running head : arginine and polyamine metabolisms in ... · trauma and pathogen infection. in this...
TRANSCRIPT
![Page 1: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/1.jpg)
1
Running head : Arginine and polyamine metabolisms in clubrooted Arabidopsis
Corresponding author: MANZANARES-DAULEUX Maria
Mailing address: UMR 118 INRA-Agrocampus Rennes, Amélioration des Plantes et
Biotechnologies Végétales, BP35327, 35653 Le Rheu Cedex, France.
Phone number: +(33) 2 23 48 51 39
Fax number: +(33) 2 23 48 51 20
Email address: [email protected]
Research category: Plants interacting with other organisms
Plant Physiology Preview. Published on February 27, 2008, as DOI:10.1104/pp.108.117432
Copyright 2008 by the American Society of Plant Biologists
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 2: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/2.jpg)
2
Differential regulation of root arginine catabolism and polyamine metabolism in
clubroot-susceptible and partially resistant Arabidopsis genotypes
Mélanie Jubault1, Céline Hamon1, Antoine Gravot2, Christine Lariagon1, Régine Delourme1,
Alain Bouchereau2, Maria J. Manzanares-Dauleux1.
1UMR 118 INRA-Agrocampus Rennes, Amélioration des Plantes et Biotechnologies
Végétales, BP35327, 35653 Le Rheu Cedex, France. 2UMR 6026 CNRS-Université de Rennes 1, Interactions Cellulaires et Moléculaires, Campus
de Beaulieu, CS 74205, 35042 Rennes Cedex, France.
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 3: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/3.jpg)
3
Corresponding author: MANZANARES-DAULEUX Maria
Email address: [email protected]
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 4: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/4.jpg)
4
ABSTRACT
The hypertrophy and hyperplasia of infected roots into clubs are the intrinsic characteristics of
clubroot, one of the economically most important diseases in Brassica crops worldwide.
Polyamines, arginine-derived metabolites, have long been recognized as cell proliferation and
differentiation regulators in plants and are consequently suitable candidates for potential gall
development factors. Furthermore, arginine catabolism, through arginase, which is strongly
connected to polyamine metabolism, would play an important role in response to wound
trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-
Plasmodiophora brassicae pathosystem to investigate the involvement of polyamine
metabolism and arginine catabolism in host responses to the pathogen infection and in partial
clubroot resistance mechanisms. We demonstrated at the transcriptional, enzymatic and
metabolic levels that polyamine metabolism and arginine catabolism are induced during the
later stages of disease in compatible Arabidopsis thaliana - Plasmodiophora brassicae
interactions. However, susceptible and partially resistant plants showed strikingly different
arginine metabolism signatures. Susceptible plants were characterized by a transient agmatine
production, a massive induction of arginase and a strong accumulation of proline. The
potential functions of this marked activation of the arginase pathway in the Plasmodiophora
brassicae pathogenicity strategy are discussed. Partially resistant plants showed a continuous
agmatine production and a weaker arginase pathway activity than the susceptible genotype.
Results suggest that the symptom severity was strongly associated to the differential
regulation of root polyamine metabolism and arginine catabolism. Further work using
arginase transgenic plants will provide insight into the physiological function of the arginase
pathway in partial clubroot resistance.
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 5: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/5.jpg)
5
Clubroot, caused by the obligate biotrophic protist Plasmodiophora brassicae Woron., is
one of the economically most important diseases of Brassica crops in the world. The life
cycle of this soil-borne pathogen can be divided into two phases: a primary phase in which
events are confined to the root hairs and a secondary phase that occurs in the cortex and the
stele of the hypocotyl and roots of the infected plants. During the second phase, multinucleate
plasmodia cause the hypertrophy (abnormal cell enlargement) and hyperplasia (uncontrolled
cell division) of infected roots into characteristic clubs (Ingram and Tommerup, 1972). These
symptoms obstruct nutrient and water transport, stunt the growth of the plant and
consequently reduce crop yield and quality. Since the pathogen survives as resting spores for
a long period (up to fifteen years) in the soil, control of the disease by agricultural practices
and/or chemical treatments is difficult and/or expensive. Thus, the development of resistant
cultivars is currently the most efficient way to control clubroot among Brassica crops. Both
qualitative and quantitative clubroot resistances have been identified and analyzed in different
cultivated Brassicaceae species (Manzanares-Dauleux et al., 2000a; Suwabe et al., 2003;
Hirai et al., 2004; Piao et al., 2004; Rocherieux et al., 2004; Hirai, 2006; Saito et al., 2006;
Suwabe et al., 2006). Monogenic or oligogenic conferred clubroot resistance introduced into
commercial cultivars leads to complete resistance (incompatible interaction) but is rapidly
overcome. Partial resistance (compatible interaction), controlled by multiple genes, would be
overcome by the pathogen more slowly and is thus an alternative for developing durable host-
plant resistance. However, mechanisms associated with partial quantitative resistance remain
poorly understood.
The wild Brassicaceae, Arabidopsis thaliana is also a host species for clubroot (Koch et
al., 1991). Natural variation in the responses to clubroot occurs in the model plant (Fuchs and
Sacristán, 1996; Siemens et al., 2002; Alix et al., 2007) and our group discovered that the
Burren accession (Bur-0) is partially resistant to the eH P. brassicae isolate (Alix et al.,
2007). The resistance harbored by this accession is under polygenic control (Jubault et al.,
2007) and is characterized by a reduction of symptom severity. Compared to a susceptible
genotype (main and secondary root systems are replaced by a big club), the partially resistant
plants usually show only tiny clubs confined to the secondary root system. These findings
make it possible to exploit the model plant and its panel of available biological and genomic
resources to gain insight into clubroot pathogenesis and the mechanisms controlling partial
resistance. Furthermore, P. brassicae does not show host specificity in Brassicaceae (i.e. the
same isolate can infect different species). Consequently, knowledge acquired on Arabidopsis
could then be rapidly integrated and transferred to cultivated crops. To date, research on
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 6: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/6.jpg)
6
clubroot using Arabidopsis as a model host system was mainly focused on the role of
hormonal regulation by auxin (Ludwig-Muller et al., 1999; Grsic-Rausch et al., 2000;
Neuhaus et al., 2000; Ando et al., 2006; Devos et al., 2006; Schuller and Ludwig-Muller,
2006) and/or cytokinins (Devos et al., 2006; Siemens et al., 2006) in the development of
clubroot symptoms. However, other molecules, such as polyamines, could also be involved in
cell proliferation and differentiation. These metabolites are of interest regarding the
development of clubroot symptoms and were previously proposed to participate in club
formation in infected roots of susceptible Brassica (Walters and Shuttleton, 1985; Cao et al.,
2008).
Polyamines are ubiquitous aliphatic cations that are produced by almost all living
organisms, including plants, animals, fungi and bacteria. Their biosynthesis and catabolism
pathways have been fully characterized for many organisms (mammals, fungi, plants). In
Arabidopsis, the amino acid arginine is the starting point for polyamine biosynthesis.
Arginine is decarboxylated by arginine decarboxylase (ADC) to yield agmatine (Fig. 1) which
then serves as the substrate for the biosynthesis of putrescine through the activities of two
enzymes, agmatine iminohydrolase (AIH) and N-carbamoylputrescine amidohydrolase
(CPA). In higher plants, putrescine is also produced by an alternative pathway, from
ornithine, as the result of the action of ornithine decarboxylase (ODC). However, several
plant species, including the model plant Arabidopsis, show reduced or absent ODC activity,
so that polyamine biosynthesis must be mostly dependant on the basic amino acid arginine
(Hanfrey et al., 2001). Putrescine is then converted into the polyamines, spermidine and
spermine, by addition of amino-propyl residues from decarboxylated S-adenosylmethionine,
which results from decarboxylation of S-adenosylmethionine by S-adenosylmethionine
decarboxylase (SAMDC). These reactions are sequentially catalyzed by two closely related
but distinct enzymes spermidine synthase (SPDS) and spermine synthase (SPMS). In higher
plants, in addition to their implication in fundamental cellular processes, such as chromatin
organization, cell proliferation, differentiation and programmed cell death (Thomas and
Thomas, 2001; Bais and Ravishankar, 2002), polyamines were also reported to be involved in
adaptive responses to abiotic (reviewed in Bouchereau et al., 1999; Urano et al., 2003;
Kuznetsov et al., 2006) and biotic stresses (reviewed in Walters, 2003). Firstly, they are
essential components of the plant cell wall, a crucial physical barrier against pathogen
invasion (Berta et al., 1997). In addition, polyamine catabolism may also contribute to
defense responses through two reaction products (reviewed in Cona et al., 2006) : γ-
aminobutyric acid (GABA), an important metabolite, largely and rapidly produced in
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 7: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/7.jpg)
7
response to biotic and abiotic stresses (Bouche and Fromm, 2004) and the reactive oxygen
species, H2O2, which has a long been recognized to play a key role in defense (Gechev et al.,
2006). Lastly, polyamine conjugation with phenolic acids was also linked with plant defense
to pathogen infection (Walters, 2000).
