running head: roles of psk in te differentiation corresponding

Running head: Roles of PSK in TE differentiation

Corresponding author:

Dr. Hiroyasu Motose

Department of Life Sciences, Graduate School of Arts and Sciences, The University of Tokyo,

Komaba 3-8-1, Meguro-ku, Tokyo 153-8902, Japan

TEL: +1-81-5454-6729

e-mail: [email protected]

Research area: Development and Hormone Action

Plant Physiology Preview. Published on March 6, 2009, as DOI:10.1104/pp.109.135954

Copyright 2009 by the American Society of Plant Biologists

www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

Involvement of Phytosulfokine in the Attenuation of Stress Response during the

Transdifferentiation of Zinnia Mesophyll Cells into Tracheary Elements1[w]

Hiroyasu Motose*, Kuninori Iwamoto, Satoshi Endo, Taku Demura, Youji Sakagami,

Yoshikatsu Matsubayashi, Kevin L. Moore, and Hiroo Fukuda

Department of Life Sciences, Graduate School of Arts and Sciences, The University of Tokyo,

Komaba 3-8-1, Meguro-ku, Tokyo 153-8902, Japan (H. M.); Department of Biological Sciences,

Graduate School of Science, The University of Tokyo, Hongo 7-3-1, Bunkyo-ku, Tokyo 113-0033,

Japan (K. I., S. E., H. F.); Plant Science Center, RIKEN, Suehiro 1-7-22, Tsurumi-ku, Yokohama,

Kanagawa 230-0045, Japan (T. D.); Graduate School of Bio-agricultural Sciences, Nagoya

University, Chikusa, Nagoya 464-8601, Japan (Y. S., Y. M); Cardiovascular Biology Research

Program, Oklahoma Medical Research Foundation and the Departments of Cell Biology and

Medicine, University of Oklahoma Health Science Center, Oklahoma City, Oklahoma 73104, USA

(K. L. M.)



Footnotes: 1This work was supported by Grants-in-Aid from the Ministry of Education, Sports, Culture,

Science, and Technology, Japan (grant no. 18770028 and 20770028 to H. M. and grant no.

19060009 and 70342863 to H. F.), the Japan Society for the Promotion of Science (grant no.

20247003 to H. F.), the Asahi Glass Foundation, the Sumitomo Foundation, and Program of Basic

Research Activities for Innovative Biosciences from BRAIN, and by National Institutes of Health

(NIH) Grant HD056022 to K.L.M.

* Corresponding author: Hiroyasu Motose, [email protected], +81-3-5454-6729

The author responsible for distribution of materials integral to the findings presented in this

article in accordance with the policy described in the Instructions for Authors

(www.plantphysiol.org) is: Hiroyasu Motose ([email protected]). [w] The online version of this article contains Web-only data.



Phytosulfokine (PSK) is a sulfated peptide hormone required for the proliferation and

differentiation of plant cells. Here, we characterize physiological roles of PSK in

transdifferentiation of isolated mesophyll cells of zinnia (Zinnia elegans L. cv Canary Bird) into

tracheary elements (TEs). Transcripts for a zinnia PSK precursor gene, ZePSK1, show two-peaks

of expression during TE differentiation; the first accumulation is transiently induced in response to

wounding at the 24th h of culture, and the second accumulation is induced in the final stage of TE

differentiation and is dependent on endogenous brassinosteroids. Chlorate, a potent inhibitor of

peptide sulfation, is successfully applied as an inhibitor of PSK action. Chlorate significantly

suppresses TE differentiation. The chlorate-induced suppression of TE differentiation is overcome

by exogenously applied PSK. In the presence of chlorate, expression of stress-related genes for

proteinase inhibitors and a pathogenesis-related protein is enhanced and changed from transient to

continuous pattern. On the contrary, administration of PSK significantly reduces accumulation of

transcripts for the stress-related genes. Even in the absence of auxin and cytokinin, addition of

PSK suppresses stress-related gene expression. Microarray analysis reveals 66 genes

downregulated and 42 genes upregulated under the presence of PSK. The large majority of

downregulated genes show significant similarity to various families of stress-related proteins,

including chitinases, phenylpropanoid-biosynthesis enzymes, ACC synthase, and receptor-like

protein kinases. These results implicate involvement of PSK in the attenuation of stress response

and healing of wound-activated cells during the early stage of TE differentiation.



Intercellular communication is indispensable to coordinate cellular behaviors of multicellular

organisms during morphogenesis and responses to environmental stimuli. In animals, many

peptide signals play important roles in cell-cell interactions. In contrast, plant cell-cell interactions

have been thought to be mediated mainly by non-peptide small organic compounds, such as abscisic

acid, auxin, brassinosteroids, cytokinin, ethylene, gibberellic acid, jasmonate, and salicylic acid.

Recently, several peptides and glycopeptides have been found as a new class of plant signaling

molecules during defense response (Pearce et al., 1991; 2001a; 2001b; Pearce and Ryan, 2003), cell

proliferation and expansion (Matsubayashi and Sakagami, 1996; Amano et al., 2007), meristem

formation (Fletcher et al., 1999; Fiers et al., 2005; Kondo et al., 2006; Kinoshita et al., 2007), stem

cell fate (Ito et al., 2006), xylem differentiation (Motose et al., 2001b; Motose et al., 2004), stomatal

development (Hara et al., 2007), and self-incompatibility (Schopfer et al., 1999; Takayama et al.,

2000). Some of these signaling peptides have been shown to interact with specific receptor-like

protein kinases (RLKs) and activate intracellular signaling cascades (reviewed in Matsubayashi,

2003; Fukuda et al., 2007).

Plant cells cultured at cell densities less than a critical value (typically 1.0 x 104 cells mL-1)

cannot proliferate despite the administration of any classical phytohormones and defined nutrients.

Addition of conditioned medium prepared from rapidly growing cell cultures stimulated

proliferation of cells cultured at low densities (Stuart and Street, 1969). This phenomenon

indicates that the conditioned medium contains secretory growth factor(s) essential for cell

proliferation. Matsubayashi and Sakagami (1996) isolated a disulfated pentapeptide named

phytosulfokine (PSK; Tyr(SO3H)-Ile-Tyr(SO3H)-Thr-Gln) as a potent mitogenic factor from

conditioned medium derived from cultures of asparagus mesophyll cells. PSK was also discovered

from suspension cultures of rice, maize, and carrot, and stimulated somatic embryogenesis as well

as cell proliferation (Matsubayashi et al., 1997; Kobayashi et al., 1999; Hanai et al., 2000a).

Identification of genes encoding ~80-aa precursors of PSK from various plant species revealed that

each preproprotein of PSK has a secretory signal sequence at N-terminal and a PSK sequence near

C-terminal flanked by dibasic amino acid residues, implying proteolytic processing similar to that

of animal peptide hormones (Yang et al., 1999; 2001; Lorbiecke and Sauter, 2002; Igasaki et al.,

2003). Tyrosine O-sulfation of PSK precursor, which is catalyzed by tyrosylprotein

sulfotransferase in Golgi apparatus (Hanai et al., 2000b), is essential for the biological activities of

PSK (Matsubayashi et al., 1996). After the processing and secretion, PSK binds to the leucine rich

repeat-receptor like kinase (LRR-RLK) on the plasma membranes (Matsubayashi et al., 2002).

Recent extensive analysis of Arabidopsis PSK receptor AtPSKR1 clearly indicates that PSK

promotes cellular longevity and potential for growth (Matsubayashi et al., 2006).



