Safety and Pharmacokinetics of Naked Plasmid DNA in theSkin: Studies on Dissemination and Ectopic Expression1

Ulrich R. Hengge, BjoÈrn Dexling, and Alireza MirmohammadsadeghDepartment of Dermatology, Venerology and Allergology, University of Essen, Essen, Germany

Gene therapy using naked DNA injected into muscleand skin is increasingly being used for vaccinationand treatment purposes. Favorably, naked plasmidDNA does not exhibit the various limitations inher-ent to viral vectors, such as the elicitation of adverseimmune responses and the risk of insertional muta-genesis. In order to assess the distribution and safetyof naked plasmid DNA in a relevant animal model,we analyzed if intracutaneously injected plasmidDNA was transported to other organs and if ectopicexpression occurred. When a ``superdose'' of a mar-ker plasmid was injected intradermally, most organs

were found transiently to contain the plasmid DNAfor several days, whereas integration into the hostgenome was not detected. With the exception ofovary, however, mRNA expression only occurred inthe skin, regional lymph nodes, and muscular tissues.From a safety standpoint, skin gene therapy withnaked plasmid DNA can be considered safe due tothe rapid biodegradation of plasmid DNA and theexclusive and transient expression of foreign genes intissues known to take up DNA. Key words: direct injec-tion/dissemination/expression/plasmid DNA/skin/b-Gal.J Invest Dermatol 116:979±982, 2001

Gene therapy is a new ®eld of biotechnologyattempting to treat diseases with DNA. Naked, i.e.,uncoated plasmid DNA, is a large, highly negativelycharged molecule that usually occurs in the nucleusor mitochondria. The direct injection of naked

plasmid DNA has been established for muscle and skin eliminatingthe need for expensive technical devices (Wolff et al, 1990; Henggeet al, 1995, 1996, 1998). Favorably, naked plasmid DNA does notexhibit the various limitations inherent to viral vectors such as theelicitation of adverse immune responses, promotor shutdown andinsertional mutagenesis. On the other hand, expression is generallytransient in the range of a couple of days.

Genetic immunization uses antigens encoded by the respectiveDNA to elicit immune responses against infectious and cancerousantigens. To date, clinical trials of naked DNA have beenperformed against in¯uenza, malaria, and human immunode®-ciency virus without signi®cant side-effects except occasionalerythema and tenderness at the injection site (Donnelly et al,1995; Calarota et al, 1998; Wang et al, 1998). With regard to cancervarious clinical trials employing naked DNA have been performedagainst colon carcinoma (Conry et al, 1995), head and necksquamous cell cancer (Wollenberg et al, 1999), and against B celllymphoma (Syrengelas et al, 1996). For therapeutic purposes, higherdoses of plasmid DNA up to 4 mg have been injectedintramuscularly in patients with thrombangitis obliterans and

myocardial ischemia without signi®cant side-effects (Isner et al,1998; Losordo et al, 1998).

Whereas several studies have characterized the pharmacokineticsof naked plasmid DNA upon intravenous and intramuscularinjection, the dissemination of naked plasmid DNA has not beenevaluated following intradermal injection. Intradermally appliedplasmid DNA can be easily monitored for adverse events orexpression due to the accessibility of the skin.

In order to assess the distribution and safety of naked plasmidDNA in an animal model relevant for skin gene therapy, weanalyzed if intracutaneously injected plasmid DNA was transportedto other organs and if ectopic expression occurred.

MATERIALS AND METHODS

Plasmid DNA injection Marker plasmid DNA (pCMV:b-gal;Clontech, Palo Alto, CA) containing the b-galactosidase indicator genewas injected intradermally at a dose of 2 mg into the right hind legabove the posterolateral muscle of four 20 kg pigs. The miniature swinewere anesthetized with ketamine, xylazine, butorphan, and atropine(1:1:1:1). The plasmid was applied in phosphate-buffered saline at aconcentration of 4 mg per ml. A total volume of 500 ml were injectedwith a tuberculin syringe and 30-g needle. The plasmid preparation waspuri®ed by double cesium chloride puri®cation and the endotoxin levelswere determined using the limulus amebocyte assay (BioWhittaker,Walkersville, MD). Endotoxin levels were typically less than 0.005 ngper mg plasmid DNA.