Two major metabolic pathways are closely connected to polyamine metabolism. Arginine
is also the precursor for the biosynthesis of nitric oxide (NO), ornithine and urea (Fig. 2). The
step catalyzed by nitric-oxide synthase (NOS) which allows the two-step oxidation of arginine
to nitric oxide and citrulline is intensively studied during abiotic stresses and plant–pathogen
interactions (Mur et al., 2006; Arasimowicz and Floryszak-Wieczorek, 2007). The second
arginine catabolism pathway is catalyzed by arginase which hydrolyzes arginine to ornithine
and urea. Whereas ornithine contributes to the biosynthesis of proline and glutamate, urea is
further catabolized by urease to carbon dioxide and ammonium. Although research on plant
arginase has mainly focused on its role in mobilizing arginine as a nitrogen source during
post-germination growth (Kolloffel and van Dijke, 1975; Zonia et al., 1995; Palmieri et al.,
2006), plant arginase was also reported to be involved in stress responses. Arginase activity
was induced in tomato leaves in response to wounding, treatment with jasmonic acid, a potent
signal for plant defense responses, and infection with a virulent strain of Pseudomonas
syringae pv. tomato (Chen et al., 2004). Potential roles in protection against herbivores and in
pathogen virulence were consequently proposed. However, although they are strongly
interconnected, since they compete for a common substrate, these three arginine catabolic
pathways, i.e. biosynthesis of polyamines, biosynthesis of NO and the urea cycle, are
frequently considered independently in higher plants. In contrast to animal systems, where a
switch between the different branches of arginine metabolism has long been recognized to be
involved in response to wound trauma and pathogen infection (Vincendeau et al., 2003; Duleu
et al., 2004; Pfaff et al., 2005), the potential role of arginine metabolism regulation in the
plant-pathogen relationship is still unclear.
Consequently, arginine metabolism appears to be an exciting metabolic pathway
potentially involved in Brassicaceae - P. brassicae interactions due to, on one hand, its
central role in plant defense-responses and, on the other hand, the role of polyamines in cell
proliferation and differentiation regulation. The present work aims to determine, first, whether
polyamine metabolism and arginine catabolism through arginase are implicated in host
responses to P. brassicae infection and, secondly, whether these metabolic pathways might be
involved in partial clubroot resistance mechanisms. Thus, we examined the temporal
responses of polyamines and arginase to clubroot in roots of both the susceptible Col-0
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 8: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/8.jpg)
8
accession and the partially resistant Bur-0 accession. We analyzed the expression levels of
genes involved in polyamine biosynthesis and encoding arginase and quantified arginase
activity, arginine-related amino-acids and free polyamine levels. Our results show that the
expression of genes involved in arginine catabolism and polyamine metabolism is induced
upon inoculation with P. brassicae in both susceptible and partially resistant accessions.
However, free polyamine production and arginine utilization is clearly regulated differently in
partially resistant plants compared to susceptible ones.
RESULTS
Clubroot resistance tests
In each test, the Arabidopsis accessions, Bur-0 and Col-0, were evaluated at 21 dpi for
clubroot symptoms. A set of differential hosts, including susceptible and resistant genotypes
of different Brassica species, was also evaluated at 49 dpi to characterize the isolate’s
pathogenicity. This confirmed that the selection isolate eH (Fähling et al., 2003) used in this
study belongs to the most virulent P. brassicae pathotype P1 (Somé et al., 1996). Analysis of
variance revealed no significant difference between tests but a significant phenotypic
variation between genotypes (p<0.001). The Col-0 accession, with a mean DI of 86, was
classified as significantly more susceptible than the Bur-0 accession (p<0.05) which showed
an intermediate behavior with a mean DI of 64, as previously reported (Alix et al., 2007;
Jubault et al., 2007).
Transcriptional profiling of genes involved in polyamine metabolism and arginine
catabolism
We used quantitative real-time RT-PCR to examine the expression levels of polyamine
biosynthesis and arginase encoding genes in control and infected roots of the partially
resistant Bur-0 accession and the susceptible Col-0 accession. Four independent experiments
were carried out at four time points (2, 7, 14 and 21 days after inoculation) to relate specific
host responses to the life-cycle of the pathogen. The first time point corresponds to the
primary phase of P. brassicae infection, i.e. the first contact between primary zoospores and
root hairs and development of primary plasmodia. Seven, 14 and 21 dpi correspond in a
susceptible genotype to the early events of cortical cells colonization and clubs formation,
respectively, during the secondary phase of infection (Fuchs and Sacristán, 1996). For each
time point, an ANOVA was performed to evaluate inoculation and genotype effects on gene
expression.
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 9: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/9.jpg)
9
Firstly, we could not detect any significant differences between the transcriptional profiles
of genes involved in polyamine biosynthesis and arginine catabolism in control roots of the
two Arabidopsis genotypes. Similarly, no significant differences were observed between
control and P. brassicae infected roots, for either gene sets or accession at the first 2 time
points (data not shown). In contrast, at 14 and 21 dpi, the ANOVA showed that expression of
most genes involved in polyamine biosynthesis and arginine catabolism had been
significantly affected by the inoculation with transcripts accumulating in response to
P. brassicae infection, in both susceptible and partially resistant roots.
Close examination of specific gene expression profiles showed that expression of genes
encoding arginine decarboxylase (ADC1), agmatine iminohydrolase (AIH), N-
carbamoylputrescine amidohydrolase (CPA), spermidine synthase (SPDS1, SPDS2) and S-
adenosylmethionine decarboxylase (SAMDC2) was significantly higher in P. brassicae
inoculated roots than in the control at 14 and 21 dpi (p<0.05 to p<0.001) (Fig. 3A; Fig. 3B).
Transcription of SAMDC1, a second gene encoding S-adenosylmethionine decarboxylase and
SPMS, encoding spermine synthase, was also induced by P. brassicae infection (p<0.05 and
p<0.01 respectively), but only transiently at 14 dpi. In contrast, mRNA levels of ADC2, a
second gene encoding arginine decarboxylase, did not change in response to infection and
expression of ACL5, a second gene encoding spermine synthase, decreased in infected plants
at 14 and 21 dpi (p<0.05 and p<0.001). None of the genes showed significant different
expression patterns between infected roots of the susceptible and partially resistant
accessions.
The expression of the two genes encoding arginase, ARGAH1 and ARGAH2, was also
monitored throughout P. brassicae infection. ARGAH1 mRNA levels increased significantly
at 14 and 21 dpi in both accessions compared to control roots (p<0.05) (Fig. 4A) but there
was no significant differences in response level between the two genotypes. ARGAH2 mRNA
levels were also higher in Col-0 and Bur-0 inoculated roots than in the control at 14 and 21
dpi. Interestingly, however, ARGAH2 mRNA levels were drastically induced in susceptible
infected roots compared to partially resistant infected roots (Fig. 4B). This observation proved
to be statistically significant with a clear interaction between genotype and inoculation factors
at 14 and 21 dpi (p<0.05 and p<0.01). Duncan’s multiple-range test (α=0.05) performed on
the four genotype*inoculation treatments also showed that ARGAH2 was expressed at
significantly higher levels in infected Col-0 roots at 14 and 21 dpi. For example, at 21 dpi, the
ARGAH2 expression was 25-fold higher in inoculated roots than control Col-0 roots but only
3-fold higher for the partially resistant genotype Bur-0.
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 10: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/10.jpg)
10
Arginase activity
To validate our results showing induced arginase expression at the transcriptional level,
arginase activity was measured in control and infected Col-0 and Bur-0 roots at 21 dpi (Fig.
5). A striking increase in arginase activity was observed in susceptible Col-0 roots in response
to P. brassicae infection. Indeed, arginase activity was 10-fold higher in infected roots than in
control roots. In contrast, arginase activity in infected roots of the partially resistant Bur-0
accession only increased slightly, as was observed at the transcriptional level.
Arginine-related amino acids
Next, we measured the amino acid content of roots at 21 dpi, specifically looking at
arginine and related amino acids i.e. ornithine, glutamate and proline contents (Fig. 6). In non-
infected roots, there was around three times more arginine in Bur-0 than Col-0. No significant
change was observed for arginine contents in response to inoculation. Ornithine levels
remained relatively low (<0.1 µmol.g-1 DW) regardless of conditions or genotypes (data not
shown). In contrast, infections had a strong impact on proline accumulation, which reached
high levels in the infected Col-0 roots. Proline also accumulated in Bur-0 roots, but in a much
lower proportion. Analysis of variance revealed a significant interaction between genotype
and inoculation factors (p<0.05). A Duncan’s multiple-range test (α=0.05) performed on the
four genotype*inoculation treatments also showed a significant higher accumulation of
proline in the infected Col-0 roots. In comparison, apparently higher levels of glutamate in
infected roots were very modest. Analysis of variance did not reveal significant changes in
glutamate contents in response to inoculation.
Free polyamines levels
To further investigate the role of polyamine metabolism following on from the above
results obtained at the transcriptional level, we quantified the levels of the precursor diamines,
agmatine and putrescine, and the levels of polyamines, spermine and spermidine, at 2, 7, 14
and 21 dpi (Fig.7; Table I). These measures were performed on the four independent
experiments previously used for the transcripts profiling.