Isolated zinnia mesophyll cells transdifferentiate into tracheary elements (TEs) in the presence of

auxin and cytokinin, providing a useful model system for plant cell transdifferentiation (reviewed in

Fukuda, 2004; Roberts and McCann, 2000). TE transdifferentiation was suppressed when zinnia

mesophyll cells were cultured at low cell densities less than 1.0 × 104 cells mL-1 (Fukuda and

Komamine, 1980; Matsubayashi et al., 1999; Motose et al., 2001a). This suppression was restored

by the administration of PSK or conditioned medium derived form the zinnia xylogenic culture,

which contained considerable amount of PSK (Matsubayashi et al., 1999), indicating the

requirement of endogenous PSK for TE differentiation. Therefore, real physiological functions of

PSK might be uncovered by studying the causal relationship between TE differentiation and PSK in

the zinnia xylogenic culture. For this purpose, we here characterized the expression of a zinnia

PSK gene and investigated effects of PSK on gene expressions using a microarray and a PSK

inhibitor.



RESULTS

Expression Pattern of ZePSK1

We cloned a zinnia gene encoding a putative PSK precursor and analyzed its expression pattern

in zinnia xylogenic culture. Isolation of zinnia cDNA for PSK was carried out by 3’-RACE

followed by 5’-RACE. The resulting cDNA fragments were sequenced and determined to cover

an open reading frame (ORF) for 75 amino acid residues (Fig. 1A, accession number AB089283).

The gene represented by this cDNA is designated ZePSK1 (Zinnia elegans PSK1). ZePSK1

belongs to a PSK gene family including OsPSK and AtPSK (Fig. 1B), which were experimentally

confirmed to encode PSK precursor (Yang et al., 1999; 2001, Matsubayashi et al., 2006). The

deduced amino acid sequence contained a N-terminal signal sequence and the pentapeptide

backbone of PSK (YIYTQ) near the C-terminal of ORF (Fig. 1A). The Asp residue, which was

indispensable for Tyr O-sulfation of PSK (Hanai et al., 2000b), was conserved immediately

N-terminal of the PSK sequence. Two Arg (amino acids 58-59) and two Lys (amino acids 72-73)

were found to border the PSK sequence, suggesting proteolytic processing of this precursor as in the

case of animal prohormone precursors. The signature motif

Cx(4-9)[E/D/Q]xCx(2)RRx(3-4)AH[T/L/V]DYIYTQ derived from comparisons of 36 PSK genes

(Lorbiecke and Sauter, 2002) were also conserved (Fig. 1B).

Reverse-transcript (RT)-PCR analysis was carried out to detect ZePSK1 transcripts (Fig. 1C to

1F) because transcripts for ZePSK1 could not be detected with RNA gel blot analysis. There are

two peaks of the accumulation of ZePSK1 transcripts in cells cultured in TE-inductive medium

containing 0.1 µg L-1 1-naphthaleneacetic acid (NAA) and 0.2 µg L-1 6-benzyladenine� �BA� (D

medium); first peak at the 24th h and second peak at 72nd h of culture (Fig. 1C). Effects of auxin

and cytokinin on the expression of ZePSK1 were analyzed for cells cultured in media with different

combinations of phytohormones; hormone-free medium (C0), medium containing only 0.1 µg L-1

NAA (CN), medium containing only 0.2 µg L-1 BA (CB), and medium containing 0.1 µg L-1 NAA

and 0.001 µg L-1 BA (CP). Cells cultured in C0, CN, and CB medium did not differentiate into TEs,

and those in CP medium differentiated rarely into TEs. The transcripts for ZePSK1 accumulated

even in these control cultures, although they did not accumulate significantly at 72 h in cells

cultured in C0 and CB media (Fig. 1C, D).

Because the transient accumulation of the ZePSK1 transcripts at 24 h was not affected by

phytohormones, the effect of wounding on the accumulation was examined. When zinnia first true

leaves were cut into small pieces and incubated on the hormone free C0 medium, the expression of

ZePSK1 was induced at the 12th and 24th h after wounding (Fig. 1E). This result suggests that the



early increase in the ZePSK1 transcripts is due to wound stimuli.

Endogenous brassinosteroids are essential for TE transdifferentiation of zinnia mesophyll cells

(Iwasaki and Shibaoka, 1991) and in particular, for the entry into the final stage of TE

differentiation, which usually occurs between 48 h and 72 h of culture (Yamamoto et al., 1997;

2001). To investigate whether brassinosteroids were required for the expression of ZePSK1 or not,

we analyzed the effect of uniconazole, which inhibits brassinosteroid biosynthesis, and brassinolide,

a biologically active brassinosteroid, on the expression of ZePSK1 (Fig. 1F). Uniconazole is also

known to inhibit gibberellin biosynthesis, but in zinnia xylogenic culture, it is confirmed that

brassinosteroids overcome uniconazole-induced suppression of TE differentiation while gibberellin

could not (Iwasaki and Shibaoka, 1991). The accumulation of the ZePSK1 transcripts was

suppressed at the 60th and 72nd h of culture by the administration of uniconazole at the start of

culture and this suppression was fully reversed by the exogenously supplied brassinolide (Fig. 1F).

This result suggested that biosynthesis of brassinosteriods is required for the induction of ZePSK1

during the late stage of TE differentiation.

Chlorate as An Inhibitor of PSK

Inhibitors of PSK should be useful to analyze the function of PSK. However specific inhibitors

of PSK have not yet been described. Therefore, we applied chlorate, a potent inhibitor of peptide

sulfation in animal cells (Baeuerle and Huttner, 1986), to suppress Tyr O-sulfation of PSK precursor,

that is indispensable for the biological activities of PSK and the binding of PSK to PSK receptor

(Matsubayashi et al., 1996; 1997; 2002; Matsubayashi and Sakagami, 1999; 2000). Chlorate

added at concentrations of more than 2 mM suppressed TE differentiation completely (Fig. 2B, D)

and cell division strongly (Fig. 2E). Administration of PSK at the concentrations above 1.0 × 10-8

M restored the chlorate-dependent inhibition of TE differentiation (Fig. 2C, F), but not cell division

(Fig. 2G). These results suggested that chlorate would be useful for analyzing roles of PSK in TE

differentiation, apart from its roles in cell division.

To investigate effect of chlorate on the tyrosine sulfation of PSK, PSK was purified from cell

suspensions cultured with or without chlorate and was subjected to immunodot blot assay using an

anti-sulfotyrosine monoclonal antibody called PSG2 (Hoffhines et al., 2006). The PSG2 binding

was significantly decreased in PSK fraction derived from culture treated with chlorate (Fig. 3),

suggesting that chlorate inhibits tyrosine sulfation of PSK in zinnia xylogenic culture.

Stage-Dependent PSK Functions



The process of TE transdifferentiation of zinnia mesophyll cells is divided into three stages

(Fukuda, 1997): stage 1 (first 24 hour), during which mesophyll cells dedifferentiate to become

pluricompetent cells; stage 2 (next 24 hour), during which dedifferentiated cells restrict their

potency of differentiation to become the precursors of TEs via procambial cells; stage 3 (final 24-48

hour), during which TE precursors form secondary cell wall and execute programmed cell death.

Based on this categorization, we investigated stage-dependent PSK functions.

First, we characterized changes in responsiveness of cells to PSK with chlorate. Chlorate was

added at the start of culture and PSK was added at various times thereafter (Fig. 4A). PSK, when

added to the culture within the 24th h of culture, most effectively reversed the chlorate-induced

inhibition of TE differentiation, and thereafter the reversal effect of PSK decreased with time.

