running head: biosynthesis of tomato fruit triterpenoids
TRANSCRIPT
1
Running head: Biosynthesis of tomato fruit triterpenoids
Corresponding Author: Reinhard Jetter
Department of Botany
University of British Columbia
6270 University Boulevard
Vancouver, BC V6T 1Z4
Canada
Phone: (604) 822-2477
Fax: (604) 822-6089
Email: [email protected]
RESEARCH AREA/MONITORING EDITOR:
Biochemical Processes and Macromolecular Structures/Joe Chappell
Plant Physiology Preview. Published on November 8, 2010, as DOI:10.1104/pp.110.162883
Copyright 2010 by the American Society of Plant Biologists
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
2
Two Oxidosqualene Cyclases Responsible for Biosynthesis of Tomato (Solanum
lycopersicum) Fruit Cuticular Triterpenoids 1
Zhonghua Wang, Ortwin Guhling, Ruonan Yao, Fengling Li, Trevor H. Yeats, Jocelyn K.C.
Rose and Reinhard Jetter*
Department of Botany, University of British Columbia, 6270 University Boulevard, Vancouver,
BC, V6T 1Z4, Canada (Z.W., O.G., R.Y., F.L., R.J.);
Department of Chemistry, University of British Columbia, 2036 Main Mall, Vancouver, BC,
Canada, V6T 1Z1, Canada (R.J.)
Department of Plant Biology, 412 Mann Library Building, Cornell University, Ithaca, NY
14853, U.S.A.,
(T.H.Y., J.K.C.R.).
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
3
Keywords
Amyrin, cuticular wax, fruit surface, pentacyclic triterpenoids, enzymatic cyclization
Footnotes:
1This work was supported by a grant from the Natural Sciences and Engineering Research
Council of Canada
*Corresponding author: Reinhard Jetter
Fax: (604) 822-6089
Email: [email protected]
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
4
ABSTRACT
The first committed step in triterpenoid biosynthesis is the cyclization of epoxysqualene into
various triterpene alcohol isomers, a reaction catalyzed by oxidosqualene cyclases (OSCs). The
different OSCs have characteristic product specificities, which are mainly due to differences in
the numbers of high-energy intermediates the enzymes can stabilize. The goal of the present
investigation was to clone and characterize OSCs from tomato (Solanum lycopersicum), a
species known to accumulate -amyrin in its fruit cuticular wax, in order to gain insights into the
enzymatic formation of this particular triterpenoid. We used a homology-based approach to
isolate two tomato OSCs, and tested their biochemical properties by heterologous expression in
yeast, as well as overexpression in tomato. One of the enzymes was found to be a product-
specific -amyrin synthase, while the other one was a multifunctional OSC synthesizing 48% -
amyrin and six other products. The product spectra of both OSCs together account for both the
range and the relative amounts of the triterpenoids found in the fruit cuticle. Both enzymes were
expressed exclusively in the epidermis of the tomato fruit, indicating that their major function is
to form the cuticular triterpenoids. The relative expression levels of both OSC genes, determined
by quantitative RT PCR, were consistent with product profiles in fruit and leaves of the tomato
cultivar MicroTom. However, the transcript ratios were only partially consistent with the
differences in amounts of product triterpenoids between the tomato cultivars MicroTom, M82
and Ailsa Craig and, thus, transcriptional control of the two OSCs alone cannot explain the fruit
triterpenoid profiles of the cultivars.
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
5
INTRODUCTION
Triterpenoids are a very diverse group of natural products with wide distribution and
particularly high chemical diversity in plants. They include compounds such as betulinic acid,
the avenacins and glycyrrhizin, which have important biological functions and medicinal
properties (Reichardt et al., 1984; Papadopoulou et al., 1999; Hayashi et al., 2001). The
biosynthetic pathway towards triterpenoids proceeds by joining six isoprene units together to
form the branched long-chain hydrocarbon squalene (Eschenmoser et al., 1955). In prokaryotes,
squalene is directly cyclized into hopanoid triterpenes, whereas in eukaryotes it is first activated
into 2,3-epoxysqualene and then cyclized (Abe, 2007). The cyclizations are highly regio- and
stereospecific, establishing the final carbon structure of the triterpenoid products.
The overall cyclization reaction comprises 1) an initial protonation step, 2) a polyene
addition cascade forming the up to five carbon cycles, 3) a series of 1,2-shifts of hydride and/or
methyl groups, and 3) a final deprotonation (Fig. 1) (Xu et al., 2004; Phillips et al., 2006). The
entire sequence of steps is catalyzed by single enzymes that are designated as triterpenoid
synthases after their preferred products, or as oxidosqualene cyclases (OSCs) after their common
substrate (Abe et al., 1993). The great diversity of triterpenoid structures, with more than 100
different carbon skeletons, is due to different OSCs and, in particular, to the numbers of
rearrangement steps the different enzymes can catalyze in the third stage of the reaction (Xu et
al., 2004). Approximately 50 OSCs have been cloned from various plant species and have been
characterized, typically using heterologous expression in yeast. Many of the plant OSCs were
found to form predominantly one triterpenoid product, but some were also reported to be
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
6
multifunctional (Morita et al., 2000; Kushiro et al., 2000; Basyuni et al., 2006). For a few plant
species, more than one OSC has been characterized, so that the suite of OSCs accounted for at
least part of the triterpenoid profile in those species (Morita et al., 1997; Morita et al., 2000;
Hayashi et al., 2000; Hayashi et al., 2001; Iturbe-Ormaetxe et al., 2006; Sawai et al., 2006a;
Sawai et al., 2006b). It is generally assumed that the OSC product specificities determined in
vivo in yeast would accurately reflect the true enzyme activities, however, in planta data to
corroborate the specificities have only rarely been reported (Han et al., 2006), and in vitro results
are missing probably due to problems with handling the lipopilic substrate and the membrane-
associatied enzymes.
A glimpse of the biochemical diversity within OSCs can be seen in the case of
Arabidopsis, where the genome was found to contain 13 OSC genes (Fazio et al., 2004). Six of
the corresponding gene products were characterized as monofunctional enzymes forming
cycloartenol, thalianol, marneral, arabidiol, lanosterol or β-amyrin (Corey et al., 1993; Fazio et
al., 2004; Xiong et al., 2006; Xiang et al., 2006; Suzuki et al., 2006; Shibuya et al., 2009). Six
other Arabidopsis OSC genes were found to encode multifunctional enzymes (Herrera et al.,
1998; Segura et al., 2000; Kushiro et al., 2000; Husselstein-Muller et al., 2001; Ebizuka et al.,
2003; Shibuya et al., 2007; Lodeiro et al., 2007; Kolesnikova et al., 2010), while the function of
one gene remains unknown. Even though the previous studies provide substantial information
about the sequence variability and biochemical specificity within this large gene family, the
information on the cyclization mechanism is still fairly limited. This is mainly due to the fact that
the large majority of OSCs characterized to date form lupeol and -amyrin, the two triterpenoids
most commonly found throughout the plant kingdom. Only rarely have OSCs forming other
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
7
pentacyclic triterpenoid products been described. That such OSCs with diverse product profiles
exist can be seen from a recent report, in which three Kalanchoe daigremontiana OSCs were
shown to synthesize taraxerol, glutinol and friedelin, i.e. products with carbon skeletons
requiring relatively many rearrangements in the course of the OSC reaction (Wang et al., 2010).
For some of the known triterpenoid products, including -amyrin, no OSC activities have been
described to date. However, information on a broad range of OSCs from various plant species,
and with varying product specificities, would help us understand how the different enzymes can
catalyze specific numbers of rearrangement steps, stabilize the high-energy intermediates
involved, and quench the reaction by deprotonation of a particular carbocation to form specific
end products.
A number of studies have reported that -amyrin accumulates to relatively high
concentrations in the lipid mixture coating the surface of tomato fruit (Vogg et al., 2004; Bauer
et al., 2004b; Saladie et al., 2007; Hovav et al., 2007; Isaacson et al., 2009). Besides, ten other
triterpenoids have also been identified in the fruit cuticular waxes extracted from the surfaces of
various tomato cultivars that have been studied in much detail in recent years (Baker et al., 1982;
Smith et al., 1996; Vogg et al., 2004; Bauer et al., 2004a; Bauer et al., 2004b; Saladie et al.,
2007; Leide et al., 2007; Hovav et al., 2007; Mintz-Oron et al., 2008; Isaacson et al., 2009;
Adato et al., 2009; Kosma et al., 2010). In particular, the surface wax on mature fruit of the
tomato variety MicroTom contains approximately 25% of triterpenoids, and 36% of this fraction
is -amyrin (Vogg et al., 2004). The relative portions of the triterpenoid fraction within the
waxes decreases in the course of fruit development, while the relative amounts of very long
chain aliphatics derived from fatty acid metabolism increases, most importantly unbranched and
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
8
methyl-branched alkanes (Leide et al., 2007; Mintz-Oron et al., 2008). Thus, the chemical data
indicate that triterpenoids are formed during early fruit expansion rather than ripening, and so
expression of OSC genes should peak relatively early. Various studies have further shown that
fruit waxes from different tomato cultivars differ in the relative portions of triterpenoids,
especially of -amyrin, with ratios of 3:3:2 between -amyrin, -amyrin and -amyrin in
MicroTom, and ratios of 3:2:2 in most other cultivars including M82 and Ailsa Craig (Vogg et
al., 2004; Mintz-Oron et al., 2008; Isaacson et al., 2009). This suggests that more than one OSC
should be involved in formation of the different triterpenoids, and that the varying product ratios
should reflect different expression levels and/or enzyme activities in the different cultivars.
