437021a/html5/thumbnails/1.jpg)
Saint Cecilia Church 19th Sunday in Ordinary Time
9 August, 2020
Dear Lord, Thank you for helping us to make it through this difficult year. Thank you that you’ve carried us through the uncertainty of deep waters, through the flames of trials, and through the pain of hard losses. We are constantly aware of how much we need you, your grace, your strength, your power working through even the toughest days. Help us to keep our focus first on you. Thank you that your power is made perfect in our weakness.
Thank you for your daily powerful presence in our lives, that we can be assured your heart is towards us, your eyes are over us, and your ears are open to our prayers. Thank you that you surround us with favor as with a shield, and we are safe in your care. We choose to press in close to you today, and keep you first in our hearts and lives. Without you we would surely fail, but with you, there is great hope. Amen.
f i
![Page 2: Saint Cecilia ChurchThe perpetual cycle of pain and anguish must end. ... water for you from the flinty rock and fed you in the desert with manna, a food unknown to your fathers.”](https://reader034.vdocuments.us/reader034/viewer/2022042414/5f2e0fcea71bd81cb437021a/html5/thumbnails/2.jpg)
#179 2
OFFICES Rectory 215.725.1240 Eleanor Kerwick Business 215.725.1240 Susan Wagner PREP 215.725.2821 Marcia Mason School 215.725.8588 Bobbie Mitchell Tuition 215.725.2201 Lisa Hnat Fax 215.725.2130 Website: www.stceciliafc.org School: scsfoxchase.org CYO Facebook: Saint Cecilia Catholic Youth Organization
Rectory Office Hours Currently closed ~ call 215-725-1240 for emergency.
Saint Cecilia Church 535 Rhawn Street
Philadelphia, Pennsylvania 19111
PASTOR Reverend Charles E. Bonner
PASTOR EMERITUS Reverend Msgr. Francis X. Dreger
PAROCHIAL VICAR Reverend Robert Lucas PERMANENT DEACON Deacon Patrick Diamond
PRINCIPAL Sister Catherine Irene Masino , IHM
VICE PRINCIPAL Sister Carolyn Elizabeth Braun, IHM
SACRAMENTS Baptism First three Sundays of the month at 12:15pm. Arrangements must be made at least two weeks prior to the Baptism. At-tendance at a Pre-Jordan class is required for first time par-ents. Please pre-register for class by contacting the Rectory at 215-725-1240. Marriage Couples must contact a priest six months prior to the wedding. Reconciliation Saturdays from 4:00 to 5:00pm Homebound Visitation Please contact the Rectory.
Sunday Vigil 5:00pm (Saturday)
6:30am, 8:00am, 9:30am, 11:00am
Monday through Friday 6:30 and 8:30 am
Saturday 8:30 am
FOCUS: God is present with us always. If we wait to be adrift upon a stormy sea in order to see that God is present with us, we will miss out on the grace and goodness that currently surrounds us. God’s love is at work in us, in every sacrament; in every moment of prayer; in every gathering for worship; in every act of kindness. He is in the tiniest whisper, and in the outstretched hand of another. LITURGY OF THE WORD: Elijah heard God in a tiny whispering sound. Paul writes to the Romans that he has great sorrow and constant anguish in his heart for his own people. In the Gospel, Peter becomes frightened while walking on the water toward Jesus. Jesus catches him from sinking. REFLECTION: It doesn’t take much imagination these days to identify with those terrified disciples as we face the deadly storm of the pandemic with its indiscriminate power to kill, sweeping across our world. So, we ask ourselves:
Do we feel like those disciples, victims in the pandemic storm’s clutches? Do we look into the midst of the storm and wonder if Jesus is just a ghost, a product of our fear-driven imagina-tion? Can we hear him say to us what he said to his frightened disciples, "Take courage, it is I, do not be afraid."