Similarly, we examined time of requirement for PSK in low cell density culture (5.0 × 103 cells

mL-1) (Fig. 4B). PSK was most effective in inducing TE differentiation when PSK was added at

the start of culture or at the 12th h of culture. TE differentiation was severely suppressed when

mesophyll cells were cultured for 36 h without exogenously supplied PSK. These results imply

that PSK is required for TE differentiation before the 24th h of culture.

Second, we investigated effects of PSK and chlorate on the accumulation of mRNAs for various

stage marker genes (Yamamoto et al., 1997; Demura et al., 2002). Transcripts for marker genes of

stage 1, ZePR (Zinnia elegans pathogenesis related protein), ZePI1 (Zinnia elegans proteinase

inhibitor 1), and ZePI2 (Zinnia elegans proteinase inhibitor 2) accumulated transiently between 12

and 36 h of culture (Fig. 5). In the presence of chlorate, ZePR, ZePI1, and ZePI2 continuously

accumulated at high level. On the contrary, administration of PSK suppressed the accumulations

of the ZePR, ZePI1, and ZePI2 transcripts. Accumulation of the ZePAL3 mRNA peaked at 24 h

and 72 h of culture (Fig. 5). Chlorate enhanced the accumulation of the ZePAL3 transcripts, which

was similar to that of the ZePR, ZePI1, and ZePI2 transcripts. Addition of PSK suppressed the

first peak of accumulation of the ZePAL3 transcripts but did not the second peak. These results

indicate that stress-related gene expression is suppressed preferentially in the presence of PSK.

This suppression occurred in the absence of auxin and cytokinin (Fig. 6A), suggesting that auxin

and cytokinin is not required for the suppression of stress response by PSK. The suppressive

effect was a little weaker in cultures with only auxin or only cytokinin than in culture with both

phytohormones or hormone-free culture (Fig. 6A). Besides the suppressive effect of PSK on stress

response, PSK also promoted TE differentiation in the presence of auxin and cytokinin (Fig. 6B),

suggesting that PSK stimulates TE differentiation via the suppression of stress response.

Chlorate treatment delayed the appearance of transcripts for stage 2 marker genes for 24 h,

including transcripts for TED3 (TE differentiation 3) and TED4 (TE differentiation 4) (Fig. 5).

However, it did not significantly affect peak transcript levels for these two genes. The



chlorate-induced delay was reversed by exogenously supplied PSK. In contrast, chlorate almost

completely suppressed the accumulation of the ZCP4 mRNA, a stage 3 marker, and PSK restored

the chlorate-induced suppression.

Microarray Analysis

To study PSK function in detail, large-scale expression analysis was performed with zinnia

microarrays consisting of ~9000 genes (Demura et al., 2002). The cDNA populations for

hybridizations to the microarray were prepared from freshly isolated zinnia mesophyll cells

(indicated as 0 h cells) and cells cultured for 24 h in four different culture conditions; D medium

without PSK nor chlorate (indicated as Mock), with 1.0 x 10-7 M PSK (indicated as PSK), with 2

mM chlorate (indicated as KClO3), or with 2 mM chlorate and 1.0 x 10-7 M PSK (indicated as

KClO3 + PSK). Gene expression profiles were compared between Mock-treated and PSK-treated

cells and between chlorate-treated and chlorate+PSK-treated cells, and genes were identified as

being differentially expressed if the signal values deviated either positively or negatively two-fold

or more in both sets in two or three independent microarray experiments (Fig. 7).

As a result, transcript levels of 66 genes and 42 genes were downregulated and upregulated in the

presence of PSK, respectively (Fig. 7, Table S1, and Table S2). Expression patterns of these genes

were compared with the previous comprehensive microarray data on changes in transcript

accumulation during TE differentiation (Demura et al., 2002). Of the 66 genes downregulated by

PSK, 46 genes (46/66 = 69.7%) were clustered into group C, which mainly included genes induced

at stage 1 with a peak at the 24th h of culture (Fig. 7, Table S1). Functionally, 21 (21/66 = 31.8%)

of the 66 genes were classified as genes encoding stress-related proteins, including four putative

chitinases (Z1809, Z2220, Z2326, Z7553), seven enzymes involved in biosynthesis of

phenylpropanoids (Z293, Z7345, ZePAL6, Z5823, Z8452, Z8712, Z9331), a putative laccase

involved in the polymerization of lignin monomers (Z8815), three redox-related enzymes (Z5164,

Z7351, ZeGSAT), ACC synthase (Z1862), and defense-response genes (Z1987, Z5204, ZePR,

ZePI1, and ZePI2) (Table S1).

Seven cDNAs downregulated by PSK exhibited high degree of sequence similarities to putative

RLKs, which were classified to three different subfamilies; LRR-RLKs (Z1175, Z7149, Z8544,

Z8757), wall-associated kinase (Z6194), and S-locus RLK (Z2332). Of these genes, Z8544,

closely resembled rice LRR-RLK Xa21 involved in the disease resistance to Xanthomonas oryzae

pv. oryzae (Song et al., 1995). Z8757 showed a high degree of homology with the carrot PSK

receptor kinase DcPSKR (Matsubayashi et al., 2002). Zinnia microarray contained three cDNAs

(Z4541, Z8757, Z9214) with significant similarities to the PSK receptor kinase, of which Z8757



was most preferentially expressed in zinnia xylogenic culture and potently downregulated by

exogenously supplied PSK. These data suggest that suppression of RLKs is involved in the

downregulation of stress response and negative feedback regulation of PSK signaling.

Genes downregulated by PSK also included genes involved in various cytological processes;

transcription (ZeHB8), transport (Z2631, Z3438, Z4657, Z6170, Z6277, Z7460), protein destination

(Z1947, Z2804, Z2715, Z5307, Z9251), cell wall metabolism and function (Z4367, Z6105, Z8790),

and lipid metabolism (Z1733, Z3304, Z3892).

Of the 42 genes upregulated in the presence of PSK, 31 genes (31/42 = 73.8%) belonged to group

A categorized by Demura et al. (2002) (Fig. 7, Table S2), of which mRNA levels were high in

freshly isolated cells (0 h cells) and decreased rapidly after the 24th h of culture. Of these 31

genes, 20 genes encoded proteins related to various chloroplast (plastid) functions including

photosynthesis, chlorophyll synthesis, carbon fixation and chloroplast protein synthesis. This

result suggests that PSK maintains chloroplast activity, which is related to the previous reports

showing promotion of chlorophyll content by PSK (Yamakawa et al., 1998; 1999). PSK also

promoted accumulation of transcripts for genes encoding nitrite transporters (Z144 and Z7443),

acid phosphatases (Z8691 and Z8692), receptor-like protein kinase (Z4539), signal recognition

particle subunit (Z6904), and glycosyl hydrolase (Z6245).



Discussion

Chlorate as an inhibitor of PSK

We chose chlorate as an inhibitor of PSK because Tyr O-sulfation of PSK is essential for its

biological activity (Matsubayashi et al., 1996) and chlorate have been widely used as a potent

inhibitor of peptide sulfation in animal cells (Baeuerle and Huttner, 1986; Beinfeld, 1994; Maiti et

al., 1998; Farzan et al., 1999). In this study, we showed that chlorate completely inhibited TE

differentiation of zinnia mesophyll cells (Fig. 2) and suppressed tyrosine sulfation of PSK (Fig. 3).