However, it has not been determined how many OSCs are involved in forming the tomato fruit
cuticular triterpenoids, and which of those OSCs are product-specific or multifunctional
enzymes.
Based on all the previous evidence, the goal of the present investigation was to clone and
characterize multiple OSCs from tomato fruit. In particular, one or more enzymes forming -
amyrin were targeted. The primary focus of the investigations was on the cultivar MicroTom;
however, other cultivars such as M82 and Ailsa Craig were also included in order to compare
OSC sequences and expression patterns. With this, we sought to answer the question which
OSCs are responsible for the formation of the triterpenoids accumulating in the tomato fruit
cuticle and, thus, contribute to the important ecophysiological functions of the fruit epidermis.
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
9
RESULTS
The goal of the present investigation was to isolate and characterize OSCs from tomato
fruit, and to test their involvement in the formation of cuticular triterpenoids accumulating in the
fruit skin. To this end, a set of four experiments was carried out centered on the tomato cultivar
MicroTom: First, a homology-based PCR approach was used to clone the enzyme(s), initially
targeting a core segment of the sequence and then extending it by RACE experiments at the 5’
and 3’ termini. Second, the biochemical characterization of the enzyme(s) was carried out by
heterologous expression in yeast and by overexpression in tomato. Third, the expression of OSC
enzyme(s) in the epidermis and/or in inner parts of the fruit was evaluated. Finally, qRT-PCR
was used to determine the relative expression levels of the OSCs, both in the leaves and fruit of
MicroTom. The expression studies were extended to the tomato cultivars M82 and Ailsa Craig,
and complemented by chemical analyses of the triterpenoids in the M82 and MictroTom
cuticular waxes.
Cloning and Sequence Analysis of Oxidosqualene Cyclases from Tomato
In order to obtain a core sequence, a PCR was performed with a set of degenerate primers
designed using conserved OSC amino acid sequences and cDNAs isolated from the epidermis of
growing fruit. The primary PCR product corresponded to the expected size of approximately
1000 bp. A second PCR was used to extend the fragment, the product was isolated and cloned
into E. coli, and sequencing inserts from five bacterial colonies revealed the presence of only two
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
10
different cDNAs. Both had substantial similarity with other OSC sequences, and were subjected
to 5’ and 3’ RACE resulting in two full-length cDNAs that were designated as SlTTS1 and
SlTTS2.
The open reading frames (ORFs) of SlTTS1 and SlTTS2 are predicted to encode proteins
of 761 and 763 amino acids with molecular weights of 89.7 kDa and 88.1 kDa, respectively
(Figure 2). The two protein sequences are 88% identical, and both contain the DCTAE motif
thought to be involved in substrate binding and the four QW motifs characteristic of the OSC
superfamily. Furthermore, SlTTS1 and SlTTS2 are highly similar to previously reported -
amyrin synthases and multifunctional triterpene synthases (Table I). Phylogenetic analysis using
neighbour-joining methods showed that SlTTS1 and SlTTS2 are more closely related to each
other than to any other OSC and that they, together with the Panax ginseng -amyrin synthases
(Kushiro et al., 1998a; Kushiro et al., 1998b), form a subclade within a group of OSC enzymes
that were all characterized as -amyrin synthases from various plant species (Figure 3).
In order to analyze the gene structure of SlTTS1 and SlTTS2, the tomato genome
sequence database (www.solgenomics.net) was queried using the two corresponding cDNA
sequences. One BAC clone, Hba0131G17, was found to contain both OSC genes and,
accordingly, SlTTS1 and SlTTS2 are arranged in tandem in a 23 kb region on chromosome 12.
The intron patterns and exon lengths of the two SlTTS genes are very similar to those of other
OSCs (Figure 4), with SlTTS2 gene organization most closely resembling OSC3 of Lotus
japonica (Sawai et al., 2006b). However, SlTTS2 differs from L. japonica OSC3 in the length of
the first and last exons. The two tomato genes differ from each other in that exons 16 and 17 in
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
11
SlTTS2 are fused into a single exon 16 SlTTS1, which indeed distinguishes SlTTS1 from all other
OSC genes studied to date.
Biochemical Characterization of the Tomato SlTTS Proteins
In order to biochemically characterize SlTTS1 and SlTTS2, two sets of experiments
using heterologous expression in yeast and overexpression in tomato fruit were carried out. For
yeast expression, the full-length cDNAs of the two putative OSCs were cloned into the
expression vector pYES2, and this construct was transformed into the yeast mutant GIL77 (gal2
hem3-6 erg7 ura3-167). This host strain lacks lanosterol synthase and so accumulates 2,3-
oxidosqualene, which can serve as a substrate for heterologously expressed OSCs (Morita et al.,
1997). Yeast transformants harbouring one of the pYES-TTS constructs or the empty pYES
vector were grown, gene expression was induced with galactose for 24 h, and then lipophilic
compounds were extracted with hexane. After purification by TLC, the triterpenoids were
identified by comparing their GC-MS characteristics with those of authentic standards and
literature data (Figures 5 and 6).
Yeast cells expressing SlTTS1 cDNA were found to produce a single triterpenoid product
that was identified as -amyrin (Figure 7). In contrast, heterologous expression of SlTTS2 led to
the formation of a mixture of triterpenoids, comprising 48 ± 0.3% of -amyrin, 13 ± 0.1% of -
amyrin, 18 ± 0.8% of -amyrin and 3 - 7% each of multiflorenol, -taraxasterol, taraxasterol
and one unidentified triterpene alcohol isomer. The yeast expression experiments were repeated
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
12
three times, always with very similar results. Overall, they indicate that SlTTS1 is a
monofunctional -amyrin synthase, while SlTTS2 is a multifunctional OSC enzyme catalyzing
the formation of seven different triterpenoid isomers.
In a second experiment, the potential OSC activities of the two tomato SlTTS proteins
were further assessed by overexpression in tomato and chemical analysis of the resulting fruit
surface waxes. Both SlTTS cDNAs were cloned into the pGWB5 vector, transformed into tomato
cv. MicroTom, and expressed under transcriptional control of the 35S promoter. Two sets of
twenty independent lines constitutively expressing SlTTS1 or SlTTS2 were recovered, and the
surface materials from fruit from the F1 generation were extracted for wax analysis. The SlTTS1
overexpressor lines were found to have amounts of -amyrin and -amyrin similar to those on
wildtype tomato fruit surfaces (Figure 8). In contrast, the amounts of -amyrin were doubled
from 0.7 g/cm2 in wild type to 1.4 g/cm
2 in SlTTS1 overexpressors. All the non-amyrin
triterpenoids remained unchanged after SlTTS1 overexpression (data not shown).
The transgenic lines harboring the SlTTS2 overexpression construct showed highly
variable triterpenoid amounts in their fruit cuticular waxes, while the very long chain fatty acid
derivatives were present at constant levels identical to those in the wild type. The transgenic fruit
could be classified into three distinct categories with significantly different triterpenoid profiles
(Student’s t-test, p<0.01). One of them, found for four of the lines, had triterpenoid amounts very
similar to wildtype levels. Three of the lines showed a gain of function phenotype, characterized
by significant increases of all seven fruit wax triterpenoids. Notably, the amounts of -, - and -
amyrin were all approximately doubled while the ratios between them were unchanged in
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
13
comparison with wild type (Figure 8). The remaining four lines recovered in the course of the
SlTTS2 overexpression experiment had fruit surface waxes containing increased levels of -
amyrin and drastically reduced levels of -amyrin and -amyrin when compared with wild type
(Figure 8). Similarly, the quantities of the non-amyrin triterpenoids were also decreased, in these
cases to trace levels that were detectable only by single ion monitoring GC-MS (data not shown).