DNA extraction from various tissues At the indicated time points(days 1, 3, and 11) pigs were killed with an overdose of intravenousphenobarbital. Two to four specimens per organ were sampled onautopsy under sterile conditions with a fresh pair of tweezers and scalpelbeing used for every sample. Around the injection site, skin specimenswere taken at a distance of 3 and 10 cm. The regional lymph node inthe right inguinal area was extirpated.

Tissue sample preparation, polymerase chain reaction (PCR) reactionset-up, PCR ampli®cation, and PCR analysis were performed in separatelaboratories. To minimize the risk of cross-sample contamination, eachtissue was processed in the tube in which it was frozen. Total cellular

Manuscript received September 25, 2000; revised December 14, 2000;accepted for publication January 26, 2001.

Reprint requests to: Dr. Ulrich R. Hengge, Department ofDermatology, Venerology and Allergology, University of Essen,Hufelandstr. 55, 45122 Essen, Germany. Email: ulrich.hengge@uni-essen.de

Abbreviation: b-gal, b-galactosidase.1Presented in part at the 28th Annual Meeting of the European Society

for Dermatological Research, Montpellier, France, September 22±25,1999.

0022-202X/01/$15.00 ´ Copyright # 2001 by The Society for Investigative Dermatology, Inc.

979

DNA was prepared from the various organs using proteinase K and theguanidinium isothiocyanate/cesium chloride method (Hirt, 1967).

RNA extraction RNA was obtained from organ specimens using theguanidinium isothiocyanate/cesium chloride method as described (Hirt,1967). To remove contaminating plasmid DNA, RNA samples wereincubated with 20 U per ml RNAse-free DNAse (Boehringer,Mannheim, Roche Diagnostics GmbH, Mannheim, Germany) for 2 h at37°C followed by phenol/chloroform extraction and ethanolprecipitation.

PCR and reverse transcriptase±PCR Following DNA and RNAextraction, PCR analysis (40 cycles, cycling at 94°C for 1 min, 60°C for1 min, and 72°C for 1.5 min) was performed on 100 ng DNA to detectinjected marker plasmid using the following primers (upstream:GCTGATGCGGTGCTGATTACGACC and downstream: GTTTAC-CCGCTCTGCTACCTGCG), yielding at 200 bp fragment. PCRproducts were separated by 2% agarose gel and visualized with ethidiumbromide (Hengge et al, 1995). In addition, expression was analyzed withreverse transcriptase on 10±200 ng total RNA, upon DNAse treatmentas described above. As a control for the DNA and RNA quality, parallelreactions were run for b-actin.

Southern blot A ®xed aliquot of total DNA extracts from each organwas digested with EcoR1 that cuts the pCMV:b-gal once followed bySouthern blotting with a random-primed b-Gal probe from the CMV:b-gal plasmid as described (Hirt, 1967; Hengge et al, 1995).

Animals Two to 8 mo old inbred miniature swine (20 kg) from theNIH herd (Poolsville, MD) were maintained in accordance with NIHGuide, USDA and Animal Welfare Act guidelines and housed inAALAC accredited housing. For ethical and logistic reasons, a smallnumber of animals was used and several specimens were processed tocontrol for reproducibility.

RESULTS

Detection of plasmid DNA Following euthanasia at severaltime points [day 1 (n = 1), day 3 (n = 2), and day 11 (n = 1)]various organs were analyzed for the presence of DNA and theirpotential expression using PCR ampli®cation. When individualsamples (each two to four per organ) from a variety of porcineorgans were analyzed for detectable plasmid DNA at day 3, DNAcould be recovered from all organs except spinal cord and bonemarrow (Table I). In general, the band intensity was high as seenin the regional lymph node, uterus, and diaphragm (Fig 1, lanes 2±4). In contrast, the ovary contained a faint band in four of ®vespecimens analyzed (Fig 1, lane 1).