The chlorate-induced inhibition of TE differentiation was recovered by exogenously supplied PSK

(Fig. 2). This reversal effect is specific for PSK since other phytohormones had no effect on the

suppression of TE differentiation by chlorate (Table S3). These results suggest that chlorate

inhibits tyrosine sulfation of PSK resulting in the suppression of TE differentiation. Chlorate

provides an advantage to investigate the roles of PSK. It is difficult to prepare enough amounts of

RNA for analysis from cultures at low cell densities, which have been used for highly sensitive

bioassay for PSK (Matsubayashi and Sakagami, 1996; Matsubayashi et al., 1999). Because

chlorate is effective for cells cultured at high cell densities, we can easily prepare RNA from

cultures in which active PSK is depleted by chlorate-treatment.

Chlorate is an inhibitor of ATP-sulfurylase, which catalyzes the synthesis of 5’-adenylylsulfate

from ATP and inorganic sulfate (Ulrich and Huber, 2001). 5’-adenylylsulfate was utilized for the

biosynthesis of Cys and 3’-phosphoadenosine-5'-phosphosulfate, a donor of Tyr O-sulfation

(Leustek et al., 2000). Because Hemmi et al. (2001) reported the requirement of glutathione,

which was biosynthesized from Cys, for TE differentiation of zinnia mesophyll cells, there is a

possibility that chlorate inhibits biosynthesis of Cys and glutathione, resulting in the inhibition of

TE differentiation. Cys, reduced form of glutathione, or glutathione disulfide, however, had no

reversal effect on the chlorate-induced suppression of TE differentiation (Table S3), suggesting that

chlorate-induced inhibition of TE differentiation did not result from the inhibition of Cys and

glutathione biosynthesis.

Chlorate is an analog of nitrate and reduced to toxic chlorite by nitrate reductase (Åberg, 1947;

Solomonson and Vennesland, 1972; Nakagawa and Yamashita, 1986). Chlorate have been used as

an herbicide and applied to isolate mutants that are defective in nitrate reduction (Oostindi and

Feenstra, 1973; Braaksma and Feenstra, 1982; Willkinson and Crawford, 1991; LaBrie et al., 1992;

Tsay et al., 1993; Lin and Cheng, 1997). Therefore, the toxic chlorite produced from chlorate by

nitrate reductase might inhibit TE differentiation. However, toxic effect of chlorate seems unlikely

from the following reasons; (1) zinnia culture medium contains nitrate at a concentration of 20 mM,

which is enough for nitrate to function as a potent competitive inhibitor of chlorate reduction



(Solomonson and Vennesland, 1972; Nakagawa and Yamashita, 1986), (2) chlorate did not affect

viability of zinna cultured cells in the presence of nitrate at concentrations of more than 20 mM (Fig.

S1), (3) chlorate added after the 12th h of culture had no effect on TE differentiation (Fig. S2).

The third observation implies that sufficient amount of 5’-adenylylsulfate may be synthesized by

ATP-sulfurylase by the 12th h of culture.

Roles of PSK in TE differentiation

It has been shown that endogenous PSK is required for transdifferentiation of zinnia mesophyll

cells into TEs (Matsubayashi et al., 1999). In the present study, we investigated functions of PSK

in TE differentiation and obtained the following results: (1) ZePSK1 transcripts accumulated in

response to wounding at the 24th h of culture, after which wound-induced genes were rapidly

downregulated (Fig. 1, Fig. 5); (2) the inhibition of active PSK biosynthesis by chlorate enhanced

expression of stress-related genes, which was significantly suppressed by exogenously supplied

PSK (Fig. 5); (3) microarray analysis identified various kinds of stress-response genes

downregulated in the presence of PSK (Table1); (4) the stress-response genes were downregulated

by the addition of PSK in the absence of auxin and cytokinin (Fig. 6). These results strongly

suggest involvement of PSK in the attenuation of stress response occurring in the early stage of TE

transdifferentiation. Although it remains to be identified which signaling pathway(s) of stress

response is downregulated, our microarray data imply that genes for phenylpropanoid biosynthesis

enzymes, chitinases, RLKs, and ACC synthase probably represent stress-response pathway

downstream of PSK. The suppression of PAL genes and an ACC synthase gene could result in the

downregulation of biosynthesis of salicyclic acid and ethylene, two potent signals mediating stress

response.

Effects of PSK and chlorate on stage-specific marker genes led to the conclusion that PSK is

required both for the entry into stage-2 and for the transition from stage-2 to stage-3. Chlorate

induced continuous stress-response gene expression, delayed stage-2 marker expression, and

suppressed stage-3 marker expression (Fig. 5). This data suggests that chlorate-treated cells are

delayed to enter into stage 2 and finally stopped before the transition from stage 2 to stage 3 with

stress response continuously activated. On the contrary, addition of PSK suppressed

stress-response genes, overcame chlorate-induced delay of stage-2 marker expression, and

recovered the suppression of stage-3 marker gene (Fig. 5). These results suggest that PSK is

essential for the progression of stage 2 and the entry into stage 3. The continuous stress response

might be incompatible with the entry into the final step of TE differentiation.

It is noteworthy that the second induction of ZePSK1 was dependent on the biosynthesis of

brassinosteroids, an essential factor for the transition from stage 2 to stage 3 (Iwasaki and Shibaoka



1991; Yamamoto et al., 1997; 2001). Brassinosteroid-dependent induction of ZePSK1 evokes the

possibility that endogenous brassinosteroids induce biosynthesis of PSK, which acts cooperatively

with brassinosteroids during the transition from Stage 2 to Stage 3. Interestingly, expression of

three zinnia HD-Zip III Homeobox genes was induced by brassinosteroids during TE differentiation

(Ohashi-Ito et al. 2002). These transcriptional factors might function with brassinosteroids and

PSK during the entry into the final stage of TE differentiation.

PSK not only activates proliferation of cultured cells (Matsubayashi and Sakagami, 1996), but

also stimulates TE differentiation (Matsubayashi et al., 1999), somatic embryogenesis (Kobayashi

et al., 1999; Hanai et al., 2000a; Igasaki et al. 2003), and pollen germination (Chen et al., 2000).

To explain the multiple functions of PSK, Matsubayashi (2003) proposed a hypothesis that PSK

confers cellular competence to respond to signals such as auxin and cytokinin, which ultimately

determine cellular behavior. In this paper, we report that one of the downstream effects of PSK

action is the attenuation of stress response. The PSK-mediated suppression of stress response

might be a prerequisite for the acquisition of competence of redifferentiation and responsiveness to

signals such as auxin and cytokinin. As an alternative hypothesis, PSK might increase general

physiological and metabolic activity, resulting in the faster downregulation of stress response and

multifunctional effects of PSK. Detailed analysis of Arabidopsis PSK receptor AtPSKR1

indicated that PSK is required for cellular longevity and potential for growth (Matsubayashi et al.,

2006). Phenotypic analysis of triple mutant of AtPSKR1, AtPSKR2, and At1g72300, which

encodes a receptor of another tyrosine-sulfated peptide called PSY1, showed that PSK and PSY1

were involved in promotion of cellular proliferation and expansion, tissue repair after wounding,

and inhibition of premature senescence (Amano et al., 2007). Since the triple mutant of

PSK/PSY1 receptors did not exhibit any significant defect in xylem development, PSK and PSY1

might not be essential for xylem differentiation in planta. Instead, PSK may participate in tissue

repair and xylem regeneration after wounding. Our study suggests that PSK might promote the

formation of a bypass of regenerated xylem through the suppression of stress response during

vascular regeneration after wounding. Further analysis of PSK/PSY1 signaling will shed new

insight on the flexible ability of plant cells for growth and differentiation.



MATERIALS AND METHODS

Cell Suspension Culture

Seeds of zinnia (Zinnia elegans L. cv. Canary bird) were purchased from Takii Shubyo (Kyoto,

Japan). Zinnia seedlings were grown on vermiculite at 25˚C under a daily 14-h light period. The

first true leaves of 14-day-old seedlings were used as the source material for isolation of mesophyll

cells.