Investigation of SlTTS Expression Patterns in Tomato Fruit
RT-PCR analyses were employed to test the tissue specificity of OSC transcription within
the green tomato fruit. To this end, two pairs of primers were designed based on the SlTTS1 and
SlTTS2 sequences, and proved to be gene-specific when tested with plasmid templates
harbouring either of the two OSCs cDNAs (data not shown). To determine whether the SlTTS
genes were expressed differentially between inner parts of the tomato fruit and the epidermis
layer, total RNA was isolated from both tissues. RT-PCR analysis using subsequently derived
cDNA templates showed that both SlTTS transcripts are expressed in the epidermal cells, but not
in the inner tissues of the fruit (Figure 9). Parallel metabolite analyses revealed that the major
part of the triterpenoids in the tomato fruit reside in the cuticle, with 74%, 79% and 74% of the
total -amyrin, -amyrin and -amyrin aglycone amounts present in the surface wax,
respectively, and the remaining 21 – 26% in the underlying epidermal cell layer and the internal
tissues of fruit.
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
14
Relative Expression Levels of SlTTS1 and SlTTS2 in Fruit and Leaves of Different Tomato
Cultivars
Finally, quantitative RT-PCR analyses were carried out to determine the relative
expression level of SlTTS1 and SlTTS2 within leaves and fruit. Since the ratios of different
triterpenoid products vary not only between these two organs, but also between fruit of different
tomato cultivars (Vogg et al., 2004; Mintz-Oron et al., 2008; Isaacson et al., 2009), this
experiment was to also compare expression patterns of both SlTTS genes between MicroTom and
the cultivars M82 and Ailsa Craig. The same primers originally designed for the cloning of the
full-length sequence from MicroTom were used to amplify corresponding cDNAs from M82 and
Ailsa Craig. One allele each of SlTTS1 and SlTTS2 was cloned and sequenced from both
cultivars, and the ORFs of the orthologous genes were found to be very similar or identical
between M82 and Ailsa Craig (Suppl. Figure 1). However, both SlTTS1 and SlTTS2 differed
between these cultivars and MicroTom, with up to eight nucleotide differences between cultivars
resulting in up to four amino acid changes, and >99.6% DNA and >99.4% protein sequence
identity (Table I). The similarities between both genes were approximately 89% on the
nucleotide level across cultivars, and 87 - 88% on the amino acid level.
The expression levels of SlTTS1 and SlTTS2 were found to be similar to each other in the
leaves and fruit of the cultivar MicroTom (Figure 10). Both genes were also expressed at similar
levels to each other in leaves of M82, whereas in the fruit of this cultivar SlTTS2 was expressed
at a much higher level than SlTTS1. The cultivar Ailsa Craig differed further, with higher
expression levels of SlTTS2 in fruit and leaves.
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
15
Terpenoid Profiles in Fruit and Leaves of Different Tomato Cultivars
The terpenoid profiles of the cuticular wax mixtures of leaves and fruits from the
MicroTom, M82 and Ailsa Craig cultivars were assessed, with particular focus on the relative
compositions of amyrin isomers. The compositions of fruit waxes from the three cultivars (Vogg
et al., 2004; Mintz-Oron et al., 2008; Isaacson et al., 2009) and also the leaf wax composition of
MicroTom had been reported before (Vogg et al., 2004). However, exact data on the leaf
triterpenoid profiles of all three cultivars were missing. Therefore, a detailed study of the leaf
wax from M82 and MicroTom was carried out. It was found that the M82 leaf was covered by
4.8 ± 0.5 g/cm2 of cuticular wax, and that the wax mixture contained 3.0 ± 1.0% of
triterpenoids, 64.3% ± 12.5% of very long chain fatty acid derivatives and 32.7 ± 13.5% of
unidentified compounds (Figure 11). n-Alkanes (C27 to C33) were the dominating compound
class with 45.6% ± 8.9%, accompanied by 16.6% ± 3.1% of branched alkanes (C29 – C33) and
20.5% ± 7.4% of alcohols (C28 and C32). The triterpenoid fraction was dominated by amyrin
isomers, comprising 29%, 33.4% and 14.4% of -amyrin, -amyrin and -amyrin, respectively.
Other triterpenoid alcohols were detected in the form of lupeol (23.3%) and trace amounts of
multiflorenol, -taraxasterol and taraxasterol. MicroTom leaf wax had a similar composition,
with a conspicuous ratio of 2:3:1 between of -amyrin, -amyrin and -amyrin, respectively.
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
16
DISCUSSION
In the present study, a homology-based approach was used to clone two tomato OSCs,
SlTTS1 and SlTTS2, which were found to encode highly similar amino acid sequences. Our
principal goal was to characterize the product spectrum of the enzymes, with the expectation that
a -amyrin synthase might be uncovered. Furthermore, we aimed to elucidate the role of the
enzymes in the formation of the triterpenoids accumulating in the fruit cuticular wax.
A phylogenetic analysis showed that SlTTS1 and SlTTS2 fall into a clade consisting
entirely of -amyrin synthases. Thus, the primary sequence of the new OSCs is in accordance
with the prediction that the tomato enzymes catalyze the formation of amyrins. However, based
on genetic information alone, it was not possible to predict the product specificities of the tomato
enzymes. It should also be noted that, in contrast to the similarity of exon sequences with amyrin
synthases, the intron pattern of SlTTS2 was identical to that of OSC3 from Lotus japonica, a
lupeol synthase that had fairly dissimilar sequence (Sawai et al., 2006b).
The product profiles of SlTTS1 and SlTTS2 were determined by heterologous expression
in yeast. It was found that SlTTS1 forms -amyrin as its sole product, while SlTTS2 catalyzes
the formation of seven different triterpenoids, with -amyrin as the major product. The in planta
overexpression of SlTTS1 and SlTTS2 led to increased accumulation of cuticular triterpenoids, in
both cases of the same products that had also been found in yeast. This finding is very important,
since most previous reports on biochemical characterizations of OSCs had relied entirely on
yeast expression systems, and it had only rarely been tested whether the heterologous
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
17
environment might alter the enzyme specificity (Han et al., 2006). The match between yeast and
in planta expression results in the present study confirms the validity of the yeast expression
system, at least for the two tomato OSCs studied. Overall, we conclude that the two enzymes are
a single product -amyrin synthase and a multifunctional OSC, respectively. SlTTS2 is the first
enzyme reported to synthesize predominantly -amyrin.
Interestingly, some of the tomato lines harboring the SlTTS2 construct exhibited a wax
triterpenoid phenotype opposite to that of the SlTTS2 overexpressors, suggesting that in these
lines the native gene was down-regulated by co-suppression. The observed increase in -amyrin
may be the result of additional 2,3-oxidosqualene substrate availability for TTS1 upon silencing
of SlTTS2. The SlTTS2 loss-of-function lines thus not only confirm the biochemical function of
the enzyme, but they also indicate that this enzyme must play a central role in the formation of
the tomato fruit wax triterpenoids. We conclude that SlTTS2 is crucial for the biosynthesis of six
of the seven triterpenoid isomers found in the wax, and partially also contributes to the formation
of the seventh component, -amyrin. Another part of the latter compound is formed by the
closely related enzyme SlTTS1. Both enzyme product profiles taken together completely match
the wax triterpenoid composition and, therefore, SlTTS1 and SlTTS2 are likely the two major
enzymes forming the triterpenoids found in the tomato fruit cuticular wax. The involvement of
additional OSCs cannot be excluded at this point, but it seems unlikely that any OSC other than
SlTTS1 and SlTTS2 would contribute substantially to the triterpenoid amounts or spectrum.
Two apparently orthologous OSCs were identified from each of the tomato cultivars M82
and Ailsa Craig, with a high degree of sequence identity to those from MicroTom. The
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
18
differences between the two genes within one cultivar were much greater than the differences
between the alleles in the cultivars. As differences between orthologous proteins were restricted
to changes in three or four amino acids, it is very likely that both SlTTS1 and SlTTS2 were
functional enzymes in all three cultivars, and that their biochemical functions should be very
similar in MicroTom, M82 and Ailsa Craig. We conclude that all three cultivars have at least one
-amyrin synthase (SlTTS1) and one multifunctional OSC producing -amyrin and other
isomers (SlTTS2).
The relative expression levels of the SlTTS1 and SlTTS2 genes varied between fruit of the
three tomato cultivars investigated, with transcripts of both genes showing similar abundance in
MicroTom, but SlTTS2 accumulating to higher levels than SlTTS1 in M82 and Ailsa Craig. This
expression pattern is in accordance with the amyrin profiles in the corresponding fruit waxes,
where the latter two cultivars had lower levels of the SlTTS1 product -amyrin than MicroTom
(Vogg et al., 2004; Mintz-Oron et al., 2008; Isaacson et al., 2009). However, it should be noted
that the differences in triterpenoid profiles between cultivars may further be due to factors other
than differential gene expression, possibly including differences in enzyme activities and/or
additional OSCs being present.