Remember to keep holy the Lord’s Day
Mass is live streamed Sundays at 9:30am
https://www.facebook.com/St-Cecilia-Church-Fox-Chase
![Page 3: Saint Cecilia ChurchThe perpetual cycle of pain and anguish must end. ... water for you from the flinty rock and fed you in the desert with manna, a food unknown to your fathers.”](https://reader034.vdocuments.us/reader034/viewer/2022042414/5f2e0fcea71bd81cb437021a/html5/thumbnails/3.jpg)
#179 3
19th Sunday in Ordinary Time The Liturgy of the Word First Reading First Book of Kings 19:9a, 11-13a At the mountain of God, Horeb, Elijah came to a cave where he took shelter. Then the LORD said to him, “Go outside and stand on the mountain before the LORD; the LORD will be passing by.” A strong and heavy wind was rending the moun-tains and crushing rocks before the LORD—but the LORD was not in the wind. After the wind there was an earthquake—but the LORD was not in the earthquake. After the earthquake there was fire—but the LORD was not in the fire. After the fire there was a tiny whispering sound. When he heard this, Elijah hid his face in his cloak and went and stood at the entrance of the cave. The word of the Lord. Thanks be to God. Responsorial Psalm Lord, let us see your kindness, and grant us your salvation. Second Reading Letter of St. Paul to the Romans 9:1-5
Brothers and sisters: I speak the truth in Christ, I do not lie; my conscience joins with the Holy Spirit in bearing me witness that I have great sorrow and constant anguish in my heart. For I could wish that I myself were accursed and cut off from Christ for the sake of my own people, my kindred according to the flesh. They are Israelites; theirs the adoption, the glory, the covenants, the giving of the law, the worship, and the promises; theirs the patriarchs, and from them, according to the flesh, is the Christ, who is over all, God blessed forever. Amen. The word of the Lord. Thanks be to God. Gospel The holy Gospel according to Matthew 14: 22-33
After he had fed the people, Jesus made the disciples get into a boat and precede him to the other side, while he dismissed the crowds. After doing so, he went up on the mountain by himself to pray. When it was evening he was there alone. Meanwhile the boat, already a few miles offshore, was being tossed about by the waves, for the wind was against it. During the fourth watch of the night, he came toward them walking on the sea. When the disciples saw him walking on the sea they were terri-fied. “It is a ghost,” they said, and they cried out in fear. At once Jesus spoke to them, “Take courage, it is I; do not be afraid.” Peter said to him in reply, “Lord, if it is you, command me to come to you on the water.” He said, “Come.” Peter got out of the boat and began to walk on the water toward Jesus. But when he saw how strong the wind was he became fright-ened; and, beginning to sink, he cried out, “Lord, save me!” Immediately Jesus stretched out his hand and caught Peter, and said to him, “O you of little faith, why did you doubt?” After they got into the boat, the wind died down. Those who were in the boat did him homage, saying, “Truly, you are the Son of God.” The Gospel of the Lord. Praise to you, Lord Jesus Christ.
Mass Schedule for Weekend ~ August 15 & 16 Saturday (Vigil) 5:00pm Celebrant: Fr. Lucas Lector: Zach Demusz 6:30am Celebrant: Fr. Bonner Lector: Celine Severino 8:00am Celebrant: Fr. Bonner Lector: Dale Tan 9:30am Celebrant: Fr. Lucas Lector: Colleen Demusz 11:00am Celebrant: Fr. Lucas Lector: Anne Corcoran
Lectors play a key role in the celebration of Mass. A lector is a Minister of the Word who proclaims God’s
Word to the assembled faith community. Liturgical proclamation of the Word is an awesome responsibil-ity to which one is called and into which one is formed.
Being a lector is more than reading. This ministry involves studying, preparing and gaining an under-standing of God’s Word that can be transferred to the assembly in a clear and understandable manner. The vital role of the lector is to communicate the depth and importance of the scriptures.
Anyone interested in joining this ministry for Sunday Masses, please contact Dave Schein by stopping in the Sacristy on Saturday evening or Sunday morning or call Dave at 215-725-0903.