Suspension culture of zinnia mesophyll cells was performed according to the procedure of

Sugiyama and Fukuda (1995). The culture medium was a slightly modified version of that

described by Fukuda and Komamine (1980). The culture medium for the induction of TE

differentiation (D medium) contained 0.1 mg L–1 NAA and 0.2 mg L–1 BA. For control

non-differentiation cultures, C0 medium that was free of NAA and BA, CB medium containing 0.2

mg L–1 BA, CN medium containing 0.1 mg L–1 NAA, and CP medium containing 0.1 mg L–1 NAA

and 0.001 mg L–1 BA was used instead of the D medium. Isolated mesophyll cells were cultured

at a density of 5.0 x 104 cells mL-1 unless otherwise stated.

TEs, divided cells, and dead cells, which are morphologically distinguishable, were counted

under a light microscope. The frequencies of TE differentiation and cell division were calculated as

the proportions of TEs and divided cells to the number of living cells, respectively. Cell viability

was calculated as the proportions of living cells and TEs to total cell number.

Culture of Leaf Pieces

Surface-sterilized first true leaves of 14-day-old seedlings were cut into small pieces with razor

blade after removing the midribs. Leaf pieces were transferred onto hormone-free C0 medium

gelled with 0.25% gellan gum in plastic dishes, and cultured in the dark at 27˚C.

PSK

PSK and unsulfated PSK were synthesized according to Matsubayashi et al. (1996).

Cloning of ZePSK1

Zinnia mesophyll cells were cultured in D medium and harvested after 24, 36, 48, 60 h in culture.

From a mixed sample of these cells, poly(A)+ RNA was prepared by use of FastTrack mRNA

Isolation Kit Ver 3.5 (Invitrogen). For 3’-RACE, first strand cDNA was reverse-transcribed from

poly(A)+ RNA with dT17-LL-BamA primer

(5’-GATTAGGATCCACTAATATCTTTTTTTTTTTTTTTTT-3’). A degenerate primer PSK-F2a

(5’-CAYACBGAYTAYATHTAYACICAR-3’) was designed for the amino acid sequence of PSK



domain. cDNA fragments were amplified from first strand cDNA by PCR with primers, PSK-F2a

and LL-BamA. After agarose gel electrophoresis, DNA of 0.24 kbp in length was cloned into

pGEM-T-Easy vector (Promega).

On the basis of the nucleotide sequences of cDNA fragments obtained through 3’-RACE, two

reverse primers PSK-R3 (5’-CATGCATGTCTAGCTCATTATACAAC-3’) and PSK-R4

(5’-CGATAATTATCGATCATAAACGAG-3’) was designed for 5’-RACE. First strand cDNA was

synthesized from poly(A)+ RNA with PSK-R4, and subjected to dC-tailing reaction. PCR

amplification from dC-tailed cDNA was performed with two primers, PSK-R3 and polyG-AP

(5’-GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG-3’) to yield DNA of 0.39 kbp. This

PCR product was cloned into pGEM-T-Easy vector (Promega).

RNA Gel Blot Analysis

Total RNA was isolated according to Ozeki et al. (1990). Twenty µg of total RNA was

separated by agarose gel electrophoresis and transferred to a positively charged nylon membrane

(Roche) and hybridized with digoxigenin-labelled antisense RNA probes. Hybridization signals

were visualized by the immunological method with anti-digoxigenin-AP Fab fragments (Roche)

according to the manufacturer’s instructions.

RT-PCR

Total RNA was extracted as described previously (Ozeki et al., 1990). After treatment with

RNase-free DNase I (Invitrogen), first strand cDNA was synthesized with Superscript II

(Invitrogen) according to the manufacturers’ instruction and was used as template for PCR using

primers, PSK-F0 (5’-ACACTCAACCACCACCATTT-3’) and PSK-R4, for 20 cycles. PCR

products were separated by agarose electrophoresis, transferred to a positively charged nylon

membrane (Roche) and hybridized with a digoxigenin-labelled antisense RNA probe.

Hybridization signals were visualized by the immunological method with anti-digoxigenin-AP Fab

fragments (Roche) according to the manufacturer’s instructions. As a control, 18S rRNA fragment

was amplified with 20 cycles using primers, TAGTAGGCCACTATCCTACCATCGA and

AATTCTAGAGCTAATACGTGCAACAAACCC.

Immunoblotting

Conditioned medium (200 mL) prepared from zinnia cell suspension cultures was buffered

(Tris-HCl at a final concentration of 20 mM at pH 8.0) and applied to a DEAE Sephadex column

(GE Healthcare) equilibrated with 20 mM Tris-HCl (pH 8.0). The column was washed with 3.0

ml of equilibration buffer and with 3.0 ml buffer containing 0.5 M KCl, and eluted with 1.0 ml



buffer containing 2.0 M KCl. The eluate was desalted by dialysis (Spectra/Por MWCO, 1000),

lyophilized, and dissolved in 100 µL of water. This solution was diluted at the 5 or 25 fold and 2

µl aliquot of each diluted solution was dot-blotted on a PVDF membrane (Hybond-P, GE

Healthcare). The immunodetection of sulfotyrosine was performed with an anti-sulfotyrosine

monoclonal antibody, PSG2, as described in Hoffhines et al. (2006). The anti-sulfotyrosine

monoclonal antibody PSG2 or control IgG4λ monoclonal antibody was used as primary antibody at

50 ng mL-1 and horseradish peroxidase-conjugated anti-human IgG was used as the secondary

antibody. The antibody binding was detected using ECL Plus (GE Healthcare).

Microarray Analysis

Zinnia cDNA microarray analysis was performed according to Demura et al. (2002). In zinnia

microarray slides, PCR-amplified cDNAs were spotted twice on each slide for the reliability of

microarray analysis. Poly(A)+ RNA was isolated from fleshly isolated mesophyll cells (0 h cells)

and cells cultured for 24 h in four different culture conditions; D medium without PSK nor chlorate

(Mock), with 1.0 x 10-7 M PSK (PSK), with 2 mM chlorate (KClO3), or with 2 mM chlorate and 1.0

x 10-7 M PSK (KClO3 + PSK) using Fast Track RNA isolation kit (Invitrogen). Cy5-labelled

cDNA population was synthesized from 2 µg of poly(A)+ RNA using Super Script II (Invitrogen).

The hybridization to the microarray and scanning were performed according to Endo et al. (2002).

Microarray experiments were done in three independent RNA samples derived from three

independent cultures. Gene expression profiles were compared between Mock-treated and

PSK-treated cells and between chlorate-treated and chlorate+PSK-treated cells, and genes were

identified as being differentially expressed if the signal values deviated either positively or

negatively two-fold or more in both comparisons (Mock vs. PSK and chlorate vs. chlorate+PSK) in

two or three independent microarray experiments.

Supplemental Data

The following materials are available in the online version of this article.

Supplemental Figure S1. Effects of KNO3 on TE differentiation, cell division, and viability in

the presence of KCl, KClO3, and PSK.

Supplemental Figure S2. Changes in the responsiveness of cells to KClO3 during xylogenic

culture.

Supplemental Table S1. Summary of genes downregulated by PSK.

Supplemental Table S2. Summary of genes upregulated by PSK.

Supplemental Table S3. Effects of Cys, glutathione, and phytohormones on the inhibition by

chlorate of TE differentiation.