Our qRT-PCR results showed that the SlTTS1 and SlTTS2 genes are expressed not only in
tomato fruit, but also in the leaves of MicroTom, M82 and Ailsa Craig. Therefore, it seems likely
that both genes also contribute to the formation of leaf cuticular triterpenoids. However, it must
be noted that the leaf waxes have triterpenoid profiles differing from those in the fruit in
quantitative and in qualitative terms, as shown by our detailed analyses of M82 leaf wax in
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
19
comparison with literature data. The most prominent quantitative difference is the shift in amyrin
ratios from 3:2:2 for -amyrin, -amyrin and -amyrin in the fruit to 2:2:1 in the leaf wax. This
trend correlates with the differences in expression levels of SlTTS1 and SlTTS2 between both
organs of M82, and can thus, at least in part, be explained by transcriptional control. It should be
noted that Ailsa Craig leaves showed a very conspicuous expression pattern with particularly low
levels of SlTTS2 transcript. Based on this finding, it may be expected that the leaf waxes of this
cultivar should contain relatively little -amyrin, however, the amyrin profiles of the leaf wax of
Ailsa Craig have not been determined to date.
One outstanding qualitative difference between the triterpenoid compositions of fruit and
leaves, at least of the cultivars MicroTom and M82, is the presence of lupeol in the latter organ, a
product that is not formed by either SlTTS1 or SlTTS2. Therefore, one or more other OSCs must
be involved in formation of leaf cuticular triterpenoids. More detailed investigations are needed
to determine the contribution of SlTTS1 and SlTTS2 to the biosynthesis of tomato leaf cuticles.
Our results on the tissue-specific expression of SlTTS1 and SlTTS2 showed that these
enzymes are localized exclusively in the epidermis of tomato fruit. We further found that the
triterpenoid products are also restricted to the fruit skin, as they accumulate to high
concentrations in the cuticular waxes coating the epidermis, but not in the internal parts of the
fruit. The close match in localization of transcripts and metabolites makes it very likely that
SlTTS1 and SlTTS2 are dedicated entirely to making the triterpenoids destined for the cuticular
wax of the fruit surface. With this, a major biological function can be assigned to these two
OSCs, as the cuticular triterpenoids contribute significantly to the chemical composition and to
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
20
the ecophysiological properties of the fruit cuticle (Vogg et al., 2004; Isaacson et al., 2009). It
should be noted that similar biological functions had previously been attributed to a few other
OSCs, for example a glutinol synthase and a friedelin synthase from Kalanchoe daigremontiana
(Wang et al., 2010).
The sequences of SlTTS1 and SlTTS2 are relatively similar to each other, containing
only 92 amino acid changes. On the other hand, the two enzymes were found to have fairly
distinct product profiles, with SlTTS1 yielding exclusively -amyrin whereas SlTTS2 is
catalyzing the formation of -amyrin (among other products). It has been predicted that the
formation of -amyrin requires only one rearrangement step less than -amyrin in the course of
the OSC-catalyzed cyclization (Fig. 1) (Xu et al., 2004; Phillips et al., 2006). This relatively
subtle difference in the mechanism of formation of both triterpenoids must be due to small
differences in protein architecture, possibly involving specific changes in amino acids lining the
active site cavity. The sequence differences between SlTTS1 and SlTTS2 give first information
on the candidate residues that may be involved in determining the amyrin isomer specificity.
The list of candidate residues for defining -amyrin synthases can be somewhat narrowed
down based on comparisons between the two OSCs characterized here in three different tomato
cultivars, and with -amyrin synthases from other species. A second observation might further
help select candidate residues: many of the amino acid changes between both enzymes are
clustered together, and many involve aromatic residues. Since it is well established that such
aromatic amino acids play important roles in stabilizing the positive charge of high-energy
intermediates of the cyclization reaction, it has been speculated that the number and exact
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
21
position of aromatic residues lining the active site might limit the number of rearrangement steps
and, therefore, determine the product outcome of OSC-catalyzed reactions (Phillips et al., 2006;
Christianson, 2006). Consequently, the changes between SlTTS1 and SlTTS2 involving aromatic
amino acids at positions 48/49, 103, 318, 388, 399, 412, 421, 478, 496, 560, 675, 742 and 760
make these residues especially interesting candidates for defining the OSC specificity of -
amyrin and -amyrin synthases. It appears very promising to use site-directed mutagenesis
experiments to test this hypothesis, in order to further our detailed understanding of the enzyme
mechanisms involved in triterpenoid biosynthesis.
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
22
MATERIALS AND METHODS
Plant Material and Surface Wax Analysis
Tomato (Solanum lycopersicum cv. MicroTom) plants were grown in standard soil under
ambient conditions in a greenhouse at the University of British Columbia. Fruits and leaves were
harvested and immediately immersed in CHCl3 for 1 min at room temperature to extract the
cuticular waxes. For direct GC-MS analyses, the wax mixtures were derivatized using bis-N,O-
(trimethylsilyl)trifluoroacetamide (BSTFA) (in pyridine at 70 °C for 60 min), dried under N2 and
dissolved in CHCl3. The qualitative composition was studied using a 6890N Network GC
(Agilent) equipped with a mass spectrometric detector (Agilent 5973N) and an HP-1 capillary
column (Agilent, length 30 m, inner diameter 320 µm, 1 µm film thickness). 1 µl of each sample
was injected on-column into a flow of helium gas held constant at 1.4 ml/min. The oven
temperature was programmed for 2 min at 50 ˚C, followed by a 40 ˚C/min ramp to 200 ˚C, held
at 200 ˚C for 2 min, increased by 3 ˚C/min to 320 ˚C, and held at 320 ˚C for 30 min.
Triterpenoids were identified by comparison with authentic compounds (-amyrin, -amyrin, -
amyrin, lupeol) and with literature data. The quantitative composition was studied using a similar
GC system equipped with flame ionization detector (FID) under the same GC conditions as
above, but H2 carrier gas inlet pressure programmed for 2 ml/min. A known amount of n-
tetracosane was added to the solvent prior to extraction, and used as internal standard for
quantifying compound amounts. The extracted surface areas of leaves were determined using
digital images and ImageJ software.
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
23
For analysis of triterpenoids contained in internal tissues, fruit were surface-extracted
with CHCl3 to remove cuticular waxes, frozen in liquid nitrogen and then ground to powder. The
powder was extracted with CHCl3 and the resulting lipid mixture fractionated by TLC
(20 × 20 cm, silica gel, 0.5 mm; Merck) using CHCl3 as the mobile phase. After the plate was
stained with primuline and viewed under UV-light, distinct bands were scratched off, extracted
with CHCl3 and analyzed by GC-MS and GC-FID for identification and quantification of the
triterpenoids, respectively. GC conditions were used as described above for wax analyses.
Cloning of OSC Genes from Tomato
Green tomato fruits were harvested and immediately plunged into liquid nitrogen and
ground thoroughly with a mortar and pestle. Total RNA was extracted from the powder using the
Trizol Reagent (Invitrogen). The RNA was used for cDNA synthesis by SuperScript II Reverse
Transcriptase (Invitrogen) following standard protocols. The resulting cDNA mixture served
directly as a template for the following PCRs.
Sequence alignments of previously characterized plant OSCs revealed conserved regions,
which were used to design degenerate oligonucleotide primers for the specific amplification of
the core fragments of OSCs from the cDNA mixture. The antisense primer AMYT was derived
from the EST clone TC160438 (TIGR tomato EST database) suspected to encode part of an OSC
sequence. To obtain the triterpenoid synthase core sequence, a PCR was performed with the
degenerate sense primer OGA1S (5’TTYGGHAGYCAARMRTGGGAT3’) combined with
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
24
antisense primer AMYT (5’CGGTATTCAGCCAAACCCCA3’), with recombinant Taq DNA
Polymerase (Invitrogen) under the following cycling conditions: 2 min 94 °C, (20 s 94 °C, 40 s
54 °C, 70 s 72 °C) × 30 cycles, 10 min final extension at 72 °C. The resulting PCR products
were separated by gel electrophoresis (1% agarose) and extracted using the QIAquick Gel
Extraction Kit (Qiagen). A DNA band of 1 kb was recovered and cloned into the pGEM-T vector
(Promega, Madison, WI, USA) and transformed into Top10 competent cells. Plasmid DNA was
purified from transformed cells using QIAprep Spin Miniprep Kit (Qiagen) and sequenced. All
further PCR products mentioned below were subcloned and sequenced by the same procedure.