When the presence of plasmid DNA was analyzed at later times(day 11), several tissues no longer contained detectable amounts ofmarker DNA. In particular, ovary, kidney, liver, spleen, lung, andthe gastrointestinal tract were always negative at this time point.Interestingly, skin around the injection site and the regional lymphnode were consistently positive. In addition, tissues such as muscleand thyroid ± known to take up and express naked plasmidDNA ± were found to contain marker DNA for extended periodsof time. On day 11, b-Gal DNA was still detectable ± albeit at lowlevels ± in muscular tissues (Fig 2, lanes 1, 3, and 4), regionallymph node (Fig 2, lane 5), and 3 cm around the skin injection site(Fig 2, lane 2).

We next analyzed, whether plasmid DNA was detectable bySouthern blot and whether it had potentially integrated into thecellular DNA in day 3 samples using a 32P-labeled b-Gal probe at asensitivity limit in the range of about 1 pg per 10 mg DNA. As seenin Fig 3, the presence of b-Gal-DNA could be con®rmed inseveral tissues, such as uterus, ovary, and lung. Importantly, noadditional bands were seen suggesting that integration of theplasmid DNA into the chromosomal DNA did not occur at thislevel of sensitivity (Fig 3).

mRNA expression Finally, we analyzed the tissues thatcontained plasmid DNA for mRNA expression followingdigestion with DNase (Table II). b-Gal-RNA was found in theskin, regional lymph node, muscle, and ovary on day 3, whereas onday 11, injected skin and perilesional skin were the only tissues thatcontained b-Gal mRNA transcripts (Fig 4).

Table I. Distribution of b-Gal plasmid DNA followingintradermal injectiona

Tissue Day 1 Day 3 Day 11

Injection site + ND +3 cm away + + +10 cm away + ND +Regional + + +lymph nodeMuscle ND + +Ovary ND + ±Heart ND + +Thyroid ND + +Brain ND + ±Kidney ND + ±Liver ND + ±Intestine ND + ±Stomach ND + ±Spleen ND + ±Lung ND + ±Uterus ND + ±Diaphragm ND + ±Spinal cord ND ± ±Bone marrow ND ± ±

aThe organs are listed with respect to the detectability of marker DNA. Threeto ®ve independent samples were analyzed per time point and tissue.

Figure 1. Intradermally injected marker DNA is transported toseveral porcine organs. PCR analysis was performed on a variety oforgan specimens on day 3 yielding detectable DNA in ovary (lane 1),regional lymph node (lane 2), uterus (lane 3), diaphragm (lane 4);pCMV:b-Gal as positive control (lane 5), marker (lane 6) andintradermally injected irrelevant plasmid pcDNA3 (lane 7).

Figure 2. Examples of organ samples harboring intradermallyinjected marker DNA on day 11. Skeletal muscle (lane 1), skin 3 cmaround the injection site (lane 2), diaphragm (lane 3), uterus (lane 4),regional lymph node (lane 5) are shown as positive examples along withpCMV:b-Gal as positive control, marker, and the unrelated injectedplasmid pcDNA3 as negative control.

980 HENGGE ET AL THE JOURNAL OF INVESTIGATIVE DERMATOLOGY

DISCUSSION

This study revealed the transient presence of plasmid DNA uponintradermal injection in a variety of different organs. It was shownthat even in larger animals having skin that morphologicallyresembles the human integument, plasmid DNA is distributedthroughout the body. Within several days, DNA was lost frommost tissues probably due to degradation (endonucleases), as hasrecently been shown (Barry et al, 1999). Around the injection site,in the corresponding lymph node and in muscular tissues, plasmidDNA could still be ampli®ed at day 11, whereas most other tissueswere negative. One potential explanation is, that plasmid DNA inthe skin may be compartmentalized and retained in the connectivetissue, thereby decreasing the rate of clearance. Skin, muscle, andthyroid are known readily to take up and transiently express nakedplasmid DNA (Wolff et al, 1990; Sikes et al, 1994; Hengge et al,1995). In agreement with other studies performed in mice andrabbits, porcine brain also maintained marker DNA for at least 11 d(Lew et al, 1995; Osaka et al, 1996), which was not expressed. Thismight be due to the abundance of blood vessels and the lowercontent of endonucleases (Barry et al, 1999). A receptor-mediatedDNA uptake mechanism has been suggested to occur in thesetissues2 (Budker et al, 2000).