ACKNOWLEDGMENTS

We are grateful to Sumitomo Chemical (Takarazuka, Hyogo, Japan) for kindly supplying

uniconazole, Dr. Ryo Yamamoto (National Institute of Crop Science, Tsukuba, Japan) for useful

advice and discussion, and Dr. Yuichiro Watanabe for encouragement.



LITERATURE CITED

Åberg B (1947) On the mechanism of the toxic action of chlorates and some related substances

upon young wheat plants. Ann R Agric Coll Sweden 15: 37-107

Amano Y, Tsubouchi H, Shinohara H, Ogawa M, Matsubayashi Y (2007) Tyrosine-sulfated

glycopepetide involved in cellular proliferation and expansion in Arabidopsis. Proc Natl Acad Sci

USA 104: 18333-18338

Baeuerle PA and Huttner WB (1986) Chlorate – A potent inhibitor of protein sulfation in intact

cells. Biochem Biophys Res Commun 141: 870-877

Beinfeld MC (1994) Inhibition of pro-cholecystokinin (CCK) sulfation by treatment with

sodium-chlorate alters its processing and decreases cellular content and secretion of CCK-8.

Neuropeptides 26: 195-200

Braaksma FJ, Feenstra WJ (1982) Isolation and characterization of nitrate reductase-deficient

mutants of Arabidopsis thaliana. Theor Appl Genet 64: 83-90

Chen YF, Matsubayashi Y, Sakagami Y (2000) Peptide growth factor phytosulfokine-alpha

contributes to the pollen population effect. Planta 211: 752-755

Demura T, Tashiro G, Horiguchi G, Kishimoto N, Kubo M, Matsuoka N, Minami A,

Nagata-Hiwatashi M, Nakamura K, Okamura Y, Sassa N, Suzuki S, Yazaki J, Kikuchi S,

Fukuda H (2002) Visualization by comprehensive microarray analysis of gene expression

programs during transdifferentiation of mesophyll cells into xylem cells. Proc Natl Acad Sci USA

99: 15794-15799

Endo M, Matsubara H, Kokubun T, Masuko H, Takahata Y, Tsuchiya T, Fukuda H, Demura

T, Watanabe M (2002) The advantages of cDNA microarray as an effective tool for identification

of reproductive organ-specific genes in a model legume, Lotus japonicus. FEBS Lett 514: 229-237

Farzan M, Mirzabekov T, Kolchinsky P, Wyatt R, Cayabyab M, Gerard NP, Gerard C,

Sodroski J, Choe H (1999) Tyrosine sulfation of the amino terminus of CCR5 facilitates HIV-1

entry. Cell 96: 666-676



Fiers M, Golemiec E, Xu J, Van der Geest L, Heidstra R, Stiekema W, Liu CM (2005) The

14-amino acid CLV3, CLE19, and CLE40 peptides trigger consumption of the root meristem in

Arabidopsis through a CLAVATA2-dependent pathway. Plant Cell 17: 2542-2553

Fletcher JC, Brand U, Running MP, Simon R, Meyerowitz EM (1999) Signaling of cell fate

decisions by CLAVATA3 in Arabidopsis shoot meristems. Science 283: 1911-1914

Fukuda H (1997) Tracheary element differentiation. Plant Cell 9: 1147-1156

Fukuda H (2004) Signals that control plant vascular cell differentiation. Nature Rev Mol Cell Biol

5: 379-391

Fukuda H, Hirakawa Y, Sawa S (2007) Peptide signaling in vascular development. Curr Opin

Plant Biol 10: 477-482

Fukuda H, Komamine A (1980) Establishment of an experimental system for the study of

tracheary element differentiation from a single cell isolated from the mesophyll of Zinnia elegans.

Plant Physiol 65: 57-60

Hanai H, Matsuno T, Yamamoto M, Yamamoto M, Matsubayashi Y, Kobayashi T, Kamada H,

Sakagami Y (2000a) A secreted peptide growth factor, phytosulfokine, acting as a stimulatory

factor of carrot somatic embryo formation. Plant Cell Physiol 41: 27-32

Hanai H, Nakayama D, Yang HP, Matsubayashi Y, Hirota Y, Sakagami Y (2000b) Existence of

a plant tyrosylprotein sulfotransferase: novel plant enzyme catalyzing tyrosine O-sulfation of

preprophytosulfokine variants in vitro. FEBS Lett 470: 97-101�

Hara K, Kajita R, Torii KU, Bergmann DC, Kakimoto T (2007) The secretory peptide gene

EPF1 enforces the stomatal one-cell-spacing rule. Genes Dev 21: 1720-1725

Henmi K, Tsuboi S, Demura T, Fukuda H, Iwabuchi M, Ogawa K (2001) A possible role of

glutathione and glutathione disulfide in tracheary element differentiation in the cultured mesophyll

cells of Zinnia elegans. Plant Cell Physiol 42: 673-676



Hoffhines AJ, Damoc E, Bridges KG, Leary JA, Moore KL (2006) Detection and purification of

tyrosine-sulfated proteins using a novel anti-sulfotyrosine monoclonal antibody. J Biol Chem 281:

37877-37887

Igasaki T, Akashi N, Ujino-Ihara T, Matsubayashi Y, Sakagami Y, Shinohara K (2003)

Phytosulfokine stimulates somatic embryogenesis in Cryptomeria japonica. Plant Cell Physiol 44:

1412-1416

Ito Y, Nakanomyo I, Motose H, Iwamoto K, Sawa S, Dohmae N, Fukuda H (2006)

Dodeca-CLE peptides as suppressors of plant stem cell differentiation. Science 313: 842-845

Iwasaki T and Shibaoka H (1991) Brassinosteroids act as regulators of tracheary-element

differentiation in isolated Zinnia mesophyll cells. Plant Cell Physiol 32: 1007-1014

Kinoshita A, Nakamura Y, Sasaki E, Kyozuka J, Fukuda H, Sawa S (2007) Gain-of-function

phenotypes of chemically synthetic CLAVATA3/ESR-related (CLE) peptides in Arabidopsis

thaliana and Oryza sativa. Plant Cell Physiol 48: 1821-1825

Kobayashi T, Eun CH, Hanai H, Matsubayashi Y, Sakagami Y, Kamada H (1999)

Phytosulphokine-alpha, a peptidyl plant growth factor, stimulates somatic embryogenesis in carrot.

J Exp Bot 50: 1123-1128

Kondo T, Sawa S, Kinoshita A, Mizuno S, Kakimoto T, Fukuda H, Sakagami Y (2006) A plant

peptide encoded by CLV3 identified by in situ MALDI TOF-MS analysis. Science 313: 845-848

LaBrie ST, Willkinson JQ, Tsay YF, Feldmann KA, Crawford NM (1992) Identification of two

tungstate-sensitive molybdenum cofactor mutants, chl2 and chl7, of Arabidopsis thaliana. Mol Gen

Genet 233: 169-176

Leustek T, Martin MN, Bick JA, Davies JP (2000) Pathways and regulation of sulfur metabolism

revealed through molecular and genetic studies. Annu. Rev. Plant Physiol Plant Mol Biol 51:

141-165

Lin Y, Cheung CL (1997) A chlorate-resistant mutant defective in the regulation of nitrate

reductase gene expression in Arabidopsis defines a new HY locus. Plant Cell 9: 21-35



Lorbiecke R, Sauter M (2002) Comparative analysis of PSK peptide growth factor precursor

homologs. Plant Sci 163: 321-332

Maiti A, Maki G, Johnson P (1998) TNF-alpha induction of CD44-mediated leukocyte adhesion

by sulfation. Science 282: 941-943

Matsubayashi Y (2003) Ligand-receptor pairs in plant peptide signaling. J Cell Sci 116: 3863-3870