MASS SCHEDULE Sunday
Vigil 5:00pm (Saturday) 6:30am, 8:00am, 9:30am, 11:00am
Monday through Friday 6:30 and 8:30 am
Saturday 8:30 am
God bless our newly baptized Christopher Fleming, Jr. Christian Ayden Orlen
Vayda Willow Schneider
Blessings on our newly married couple John Loughlin & Courtney Haugh
![Page 4: Saint Cecilia ChurchThe perpetual cycle of pain and anguish must end. ... water for you from the flinty rock and fed you in the desert with manna, a food unknown to your fathers.”](https://reader034.vdocuments.us/reader034/viewer/2022042414/5f2e0fcea71bd81cb437021a/html5/thumbnails/4.jpg)
#179 4
Pray For Our Troops Jason Showmaker (Navy) Mark Strecker (Navy) Michael D’Antonio (Air Force) Sean Lay (Army) Brian A. Mason (Army) Christopher J. Starrett (USMC) Brandan Beaudet (USMC) Michael Molz (Army) Patrick Breslin (Army) Erin Bartholomew (Navy) Nick Marteney (Navy) Martin P. O’Donnell (Trauma Nurse-Air Force)
Caring For Friends ~ We are still collecting food for Caring For Friends and we thank you for continuing to bring meals to our freezer. Just add an extra portion to your family meal, freeze it in the trays we provide, and bring it to the freezer located in the alcove between the church and rectory here at Saint Cecilia. Our freezer hours are open every day from 8:30am to 4:00pm.
There are many ways you can volunteer to help this minis-try. For more information please call our Coordinator, Ber-nadette O’Donnell at 215-379-3448 or Caring for Friends at 215-464-2224. Learn more at caringforfriends.org.
Pre-Cana Attending a Pre-Cana session is required for all engaged couples preparing to cele-brate the Sacrament of Matrimony. Maternity BVM Parish, located at 9220 Old Bustleton Avenue (19115) will be holding their Fall Pre-Cana Day on Saturday, September 26, 2020. Advance registration is necessary. To register, please call the rectory at 215-673-8127.
Message from the Social Security Office Although our offices are currently not providing in-person service due to the coronavirus, you can still reach us by phone at 866-331-7840, Monday through Friday (9am to 4pm).
Fatima Holy Hour ~ August 13 All are welcome to the annual Fatima Holy Hour for World Peace sponsored by The World Apostolate of Fatima on Thursday, August 13. It will be at Saint William Church (lower church) beginning 7:00pm. Please remember to wear a mask and observe social distancing. You are welcome to invite your friends and family too.
PREP Volunteers We are in need of volunteer PREP teachers for online instruction for the 2020-2021 school year. At this moment, classes will take place online and not in the classroom. Teachers will be instructed how to do virtual classes. If you are interested in volun-teering your time for this very important ministry, please contact the rectory at 215-725-1240.
PREP Parish Religious Education Program
Register NOW for 2020-2021 year Deadline ~ Friday, August 21, 2020
Classes for the moment will be online via Zoom beginning Sunday, September 13.
Call the rectory at 215-725-1240 to register for PREP. A completed form along with payment, baptismal certifi-cate or permission from Pastor of another parish are due to the rectory no later than August 21. COST: $75 (one child) $125 (two children) $175 (three or more children) Study books will be available for pick up on Saturday, August 29 at the PREP office from 9:30am to 12:00 noon. This is the only day you will be able to pick up your books.
Novena to Mary ~ August 6-14 Archbishop Nelson Perez invites us all to join in a novena in preparation for the Solemnity of the As-sumption on Aug. 15. The special intention of this novena is for an end to the coronavirus pandemic.
Immaculate Virgin, Mother of Jesus and our Mother, we believe in your triumphant as-sumption into heaven where the angels and saints acclaim you as Queen of Heaven and earth. We join them in praising you and bless the Lord who raised you above all creatures. With them we honor you. We are confident that you watch over our daily lives and we ask that you intercede for us now.
(Mention your requests here, including the petition for an end of the Coronavirus pandemic.)
We are comforted by our faith in the coming resurrection and we look to you for prayers and comfort. After this earthly life, show us Jesus, the blessed fruit of your womb, O kind, O loving, O sweet Virgin Mary.
Queen assumed into Heaven, pray for us. Amen.
(If possible, pray the Rosary each day.)
Assumption of BVM This Saturday, August 15 is the So-lemnity of the Assumption of the Blessed Virgin Mary. This year it is not a Holy Day of Obli-gation, but we encourage everyone to attend the 8:30am Mass on Saturday in Church or watch the Mass on your computer or TV.
Second Collection next weekend will be taken up for the Catholic University of America in Washington, DC. Thank you for your financial support.