Our results extend earlier studies by Udvardi et al (1999) whoinvestigated the presence and expression of naked plasmid DNAafter epicutaneous and intracutaneous application. Followingepicutaneous application to intact mouse skin, DNA could bedetected for up to 1 wk; however, the plasmid DNA was onlyexpressed after intracutaneous injection or particle-mediated genetransfer, but not after epicutaneous administration (Udvardi et al,1999).

When different application routes (intravenous, intramuscular,and intradermal) of plasmid DNA were compared with regard tosafety, signi®cant clinical or histologic toxicity has not beenobserved (Wolff et al, 1992; Parker et al, 1995; Hartikka et al, 1996;Winegar et al, 1996; Torres et al, 1997); however, Davis et al (1997)detected some degree of muscle ®ber degeneration and regener-ation following the intramuscular application of reporter gene- andhepatitis B surface antigen-expressing plasmids, whereas theintegrity and function were not compromised. Of note, plasmidDNA could be detected for more than 1 y (Wolff et al, 1992; Daviset al, 1997). The differences in the detectability of plasmid DNAacross various studies using intramuscular injection may be due tothe coadministration and timing of bupivacaine that leads to muscle®ber destruction and may alter plasmid distribution and/orpersistence (Wells, 1993). In addition, species-related effects mustbe considered.

The widespread presence of plasmid DNA has also beendescribed in rabbits and mice by quantitative PCR following theinjection of either 100 mg or 400 mg of plasmid DNA into theposterolateral muscle of the hind leg (Winegar et al, 1996).Interestingly, plasmid DNA was mainly found in the skin above theinjected muscle besides the injected muscle itself (Winegar et al,1996). For example, 4 h after the injection of 400 mg, the plasmidwas detected at the injection site at a mean copy number of 106 inmuscle and 4 3 104 in skin per mg tissue; however, it wasundetectable by PCR in most of the tissues and ¯uids examined,such as spleen, liver, jejunum, lymph nodes, and gonads given adetection limit of 10 copies per mg tissue, which may be explainedby the containing effect of the muscle fascia. When plasmid DNAcopies were quanti®ed using PCR-based methods at 30 and 60 dfollowing intramuscular injections in mice, about 1500 copies per150,000 genomes (10 fg per mg genomic DNA) were detected(Martin et al, 1999). Interestingly, the time after injection (i.e., 30or 60 d) was no predictor of the plasmid copy number being

Table II. Ectopic expression of marker RNA in varioustissues following intradermal DNA injectiona

Tissue Day 1 Day 3 Day 11

Injection site + ND +3 cm away + + +10 cm away + ND +Regional + + ±lymph nodeMuscle ND + ±Ovary ND + ±Heart ND ± ±Brain ND ± ±Thyroid ND ± NDKidney ND ± NDLiver ND ± NDIntestine ND ± ±Stomach ND ± ±Spleen ND ± ±Lung ND ± ±Uterus ND ± ±Diaphragm ND ± ±Spinal cord ND ± ±Bone marrow ND ± ±

aA summary of various organs with respect to the detectability of marker RNAis depicted. Three to ®ve independent samples were analyzed per time point andtissue.