Matsubayashi Y, Sakagami Y (1996) Phytosulfokine, sulfated peptides that induce the

proliferation of single mesophyll cells of Asparagus officinalis L. Proc Natl Acad Sci USA 93:

7623-7627

Matsubayashi Y, Sakagami Y (1999) Characterization of specific binding sites for a mitogenic

sulfated peptide, phytosulfokine-alpha, in the plasma-membrane fraction derived from Oryza sativa

L. Eur J Biochem 262: 666-671

Matsubayashi Y, Sakagami Y (2000) 120-and 160-kDa receptors for endogenous mitogenic

peptide, phytosulfokine-alpha, in rice plasma membranes. J Biol Chem 275: 15520-15525

Matsubayashi Y, Hanai H, Hara O, Sakagami Y (1996) Active fragments and analogs of the

plant growth factor, phytosulfokine: Structure-activity relationships. Biochem Biophys Res

Commun 225: 209-214

Matsubayashi Y, Takagi L, Sakagami Y (1997) Phytosulfokine-alpha, a sulfated pentapeptide,

stimulates the proliferation of rice cells by means of specific high-and low-affinity binding sites.

Proc Natl Acad Sci USA 94: 13357-13362

Matsubayashi Y, Takagi L, Omura N, Morita A, Sakagami Y (1999) The endogenous sulfated

pentapeptide phytosulfokine-alpha stimulates tracheary element differentiation of isolated

mesophyll cells of zinnia. Plant Physiol 120: 1043-1048

Matsubayashi Y, Ogawa M, Morita A, Sakagami Y (2002) An LRR receptor kinase involved in

perception of a peptide plant hormone, phytosulfokine. Science 296: 1470-1472



Matsubayashi Y, Ogawa M, Kihara H, Niwa M, Sakagami Y (2006) Disruption and

overexpression of Arabidopsis phytosulfokine receptor gene affects cellular longevity and potential

for growth. Plant Physiol 142: 45-53

Motose H, Fukuda H, Sugiyama M (2001a) Involvement of local intercellular communication in

the differentiation of zinnia mesophll cells into tracheary elements. Planta 213: 121-131

Motose H, Sugiyama M, Fukuda H (2001b) An arabinogalactan protein(s) is a key component of

a fraction that mediates local intercellular communication involved in tracheary element

differentiation of zinnia mesophyll cells. Plant Cell Physiol 42: 129-137

Motose H, Sugiyama M, Fukuda H (2004) A proteoglycan mediates inductive interaction during

plant vascular development. Nature 429: 873-878

Nakagawa H, Yamashita N (1986) Chlorate reducing activity of spinach nitrate reductase. Agric

Biol Chem 50: 1893-1894

Ohashi-Ito K, Demura T, Fukuda H (2002) Promotion of transcript accumulation of novel Zinnia

immature xylem-specific HD-Zip III homeobox genes by brassinosteroids. Plant Cell Physiol 43:

1146-1153

Oostindi FJ, Feenstra WJ (1973) Isolation and characterization of chlorate-resistant mutants of

Arabidopsis thaliana. Mutat Res 19: 175-185

Ozeki Y, Matsui K, Sakuta M, Matsuoka M, Ohashi Y, Kano-Murakami Y, Yamamoto N,

Tanaka Y (1990) Differential regulation of phenylalamine ammonia-lyase genes during

anthocyanin synthesis and by transfer effect in carrot suspension cultures. Physiol Plant 80: 379-387

Pearce G, Strydom D, Johnson S, Ryan CA (1991) A polypeptide from tomato leaves activates

the expression of proteinase inhibitor genes. Science 253: 895-898�

Pearce G, Moura DS, Stratmann J, Ryan CA (2001a) Production of multiple plant hormones

from a single polyprotein precursor. Nature 411: 817-820

Pearce G, Moura DS, Stratmann J, Ryan CA (2001b) RALF, a 5-kDa ubiquitous polypeptide in



plants, arrests root growth and development. Proc Natl Acad Sci USA 98: 12843-12847

Pearce G, Ryan CA (2003) Systemic signaling in tomato plants for defense against herbivores:

Isolation and characterization of three novel defense-signaling glycopeptide hormones coded in a

single precursor gene. J Biol Chem 278: 30044-30050�

Roberts K, McCann MC (2000) Xylogenesis: the birth of a corpus. Curr Opin Plant Biol 3:

517-522

Schopfer CR, Nasrallah ME, Nasrallah JB (1999) The male determinant of self-incompatibility

in Brassica. Science 286: 1697-1700.

Solomonson LP, Vennesland B (1972) Nitrate reductase and chlorate toxicity in Chlorella vulgaris

Beijerinck. Plant Physiol 50: 421-424

Song WY, Wang GL, Chen LL, Kim HS, Pi LY, Holsten T, Gardner J, Wang B, Zhai WX, Zhu

LH, Fauquet C, Ronald P (1995) A receptor kinase-like protein encoded by the rice disease

resistance gene, Xa 21. Science 270: 1804-1806

Stuart R, Street HE (1969) Studies on the growth in culture of plant cells. IV. The initiation of

division in suspensions of stationary-phase cells of Acer Pseudoplatanus L. J Exp Bot 20: 556-571

Sugiyama M, Fukuda H (1995) Zinnia mesophyll culture system to study xylogenesis. In K

Lindsey, eds, Plant Tissue Culture Manual, Supplement 5, Kluwer Academic Publishers, Dordrecht,

pp H2 1-15

Takayama S, Shiba H, Iwano M, Shimosato H, Che FS, Kai N, Watanabe M, Suzuki G, Hinata

K, Isogai A (2000) The pollen determinant of self-incompatibility in Brassica campestris. Proc Natl

Acad Sci USA 97: 1920-1925.

Tsay YF, Schroeder JI, Feldmann KA, Crawford NM (1993) The herbicide sensitivity gene

CHL1 of Arabidopsis encodes a nitrate-inducible nitrate transporter. Cell 72: 705-713

Ullrich TC, Huber R (2001) The complex structures of ATP sulfurylase with thiosulfate, ADP and

chlorate reveal new insights in inhibitory effects and the catalytic cycle. J Mol Biol 313: 1117-1125



Willkinson JQ, Crawford NM (1991) Identification of the Arabidopsis CHL3 gene as the nitrate

reductase structural gene NIA2. Plant Cell 3: 461-471

Yamakawa S, Matsubayashi Y, Sakagami Y, Kamada H, Satoh S (1998) Promotion by a

peptidyl growth factor, phytosulfokine, of chlorophyll formation in etiolated cotyledon of cucumber.

Biosci Biotech Biochem 62: 2441-2443

Yamakawa S, Matsubayashi Y, Sakagami Y, Kamada H, Satoh S (1999) Promotive effects of

the peptidyl plant growth factor, phytosulfokine-alpha, on the growth and chlorophyll content of

Arabidopsis seedlings under high night-time temperature conditions. Biosci Biotech Biochem 63:

2240-2243

Yamamoto R, Demura T, Fukuda H (1997) Brassinosteroids induce entry into the final stage of

tracheary element differentiation in cultured Zinnia cells. Plant Cell Physiol 38: 980-983

Yamamoto R, Fujioka S, Demura T, Takatsuto S, Yoshida S, Fukuda H (2001) Brassinosteroid

levels increase drastically prior to morphogenesis of tracheary elements. Plant Physiol 125: 556-563

Yang H, Matsubayashi Y, Nakamura K, Sakagami Y (1999) Oryza sativa PSK gene encodes a

precursor of phytosulfokine-alpha, a sulfated peptide growth factor found in plants. Proc Natl Acad

Sci USA 96: 13560-13565

Yang H, Matsubayashi Y, Nakamura K, Sakagami Y (2001) Diversity of Arabidopsis genes

encoding precursors for phytosulfokine, a peptide growth factor. Plant Physiol 127: 842-851



Figure legends

Figure 1. Structure and expression of ZePSK1. A, nucleotide and deduced amino acid sequences

of ZePSK1 cDNA. The deduced amino acid sequence with single letter abbreviations are shown

below the nucleotide sequence of ZePSK1. The potential N terminal signal sequence is underlined

and the PSK sequence is underscored with double lines. The Asp residue near PSK sequence is

printed in bold and the dibasic pairs (putative processing sites) are printed in italic. The nucleotide

sequence reported in this paper has been submitted to the DDBJ under accession number AB089283.