Metabolic profiling of control Arabidopsis roots showed that agmatine and spermidine are
the most abundant polyamines. An ANOVA was performed to evaluate time point and
genotype effects on each metabolite level. No significant differences in putrescine and
spermine content were detected between the two genotypes. However, whereas spermine
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 11: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/11.jpg)
11
content did not change along the time course, the putrescine level decreased significantly at
21 dpi both in Col-0 and Bur-0 roots (p<0.05). Significant increases in agmatine and
spermidine were observed at 14 dpi in Col-0 roots (p<0.05).
For each time point, ANOVA was then performed to evaluate inoculation and genotype
effects on metabolite level. At the two first time points, there was no significant difference in
agmatine levels in non-infected and P. brassicae infected roots (Fig. 7). At 14 dpi, however,
the agmatine level significantly increased in response to infection, both in susceptible and
partially resistant roots. At 21 dpi, the effect of the interaction between accession and
inoculation factors was significant (p<0.01). Indeed, whereas agmatine level continued to rise
at 21 dpi in the partially resistant roots, it stopped in the susceptible roots. A Duncan’s
multiple-range test (α=0.05) performed on the four accession*inoculation treatments
confirmed that there was a significant higher level of agmatine in the Bur-0 infected roots
(Fig.7).
The level of putrescine did not change in response to clubroot infection either in
susceptible or partially resistant roots (Table I). As opposed to Bur-0 roots, variations in
spermidine and spermine levels were detected at 7 and 14 dpi in Col-0 roots. Upon
P. brassicae infection, spermidine and spermine levels in susceptible roots tended to increase
at 7 dpi and then to decrease at 14 dpi, however these variations were not statistically
significant.
DISCUSSION
The present study is the first report of the involvement of arginine metabolism in the
A. thaliana - P. brassicae interaction. Consistent results obtained both at the transcriptional,
enzymatic and metabolic levels demonstrated that polyamine metabolism and arginine
catabolism are induced in compatible A. thaliana - P. brassicae interactions. Furthermore, we
demonstrated that upon P. brassicae infection, susceptible and partially resistant plants
exhibit striking differences in the regulation of arginine metabolism. In susceptible plants
(Col-0), arginase activity was massively induced at 14 dpi and 21 dpi. This was associated
with no change in ornithine content but with a large accumulation of proline. Furthermore,
polyamine biosynthesis was also up-regulated with an accumulation of agmatine at 14 dpi.
Partially resistant plants (Bur-0), on the other hand, exhibited a slight arginase induction and a
moderate accumulation of proline. In addition, as in susceptible plants, polyamine
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 12: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/12.jpg)
12
biosynthesis was also induced, however, agmatine accumulation, observed from 14 dpi,
continued to increase at 21 dpi.
Transcriptional and enzymatic analyses of arginine metabolism
We determined the transcriptional profile of genes involved in arginine metabolism in
response to P. brassicae infection. In this study, we were particularly interested in the
arginase and polyamine pathways. The NOS pathway was not included in this study because
the nature of its coding gene remains elusive and controversial (Guo et al., 2003; Zemojtel et
al., 2006). In A. thaliana, most of enzymes involved in ornithine and polyamine production
are encoded by duplicated genes. However, although they encode the same enzyme,
duplicated genes encoding arginine decarboxylase (ADC1 and ADC2), spermine synthase
(SPMS and ACL5) and arginase (ARGAH1 and ARGAH2) were expressed differentially
following P. brassicae infection. Whereas ADC1 and SPMS transcripts accumulated at 14 and
21 dpi, like other polyamine biosynthetic genes, the expression of ADC2 and ACL5 was
surprisingly opposite. While ARGAH1 transcripts accumulated in a similar fashion in both
susceptible and partially resistant accessions, ARGAH2 overexpression was significantly
higher in the susceptible accession than in the partially resistant accession at 14 and 21 dpi.
This differential regulation of gene responsiveness was previously observed in biotic and
abiotic stress. Indeed, ADC2 was found to be specifically involved in hyperosmotic stress
(Soyka and Heyer, 1999), in water stress (Alcazar et al., 2006) and in response to jasmonic
acid and ABA applications (Perez-Amador et al., 2002; Urano et al., 2003). Exogenous ABA
also upregulated SPMS expression (Hanzawa et al., 2002; Urano et al., 2003) but not ACL5,
which was specifically induced upon indolacetic acid application (Hanzawa et al., 2000).
Even if two genes (LeARG1 and LeARG2) encoding arginase were identified in Lycopersicon
esculentum, specific induction of LeARG2 was observed in response to wounding, jasmonic
acid treatment and infection with a virulent strain of Pseudomonas syringae pv. tomato (Chen
et al., 2004).
Arginase activity measurements do not appear to exactly reflect the expression of both
ARGAH1 and ARGAH2, the two genes encoding arginase. ARGAH1 showed higher basal and
P. brassicae-induced expression levels than ARGAH2, but the strong enhancement of arginase
activity in susceptible infected roots appears to be more consistent with the massive increase
in ARGAH2 expression in susceptible plants than with the overall higher ARGAH1
expression. Taken together, these results suggest that ARGAH2 is the predominant
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 13: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/13.jpg)
13
P. brassicae-inducible isoform in Arabidopsis roots and that the two arginase isoforms have
contrasting biochemical properties or differing post-transcriptional regulations.
Polyamine metabolism and arginase are induced in compatible A. thaliana-P. brassicae
interactions
Arginine metabolism was induced in response to clubroot infection, in both susceptible
and partially resistant plants. In the literature, similar induction was previously reported in
biotic stress, both through arginase and polyamine pathways. Chen et al. (2004) reported an
increase in arginase activity in L. esculentum plants infected with a virulent strain of
P. syringae pv. tomato. Furthermore, in mammalian systems, arginase induction has long
been associated with various parasite infections (Vincendeau et al., 2003; Duleu et al., 2004).
The polyamine biosynthesis pathway was induced in both compatible and incompatible host-
pathogen interactions (reviewed in Walters, 2000; 2003). Furthermore, consistent with our
results, Cao et al. (2008) also reported, at the proteome level, the upregulation of the
polyamine biosynthetic enzyme spermidine synthase in B. napus in response to P. brassicae
infection. Previous reports on polyamine contents generally focused on the diamine,
putrescine, and/or the polyamines, spermidine and spermine, however, no information is
currently available on the regulation of agmatine, the precursor to putrescine, in response to
pathogen infection. The present study is thus the first report of agmatine involvement in biotic
stress. Surprisingly, whereas agmatine accumulated in response to infection in Col-0 and Bur-
0 roots, no significant variations in putrescine, spermidine and spermine levels were reported.
Burtin and Michael (1997) also reported that ADC overexpression in transgenic tobacco
plants induced agmatine accumulation but did not affect putrescine, spermine and spermidine
levels. These results suggest that other polyamine regulating mechanisms are involved, such
as polyamine catabolism (reviewed in Cona et al., 2006), conjugation and transport (reviewed
in Martin-Tanguy, 2001). Hydroxycinnamic acid amide conjugates were proposed to play a
role in defense mechanisms against biotic and abiotic stress, by acting as radical scavengers,
antifungal agents or in strengthening the plant cell wall against microbial degradation (Bors et
al., 1989; Walters, 2000; Von Roepenack-Lahaye et al., 2003). Walters and Shuttleton (1985)
measured the free polyamine levels in turnip roots infected by P. brassicae and showed that
putrescine, spermidine and spermine concentrations were higher in ‘clubbed’ regions of the
infected turnip roots than in non infected roots, while the concentrations were lower in
regions of infected roots not exhibiting symptoms of clubroot development. These results
suggest that in infected roots, homeostatic regulation, involving transport of polyamines from
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 14: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/14.jpg)
14
regions not exhibiting symptoms to ‘clubbed’ regions may be taking place. Because we
looked at whole roots, any localized variations in polyamine levels due to this type of
transport mechanisms between the different parts of infected roots were not detected. Lastly,
we cannot exclude that some of the polyamines we measured were contributed by
P. brassicae. Indeed, due to its exclusive intracellular life cycle, it is difficult to distinguish
between metabolites of plant or pathogen origin.
Susceptible and partially resistant plants showed differences in arginine catabolism
regulation following P. brassicae infection
Arginase catabolism was strongly induced in the susceptible plants. ARGAH1 and
particularly ARGAH2 expression and arginase activity markedly increased upon P. brassicae
infection. Induction of arginase may represent a pathogenicity strategy by P. brassicae.