![Page 5: Saint Cecilia ChurchThe perpetual cycle of pain and anguish must end. ... water for you from the flinty rock and fed you in the desert with manna, a food unknown to your fathers.”](https://reader034.vdocuments.us/reader034/viewer/2022042414/5f2e0fcea71bd81cb437021a/html5/thumbnails/5.jpg)
#179 5
Saint Cecilia School 525 Rhawn Street, Philadelphia, PA 19111
A Christ-Center Community Committed to Academic Excellence
Extra Curricular Activities Student Council Future Cities Team Forensics Mathletes Altar Servers Service Commission School Band/Strings Program CYO Sports Scouting Reading Olympics
Looking for a great school ~ Here we are! Registration for Pre-K through grade 7 now being accepted
Academics Religious Education Archdiocesan Elementary Curriculum Honors Math Science Lab Program Technology Music Education Physical Education/Health Fine Arts
Special Services CARES (after school program) CORA (Educational & Counseling Services) SHALOM Program NDS Program (we offer FREE break-fast and lunch for students) Catapult (Title 1 Reading, ELL, Family Counseling )
Middle States Accreditation PA Licensed Early Childhood Program & Afternoon School Care
REGISTER NOW FOR 2020-2021 Please call the school’s main office at 215-725-8588.
For tuition information, please email Lisa Hnat at [email protected]
![Page 6: Saint Cecilia ChurchThe perpetual cycle of pain and anguish must end. ... water for you from the flinty rock and fed you in the desert with manna, a food unknown to your fathers.”](https://reader034.vdocuments.us/reader034/viewer/2022042414/5f2e0fcea71bd81cb437021a/html5/thumbnails/6.jpg)
179 Church of St. Cecilia, Philadelphia, PA (3rd) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
Stone • Brick • Concrete • Pointing • EP Henry • Stucco • Waterproofi ngZucaroZucaroCONTRACTINGCONTRACTING
Masonry ContractorsSince 1922
215.533.1934215.533.1934
20% Discounton Labor for all Mechanical Work
15% Cash Paidfor Accident Referrals
$39.00+tax
Inspection & Emissions
$19.95Oil Change
(Most Cars)
Auto Body & Repair Shop
612 Huntingdon Pike, Rockledge 215-379-3113 www.abbysautocenter.com
Lifetime Warranty on all Paint & Body Work. Satisfaction Guaranteed
In Our 4th Decade of Quality Service
French Drains • Foundation Repair • Mold Remediation
215-639-8500www.morganbasementwaterproofing.com
All Work Guaranteed
Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you money with your monthly
payments on your commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days! Four
season customer service is our top priority.
www.duqfunding.com1650 Market Street - Suite 3600, Philadelphia, PA 19103
• Physical, Occupational & Speech Therapy• Short & Long Term Care• Beautiful On-Site Chapel With Daily Mass• Memory Support • Respite Stay• Adult Daycare • Woundcare• IV Therapy • Trach Care
ST. JOHN NEUMANN CENTERFOR REHAB AND HEALTHCARE
10400 Roosevelt Blvd.Philadelphia, PA
215-698-5600www.stnrehab.org
BUILD YOUR COMMUNITYBUILD YOUR COMMUNITY- Shop Local -
P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !
Advertise Your Business Here800-333-3166
ext. 161www.jppc.net
Rafferty Roofi ng215-281-0771
PA062531
For Quality & Honest Work at Reasonable PricesFree Estimates • Licensed & Insured
20 YEAR GUARANTEE ON HOT WHITE RUBBER ROOF
After
Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications
To all those essential workers keeping us safe,
yourservice is
invaluable & appreciated.