B, amino acid sequence comparison of PSK precursors. Single letter abbreviations for amino acid

residues are used. Gaps are shown as dashes (-). Sequence motif is according to Lorbieche and

Sauter (2002). C, D, E, and F, expression pattern of ZePSK1. C, zinnia mesophyll cells were

cultured in D medium or CN medium and collected at every 12 h. Total RNAs were isolated and

subjected to RT-PCR of ZePSK1 and 18S rRNA. D, effect of auxin and cytokinin on the

expression of ZePSK1. Zinnia mesophyll cells were cultured in C0, CB, CN, Cp, and D medium.

Total RNAs were isolated from zinnia cells cultured for 24, 48, and 72 h for RT-PCR analysis of

ZePSK1 and 18S rRNA. E, effect of wounding on the expression of ZePSK1. First true leaves

were cut into small pieces and cultured for 24 h on hormone-free medium. Total RNA was

isolated from leaf pieces cultured for 12 h and 24 h, and subjected to RT-PCR of ZePSK1 and 18S

rRNA. F, effects of uniconazole and brassinolide on the expression of ZePSK1. Isolated

mesophyll cells were cultured for 48 h, 60 h, and 72 h in D medium without uniconazole nor

brassinolide (D) or D medium with 5 µM uniconazole (U) or with 5 µM uniconazole and 10 nM

brassinolide (UB). Total RNA was isolated for the expression analysis of ZePSK1 and 18S rRNA

by RT-PCR.

Figure 2. Inhibition of TE differentiation by chlorate and its reversal by PSK. A, B, and C,

photographs of cells cultured for 96 h in D medium containing 2 mM KCl (A), 2 mM KClO3 and

200 nM unsulfated PSK (B), 2 mM KClO3 and 200 nM PSK (C). Bar = 50 µm. D and E, effects

of chlorate on TE differentiation and cell division. KCl or KClO3 were added at the start of culture

at various concentrations indicated in horizontal axis. F and G, PSK overcame chlorate-induced

inhibition of TE differentiation. 2 mM KClO3 and various concentrations of PSK were added at

the start of culture. Frequencies of TE differentiation (D and F) and cell division (E and G) were

determined at the 96th h of culture. Data represent averages and SD of three replicates.

Figure 3. Inhibition of tyrosine sulfation of PSK by chlorate. PSK was purified from

conditioned medium of cell suspensions cultured for 72 h in D medium (D) or D medium



containing 2 mM KClO3 (KClO3) or 2 mM KClO3 + 200 nM PSK (KClO3 + PSK). Tyrosine

sulfation of PSK was detected by immunoblot assay using an anti-sulfotyrosine monoclonal

antibody, PSG2.

Figure 4. Changes in the responsiveness of cells to PSK and chlorate during xylogenic culture.

A, KClO3 at 2 mM was added to cell suspensions at the start of culture, and then PSK or unsulfated

PSK (OH-PSK) were added at various times thereafter indicated on horizontal axis at the

concentration of 200 nM. Frequencies of TE differentiation were determined at the 96th h of

culture. B, Effect on TE differentiation of PSK added at various times to low-density culture.

Cells were cultured at 5.0 × 103 cells mL-1 and supplied with PSK at a concentration of 100 nM at

various times of culture indicated in this panel. OH-PSK was administrated at a concentration of

100 nM at the start of culture. Frequencies of TE differentiation were determined at various times

indicated on horizontal axis. Data represent averages and SD of three replicates.

Figure 5. Effects of chlorate and PSK on marker gene expression. Total RNA was isolated from

zinnia cells cultured for indicated periods in D medium (D) or D medium containing 2 mM KClO3

(KClO3) or 2 mM KClO3 + 200 nM PSK (KClO3 + PSK). RNA gel blot hybridization was

performed with digoxigenin-labelled antisense probes for ZePR, ZePI1, ZePI2, PAL3, TED3, TED4,

and ZCP4.

Figure 6. Effect of auxin and cytokinin on the suppression of stress response genes. A, Zinnia

mesophyll cells were cultured in 4 different media; hormone-free medium (C0), medium with

cytokinin (CB), medium with auxin (CN), or medium with cytokinin and auxin (D), in the absence or

presence (+ PSK) of 200 nM PSK. Total RNA was isolated from cells cultured for 24 h. RNA

gel blot hybridization was performed with digoxigenin-labelled antisense probes for ZePR, ZePI1,

ZePI2, and ZePAL3. B, effect of PSK on TE differentiation in the presence of auxin and cytokinin.

Cells were cultured in D medium in the absence (D) or presence (D + PSK) of 200 nM PSK.

Frequencies of TE differentiation were determined at the 60th h of culture. Data represent

averages and SD of three replicates (P-value <0.01 in the Student’s t-test).

Figure 7. Summary of microarray analysis. A and B, expression pattern of genes downregulated

(A) or upregulated (B) by PSK. Fleshly isolated mesophyll cells were cultured for 24 h in D

medium without PSK nor KClO3 (Mock), with 200 nM PSK (PSK), with 2 mM KClO3 (KClO3), or

with 200 nM PSK and 2 mM KClO3 (PSK + KClO3). Poly (A)+ RNA was prepared from 0 h cells

and cells cultured in Mock, PSK, KClO3, and PSK + KClO3 for microarray analysis. C and D,



clustering of genes downregulated (C) or upregulated (D) by PSK according to the classification

described in E. E, schematic expression patterns of six different groups of genes during TE

differentiation described in Demura et al. (2002).

Figure S1. Effects of KNO3 on TE differentiation, cell division, and viability in the presence of

KCl, KClO3, and PSK. 2 mM KCl (indicated as KCl), 2 mM KClO3 (KClO3), or 2 mM KClO3

and 200 nM PSK (KClO3 + PSK) was added at the start of culture to the medium containing various

concentrations of KNO3. The frequencies of TE differentiation, the frequencies of cell division,

and viability were determined at the 96th h of culture. Data represent averages and SD of three

replicates.

Figure S2. Changes in the responsiveness of cells to KClO3 during xylogenic culture. KClO3 at

2 mM was added to cell suspensions at various times of culture. Frequencies of TE differentiation

were determined at the 96th h of culture. Data represent averages and SD of three replicates.



ABD

E

UnclassifiedB

E

A

CD

UnclassifiedC D

�

�

�

�

�

�

�

�

� � � � �

��

��

��

��

��

��

��

��

��

��

��

� � � � �

A B

E

0

2

4

6

8

0

2

10

4

6

8

Nor

mal

ized

inte

nsity

Nor

mal

ized

inte

nsity

Nor

mal

ized

inte

nsity

0 24 48 72 96

A

B

C

D

E



running head: roles of psk in te differentiation corresponding

Documents