Indeed, because arginase competes with NOS for a common substrate, its induction could
play an important role in pathogenesis by attenuating the production of NO-mediated host
defenses. This hypothesis is supported by increasing evidence from mammalian systems
(Vincendeau et al., 2003). For example, trypanosomes can evade host defenses by stimulating
the expression of macrophage arginase, which effectively inhibits NO production and NO-
mediated trypanosome killing (Duleu et al., 2004). Arginase induction could also be a way of
diverting nitrogen metabolism in favor of the pathogen. Induction occurred at 14 days and 21
days post inoculation, corresponding to the second phase of the P. brassicae life cycle (Fuchs
and Sacristán, 1996). During this phase, multinucleate plasmodia grow by mitotic division
and consequently cause the hypertrophy and hyperplasia of host cells. By analogy to the
proposed role of arginase in nitrogen metabolism during post-germinative growth (Kolloffel
and van Dijke, 1975; Zonia et al., 1995), P. brassicae-induced degradation of arginine to
ammonium and ornithine may provide a mechanism to divert plant nitrogen into the
production of amino acids indispensable for pathogen multiplication. Plasmodia would thus
redirect host nutrients to their own benefits, thereby acting as a metabolic sink. P. brassicae
was previously proposed to interfere in host carbon metabolism following observations that
carbohydrates accumulate in infected tissues (Evans and Scholes, 1995). We also observed an
acute accumulation of proline in Col-0 infected roots which strengthens the idea that
susceptibility is associated with an enhancement of the metabolic flux from arginine to
proline. Free proline biosynthesis and accumulation at high levels is very common in plants
subjected to osmotic, drought or saline strains (Delauney and Verma, 1993). Of note,
although reasonable, the amounts of proline detected in infected roots in this experiment were
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 15: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/15.jpg)
15
of surprising magnitude (92 µmol.g DW-1) and this may warrant further attention. Proline,
along with γ-aminobutyric acid and α-aminoadipic acid were recently observed to strongly
accumulated in T-DNA induced Arabidopsis tumors cells and were viewed by the authors as
stress metabolites (Deeken et al., 2006). Our findings with this pathosystem, however, raise
several issues: was all the neosynthetized proline pool actually derived from ornithine through
an ornithine amino-transferase activity or was a more classically described stress-induced
glutamate to proline biosynthetic pathway involved? In which cellular and subcellular
compartments, including intracellular pathogen, does proline biosynthesis and accumulation
really take place? Without answers to these questions, it is difficult to conclude if, on one
hand, proline accumulated inside the pathogen favoring its growth, through, for instance
osmotic or oxidative protection (Chen and Dickman, 2005), or if, on the other hand, proline
accumulation in the plant tissue simply reflects attempts by plant metabolism to manage the
cellular stress caused by pathogen growth. In the partially resistant accession, agmatine
accumulation occurred at 14 and 21 dpi and slight arginase induction and proline
accumulation were observed upon inoculation. This weaker response in partially resistant
plants may suggest that the pathogen influence on host-metabolism was attenuated or delayed
compared to the situation in susceptible plants. However, as yet we cannot conclude whether
this regulation of arginine metabolism is the cause or the result of the partial clubroot
resistance.
Further investigations using various sets of mutants and overexpressors are planned in our
laboratory in order to test some of these hypotheses. For instance, genetic manipulation of
arginase expression in A. thaliana transgenic plants or quantification of arginase activity in a
range of Brassicaceae, showing extreme and intermediate levels of resistance to clubroot, will
provide insights into the physiological function of arginase in host-pathogen interactions and
in partial clubroot resistance. Moreover, mutant genotypes for genes encoding enzymes
involved in polyamine metabolism will be assessed for responsiveness to P. brassicae.
However that may be, the coordination of the multiple routes from arginine directing
metabolites towards nitrogen and carbon trophic channels, defense systems, growth regulators
or signaling compounds remain undoubtedly a major challenge for stressed plants and may be
considered as a target of prime interest within the scope of quantitative resistance to
P. brassicae.
MATERIALS AND METHODS
Pathogen
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 16: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/16.jpg)
16
The selection isolate eH (Fähling et al., 2003), used in this study, belongs to the most
virulent Plasmodiophora brassicae pathotype P1, according to the host differential set
established by Somé et al. (1996). It was kindly provided by J. Siemens (University of
Dresden, Germany).
Plant materials
Seeds of the Arabidopsis thaliana accessions Bur-0 (172AV) and Col-0 (186AV) were
obtained from the Versailles Resource Center. These accessions are partially resistant and
susceptible to the Plasmodiophora brassicae isolate eH respectively (Alix et al., 2007).
Brassica napus ssp. oleifera cv ‘Nevin’ (ECD6), Brassica napus ssp. rapifera cv
‘Wilhelmsburger’ (ECD10) and Brassica napus ssp. oleifera (Brutor), which constitute the
host differential set established by Somé et al. (1996), and the highly clubroot susceptible
Brassica rapa ssp. pekiniensis cv ‘Granaat’ (ECD5) were included as controls in each
clubroot test.
Growth conditions and inoculation procedure
Five independent experiments were performed using a two block design. Arabidopsis
seeds were placed on wet blotting paper in Petri dishes at 4°C for 3 days to synchronize
germination. Seeds were then individually sown in 4 cm-diameter pots containing a [2/3
compost, 1/3 vermiculite] mix sterilized by autoclaving. Arabidopsis plants were grown under
controlled environmental conditions (16 hours light at 22°C and 8 hours dark at 19°C) and
inoculated 7 days after germination (stage 1.04 (Boyes et al., 2001)). The inoculum was
prepared according to Manzanares-Dauleux et al. (2000a) and inoculation was performed by
applying 1mL of resting spore suspension (107 spores.ml-1) to the crown of each seedling. The
resting spore suspension was replaced by distilled water for control plants. To relate specific
host responses to the life-cycle of the pathogen, infected and control plants were then
harvested at four time points: 2, 7, 14 and 21 days post inoculation (dpi) (respectively stages
1.04, 1.08, 1.12 and 3.90 to 6.50 (Boyes et al., 2001)). In the last experiment, infected and
control plants were only harvested at 21 dpi (stages 3.90 to 6.50 (Boyes et al., 2001)).
Depending on the kinetic point, between 84 to 600 individual plants were harvested per
analysis point. Roots of the whole plants were thoroughly rinsed in different baths of distilled
water. Roots and leaves dissected from whole plants were frozen in liquid nitrogen and stored
at -80°C. To check that the inoculation was successful, in each test, 6 to 12 plants of each
Arabidopsis accession were evaluated for clubroot resistance at 21 dpi and symptoms were
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 17: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/17.jpg)
17
recorded using the scale previously described for Brassica oleracea (Manzanares-Dauleux et
al., 2000b) : 0 - no visible swelling; 1 - very slight swelling usually confined to lateral roots; 2
– moderate swelling on lateral roots and taproot; 2+ - severe clubs on all roots, but some roots
remain; 3 – no root left, only one big gall. A disease index (DI) was calculated: DI = (n1×25 +
n2×50 + n2+×75 + n3×100) / N, where ‘ni’ is the number of plants in the symptom class ‘i’
and N is the total number of plants tested; an accession displaying a DI of zero is completely
resistant and develops no clubroot symptoms while an accession with a DI of 100 is highly
susceptible (Manzanares-Dauleux et al., 2000b).
Real-time RT-PCR
Total RNA was extracted from approximately 30 mg of frozen root samples using the SV
Total RNA Isolation kit (Promega, Madison, Wisconsin, USA). Any remaining of genomic
DNA was removed by digestion with DNase I (DNA-freeTM, Ambion®, Austin, Texas, USA)
according to the manufacturer’s protocol. To check for genomic DNA contamination, a PCR
reaction was carried out on the RNA samples using Actin8 primers. The total RNA was
quantified with a spectrophotometer and electrophoresed on a 2% agarose gel to check the
concentration and integrity. First-strand complementary DNA (cDNA) synthesis was
performed in a 20µL total reaction volume using 250 ng DNAse-digested total RNA, 1µM
oligodT primer, 1mM dNTPs, 1X first strand buffer (Invitrogen), 20mM dithiothreitol (DTT;
Invitrogen), 40U RNaseOUT™ Recombinant Ribonuclease Inhibitor (Invitrogen) and 200U
Superscript™ II Reverse Transcriptase (Invitrogen) by incubating for 2 hours at 42°C. The
reaction was terminated by incubation for 15 min at 70°C. The cDNA was diluted by 1/40 and
their quality was confirmed by conventional RT-PCR with Actin8 primers (Table II).
For each gene, primers for real-time RT-PCR were designed on gene sequence tags
(GSTs, Hilson et al., 2004) with Primer Express® v1.5 software (Applied Biosystems) and
synthesized by Eurogentec. The genes, as well as the sequence of their specific
oligonucleotides, are presented in Table I. 3µL of cDNA was used for PCR amplification
using the SYBR-Green PCR Master kit containing a Hot start Taq polymerase (Applied
Biosystems) and 0.9µM of each specific primer, in the ABI PRISM® 7700 Sequence
Detection system (Applied Biosystems). 10µL reactions were run in duplicate in a 96-well
thin-wall PCR plate (MicroAmp Optical 96-Wells Reaction Plate, Applied Biosystems). The
PCR amplification protocol consisted of a denaturation step at 95°C for 10 min, followed by
40 cycles of 15s at 95°C and 1 min at 60°C. The SYBR Green I fluorescence signal was
measured during the 60°C annealing step. To check the annealing specificity of each
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 18: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/18.jpg)
18
oligonucleotide, melting-curve analysis (55°C-94°C) was carried out at the end of
amplification. For calculations, a standard curve was determined for each gene using different
dilutions of cDNA products. Expression levels for each target gene were then quantified
following normalization to actin8, the endogenous reference.