Figure 4. mRNA expression in samples containing marker DNA.To assess the potential expression of marker DNA present in the tissuesidenti®ed above, reverse transcriptase±PCR was performed on 10±100 ng of total RNA. On day 3, the regional lymph node (lane 1) andskin 3 cm around the injection site (lane 2) are depicted. On day 11, theinjected site (lane 6) as well as 3 cm (lane 5) and 10 cm around (lane 4)were expressing b-Gal mRNA besides a weak band in the regionallymph node (lane 3); lane 7 represents the injection site without reversetranscriptase, and lane 9 the positive control; lane 10 shows the negativecontrol for the PCR reaction, respectively; lane 8, marker.

2Tschakarjan E, Trappmann K, Immler D, Meyer HE,Mirmohammadsadegh A, Hengge UR: Keratinocytes take-up nakedplasmid DNA: evidence for DNA binding proteins in keratinocytemembranes. J Invest Dermatol 113:434, 1999

Figure 3. Southern blot of day 3 samples showing the lack ofintegration into host DNA. Southern blotting on EcoRI-digestedcellular DNA was performed on all day 3 and 11 tissues samples withdetectable DNA. Depicted are 10 ng of control CMV:b-Gal next to5 mg of each diaphragm (lane 1), uterus (lane 2), ovaries (lane 3), lung(lane 4), thyroid (lane 5), thymus (lane 6), kidney (lane 7), and liver(lane 8).

VOL. 116, NO. 6 JUNE 2001 DISSEMINATION AND ECTOPIC EXPRESSION OF NAKED DNA 981

associated with the genomic DNA. Even in the worst case scenario,if all detectable copies were integrated, the calculated rate ofmutations would still be 3000 times less than the spontaneousmutation rate for mammalian genomes (Ledley and Ledley, 1994;Martin et al, 1999). Thus, from a safety standpoint, naked DNA canbe considered to not pose a signi®cant risk for genomic alteration.

Following the injection or ingestion of foreign DNA, thegastrointestinal and bronchoalveolar mucosa of mice and dogs takeup the available DNA (Meyer et al, 1995; Takehara et al, 1996;Schubbert et al, 1997; Hengge et al, 1999). Unprotected (``naked'')phage M13 DNA was not completely degraded upon passagethrough the gastrointestinal tract, but sequences of up to 900 basesin length were detectable as early as 2±4 h after feeding in about 1of 1000 peripheral leukocytes (Schubbert et al, 1997).Chromosomal integration was not detected (Schubbert et al,1997; Martin et al, 1999).

Despite certain advantages for gene therapy with naked DNA,there are intrinsic fundamental problems associated with theunprotected character of plasmid DNA. In particular, the reductionof genome equivalents will translate into a rapid loss of geneexpression. In that regard, 99% of intravenously injected nakedDNA were degraded within 90 min yielding a half-life of about10 min (Kawabata et al, 1995; Barry et al, 1999). Despite themassive destruction, tissue nuclease levels did not determine thetransfection ef®ciency of skin and muscle. Rather, cell- and tissue-speci®c uptake and expression and perhaps more subtle nucleaseeffects may act in concert (Barry et al, 1999; Budker et al, 2000).

Another reason for the transient presence of DNA is the lack ofintegration into epidermal stem cells. When DNA is endocytosedinto keratinocytes, most of it generally remains episomal (extra-chromosomal and outside the nucleus). It will not only be degradedbut also diluted, when cells divide (Hengge et al, 1999). Eventually,plasmid DNA is lost from the epidermis when epithelial cells sloughoff. In keeping with earlier reports by us and colleagues we did not®nd evidence for cellular integration into various tissues thatcontained high amounts of episomal DNA (Wolff et al, 1990, 1992;Hengge et al, 1995).

Taken together, these results contribute to the understanding ofDNA dissemination and longevity of expression in a relevant largeanimal model with skin similar to humans. The mechanisms forplasmid distribution are not entirely clear, but transport viadendritic cells, blood, and lymph is suspected. As expected,naked plasmid DNA is almost entirely degraded over time;however, the relatively short time frame of uptake and expressionis suf®cient to elicit important biologic responses, such as seen ingenetic vaccination (Walker et al, 1998). From a safety standpoint,skin gene therapy with naked plasmid DNA can be considered safedue to the rapid biodegradation of plasmid DNA and the exclusiveand transient expression of foreign genes in tissues known to takeup DNA.