The core fragment was extended in a second PCR (conditions as above) using the primers
OGT4S (5’CAYCAGAAYGAAGATGGW3’) and gene-specific primer OGAS1A
(5’CATCATTCATCTCACTGGC3’) synthesized according to the obtained core sequences. Two
different core sequences were obtained, one named SlTTS1 and found to be identical to the
database sequence TC160438, and another one named SlTTS2. For 3’-end amplification of the
SlTTS2 cDNA, first strand synthesis was carried out for 1 h at 42 °C using 5 μg total RNA, AP-
primer (5’ GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT 3’), and reverse
transcriptase in 20 μl. The product served as template in a PCR (conditions as above except
annealing temperature 55 °C) with the adapter primer AUAP
(5’GGCCACGCGTCGACTAGTAC 3’) and the specific primer LEASB1S
(5’AGGGTTGTGGTAGTCAATC3’). The 5’-ends of both cDNAs were amplified by the 5’
RACE system of Invitrogen (Version 2.0) with two nested gene-specific anti-sense primers
OGAS6A (5’AGAATCCATTTCCTTGCTCTA3’) and OGAS7A
(5’CACGCATTATTTACACCGCC3’).
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
25
The corresponding full-length cDNAs were amplified using tomato cDNA as a template
and the specific N- and C-terminal primers, respectively:
LeTTS1F: 5’TTGGAGCTCAGGATGTGGAAATTGAAAATTGCTG3’, SacI site underlined
LeTTS1R:5’CCCGAATTCTTAGTTGTTTTCTAATGGTAATAC3’, EcoRI site underlined
LeTTS2F: 5’TTGGAGCTCAAGATGTGGAAGTTGAAGATTGCAA3’, SacI site underlined
LeTTS2R: 5’CCCGAATTCCTATATGTAGTTGTGTTTTAATGGT3’, EcoRI site underlined.
The PCRs were conducted with Phusion High fidelity DNA polymerase (NEB) in a final volume
of 50 μl (1 μM of each primer and 1 μl of cDNA) under the following conditions: 30 s 98 °C
(10 s 98 °C, 30 s 55 °C, 75 s 72 °C) × 28 cycles, 10 min 72 °C. The resulting 2.3 kb PCR
products were purified by gel electrophoresis and cloned for sequencing. Sequence information
for the putative triterpenoid synthases SlTTS1 and SlTTS2 has been deposited in the GenBank
Accession Nos. HQ266579 and HQ266580, respectively.
Functional Expression of OSC cDNAs in Yeast and Product Analysis
The full-length cDNAs of putative triterpenoid synthases were double-digested with SacI
and EcoRI enzymes and ligated into the yeast expression vector pYES2 (Invitrogen) under the
control of the GAL1 promoter. The constructs were transformed into Top10 Competent Cells.
Plasmid DNAs were prepared and used to transform the mutant yeast strain GIL77 by the
LiAc/SS-DNA/PEG method (Gietz and Woods, 2002). After galactose induction and 24 h
incubation in 0.1 M potassium phosphate-containing glucose and hemin, cells were collected,
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
26
refluxed for 5 min in 20% KOH/50% EtOH, and extracted twice with hexane. Both hexane
solutions were combined, the solvent was removed under a gentle stream of N2 and the residue
was re-dissolved in 0.2 ml of CHCl3. The extracts were either directly derivatized using BSTFA
at 70 °C for 60 min and then analyzed by GC–FID/MS as described above or further purified by
thin layer chromatography (TLC) plate (20 × 20 cm, silica gel 60 F254, 0.25 mm; Merck,
Darmstadt, Germany) for GC-FID/MS analysis. Plates were developed using a sandwich
technique and chloroform as the mobile phase, then stained with primuline and viewed under
UV-light. The bands potentially containing cyclization products were scratched from the plates,
extracted with CHCl3, filtered, and prepared for GC analysis.
Tomato overexpression
SlTTS1 and SlTTS2 cDNAs were cloned into the pGWB5 vector under the control of 35S
promoter by using the Gateway Cloning system (Invitrogen). The vectors were transferred to
Agrobacterium tumefaciens GV3301. Plant transformation was carried out as described by Dan
et al. (2006). Transgenic plants were growing in a green house until the fruits turned to mature
red, then harvested to do wax extraction and GC/FID/MS analysis as described before.
RT-PCR analysis.
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
27
The epidermal cell layers were peeled from the green fruits surface of MicroTom, the
remaining inner tissue as well as the epidermis preparations were immediately frozen in liquid
nitrogen, ground into powders using a mortar and pestle, and used to extract RNA with Trizol
Reagent (Invitrogen). The RNA samples were used for cDNA synthesis by SuperScript II
Reverse Transcriptase (Invitrogen) following standard protocols. Gene-specific primers
(SlTTS1: 5’CGTCGAATGCACTGCCTCAT3’ and 5’GGACCAAATTGCACTCTATATC3’;
SlTTS2: 5’TGTTGAGTGCACTAGCTCGG3’ and 5’ACGGACAACTCGATTCACTAAGC3’)
were designed to amplify fragments of the two OSCs. Additionally, the actin gene fragment was
amplified as a positive control using the primers actinF: 5’CAAGTCATCATCCGTTTG3’ and
actinR: 5’ATACCAGTGGTACGACC3’. PCR cycle numbers and template amounts were
optimized to yield products in the linear range of the reaction. PCR conditions were: denatured at
94 °C for 2 min, followed by 28 cycles of: 94 °C for 20 s, 55 °C for 30 s, and 72 °C for 60 s.
Reactions were maintained at 72 °C for 2 min before separation of PCR products by
electrophoresis in a 1% agarose gel.
Quantitative RT-PCR analysis.
The RNA samples from tomato leaf or green fruits were used for cDNA synthesis by
SuperScript II Reverse Transcriptase (Invitrogen) following standard protocols. Gene-specific
primers were designed to amplify a fragment of SlTTS1 by TTS1F:
CGTCGAATGCACTGCCTCAT and T1R2: 5’TACCATGAACCATCAGGCATT3’, and
SlTTS2 by TTS2F: 5’TGTTGAGTGCACTAGCTCGG3’ and T2R2:
5’TACCATGAACCGTCAGGCTCC3’. Quantitative PCR was carried out using SYBR
GreenER qPCR SuperMix Universal kit (Invitrogen). The q-PCRs were programmed at 95 °C
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
28
for 9 min, followed by 40 cycles of: 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s on a MJ
mini opticon real-time PCR system.
Phylogenetic Analyses
Sequence alignments and phylogenetic analyses based on a neighbour-joining method
were carried out with the ClustalX program Version 1.83 (Thompson et al., 1997), using the
amino acid sequences of cloned and characterized plant OSCs. A phylogenetic tree was created
with the MEGA3.1 program. The number of bootstrap replications was 1000. The GenBank
database accession numbers of the sequences used in the analysis are summarized in table II:
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
29
SUPPLEMENTAL DATA
The following materials are available in the online version of this article.
Supplementary Figure 1 Amino acid sequences of the SlTTS1 and SlTTS2 alleles of tomato
cultivars MicroTom and M82.
ACKNOWLEDGEMENTS
The authors would like to thank Bangjun Wang for technical help and Dr. Y. Ebizuka
(Tokyo) for providing the yeast strain GIL77. This work has been supported by NSERC Special
Research Opportunity and Strategic Grants, by the Canada Foundation for Innovation, the British
Columbia Knowledge Development Fund and the Canada Research Chairs Program. Funding
was provided to J.K.C.R. by NSF Plant Genome Research Program grant (DBI-0606595) and
T.H.Y. was supported in part by an NIH chemistry/biology interface training grant (grant number
T32 GM008500).
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
30
REFERENCES
Abe I (2007) Enzymatic synthesis of cyclic triterpenes. Nat Prod Rep 24: 1311-1331
Abe I, Rohmer M, Prestwich GD (1993) Enzymatic cyclization of squalene and oxidosqualene
to sterols and triterpenes. Chem Rev 93: 2189-2206
Adato A, Mandel T, Mintz-Oron S, Venger I, Levy D, Yativ M, Dominguez E, Wang Z,
DeVos RCH, Jetter R, Schreiber L, Heredia A, Rogachev I, Aharoni A (2009) Fruit-
surface flavonoid accumulation in tomato is controlled by a SlMYB12-regulated
transcriptional network. PLoS Genetics 5:
Baker EA, Bukovac MJ, Hunt GM (1982) Composition of tomato fruit cuticle as related to
fruit growth and development. In: The plant cuticle, Linnean Society Symposium Series,
vol. 10. Cutler,D.F.; Alvin,K.L.; Price,C.E. Eds., Academic Press, London, p. 33-44
Basyuni M, Ebizuka Y, Oku H, Inafuku M, Baba S, Iwasaki H, Oshiro K, Okabe T,
Shibuya M (2006) Molecular cloning and functional expression of a multifunctional
triterpene cDNA from a mangrove species Kandelia candel (L.) Druce. Phytochemistry
67: 2517-2524
Bauer S, Schulte E, Thier H-P (2004a) Composition of the surface wax from tomatoes. 1.