rivate & Public Healthcare - La- - - -- -- - - - nforcement, Public Safety - OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOfficeccecececececececececececece
ponders - Fooooooooooood &d & d &d & d & d & d & d &d & d &d &d &d & d & d & AAAAAAgrAAAAAAAAlture - Energy Sector rrrrrrrr rrrrr - Wa- Wa- Wa- WWW- Wa- Wa- Wa- WaWa- Wa- Wa- WWaste
Waterwaste - Transportattattattattattattatattatattattattattta ion ion ion ononononon on on onon on on on & Lo&&&&&&&& gics - Public Woooooooorks r & - & Infrfffffffffffff astastrastrtstttstaststtsttstst uctur
Communicatatatttttttatattatttioionononsionsionionionionsionionsiooniono & I&&&&&&&&& nforf matioy Workeorkekkekekekekekekekekekkekers -rs -rs -rs -rs -rs -rs -rs rs -rs -rs -rs -rs -s -s - Community
overnment WWWWWWWWWWWWWWWorkeorkeorkeorkeorkorkorkeorkeorkeorkeorkeorkorkorkeorkerrs - Critical Maacturing -g ---g --g -g ---g --g --- CheCheCheCheCheCheCheCheCheCheCheCheCheCheChemical & Hazardouateteeeeeeeeeeeeeerialrrrrrrrrrrrrrr s FiFiFiFiFiFiFiFiFiFiFiFiFiFiFinancnancnannannananaannanannancnancnancan ial Services - Defensdustristristristristristrstrtristristristritristritritrial Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Baasasasasasasase - Commercial Faciesssssessessssssss WorWorWorWorWorWorWorWorWorWorWorWorWorWorWorkkkkkkekekekerskekekkkk - Resid ti l & Sh ltervicesicesicesicescescecescesicesicesicescescescesces & Facilities - Hygiene Prod
To all thoserivate & Publicrivate & nforcement Pubnforcement Pub
ssentialFirst RespFirst Resp
workersWaterwaste Waterwaste
keepingcs - PublicuCommunCommun
s safe,chnologychnology
yzardouzardouD fD
service isvices DefensDefenmercial Facimercial Faci
invaluable &idential & Shelteidential & ShelteH i P dH i Ptha
nk yo
u
afeeeefeeeeeeeefefefefetyty --ttty --ttttty t -tt -- OffiOOOOOOOOOOOOO cers & First RespondeFFFoFFFFFF od &d &d &d &&&d &&d &&od d &&d &d &d &d &d &d &d &d &d AgrAAgrAAAAAgrAAAAAgrgrrgrrAggrrrAgrA rrgAAA rAAAgrAAgg iculicucuiculuiculiculiculcuiculiiicuicultureturetureurertureurturertureurrrurerrrurrtur - E- E- EE- E- E- E-- EEE- EEEnergy Se
ooroorror rrr - WaWa- WaWa- Wa- WW- WaWWWWWW- W- WWaa- WWaWaWaaWaasteststtstee stesssteetsteetts ess ees e & Wa& Wa& W& Wa& WaWaWW& Wa& Wa& WaW& Wa& Wa& WaWWWaa&& W& WaWa& Waterwterwterwterwteterwterwterwterwerwtterwe wteteerwerwerwrwwterwtterwwwasteastasteaasteasteaastesteteasteaassteasteaststststeeeeeee - TTT- T- TT- TT- T--- T- TT- T-- ranrarrarararrararraararaaaraarortrtrtrtrtrrrttttttatioatitiatiotitatiattiiatataatatataaaa n &&n & n &&n &nn Logistics - Public Wor
MASSES FOR THE WEEK OF August 10
MONDAY, August 10 6:30am – Thomas Cunningham 8:30am – Ray & Marion Whalen
TUESDAY, August 11 6:30am – Pauline Slobogin 8:30am – Norbert Kuznicki (1st anniversary)
WEDNESDAY, August 12 6:30am – Mary McFadden 8:30am – Susan York
THURSDAY, August 13 6:30am – Laureano Garcia 8:30am – Edward & Katherine Potts
FRIDAY, August 14 6:30am – Irene & Henry Kotarski 8:30am – Raymond Wagner
SATURDAY, August 15 8:30am – Dec. members Hoffman Family 5:00pm – Javier Zuazo
Remember Our Sick and Suffering Walter Hnat Ed Lieber Christopher Rodgers Patricia Moore James J. Tobin Mary Schultz Ann Marie Tobin Masgai Charles Friel Meghan Kovacs Joan Marie Reiley John Lawrysk Maki Turner Kirsten Hosack-Edling Helen Flood Stephanie Morgan James Potts Owen Doyle Mary Benson Esther Sharp Mary Jane Brough Leo Wuestkamp Stephen Ruczynski Helen Tobin Mike McKee Andrew Slivjak Melissa Fischer George Burbage Patricia Greenleaf Rita Giordano Daniel Mitchell Lisa Kovacs-Breuer Gregory Farrell Ed MacNew Timothy Martin John Smykal Julia McCauley Alice Davis Mary Matthews Josephine O’Donnell Marguerite Zeltman Alice Zmijewski Jack Vogler Eileen Gaynor Alberta DeMasi Eleanor DeNoble Eugenia DiSilva Marian Diel Kathi Silcox Catherine Needham Connie Merkel Ellen Jones