Arginase assays
A known weight of frozen powdered root tissues (usually 0.5 g) was ground and
homogenized in 1mL extraction buffer for 3 min. The extraction medium consisted of 100
mM Tris-HCl (pH7.5), 1% (v/v) 2-mercaptoethanol and 0.1mM phenylmethylsulfonyl
fluoride (Chen et al., 2004). Homogenates were centrifuged at 10.000xg for 15 min at 4°C
and the supernatants were used as the enzyme source. Protein concentrations were determined
by the Bradford method (Bradford, 1976). Before the arginase activity was assayed, the
enzyme extract was made up to 5mM in MnCl2 and left for 15 min at room temperature to
activate arginase (Goldraij and Polacco, 1999). A standard reaction mixture contained 450µL
125mM Tris-HCl (pH9.5), 50µL 550mM L-arginine (adjusted to pH 9.5), 25µL 44mM MnCl2
and 25µL enzyme source. Control assays were concurrently performed by removing L-
arginine or replacing native enzyme extract by boiled enzyme extract or increasing enzyme
dose in the assay. The reaction mixture was incubated with continuous agitation (500 rpm) for
45 min at 30°C and the reaction was stopped at 0, 15, 30 and 45 min by adding 500µL 10%
(v/v) perchloric acid. Precipitated proteins were removed by centrifugation at 12.000xg for 15
min and ornithine released in the medium was spectrophotometrically measured by the
Chinard method (Chinard, 1952) modified according to Roubelakis and Kliewer (1978).
Absorbances were read at 515 nm, standard L-ornithine solutions (0-250µM) were used for
calibration. To verify the results obtained by this colorimetric method, the amino acid
composition of the reaction mixture was determined by UPLC with the Waters AccQ-Tag®
amino acid analysis system as described below. Arginase activity was expressed as the
average of triplicates assays, as nanomoles of ornithine released per min per mg of protein.
Arginine-related amino acids contents
Samples were ground in liquid nitrogen and freeze-dried. Methanol-chloroform-water
based extractions were made on 10 mg of the resulting dry powder using the following
procedure: the powder was suspended in 400 µl of a 100 µM DL-3-aminobutyric acid
(BABA) solution in methanol followed by 15 min agitation at RT. 200 µl of chloroform were
then added, followed by a 5 min agitation step. Finally 400 µl H2O were added, samples were
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 19: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/19.jpg)
19
then vortexed vigorously to induce phase separation and centrifuged at 13000xg for 5 min.
The upper phase, which contains amino acids, was transferred to a clean vial and dried under
vacuum. Dry residues were resuspended in 50 µl of ultra-pure water and 10 µl were used for
the derivatization using the AccQ•Tag Ultra Derivitization Kit (Waters corporation, Milford
USA). Derivatized amino acids were analyzed using an AcquityTM UPLC system (Waters,
Milford USA). One µl of the reaction mixture was injected onto an AcquityTM UPLC BEH
C18 1.7 µm 2.1 x 100 mm column heated at 55°C. Amino acids were eluted with a mixture of
10-fold diluted AccQ•Tag Eluent A (Waters, Milford USA) and pure acetonitrile, at a flow
rate of 0.7 mL.min-1 according to the following gradient : initial, 99.9 % A ; 0.54 min, 99.9 %
A ; 6.50 min, 90.9 % A, curve 7 ; 8.50 min, 78.8 % A, curve 6 ; 8.90 min, 40.4 % A, curve 6 ;
9.50 min, 40.4 % A, curve 6 ; 9.60 min, 99.9 % A, curve 6 ; 10.10 min, 99.9 % A. Derivatized
amino acids were detected at 260 nm using a photo diode array detector. Amino acids were
characterized by co-chromatography of individual standards and quantified by comparison of
individual external calibration curves.
Isolation of free polyamines
Extraction: Dry weights were determined after freeze-drying. Approximately 5-30 mg of
powdered root samples were thoroughly mixed with 800 µL of 1M HCl supplemented with
10 µM of Heptanediamine (Hda) as internal standard, on a magnetic stirring plate (2000 rpm)
for 1h at 4°C. The homogenates were then centrifuged for 15 min at 10000xg at 4°C and the
supernatants collected. The pellets were further extracted twice with 600 µl HCl 1M and 10
µM Hda and stirred for 30 min at 4°C. The homogenates were centrifuged for 15 min at
10000xg at 4°C. The combined supernatants were used as the crude extract for
characterization and determination of free polyamines.
Chromatographic analysis: Extracted polyamines were derivatized with dansyl chloride
(5-Dimethylamino-1-naphthalenesulfonyl chloride) according to the method of Smith and
Davies (1985). Two hundred microliters of supernatant was added to 100 mg of sodium
carbonate and 600 µL of dansyl chloride in acetone (10 mg.mL-1). The mixture was incubated
overnight at room temperature. Three hundred microliters of aqueous proline (150 mg.mL-1)
was added to the mixture to remove the excess dansyl chloride. The dansylated polyamines
were further extracted with ethyl acetate. The organic phase containing polyamines was dried
under nitrogen stream and the residue solubilized with 800 µL of methanol and stored at
−20°C until analysis. Free polyamines were separated and quantified through high
performance liquid chromatography (HPLC) after yield correction with the internal standard
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 20: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/20.jpg)
20
and calibration with external standards (Hayman et al., 1985; Duhaze et al., 2002). The
mobile phase consisted of a solution of 17.5 mM potassium acetate (pH 7.17) as eluant A and
acetonitrile as eluant B. The solvent gradient was modified according to Hayman et al. (1985)
as follow: t=0 min, 70% A; t=2 min, 58% A; t=24 min, 58% A; t=25 min, 55% A; t=32 min,
55% A; t=52 min, 45% A; t=53 min, 35% A; t=64 min, 35% A; t=70 min, 20% A, t=75 min,
100% B; t=80 min, 70% A. The flow-rate of the mobile phase was 1.5 ml.min−1. The column
was then rinsed for 8 min with 70% A before the next injection. Fluorescence was measured
with an excitation wavelength of 366 nm and an emission wavelength of 490 nm. The high-
performance liquid chromatography (HPLC) design consisted of a HP series 1050 system, an
autosampler with a 20 µL injection loop, a Shimadzu RF-10AXL fluorometer and a Waters
Spherisorb 5 µm ODS2 column (4.6x250 mm). Signals were computed and analyzed using
AZUR software (Datalys).
Statistical analysis
The data were statistically analyzed using a generalized linear model [(PROC GLM of
Statistical Analysis System (SAS) software (SAS Institute Inc., 2000)]. Multiple comparisons
of means were performed using Duncan’s multiple-range test (α=0.05).
ACKNOWLEDGMENTS
We acknowledge Henri Bellis, Pascal Glory, Marcellin Deschamps and our colleagues of
OUEST-Génopole® for technical assistance and Dr Françoise Hennion for her help in
polyamine investigations. Mélanie Jubault is a PhD student funded by the French Ministry of
Research.
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 21: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/21.jpg)
21
LITERATURE CITED
Alcazar R, Cuevas JC, Patron M, Altabella T, Tiburcio AF (2006) Abscisic acid
modulates polyamine metabolism under water stress in Arabidopsis thaliana.
Physiologia Plantarum 128: 448-455
Alix K, Lariagon C, Delourme R, Manzanares-Dauleux MJ (2007) Exploiting natural
genetic diversity and mutant resources of Arabidopsis thaliana to study the A.
thaliana-Plasmodiophora brassicae interaction. Plant Breeding 126: 218-221
Ando S, Tsushima S, Tagiri A, Kamachi S, Konagaya KI, Hagio T, Tabei Y (2006)
Increase in BrAO1 gene expression and aldehyde oxidase activity during clubroot
development in Chinese cabbage (Brassica rapa L.). Molecular Plant Pathology 7:
223-234
Arasimowicz M, Floryszak-Wieczorek J (2007) Nitric oxide as a bioactive signalling
molecule in plant stress responses. Plant Science 172: 876-887
Bais HP, Ravishankar GA (2002) Role of polyamines in the ontogeny of plants and their
biotechnological applications. Plant Cell, Tissue and Organ Culture 69: 1-34
Berta G, Altamura MM, Fusconi A, Cerruti F, Capitani F, Bagni N (1997) The plant cell
wall is altered by inhibition of polyamine biosynthesis. New Phytologist 137: 569-577
Bors W, Langebartels C, Michel C, Sandermann H, Jr. (1989) Polyamines as radical
scavengers and protectants against ozone damage. Phytochemistry 28: 1589-1595
Bouche N, Fromm H (2004) GABA in plants: just a metabolite? Trends in Plant Science 9:
110-115
Bouchereau A, Aziz A, Larher F, Martin-Tanguy J (1999) Polyamines and environmental
challenges: recent development. Plant Science 140: 103-125
Boyes DC, Zayed AM, Ascenzi R, McCaskill AJ, Hoffman NE, Davis KR, Gorlach J
(2001) Growth stage-based phenotypic analysis of Arabidopsis: a model for high
throughput functional genomics in plants. Plant Cell 13: 1499-1510
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Analytical
Biochemistry 72: 248-254
Burtin D, Michael AJ (1997) Overexpression of arginine decarboxylase in transgenic plants.