Identification of the components by GC/MS. Eur Food Res Technol 219: 223-228
Bauer S, Schulte E, Thier H-P (2004b) Composition of the surface wax from tomatoes. 2.
Quantification of the components at the ripe red stage and during ripening. Eur Food Res
Technol 219: 487-491
Christianson DW (2006) Structural biology and chemistry of the terpenoid cyclases. Chem Rev
106: 3412-3442
Corey EJ, Matsuda SPT, Bartel B (1993) Isolation of an Arabidopsis thaliana gene encoding
cycloartenol synthase by functional expression in a yeast mutant lacking lanosterol
synthase by the use of a chromatographic screen. Proc Natl Acad Sci USA 90: 11628-
11632
Dan Y, Yan H, Munyikwa T, Dong J, Zhang Y, Armstrong CL (2006) MIcro-Tom - a high-
throughput model transformation system for functional genomics. Plant Cell Rep 25:
432-441
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
31
Ebizuka Y, Katsube Y, Tsutsumi T, Kushiro T, Shibuya M (2003) Functional genomics
approach to the study of triterpene biosynthesis. Pure Appl Chem 75: 369-374
Eschenmoser A, Ruzicka L, Jeger O, Arigoni D (1955) Zur Kenntnis der Triterpene. 190. Eine
stereochemische Interpretation der biogenetischen Isoprenregel bei den Triterpenen. Helv
Chim Acta 38: 1890-1904
Fazio GC, Xu R, Matsuda SPT (2004) Genome mining to identify new plant triterpenoids. J
Am Chem Soc 126: 5678-5679
Gietz RD, Woods RA (2002) Transformation of yeast by the LiAc/SS carrier DNA/PEG
method. Methods in Enzymology 350: 87-96
Han JY, Kwon YS, Yang DC, Jung YR, Choi YE (2006) Expression and RNA interference-
induced silencing of the dammarenediol synthase gene in Panax ginseng. Plant Cell
Physiol 47: 1653-1662
Hayashi H, Hiraoka N, Ikeshiro Y, Kushiro T, Morita M, Shibuya M, Ebizuka Y (2000)
Molecular cloning and characterization of a cDNA for Glycyrrhiza glabra cycloartenol
synthase. Biol Pharm Bull 23: 231-234
Hayashi H, Huang P, Kirakosyan A, Inoue K, Hiraoka N, Ikeshiro Y, Kushiro T, Shibuya
M, Ebizuka Y (2001) Cloning and characterization of a cDNA encoding -amyrin
synthase involved in glycyrrhizin and soyasaponin biosyntheses in licorice. Biol Pharm
Bull 24: 912-916
Herrera JBR, Bartel B, Wilson WK, Matsuda SPT (1998) Cloning and characterization of the
Arabidopsis thaliana lupeol synthase gene. Phytochemistry 49: 1905-1911
Hovav R, Chehanovsky N, Moy M, Jetter R, Schaffer AA (2007) The identification of a gene
(Cwp1), silenced during Solanum evolution, which causes cuticle microfissuring and
dehydration when expressed in tomato fruit. Plant J 52: 627-639
Husselstein-Muller T, Schaller H, Benveniste P (2001) Molecular cloning and expression in
yeast of 2,3-oxidosqualene-triterpenoid cyclases from Arabidopsis thaliana. Plant Mol
Biol 45: 75-92
Isaacson T, Kosma DK, Matas AJ, Buda GJ, He Y, Yu B, Pravitasari A, Batteas JD, Stark
RE, Jenks MA, Rose JKC (2009) Cutin deficiency in the tomato fruit cuticle
consistently affects resistance to microbial infection and biomechanical properties, but
not transpirational water loss. Plant J 60: 363-377
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
32
Iturbe-Ormaetxe I, Haralampidis K, Papadopoulou K, Osbourn AE (2006) Molecular
cloning and characterization of triterpene synthases from Medicago truncatula and Lotus
japonicus. Plant Mol Biol 51: 731-743
Kolesnikova MD, Wilson WK, Lynch DA, Obermeyer AC, Matsuda SPT (2010)
Arabidopsis camelliol C synthase evolved from enzymes that make pentacycles. Org Lett
9: 5223-5226
Kosma DK, Parsons EP, Isaacson T, Lu S, Rose JKC, Jenks MA (2010) Fruit cuticle lipid
composition during development in tomato ripening mutants. Physiol Plant 139: 107-117
Kushiro T, Shibuya M, Ebizuka Y (1998a) Molecular cloning of oxidosqualene cyclase cDNA
from Panax ginseng: the isogene that encodes -amyrin synthase. International
Symposium on Natural Medicines, Kyoto, Japan
Kushiro T, Shibuya M, Ebizuka Y (1998b) -Amyrin synthase. Cloning of oxidosqualene
cyclase that catalyzes the formation of the most popular triterpene among higher plants.
Eur J Biochem 256: 238-244
Kushiro T, Shibuya M, Masuda K, Ebizuka Y (2000) A novel multifunctional triterpene
synthase from Arabidopsis thaliana. Tetrahedr Lett 4: 7705-7710
Leide J, Hildebrandt U, Reussing K, Riederer M, Vogg G (2007) The developmental pattern
of tomato fruit wax accumulation and its impact on cuticular transpiration barrier
properties: effects of a deficiency in a -ketoacyl-CoA synthase (LeCER6). Plant Physiol
144: 1667-1679
Lodeiro S, Xiong Q, Wilson WK, Kolesnikova MD, Onak CS, Matsuda SPT (2007) An
oxidosqualene cyclase makes numerous products by diverse mechanisms: a challenge to
prevailing concepts of triterpene biosynthesis. J Am Chem Soc 129: 11213-11222
Mintz-Oron S, Mandel T, Rogachev I, Feldberg L, Lotan O, Yativ M, Wang Z, Jetter R,
Venger I, Adato A, Aharoni A (2008) Gene expression and metabolism in tomato fruit
surface tissues. Plant Physiol 147: 823-851
Morita M, Shibuya M, Kushiro T, Masuda K, Ebizuka Y (2000) Molecular cloning and
functional expression of triterpene synthases from pea (Pisum sativum). New -amyrin-
producing enzyme is a multifunctional triterpene synthase. Eur J Biochem 267: 3453-
3460
Morita M, Shibuya M, Lee M-S, Sankawa U, Ebizuka Y (1997) Molecular cloning of pea
cDNA encoding cycloartenol synthase and its functional expression in yeast. Biol Pharm
Bull 20: 770-775
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
33
Papadopoulou K, Melton RE, Leggett M, Daniels MJ, Osbourn AE (1999) Compromised
disease resistance in saponin-deficient plants. Proc Natl Acad Sci USA 96: 12923-12928
Phillips DR, Rasbery JM, Bartel B, Matsuda SPT (2006) Biosynthetic diversity in plant
triterpene cyclization. Current Opinion in Plant Biology 9: 1-10
Reichardt PB, Bryant JP, Clausen TP, Wieland GD (1984) Defense of winter-dormant
Alaska paper birch against snowshoe hares. Oecologia (Berlin) 65: 58-69
Saladie M, Matas AJ, Isaacson T, Jenks MA, Goodwin SM, Niklas KJ, Xiaolin R,
Labavitch JM, Shackel KA, Fernie AR, Lytovchenko A, O'Neill MA, Watkins CB,
Rose JKC (2007) A re-evaluation of the key factors that influence tomato fruit softening
and integrity. Plant Physiol 144: 1012-1028
Sawai S, Akashi T, Sakurai N, Suzuki H, Shibata D, Ayabe S-I, Aoki T (2006a) Plant
lanosterol synthase: divergence of the sterol and triterpene biosynthetic pathways in
Eukaryotes. Plant Cell Physiol 47: 673-677
Sawai S, Shindo T, Sato S, Kaneko T, Tabata S, Ayabe S-I, Aoki T (2006b) Functional and
structural analysis of genes encoding oxidosqualene cyclases of Lotus japonicus. Plant
Sci 170: 247-257
Segura MJR, Meyer MM, Matsuda SPT (2000) Arabidopsis thaliana LUP1 converts
oxidosqualene to multiple triterpene alcohols and a triterpene diol. Org Lett 2: 2257-2259
Shibuya M, Katsube Y, Otsuka M, Zhang H, Tansakul P, Xiang T, Ebizuka Y (2009)
Identification of a product specific -amyrin synthase from Arabidopsis thaliana. Plant
Physiol Biochem 47: 26-30
Shibuya M, Xiang T, Katsube Y, Otsuka M, Zhang H, Ebizuka Y (2007) Origin of structural
diversity in natural triterpenes: direct synthesis of seco-triterpene skeletons by
oxidosqualene cyclase. J Am Chem Soc 129: 1450-1455
Smith RM, Marshall JA, Davey MR, Lowe KC, Power JB (1996) Comparison of volatiles
and waxes in leaves of genetically engineered tomatoes. Phytochemistry 43: 753-758
Suzuki M, Xiang T, Ohyama K, Seki H, Saito K, Muranaka T, Hayashi H, Katsube Y,
Kushiro T, Shibuya M, Ebizuka Y (2006) Lanosterol synthase in dicotyledonous
plants. Plant Cell Physiol 47: 565-571
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The
CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment
aided by quality analysis tools. Nucleic Acids Res 25: 4876-4882
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
34
Vogg G, Fischer S, Leide J, Emmanuel E, Jetter R, Levy AA, Riederer M (2004) Tomato
fruit cuticular waxes and their effects on transpiration barrier properties: functional
characterization of a mutant deficient in a very-long-chain fatty acid -ketoacyl-CoA
synthase. J Exp Bot 55: 1401-1410
Wang Z, Yeats T, Han H, Jetter R (2010) Cloning and characterization of oxidosqualene
cyclases from Kalanchoe daigremontiana: enzymes catalyzing up to ten rearrangement
steps yielding friedelin and other triterpenoids. J Biol Chem, in press
Xiang T, Shibuya M, Katsube Y, Tsutsumi T, Otsuka M, Zhang H, Masuda K, Ebizuka Y
(2006) A new triterpene synthase from Arabidopsis thaliana produces a tricyclic
triterpene with two hydroxyl groups. Org Lett 8: 2835-2838
Xiong Q, Wilson WK, Matsuda SPT (2006) An Arabidopsis oxidosqualene cyclase catalyzes
iridal skeleton formation by grob fragmentation. Angew Chem Int Ed 45: 1285-1288
Xu R, Fazio GC, Matsuda SPT (2004) On the origins of triterpenoid skeletal diversity.