Let us pray for the souls of all the faithful departed, especially John Duffy Kathleen Morrell James J. Fee Isabel Lang Jane Amato
![Page 7: Saint Cecilia ChurchThe perpetual cycle of pain and anguish must end. ... water for you from the flinty rock and fed you in the desert with manna, a food unknown to your fathers.”](https://reader034.vdocuments.us/reader034/viewer/2022042414/5f2e0fcea71bd81cb437021a/html5/thumbnails/7.jpg)
179 Church of St. Cecilia, Philadelphia, PA (i) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
FOX CHASE WINDOWS & DOORSSALES - INSTALLATION
Please Call ... 215-725-4211
FREE ESTIMATES
Parish Member
ALL TYPES WIRING & REPAIRS215–329–9456 Parish Member
G.J. ROSSI & SONELECTRICIANS
Now In Our 3rd Generation
PATRICK J. FOY(215) 281-9656
Interior & Exterior PaintingWallpapering & Scraping
FREE Estimates • Reliable • Honest
309 Central Ave., Cheltenham379-0881
JOSEPH P. FARLEYPLUMBING & HEATING
Alterations-Jobbing
Reg. No. 3121P.A. 043294
Classic OpticalDR. AMY C. TAN, O.D. 215-722-2242
*Eye Exams * Contact Lenses * Eyeglasses6516 R S A . (G R S )
Sweeney’sVerree Tavern
KITCHEN OPEN FROM 11 AM TO MIDNIGHT
The all new Kim’s Crab CakesPhilly’s Largest Wings
All Soups & Chili HomemadeTAKE OUT AVAILABLE
All Major Sporting Events With 6 Colored TV’s
Finest Tavern Food Now Available in our
New Private Dining Room
7968 VERREE RD.215–725-3366
Mariann OwensOffi ce: (215) 698-2000Direct: (215) 698-2027Cell: (215) 280-7222Email: [email protected] Buyers and Sellersin Philadelphia, Bucks, and Montgomery CountiesEach Offi ce Independently Owned and Operated
2000
SENIOR CITIZEN DISCOUNTS
ReliableFull Service Plumber
PLUMBING, HEATING & DRAIN CLEANING EMERGENCY SERVICE
INSURED • FREE ESTIMATES215-722-6783215-379-8300
SERVING ENTIRE CITY & SUBURBS
CITY VIOLATIONS CORRECTED
SEWER LINES REPLACED • HOT WATER HEATERSFROZEN PIPES • WATER PRESSURE INCREASED
DIGGING & EXCAVATION SPECIALISTS
Reg. Master Plumber #4287Michael Zalewski
Experience Peace of Mind:Pre-Arrange Your Burial at an
Archdiocese of Philadelphia Cemetery.
• Save today through pre-planning• Convenient terms for all of your burial needs• Traditional in ground, mausoleum & cremation options available at most cemeteries
CALL 215-352-4001 TODAY
Leslie AitaVocalist
Parishioner
Visit Us At Our New Location
Rockledge Plaza Huntingdon Pike
408 Huntingdon PikeRockledge, PA 19046215-379-2100
Family Ownedand Operated
Since 1948
$350Off Any New Stairlift With This Ad
• FREE in home evaluations• Family owned & operated for more than 20 years
1.888.900.8883
www.Tri-StateStairlifts.com
Traditional Funerals, Church Funerals & Memorial Services, Cremations“ONE FAMILY HELPING ANOTHER”
7450 Oxford Ave Phila, PA 19111 215-728-1050
David G RichardsonSupervisor/Owner
Cher l A Webb-RichardsonManager & LCBA Insurance Rep
Parishioner
richardsonsfuneralhome.com Councilman Brian O’Neill
Northeast offi ces near St. Cecilia ParishionersFox Chase - 432 Rhawn Street • 215-685-6431 • Rhawnhurst - 7522 Castor Ave • 215-685-0438
FreeNotaryPublic
Free copies
& Faxes
Karon MassadoReal Estate Salesperson
o 267.435.8015 m [email protected]
1601 Market St.- Fl. 19, Phila, PA
Wackerman Funeral Home, Inc.Wackerman Funeral Home, Inc.8060 Verree Rd. Philadelphia, PA 19111
www.wackermanfuneralhome.com 215-342-5200 Elizabeth Wackerman Bailey, Supervisor 1944 – Austin C. Wackerman - 2017 Emily Wackerman Funeral Director
Free & Confi dential Pregnancy Services24 Hour Hotline: 1-800-550-4900
www.BirthRight.org
“It is the right of every pregnant woman to give birth, and the right of every child to be born.”