Biochem. J. 325: 331-337
Cao T, Srivastava S, Rahman MH, Kav NNV, Hotte N, Deyholos MK, Strelkov SE
(2008) Proteome-level changes in the roots of Brassica napus as a result of
Plasmodiophora brassicae infection. Plant Science 174: 97-115
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 22: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/22.jpg)
22
Chen CB, Dickman MB (2005) Proline suppresses apoptosis in the fungal pathogen
Colletotrichum trifolii. Proceedings of the National Academy of Sciences of the
United States of America 102: 3459-3464
Chen H, McCaig BC, Melotto M, He SY, Howe GA (2004) Regulation of plant arginase by
wounding, jasmonate, and the phytotoxin coronatine. Journal of Biological Chemistry
279: 45998-46007
Chinard FP (1952) Photometric estimation of proline and ormithine. Journal of Biological
Chemistry 199: 91-95
Cona A, Rea G, Angelini R, Federico R, Tavladoraki P (2006) Functions of amine
oxidases in plant development and defence. Trends in Plant Science 11: 80-88
Deeken R, Engelmann JC, Efetova M, Czirjak T, Muller T, Kaiser WM, Tietz O,
Krischke M, Mueller MJ, Palme K, Dandekar T, Hedrich R (2006) An integrated
view of gene expression and solute profiles of Arabidopsis tumors: A genome-wide
approach. Plant Cell 18: 3617-3634
Delauney AJ, Verma DPS (1993) Proline synthesis and osmoregulation in plants. Plant
Journal 4: 215-223
Devos S, Laukens K, Deckers P, Straeten Dvd, Beeckman T, Inze D, Onckelen Hv,
Witters E, Prinsen E (2006) A hormone and proteome approach to picturing the
initial metabolic events during Plasmodiophora brassicae infection on Arabidopsis.
Molecular Plant-Microbe Interactions 19: 1431-1443
Duhaze C, Gouzerh G, Gagneul D, Larher F, Bouchereau A (2002) The conversion of
spermidine to putrescine and 1,3-diaminopropane in the roots of Limonium tataricum.
Plant Science 163: 639-646
Duleu S, Vincendeau P, Courtois P, Semballa S, Lagroye I, Daulouede S, Boucher JL,
Wilson KT, Veyret B, Gobert AP (2004) Mouse strain susceptibility to trypanosome
infection: an arginase-dependent effect. Journal of Immunology 172: 6298-6303
Evans JL, Scholes JD (1995) How does clubroot alter the regulation of carbon metabolism in
its host? Aspects of Applied Biology: 125-132
Fähling M, Graf H, Siemens J (2003) Pathotype separation of Plasmodiophora brassicae by
the host plant. Journal of Phytopathology - Phytopathologische Zeitschrift 151: 425-
430
Fuchs H, Sacristán MD (1996) Identification of a gene in Arabidopsis thaliana controlling
resistance to clubroot (Plasmodiophora brassicae) and characterization of the
resistance response. Molecular Plant-Microbe Interactions 9: 91-97
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 23: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/23.jpg)
23
Gechev TS, Breusegem Fv, Stone JM, Denev I, Laloi C (2006) Reactive oxygen species as
signals that modulate plant stress responses and programmed cell death. BioEssays 28:
1091-1101
Goldraij A, Polacco JC (1999) Arginase is inoperative in developing soybean embryos.
Plant Physiology 119: 297-303
Grsic-Rausch S, Kobelt P, Siemens JM, Bischoff M, Ludwig-Muller J (2000) Expression
and localization of nitrilase during symptom development of the clubroot disease in
Arabidopsis. Plant Physiology 122: 369-378
Guo F-Q, Okamoto M, Crawford NM (2003) Identification of a plant nitric oxide synthase
gene involved in hormonal signaling. Science 302: 100-103
Hanfrey C, Sommer S, Mayer MJ, Burtin D, Michael AJ (2001) Arabidopsis polyamine
biosynthesis: absence of ornithine decarboxylase and the mechanism of arginine
decarboxylase activity. The Plant Journal 27: 551-560
Hanzawa Y, Imai A, Michael AJ, Komeda Y, Takahashi T (2002) Characterization of the
spermidine synthase-related gene family in Arabidopsis thaliana. FEBS Letters 527:
176-180
Hanzawa Y, Takahashi T, Michael AJ, Burtin D, Long D, Pineiro M, Coupland G,
Komeda Y (2000) ACAULIS5, an Arabidopsis gene required for stem elongation,
encodes a spermine synthase. EMBO Journal 19: 4248-4256
Hayman AR, Gray DO, Evans SV (1985) New high-performance liquid chromatography
system for the separation of biogenic amines as their Dns derivatives. Journal of
Chromatography 325: 462-466
Hirai M (2006) Genetic analysis of clubroot resistance in Brassica crops. Breeding Science
56: 223-229
Hirai M, Harada T, Kubo N, Tsukada M, Suwabe K, Matsumoto S (2004) A novel locus
for clubroot resistance in Brassica rapa and its linkage markers. Theoretical and
Applied Genetics 108: 639-643
Ingram DS, Tommerup IC (1972) The life history of Plasmodiophora brassicae Woron
Proceedings of the Royal Society of London. Series B, Biological Sciences 180: 103-
112
Jubault M, Lariagon C, Simon M, Delourme R, Manzanares-Dauleux MJ (2008)
Identification of Quantitative Trait Loci controlling partial clubroot resistance in new
mapping populations of Arabidopsis thaliana. Theoretical and Applied Genetics In
revision
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 24: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/24.jpg)
24
Koch E, Cox R, Williams PH (1991) Infection of Arabidopsis thaliana by Plasmodiophora
brassicae. Journal of Phytopathology 132: 99-104
Kolloffel C, van Dijke HD (1975) Mitochondrial arginase activity from cotyledons of
developing and germinating seeds of Vicia faba L. Plant Physiol. 55: 507-510
Kuznetsov VV, Radyukina NL, Shevyakova NI (2006) Polyamines and stress: biological
role, metabolism, and regulation. Russian Journal of Plant Physiology 53: 583-604
Ludwig-Muller J, Pieper K, Ruppel M, Cohen JD, Epstein E, Kiddle G, Bennett R
(1999) Indole glucosinolate and auxin biosynthesis in Arabidopsis thaliana (L.)
Heynh. glucosinolate mutants and the development of clubroot disease. Planta 208:
409-419
Manzanares-Dauleux MJ, Delourme R, Baron F, Thomas G (2000a) Mapping of one
major gene and of QTLs involved in resistance to clubroot in Brassica napus.
Theoretical and Applied Genetics 101: 885-891
Manzanares-Dauleux MJ, Divaret I, Baron F, Thomas G (2000b) Evaluation of French
Brassica oleracea landraces for resistance to Plasmodiophora brassicae. Euphytica
113: 211-218
Martin-Tanguy J (2001) Metabolism and function of polyamines in plants: recent
development (new approaches). Plant Growth Regulation 34: 135-148
Mur LAJ, Carver TLW, Prats E (2006) NO way to live; the various roles of nitric oxide in
plant-pathogen interactions. J. Exp. Bot. 57: 489-505
Neuhaus K, Grsic-Rausch S, Sauerteig S, Ludwig-Muller J (2000) Arabidopsis plants
transformed with nitrilase 1 or 2 in antisense direction are delayed in clubroot
development. Journal of Plant Physiology 156: 756-761
Palmieri L, Todd CD, Arrigoni R, Hoyos ME, Santoro A, Polacco JC, Palmieri F (2006)
Arabidopsis mitochondria have two basic amino acid transporters with partially
overlapping specificities and differential expression in seedling development.
Biochimica et Biophysica Acta (BBA) - Bioenergetics 1757: 1277-1283
Perez-Amador MA, Leon J, Green PJ, Carbonell J (2002) Induction of the arginine
decarboxylase ADC2 gene provides evidence for the involvement of polyamines in the
wound response in Arabidopsis. Plant Physiology 130: 1454-1463
Pfaff AW, Villard O, Klein J-P, Mousli M, Candolfi E (2005) Regulation of Toxoplasma
gondii multiplication in BeWo trophoblast cells: cross-regulation of nitric oxide
production and polyamine biosynthesis. International Journal for Parasitology 35:
1569-1576
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 25: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/25.jpg)
25
Piao ZY, Deng YQ, Choi SR, Park YJ, Lim YP (2004) SCAR and CAPS mapping of CRb,
a gene conferring resistance to Plasmodiophora brassicae in Chinese cabbage
(Brassica rapa ssp. pekinensis). Theoretical and Applied Genetics 108: 1458-1465
Rocherieux J, Glory P, Giboulot A, Boury S, Barbeyron G, Thomas G, Manzanares-
Dauleux MJ (2004) Isolate-specific and broad-spectrum QTLs are involved in the
control of clubroot in Brassica oleracea. Theoretical and Applied Genetics 108: 1555-
1563
Roubelakis KA, Kliewer WM (1978) Enzymes of Krebs-Henseleit cycle in Vitis vinifera L.
III. In vivo and in vitro studies of arginase. Plant Physiology 62: 344-347
Saito M, Kubo N, Matsumoto S, Suwabe K, Tsukada M, Hirai M (2006) Fine mapping of
the clubroot resistance gene, Crr3, in Brassica rapa. TAG Theoretical and Applied
Genetics 114: 81-91
Schuller A, Ludwig-Muller J (2006) A family of auxin conjugate hydrolases from Brassica
rapa: characterization and expression during clubroot disease. New Phytologist 171:
145-158
Siemens J, Keller I, Sarx J, Kunz S, Schuller A, Nagel W, Schmulling T, Parniske M,
Ludwig-Muller J (2006) Transcriptome analysis of Arabidopsis clubroots indicate a
key role for cytokinins in disease development. Molecular Plant-Microbe Interactions
19: 480-494
Siemens J, Nagel M, Ludwig-Muller J, Sacristán MD (2002) The interaction of
Plasmodiophora brassicae and Arabidopsis thaliana: parameters for disease
quantification and screening of mutant lines. Journal of Phytopathology 150: 592-605
Smith MA, Davies PJ (1985) Separation and quantitation of polyamines in plant tissue by
High Performance Liquid Chromatography of their dansyl derivatives. Plant Physiol.