The support of Dr. Jonathan Vogel, Dermatology Branch, NIH is gratefully

acknowledged. In addition, the expert veterinarian treatment from Dr. Victoria

Hamshire and Melissa Williams were invaluable throughout the entire study. We

are grateful to Nicole-C. Bartosch for typing the manuscript and Hagen Apel for his

photographical skills.

REFERENCES

Barry ME, Pinto-Gonzalez D, Orson FM, McKenzie GJ, Petry GR, Barry MA: Roleof endogenous endonucleases and tissue site in transfection and CpG-mediatedimmune activation after naked DNA injection. Hum Gene Ther 10:2461±2480,1999

Budker V, Budker T, Zhang G, Subbotin V, Loomis A, Wolff JA: Hypothesis: nakedplasmid DNA is taken up by cells in vivo by a receptor-mediated process. JGene Med 2:76±88, 2000

Calarota S, Bratt G, Nordlund S, Hinkula J, Leandersson AC, Sandstrom E, WahrenB: Cellular cytotoxic response induced by DNA vaccination in HIV-1-infectedpatients. Lancet 351:1320±1325, 1998

Conry R, LoBuglio A, Loechel F, et al: A carcinoembryonic antigen polynucleotidevaccine for human clinical use. Cancer Gene Ther 2:33±38, 1995

Davis HL, Millan CL, Watkins SC: Immune-mediated destruction of transfectedmuscle ®bers after direct gene transfer with antigen-expressing plasmid DNA.Gene Ther 4:181±188, 1997

Donnelly JJ, Friedman A, Martinez D, et al: Preclinical ef®cacy of a prototype DNAvaccine: enhanced protection against antigenic drift in in¯uenza virus. Nat Med1:583±587, 1995

Hartikka J, Sawdey M, Cornefert-Jensen F, et al: An improved plasmid DNAexpression vector for direct injection into skeletal muscle. Hum Gene Ther7:1205±1217, 1996

Hengge UR, Chan EF, Foster RA, Walker PS, Vogel JC: Cytokine gene expressionin epidermis with biological effects following injection of naked DNA. NatGenet 10:161±166, 1995

Hengge UR, Walker PS, Vogel JC: Expression of naked DNA in human, pig andmouse skin. J Clin Invest 97:2911±2916, 1996

Hengge UR, PfuÈtzner W, Williams M, Goos M, Vogel JC: Ef®cient expression ofnaked plasmid DNA in mucosal epithelium: prospective for the treatment ofskin lesions. J Invest Dermatol 111:605±608, 1998

Hengge UR, Taichman LB, Kaur P, et al: How realistic is cutaneous gene therapy?Exp Dermatol 8:419±431, 1999

Hirt B: Selective extraction of polyoma DNA from infected mouse cell cultures. JMol Biol 26:365±369, 1967

Isner JM, Baumgartner I, Rauh G, et al: Treatment of thromboangiitis obliterans(Buerger's disease) by intramuscular gene transfer of vascular endothelialgrowth factor: preliminary clinical results. J Vasc Surg 28:964±973, 1998

Kawabata K, Takakura Y, Hashida M: The fate of plasmid DNA after intravenousinjection in mice: involvement of scavenger receptors in its hepatic uptake.Pharm Res 12:825±830, 1995

Ledley TS, Ledley FD: Multicompartment, numerical model of cellular events in thepharmacokinetics of gene therapies. Hum Gene Ther 5:679±691, 1994

Lew D, Parker SE, Latimer T, et al: Cancer gene therapy using plasmid DNA.pharmacokinetic study of DNA following injection in mice. Gene Ther6:553±564, 1995

Losordo DW, Vale PR, Symes JF, et al: Gene therapy for myocardial angiogenesis:initial clinical results with direct myocardial injection of phVEGF165 as soletherapy for myocardial ischemia. Circulation 98:2800±2804, 1998