~Birthright Charter7986 Oxford Avenue
Philadelphia, PA 19111215-728-0385
A Blessing from God
John DeCristofaroROOFING
Specializing in: Hot Asphalt RoofsShingle Roofs • Gutters • Spouts
215-379-2953 Member of St. Cecilia
A Tompkins Community BankFormerly Madison Bank
8000 Verree Rd., Philadelphia(215) 722-4566
www.risingsunhomecare.org
Providing The Highest Quality Care
Parishioner of St. Cecilia
215-605-9555
catering For your next event, call ahead to order
- Pickup or Delivery -WHITMAN SQUARE 215-969-3455 x1
Eric McHughParishioner
CYO Volunteer OFFERING AUTO, HOME, LIFE,
& BUSINESS INSURANCE Call for a quote
215-328-9990 x7001 or email [email protected]
210 Huntingdon Pike, Rockledge
Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting. This describes the power of...
ve, supuuuu portive, refefefefefefefferrals, relationshipppps,,,, affordable, repeeee etitious, versatile, last
Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN! Call 1.800.333.3166!
What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle
to make sure it is the car they are supposed to enter.
In Remembrance of Samantha Josephson
#WHATSMYNAME
Patronize the Adve isers who make this bulletin possible!
BUILD YOUR COMMUNITY!
Patt o i e the A
SHOP LOCAL
To advertise your business in this weekly bulletin,contact us at 1.800.333.3166
or visit us at www.jppc.net
![Page 8: Saint Cecilia ChurchThe perpetual cycle of pain and anguish must end. ... water for you from the flinty rock and fed you in the desert with manna, a food unknown to your fathers.”](https://reader034.vdocuments.us/reader034/viewer/2022042414/5f2e0fcea71bd81cb437021a/html5/thumbnails/8.jpg)
179 - Church of St. Cecilia, Philadelphia, PA (b) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
Schmidt’s Florist 700 Solly Ave., Phila., PA 19111
www.schmidtsfl orist.com 215-745-6234
LAW OFFICES
PAUL A. COGHLAN437 RHAWN STREET
PHILADELPHIA, PA 19111(215) 725-5998
FAX (215) 725-3904
Robert Wetzel, F.D.419 Huntingdon Pike, Rockledge
Erich Wetzel, Supv.Willow Grove - Bill Herchenroder, Supv. INC.
Funeral Directors Since 1881 215-663-8550 • www.wetzelandson.com
Stewart and McGowanATTORNEYS-AT-LAW
6221 RISING SUN AVE. (Opposite St. William’s Church)338-2800
S W D ’ E
WE DELIVER~ Traditional Pizza~ White Pizza~ Tomato Pies
The Original
Pizza6500 Rising Sun Ave. • 215-745-9992
Nora McCloskeyParishioner
Fine Art ClassesWorkshops & Partiesfor Children & Adults215-301-0103
www.bloomingartiststudio.comwww.bloomingartiststudio.com
PLUMBING, HEATING, DRAIN CLEANING & AIR CONDITIONING
SENIOR CITIZEN DISCOUNTFREE ESTIMATES
Ph: (215) 728-1482Fax: (215) 742-7098
8675 Torresdale Ave.Philadelphia, PA 19136
WWW.BILLFRUSCO.COM
O’Donnell PaintingInterior and Exterior
House Painting & Drywall RepairNeat Clean Work • No Job Too SmallFree Estimates 215-677-5854
THOMAS A. CUNNINGHAM, ESQ.Attorney At Law
AUTO ACCIDENT — PERSONAL INJURYWILLS — DIVORCE — REAL ESTATE
109 Huntingdon Pike • Rockledge, PA 19046215-722-6230
Traveling Hair DresserServicing Men, Women & Children
Parishioner for 48 years
215-806-8187
Krissy Tamaro
Reichwein
JOHN F. GIVNISH(3rd Generation)
JOHN F.X. GIVNISH, III(4th Generation)
Serving the Archdioceseof Philadelphia with
grace and dignity since 1928
1-800-GIVNISH
Each Offi ce Independently Owned and Operated
Larry AitaREALTOR®
Seniors Real Estate SpecialistOutstanding Agents. Outstanding Results.