Phytochemistry 65: 261-291
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
35
FIGURE LEGENDS
Figure 1 Mechanism for the cyclization of epoxysqualene into pentacyclic triterpenoids.
The reaction starts with the protonation of oxidosqualene (1), then involves a series of
carbocationic intermediates that first undergo cyclization (2) and then various rearrangements
(3), before deprotonation (4) yields the various natural products.
Figure 2 Amino acid sequences of the two OSCs, SlTTS1 and SlTTS2, isolated from the
tomato cultivar MicroTom. The conserved QW motives thought to stabilize OSC structure are
highlighted by single underlines, while the highly conserved DCTAE motif involved in substrate
binding and protonation is marked by a double underline.
Figure 3 Phylogenetic analysis comparing the two new OSC cDNAs cloned from tomato cv.
MicroTom to previously known OSCs from other plant species. The gene names and
sequences as well as the full name of species are given in the Materials and Methods section.
Figure 4 Gene structure of the tomato cv. MicroTom OSCs in comparison with those of
other plant species. The ORFs are represented by lines, with introns as boxes. Intron lengths in
nucleotides are shown above the boxes, introns with common length between most OSCs are
shaded in grey, and introns with a characteristic length in only a few species are highlighted in
black.
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
36
Figure 5 Mass spectra of pentacyclic triterpenoids. Compounds 1, 2 and 4, formed by yeast
strains heterologously expressing the two tomato cv. MicroTom OSCs (left), have fragmentation
patterns identical with those of authentic standards of -amyrin, -amyrin and -amyrin (right).
Spectra are shown for the trimethylsilyl derivatives of the triterpenoid alcohols.
Figure 6 Mass spectra of pentacyclic triterpenoids. Compounds 3 and 5 - 7, formed by yeast
strains heterologously expressing the two tomato cv. MicroTom OSCs (left), have fragmentation
patterns identical with those of triterpenoids found in the cuticular wax of tomato fruit (right).
Wax constituents 5 – 7 were identified as multiflorenol, -taraxasterol and taraxasterol in
accordance with the literature, while compound 3 remained unidentified. Spectra are shown for
the trimethylsilyl derivatives of the triterpenoid alcohols.
Figure 7 Gas chromatographic analysis of triterpenoids in transgenic yeast. Yeast were
transformed with the vectors indicated in the various panels, grown and extracted. Triterpenoid
alcohols were separated from other neutral lipids by TLC, and converted into trimethylsilyl
ethers prior to GC analysis. In the empty vector control no triterpenoids were detected. In
contrast, the yeast strains harboring SlTTS1 and SlTTS2 constructs were found to contain the
triterpenoid compound 2 and a series of compounds 1 – 7, respectively. All seven compounds 1 –
7 were also detected in the MicroTom fruit cuticular wax, together with very long chain fatty
acid derivatives a – e (n-nonacosane, b: n-triacontane, c: n-hentriacontane, d: n-dotriacontane, e:
n-tritriacontane).
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
37
Figure 8 Relative amounts of amyrin isomers in the fruit cuticular waxes of various lines of
MicroTom. The percentages of -amyrin, -amyrin and -amyrin are given for the wild type
(WT), transgenic fruit overexpressing the OSCs (SlTTS1+ and SlTTS2+), and overexpressors
with co-suppressed SlTTS2 (SlTTS2-). Amounts of each triterpenoid were quantified as %
relative to the level of wildtype -amyrin and given as averages of three independent lines and
analyses with standard deviations.
Figure 9 RT-PCR analysis of the expression patterns of the two OSC genes in MicroTom
fruit. The SlTTS1 and SlTTS2 enzymes generating pentacyclic triterpenoids were found
expressed only in the epidermis layers, but not in the internal tissues of the fruit.
Figure 10 Quantitative RT-PCR analysis of the two OSC genes in fruit and leaves of the
three tomato cultivars MicroTom (MT), M82 and Ailsa Craig (AC). The relative expression
levels were determined in green immature fruit and normalized for each mRNA sample (n=3,
SD).
Figure 11 Chemical composition of cuticular wax on leaves of tomato cvs. M82 and
MicroTom. The absolute amounts of all identified compounds are given as averages of three
independent parallel experiments with standard deviations.
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
38
Table I. Identity levels in pairwise comparisons between the SlTTS1 and SlTTS2 cDNAs and alleles in the tomato cultivars MicroTom, M82 and
Ailsa Craig. Nucleotide identities are given as percentages in normal font, while percentages of amino acid identity are shown in italics.
TTS1 TTS2
MicroTom M82 Ailsa Craig MicroTom M82 Ailsa Craig
TTS1 MicroTom - 99.7% 99.6% 89.2% 89.2% 89.2%
M82 99.6% - 100% 89.1% 89.1% 89.1%
Ailsa Craig 99.5% 100% - 89.1% 89.1% 89.1%
TTS2 MicroTom 87.8% 87.7% 87.5% - 99.8% 99.8%
M82 87.7% 87.5% 87.4% 99.4% - 100%
Ailsa Craig 87.7% 87.5% 87.4% 99.4% 100% -
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
39
Table II: Accession data for the OSCs used in the phylogenetic analyses.