78: 89-91
Somé A, Manzanares MJ, Laurens F, Baron F, Thomas G, Rouxel F (1996) Variation for
virulence on Brassica napus L. amongst Plasmodiophora brassicae collections from
France and derived single-spore isolates. Plant Pathology 45: 432-439
Soyka S, Heyer AG (1999) Arabidopsis knockout mutation of ADC2 gene reveals
inducibility by osmotic stress. FEBS Letters 458: 219-223
Suwabe K, Tsukazaki H, Iketani H, Hatakeyama K, Fujimura M, Nunome T, Fukuoka
H, Matsumoto S, Hirai M (2003) Identification of two loci for resistance to clubroot
(Plasmodiophora brassicae Woronin) in Brassica rapa L. Theoretical and Applied
Genetics 107: 997-1002
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 26: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/26.jpg)
26
Suwabe K, Tsukazaki H, Iketani H, Hatakeyama K, Kondo M, Fujimura M, Nunome T,
Fukuoka H, Hirai M, Matsumoto S (2006) Simple sequence repeat-based
comparative genomics between Brassica rapa and Arabidopsis thaliana: the genetic
origin of clubroot resistance. Genetics 173: 309-319
Thomas T, Thomas TJ (2001) Polyamines in cell growth and cell death: molecular
mechanisms and therapeutic applications. Cellular and Molecular Life Sciences
(CMLS) 58: 244-258
Urano K, Yoshiba Y, Nanjo T, Igarashi Y, Seki M, Sekiguchi F, Yamaguchi-Shinozaki
K, Shinozaki K (2003) Characterization of Arabidopsis genes involved in
biosynthesis of polyamines in abiotic stress responses and developmental stages.
Plant, Cell and Environment 26: 1917-1926
Vincendeau P, Gobert AP, Daulouede S, Moynet D, Mossalayi MD (2003) Arginases in
parasitic diseases. Trends in Parasitology 19: 9-12
Von Roepenack-Lahaye E, Newman M-A, Schornack S, Hammond-Kosack KE, Lahaye
T, Jones JDG, Daniels MJ, Dow JM (2003) p-coumaroylnoradrenaline, a novel plant
metabolite implicated in tomato defense against pathogens. J. Biol. Chem. 278:
43373-43383
Walters DR (2000) Polyamines in plant-microbe interactions. Physiological and Molecular
Plant Pathology 57: 137-146
Walters DR (2003) Polyamines and plant disease. Phytochemistry 64: 97-107
Walters DR, Shuttleton MA (1985) Polyamines in the roots of turnip infected with
Plasmodiophora brassicae Wor. New Phytologist 100: 209-214
Zemojtel T, Frohlich A, Palmieri MC, Kolanczyk M, Mikula I, Wyrwicz LS, Wanker
EE, Mundlos S, Vingron M, Martasek P, Durner J (2006) Plant nitric oxide
synthase: a never-ending story? Trends in Plant Science 11: 524-525
Zonia LE, Stebbins NE, Polacco JC (1995) Essential role of urease in germination of
nitrogen-limited Arabidopsis thaliana seeds. Plant Physiol. 107: 1097-1103
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 27: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/27.jpg)
27
FIGURES
Figure 1. Polyamine biosynthetic pathway in Arabidopsis thaliana.
Figure 2. Arginine catabolism in Arabidopsis thaliana. Abbreviations: NOS, nitric oxide
synthase; ADC, arginine decarboxylase.
Figure 3. Relative transcript levels of polyamine biosynthetic genes encoding arginine
decarboxylase (ADC1, ADC2), agmatine iminohydrolase (AIH), N-carbamoylputrescine
amidohydrolase (CPA), spermidine synthase (SPDS1, SPDS2), spermine synthase (SPMS,
ACL5), and S-adenosylmethionine decarboxylase (SAMDC1, SAMDC2) in non-infected
(control) and infected roots of (A) the susceptible accession Col-0 and (B) the partially
resistant accession Bur-0 at 14 and 21 days post inoculation (dpi). Values were obtained by
real-time quantitative reverse transcriptase polymerase chain reaction and are normalized to
the host actin8 gene. Samples of control and infected roots were analyzed in duplicate in four
independent experiments. Significant differences from controls are shown at * p < 0.05, ** p
< 0.01, *** p < 0.001.
Figure 4. Relative transcript levels of the genes (A) ARGAH1 and (B) ARGAH2 encoding
arginase in non-infected (control) and infected roots of the susceptible accession Col-0 and
the partially resistant accession Bur-0 at 14 and 21 days post inoculation (dpi). Values were
obtained by real-time quantitative reverse transcriptase polymerase chain reaction and are
normalized to the host actin8 gene. Samples of control and infected roots were analyzed in
duplicate in four independent experiments. For each time point, same letters indicate non
significant difference at p=0.05.
Figure 5. Levels of arginase activity in non-infected (control) and infected roots of the
susceptible accession Col-0 and the partially resistant accession Bur-0 at 21 days post
inoculation (dpi). Arginase activity was expressed as nanomoles of ornithine released per
minute per milligram of protein. Values represent means of two replicates. Same letters
indicate non significant difference at p=0.05.
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 28: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/28.jpg)
28
Figure 6. Effect of P. brassicae inoculation on arginine-related amino acid contents in roots
of the susceptible accession Col-0 and the partially resistant accession Bur-0 at 21 days post
inoculation. Amino acid contents were expressed as micromoles per gram of dried weight.
Values represent means of two replicates. For each amino acid, same letters indicate non
significant difference at p=0.05.
Figure 7. Contents of agmatine in non-infected (control) and infected roots of the susceptible
accession Col-0 and the partially resistant accession Bur-0 at 2, 7, 14 and 21 days post
inoculation (dpi). Agmatine contents were expressed as micromoles per gram of dried weight.
Samples of control and infected roots were analyzed in four independent experiments. For
each time point, same letters indicate non significant difference at p=0.05.
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 29: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/29.jpg)
29
TABLES
Table I. Effect of P. brassicae inoculation on free polyamine concentrations in roots of the
susceptible accession Col-0 and the partially resistant accession Bur-0 at 2, 7, 14 and 21 days
post inoculation (dpi). Values represent means of four independent experiments ±SE.
Polyamine content (µmol.g-1DW) Polyamine Genotype Inoculation
2 dpi 7 dpi 14 dpi 21 dpi
Non-inoculated 0.37 ±0.08 0.6 ±0.16 0.54 ±0.43 0.17 ±0.04 Col-0
Inoculated 0.32 ±0.11 0.58 ±0.3 0.44 ±0.14 0.26 ±0.15
Non-inoculated 0.45 ±0.17 0.46 ±0.18 0.25 ±0.03 0.22 ±0.10
Putrescine
Bur-0
Inoculated 0.38 ±0.24 0.45 ±0.17 0.35 ±0.10 0.29 ±0.08
Col-0 Non-inoculated 0.3 ±0.29 0.79 ±0.13 1.8 ±0.79 0.61 ±0.82
Inoculated 0.18 ±0.06 2.02 ±1.10 0.44 ±0.29 0.87 ±0.84
Bur-0 Non-inoculated 0.18 ±0.1 0.42 ±0.39 0.33 ±0.39 0.63 ±0.64
Spermidine
Inoculated 0.33 ±0.33 0.28 ±0.1 0.18 ±0.11 0.69 ±0.72
Non-inoculated 0.22 ±0.17 0.35 ±0.26 0.46 ±0.55 0.06 ±0.03 Col-0
Inoculated 0.18 ±0.06 0.49 ±0.45 0.08 ±0.01 0.05 ±0.02
Non-inoculated 0.14 ±0.1 0.09 ±0.04 0.07 ±0.03 0.06 ±0.01
Spermine
Bur-0
Inoculated 0.19 ±0.13 0.14 ±0.05 0.06 ±0.02 0.09 ±0.04
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 30: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/30.jpg)
30
Table II. Genes and oligonucleotides used in the real-time RT-PCR experiments.