Regency Realty
Cell: (215) 478-4344Offi ce: (215) [email protected]’s Get Moving!
2018 Outstanding
Agentof the Year
s.
Parishioner
Serving Families Since 1900
Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick, F.D. 1924-2013
Th omas M. McGoldrick, F.D. SupervisorJames T. Meyers, F.D. • Timothy J. Meyers, F.D.
215-884-0800 507 West Avenue, Jenkintown, PA 19046 www.mcgoldrickfh .com
Mallory’s Army FoundationUnited Together In The Fight Against Bullying...
Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com
(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send your email address by text message:
Text MALLORYSARMY to 22828 to get started.Message and data rates may apply.
JIM CASEYWallcoveringPainting • ScrapingClean Work • Since 1986215-379-0558 Member of Parish
Professionals Serving Professionals
Jay B. ComlyBuilding & Offi ce Maintenance
w/an A+ Rating
Commercial • AutomotiveResidential • Safes
Fully Equipped RadioDispatched Mobile Trucks
7936 Oxford Ave. 215-745-5007
Full Service Locksmith Since 1978Member of Parish
VERREEPHARMACY
7960 VERREE RD.(AT RHAWN)Free Delivery
M-F 9AM - 8PMSat. 9AM - 6PM
Sun. 9AM - 1 PM215-342-0100
Mitchell Spivack, R. PH.
HandymanElectric, PlumbingOdd jobs... Just Ask!
From McCloy’s TV 267-231-8785
A Heavenly Hair Salon215-379-1880
Angel Cuts
See You Soon!930 Fox Chase Road, Rockledge
Tax & AccountingFrancis J. McConnell CPA
Tax Preparation • Individual & Business(Across from St. Williams)
Call (215) 742-3428 for Appointments
Charles P. Elliott, PC 110 Central Ave
Cheltenham, PA 19012
215-663-2500We Make House Calls
Complimentary InitialConsultation
We are here for all your tax, IRS, fraud investigations,
& inheritance tax.
RENEE ROACHEREALTOR ~ PARISHIONER
FOX CHASE SPECIALISTBuying or Selling a Home?
Call Today!
Office 215-961-6000 Cell [email protected]
EASTERNEEEAEAAEAEEEEEEEEEEEEEEEEAEASTSTTTSTTTSSTTTTTTTTTEEREEEEEEEEEEEEEEAEAEAEEEEEEEEASTSTTTSTTSSTTTEEEREEEE
A Signature Hair Salon llc$10 OFF Color ServiceMen | Women | Children
7950 Bustleton Ave., Philadelphia, PA215-821-3522
Cochrane Construction LLC
ROOFINGSIDING * GUTTERS
Chimney Restorations & RepairsLicensed & Insured PA # 154589
Senior Citizen Discounts • Free Est.215-839-4317
www.cochraneconstruction.org
Friends, Family, Neighbors!
1-844-640-4200 PaulsRun.org/Living
Wedding Invitations Wedding Invitations & Holiday Cards& Holiday CardsLog onto Log onto www.jppc.netwww.jppc.netconveniently from yourconveniently from yourhome or offi ce.home or offi ce.Online CatalogOnline CatalogOnline OrderingOnline OrderingOnline ProofingOnline ProofingAll Major Credit All Major Credit Cards AcceptedCards Accepted
FREE UPS FREE UPS GROUND GROUND SHIPPINGSHIPPING!
WE CARE AND IT SHOWS
Beautiful On-Site Chapel with Daily Mass - Respite Stay Available
We Acknowledge We Appreciate
2990 Holme Ave., Phila.215-335-2100
www.imrehab.org
IMMACULATE MARYCENTER
Rehabilitation & Healthcare
Advertise Your Business Here
800-333-3166 ext. 161www.jppc.net