Accession No. Species Function
At4g15340 Arabidopsis thaliana Arabidiol synthase PEN1
At4g15370 Arabidopsis thaliana Baruol synthase BARS1/PEN2
At5g48010 Arabidopsis thaliana Thalianol synthase PEN4
At5g42600 Arabidopsis thaliana Marneral synthase PEN5
At1g78500 Arabidopsis thaliana Multifunctional triterpene synthase PEN6
At3g45130 Arabidopsis thaliana Lanosterol synthase LAS1/PEN7
At1g78970 Arabidopsis thaliana Multifunctional triterpene synthase LUP1
At1g78960 Arabidopsis thaliana Multifunctional triterpene synthase LUP2
At1g78950 Arabidopsis thaliana β-amyrin synthase AtBAS LUP4
At1g66960 Arabidopsis thaliana Multifunctional triterpene synthase LUP5
At2g07050 Arabidopsis thaliana Cycloartenol synthase CAS1
AB263204 Rhizophora stylosa Multifunctional triterpene synthase RsM2
AB257507 Kandelia candel Multifunctional triterpene synthase KcMS
AB037203 Glycyrrhiza glabra β-amyrin synthase GgbAS1
AB181244 Lotus japonicus β-amyrin synthase OSC1
AB034802 Pisum sativum β-amyrin synthase PSY
AJ430607 Medicago truncatula β-amyrin synthase AMY1
AF478455 Lotus japonicus Multifunctional triterpene synthase LjAMY2
AB034803 Pisum sativum Multifunctional triterpene synthase PSM
AB289585 Bruguiera gymnorhiza β-amyrin synthase BgbAS
AB014057 Panax ginseng β-amyrin synthase PgbAS/PNY2
AB009030 Panax ginseng β-amyrin synthase PNY
AB263203 Rhizophora stylosa Multifunctional triterpene synthase RsM1
AB206469 Euphorbia tirucalli β-amyrin synthase EtbAS
AB181245 Lotus japonicus Lupeol synthase OSC3
AB116228 Glycyrrhiza glabra Lupeol synthase GgLUS1
AB181246 Lotus japonicus Cycloartenol synthase QSC5
AB244671 Lotus japonicus Lanosterol synthase OSC7
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
40
C H3
CH3
CH3
C+
C H3
C H3
C H3
OH
H
C H3
H
C H3
H
C H3
CH3
CH3
C+
CH3
C H3
OH
H
C H3
H
C H3
H
C H3
H
C H 3
H
CH3
C+
C H3
C H3
OH
H
C H3
H
C H3
H
C H3C H
3
CH3
HCH3
CH3
C+
CH3
CH3
CH3
OH
H
CH3
H
CH3
CH3
HCH3
CH3
C+
CH3
CH3
CH3
CH3
OH
H
CH3
H
CH3
H
H
CH3
CH3
C+
CH3
CH3
CH3
CH3
OH
H
CH3
C H3
H
H
CH3
CH3
C+
C H3
C H3
CH3
C H3
C H3
OH
H
H
H CH3
CH3
CH3
C+
CH3
CH3 CH3
CH3
CH3
OH
H
H
H C H3
CH3
CH3
CH+
C H3
C H3
C H3
C H3
C H3
OH
H
H
H
H CH3
CH3
CH3
C+
C H3
C H3
CH3
C H3
C H3
OH
H
H
H CH3
CH3
CH3CH3
CH3 CH3
CH3
CH3
OH
H
CH3
H
H
CH3
CH3CH3
CH3 CH3
CH3
CH3
OH
H
CH3
CH3
CH3CH3
CH3
CH3
OH
H
CH3
H
CH3
H
Germanicol -Amyrin -Amyrin Taraxerol Multiflorenol Glutinol FriedelinIsomultiflorenol WalsurenolPicenol
CH3
CH3CH3
CH3
H
CH3
H
CH3
H
CH3O
CH3
CH3
CH3
CH3CH3
CH3 CH3
CH3
CH3
O
CH3
CH3
CH3
C+
CH3
CH3 CH3
CH3
CH3
OH
H
H CH3
CH3
CH3CH3
CH3 CH3
CH3
CH3
OH
Epoxysqualene
1
2
3 3 3 3 3 3 3 3 3
444444444
H
HC H
3
CH3
CH3
C H3
C H3
CH3
C H3
C H3
OH
H
Figure 1 Mechanism for the cyclization of epoxysqualene into pentacyclic triterpenoids. The reaction starts with the protonation of
oxidosqualene (1), then involves a series of carbocationic intermediates that first undergo cyclization (2) and then various rearrangements (3), before
deprotonation (4) yields the various natural products.
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
41
Figure 2 Amino acid sequences of the two OSCs, SlTTS1 and SlTTS2, isolated from the tomato cultivar MicroTom. The conserved QW
motives thought to stabilize OSC structure are highlighted by single underlines, while the highly conserved DCTAE motif involved in substrate
binding and protonation is marked by a double underline.
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
42
Figure 3 Phylogenetic analysis comparing the two new OSC cDNAs cloned from tomato cv. MicroTom to previously known OSCs from
other plant species. The gene names and sequences as well as the full name of species are given in the Materials and Methods section.
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
43
Figure 4 Gene structure of the tomato cv. MicroTom OSCs in comparison with those of other plant species. The ORFs are represented by lines,
with introns as boxes. Intron lengths in nucleotides are shown above the boxes, introns with common length between most OSCs are shaded in grey,
and introns with a characteristic length in only a few species are highlighted in black.
201 186 90 198 85 167 189 114 120 123 99 57 47 144 178 165 123
SlTTS2 201 186 90 198 85 167 189 114 120 123 99 57 47 144 178 81 84 129
198 186 90 195 85 167 189 114 123 123 99 57 47 144 178 81 84 120
SlTTS1
At CAS1
201 186 90 198 85 167 192 114 120 123 99 57 369 123
218 186 90 198 85 167 189 114 120 123 99 57 47 144 178 81 84
Lj OSC1
Lj OSC3
81 84
204 186 90 198 85 167 192 114 120 123 99 57 191 114 81 84 At Lup1
178
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
44
Figure 5 Mass spectra of pentacyclic triterpenoids. Compounds 1, 2 and 4, formed by yeast strains heterologously expressing the two tomato cv.
MicroTom OSCs (left), have fragmentation patterns identical with those of authentic standards of -amyrin, -amyrin and -amyrin (right). Spectra
are shown for the trimethylsilyl derivatives of the triterpenoid alcohols.
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
45
Figure 6 Mass spectra of pentacyclic triterpenoids. Compounds 3 and 5 - 7, formed by yeast strains heterologously expressing the two tomato cv.
MicroTom OSCs (left), have fragmentation patterns identical with those of triterpenoids found in the cuticular wax of tomato fruit (right). Wax
constituents 5 – 7 were identified as multiflorenol, -taraxasterol and taraxasterol in accordance with the literature, while compound 3 remained
unidentified. Spectra are shown for the trimethylsilyl derivatives of the triterpenoid alcohols.
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
46
Figure 7 Gas chromatographic analysis of triterpenoids in transgenic yeast. Yeast were transformed with the vectors indicated in the various
panels, grown and extracted. Triterpenoid alcohols were separated from other neutral lipids by TLC, and converted into trimethylsilyl ethers prior to
GC analysis. In the empty vector control no triterpenoids were detected. In contrast, the yeast strains harboring SlTTS1 and SlTTS2 constructs were
found to contain the triterpenoid compound 2 and a series of compounds 1 – 7, respectively. All seven compounds 1 – 7 were also detected in the
MicroTom fruit cuticular wax, together with very long chain fatty acid derivatives (a: n-nonacosane, b: n-triacontane, c: n-hentriacontane, d: n-
dotriacontane, e: n-tritriacontane).
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
47
WT
SlT
TS
1(+
)
SlT
TS
2(+
)
SlT
TS
2(-
)
Rela
tive
am
yri
n a
mo
un
ts
[% o
f w
ild
typ
e
-am
yri
n]
0
50
100
150
200
250-Amyrin
-Amyrin
-Amyrin**
**
**
**
**
**
**
Figure 8 Relative amounts of amyrin isomers in the fruit cuticular waxes of various lines of MicroTom. The percentages of -amyrin, -amyrin
and -amyrin are given for the wild type (WT), transgenic fruit overexpressing the OSCs (SlTTS1+ and SlTTS2+), and overexpressors with co-
suppressed SlTTS2 (SlTTS2-). Amounts of each triterpenoid were quantified as % relative to the level of wildtype -amyrin and given as averages of
three independent lines and analyses with standard deviations.
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
48
Figure 9 RT-PCR analysis of the expression patterns of the two OSC genes in MicroTom fruit. The SlTTS1 and SlTTS2 enzymes generating
pentacyclic triterpenoids were found expressed only in the epidermis layers, but not in the internal tissues of the fruit.
SlTTS1
SlTTS2
Actin
Epidermal
peel
Internal
tissue
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
49
Fruit Leaf
MT M82 AC MT M82 AC
Rela
tive E
xp
ressio
n[%
of
tota
l T
TS
tra
nscri
pts
in
org
an
]
0
20
40
60
80
100
TTS1
TTS2
Figure 10 Quantitative RT-PCR analysis of the two OSC genes in fruit and leaves of the three tomato cultivars MicroTom (MT), M82 and
Ailsa Craig (AC). The relative expression levels were determined in green immature fruit and normalized for each mRNA sample (n=3, SD).
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.
50
C27
C28
C29
C30
C31
C32
C33
C29
C31
C32
C33
C26
C28
C30
C32
d-A
myri
nb
-Am
yri
na
-Am
yri
nL
up
eo
l
Wax lo
ad
[
g/c
m2]
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5 M82
MicroTom
n-AlkanesBranched
alkanesAlcohols
Figure 11 Chemical composition of cuticular wax on leaves of tomato cvs. M82 and MicroTom. The absolute amounts of all identified
compounds are given as averages of three independent parallel experiments with standard deviations.
www.plantphysiol.orgon January 21, 2019 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.