Martin T, Parker SE, Hedstrom R, et al: Plasmid DNA malaria vaccine: the potentialfor genomic integration after intramuscular injection. Hum Gene Ther10:759±768, 1999

Meyer KB, Thompson MM, Levy MY, Barron LG, Szoka FC Jr: Intratracheal genedelivery to the mouse airway: characterization of plasmid DNA expression andpharmacokinetics. Gene Ther 2:450±460, 1995

Osaka G, Carey K, Cuthbertson A, et al: Pharmacokinetics, tissue distribution, andexpression ef®ciency of plasmid [33P] DNA following intravenousadministration of DNA/cationic lipid complexes in mice: use of a novelradionuclide approach. J Pharm Sci 85:612±618, 1996

Parker SE, Vahlsing HL, Ser®lippi LM, et al: Cancer gene therapy using plasmidDNA. safety evaluation in rodents and non-human primates. Hum Gene Ther6:575±590, 1995

Schubbert R, Renz D, Schmitz B, Doer¯er W: Foreign (M13) DNA ingested bymice reaches peripheral leukocytes, spleen, and liver via the intestinal wallmucosa and can be covalently linked to mouse DNA. Proc Natl Acad Sci USAUSA 94:961±966, 1997

Sikes ML, O'Malley BW Jr, Finegold MJ, Ledley FD: In vivo gene transfer into rabbitthyroid follicular cells by direct DNA injection. Hum Gene Ther 5:837±844,1994

Syrengelas AD, Chen TT, Levy R: DNA immunization induces protectiveimmunity against B-cell lymphoma. Nat Med 2:1038±1041, 1996

Takehara T, Hayashi N, Yamamoto M, Miyamoto Y, Fusamoto H, Kamada T: Invivo gene transfer and expression in rat stomach by submucosal injection ofplasmid DNA. Hum Gene Ther 7:589±593, 1996

Torres CA, Iwasaki A, Barber BH, Robinson HL: Differential dependence on targetsite tissue for gene gun and intramuscular DNA immunizations. J Immunol158:4529±4532, 1997

Udvardi A, Kufferath I, Grutsch H, Zatloukal K, Volc-Platzer B: Uptake ofexogenous DNA via the skin. J Mol Med 77:744±750, 1999

Walker PS, Scharton-Kersten T, Rowton E, Hengge UR, Bouloc A, Udey MC,Vogel JC: Genetic immunization with gp63 cDNA results in a Th1 typeimmune response and protection in a murine model of leishmaniasis. HumGene Ther 9:1899±1907, 1998

Wang R, Doolan DL, Le TP, et al: Induction of antigen-speci®c cytotoxic Tlymphocytes in humans by a malaria DNA vaccine. Science 282:476±480, 1998

Wells D: Improved gene transfer by direct plasmid injection associated withregeneration in mouse skeletal muscle. FEBS Lett 332:179±182, 1993

Winegar RA, Monforte JA, Suing KD, O'Loughlin KG, Rudd CJ, MacGregor JT:Determination of tissue distribution of an intramuscular plasmid vaccine usingPCR and in situ DNA hybridization. Hum Gene Ther 7:2185±2194, 1996

Wolff JA, Malone RW, Williams P, Chong W, Acsadi G, Jani A, Felgner PL: Directgene transfer into mouse muscle in vivo. Science 247:1465±1468, 1990

Wolff JA, Ludtke JJ, Acsadi G, Williams P, Jani A: Long-term persistence of plasmidDNA and foreign gene expression in mouse muscle. Hum Mol Genet1:363±369, 1992

Wollenberg B, Kastenbauer Mundl H, Schaumberg J, et al: Gene therapyÐphase Itrial for primary untreated head and neck squamous cell cancer (HNSCC)UICC stage II-IV with a single intratumoral injection of hIL-2 plasmidsformulated in DOTMA/Chol. Hum Gene Ther 10:141±147, 1999

982 HENGGE ET AL THE JOURNAL OF INVESTIGATIVE DERMATOLOGY