Genes Loci Encoded proteins Primers (5’-3’)
Actin8 At1g49240 Actin TTACCCGACGGACAAGTGATC
ATGATGGCTGGAAAAGGACTTC
ADC1 At2g16500 Arginine decarboxylase CCAAGGTGTGTATCCTGTGAAAT
AGCTTCTAAACCGAATCGAAAAC
ADC2 At4g34710 Arginine decarboxylase GCGATGGACCACACAGCTTT
AGAACATCCGCTGAGGACTGA
AIH At5g08170 Agmatine
iminohydrolase
TCGAGAATGCAAGAGAGATCGTT
CATTTTCGGCGACGGAAGTA
CPA At2g27450 N-carbamoylputrescine
amidohydrolase
GATCAAGTCGAAAAGGCAAAGCT
CCATCCATAGTAAGAAGCACCTTGT
SPDS1 At1g23820 Spermidine synthase CTAATCTGGAGGATCGTTGAATTT
ATAGTCGCTCTTGCATTGTGTTAC
SPDS2 At1g70310 Spermidine synthase TTGCCCGTGAAGAGACCTAGA
TCCACCGTTCTCTGTTTCCAT
SPMS At5g53120 Spermine synthase TGGCTCCATACTCATCTTATTGAA
CGCATAGTGAACACTTTTGAATG
ACL5 At5g19530 Spermine synthase CCATCATTTGCGGACACATG
GAGACGAAAGAAGGAGCGTTTAGA
SAMDC1 At3g02470 S-adenosylmethionine
decarboxylase
TCTTTGAGCCAAGCATCTTTCA
GCAGCAGGTGTAAGAATTTCATCA
SAMDC2 At5g15950 S-adenosylmethionine
decarboxylase
TCTCCGAGATCTACCTTGAAATG
GATTCCCTATTCCTTCTCGTCCT
ARGAH1 At4g08900 Arginase /Agmatinase GTCGAGGATTATTGGTAGAAAAGG
GAACGACGCAGAATTTAGTCTATG
ARGAH2 At4g08870 Arginase / Agmatinase TGGTACTTTGGAGTTTAATCGTTG
TGTCTATGAGACCACACTTATTGC
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 31: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/31.jpg)
Figure 1. Polyamine biosynthetic pathway in Arabidopsis thaliana.
Putrescine
Arginine
S-adenosyl methionine
Decarboxylated S-adenosyl methionine
CPA
AIH
Agmatine
N-carbamoyl putrescine
Spermidine
Spermine
SPDS
SAMDC
SPMS
ADC
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 32: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/32.jpg)
Figure 2. Arginine catabolism in Arabidopsis thaliana. Abbreviations: NOS, nitric oxide
synthase; ADC, arginine decarboxylase.
Nitric oxide
Glutamate Proline
Arginine
Agmatine
Ornithine
Citrulline
Polyamines Urea
ADC
Arginase
NOS
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 33: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/33.jpg)
Figure 3. Relative transcript levels of polyamine biosynthetic genes encoding arginine
decarboxylase (ADC1, ADC2), agmatine iminohydrolase (AIH), N-carbamoylputrescine
amidohydrolase (CPA), spermidine synthase (SPDS1, SPDS2), spermine synthase (SPMS,
ACL5), and S-adenosylmethionine decarboxylase (SAMDC1, SAMDC2) in non-infected
(control) and infected roots of (A) the susceptible accession Col-0 and (B) the partially
resistant accession Bur-0 at 14 and 21 days post inoculation (dpi). Values were obtained by
real-time quantitative reverse transcriptase polymerase chain reaction and are normalized to
the host actin8 gene. Samples of control and infected roots were analyzed in duplicate in four
independent experiments. Significant differences from controls are shown at * p < 0.05, ** p
< 0.01, *** p < 0.001.
SAMDC2
0.0 0.5 1.0 1.5 2.0 2.5 3.0
14 dpi 21 dpi
* *
Rel
ativ
e m
RN
A l
evel
s 21 dpi
Bur-0 control Bur-0 infected
ADC1
0.0 0.2 0.4 0.6 0.8 1.0
14 dpi 21 dpi
* **
Rel
ativ
e m
RN
A le
vels ADC2
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5
14 dpi AIH
0.0 0.2 0.4 0.6 0.8 1.0 1.2
Rel
ativ
e m
RN
A l
evel
s
*** ***
CPA
0.0 0.5 1.0 1.5 2.0 2.5 3.0
14 dpi 21 dpi
* **
Rel
ativ
e m
RN
A l
evel
s
SPDS1
0.0 0.5 1.0 1.5 2.0 2.5
14 dpi 21 dpi
* *
Rel
ativ
e m
RN
A l
evel
s SPDS2
0.0 0.2 0.4 0.6 0.8 1.0 1.2
14 dpi 21 dpi Rel
ativ
e m
RN
A le
vels
**
*
SPMS
0.0 0.2 0.4 0.6 0.8 1.0
14 dpi 21 dpi Rel
ativ
e m
RN
A le
vels
**
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0
14 dpi
* ***
ACL5
21 dpi Rel
ativ
e m
RN
A le
vels
SAMDC1
0.0 0.2 0.4 0.6 0.8
14 dpi
*
Rel
ativ
e m
RN
A l
evel
s
21 dpi
14 dpi 21 dpi
Rel
ativ
e m
RN
A l
evel
s
B Col-0 control Col-0 infected
ADC1
0.0 0.2 0.4 0.6 0.8 1.0
14 dpi 21 dpi
* ** R
elat
ive
mR
NA
lev
els ADC2
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5
14 dpi 21 dpi Rel
ativ
e m
RN
A l
evel
s
AIH
0.0 0.2 0.4 0.6 0.8 1.0 1.2
Rel
ativ
e m
RN
A l
evel
s
*** ***
21 dpi 14 dpi CPA
0.0 0.5 1.0 1.5 2.0 2.5 3.0
14 dpi 21 dpi
* **
Rel
ativ
e m
RN
A l
evel
s
SPDS1
0.0 0.5 1.0 1.5 2.0 2.5
14 dpi 21 dpi
* *
Rel
ativ
e m
RN
A le
vels
SPDS2
0.0 0.2 0.4 0.6 0.8 1.0 1.2
14 dpi 21 dpi Rel
ativ
e m
RN
A l
evel
s
** *
SPMS
0.0 0.2 0.4 0.6 0.8 1.0
14 dpi 21 dpi Rel
ativ
e m
RN
A l
evel
s
**
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0
14 dpi
* ***
ACL5
21 dpi Rel
ativ
e m
RN
A l
evel
s
SAMDC1
0.0 0.2 0.4 0.6 0.8
14 dpi
*
Rel
ativ
e m
RN
A l
evel
s
SAMDC2
0.0 0.5 1.0 1.5 2.0 2.5 3.0
14 dpi 21 dpi
* *
Rel
ativ
e m
RN
A l
evel
s
A
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 34: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/34.jpg)
Figure 4. Relative transcript levels of the genes (A) ARGAH1 and (B) ARGAH2 encoding
arginase in non-infected (control) and infected roots of the susceptible accession Col-0 and
the partially resistant accession Bur-0 at 14 and 21 days post inoculation (dpi). Values were
obtained by real-time quantitative reverse transcriptase polymerase chain reaction and are
normalized to the host actin8 gene. Samples of control and infected roots were analyzed in
duplicate in four independent experiments. For each time point, same letters indicate non
significant difference at p=0.05.
0.00
0.05
0.10
0.15
0.20
14 dpi 21 dpi
B
Rel
ativ
e m
RN
A le
vels
b
a
b
b
b
a
b b
Col-0 control Col-0 infected Bur-0 control Bur-0 infected
0.0
0.2
0.4
0.6
0.8
1.0
1.2
14 dpi 21 dpi
Rel
ativ
e m
RN
A le
vels
A
b
a
b
c
b
a
b
a
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 35: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/35.jpg)
Figure 5. Levels of arginase activity in non-infected (control) and infected roots of the
susceptible accession Col-0 and the partially resistant accession Bur-0 at 21 days post
inoculation (dpi). Arginase activity was expressed as nanomoles of ornithine released per
minute per milligram of protein. Values represent means of two replicates. Same letters
indicate non significant difference at p=0.05.
0
20
40
60
80
100
120
Col-0 control Col-0 infected Bur-0 control Bur-0 infected
Arg
inas
e ac
tivi
ty
b
a
b b
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 36: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/36.jpg)
Figure 6. Effect of P. brassicae inoculation on arginine-related amino acid contents in roots
of the susceptible accession Col-0 and the partially resistant accession Bur-0 at 21 days post
inoculation. Amino acid contents were expressed as micromoles per gram of dried weight.
Values represent means of two replicates. For each amino acid, same letters indicate non
significant difference at p=0.05.
0
10
20
30
40
50
60
70
80
90
100
Glutamate Arginine Proline
Am
ino
acid
s co
nte
nts
(µm
ol.g
DW
-1)
Col-0 control Col-0 infected Bur-0 control Bur-0 infected
a a
a a
a a
b
a
b
b
a a
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 37: Running head : Arginine and polyamine metabolisms in ... · trauma and pathogen infection. In this study, we exploited the Arabidopsis thaliana-Plasmodiophora brassicae pathosystem](https://reader036.vdocuments.us/reader036/viewer/2022070808/5f075c8a7e708231d41c9a9e/html5/thumbnails/37.jpg)
Figure 7. Contents of agmatine in non-infected (control) and infected roots of the susceptible
accession Col-0 and the partially resistant accession Bur-0 at 2, 7, 14 and 21 days post
inoculation (dpi). Agmatine contents were expressed as micromoles per gram of dried weight.
Samples of control and infected roots were analyzed in four independent experiments. For
each time point, same letters indicate non significant difference at p=0.05.
0
0,5
1
1,5
2
2,5
3
2 dpi 7 dpi 14 dpi 21 dpi
Agm
atin
e co
nte
nts
(µm
ol.g
DW
-1)
b b
b
a
cb
c
b
a
a a
a a
a a
a a
Col-0 control Col-0 infected Bur-0 control Bur-0 infected
www.plantphysiol.orgon June 23, 2020 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.