Central Annals of Clinical and Medical Microbiology

Cite this article: Shukla A, Patil H, Raut A, Choudhary S (2015) RT-PCR More Sensitive to Nested PCR for Fast Detection Tuberculosis Infection. Ann Clin Med Microbio 1(2): 1009.

*Corresponding author

Arvind Kumar Shukla, Department of Biotechnology and Bioinformatics, D.Y. Patil University, Plot No.50, Sector- 15, C.B.D. Belapur, Navi Mumbai, 400614, Maharastra, India, Tel: 91-9768864441/ 91-9702943189;

Submitted: 07 April 2015

Accepted: 18 August 2015

Published: 16 September 2015

Copyright© 2015 Shukla et al.

OPEN ACCESS

Keywords•RT-PCR – Sputum•Nested PCR – Sputum•Drug susceptibility•MDR-TB - Mycobacterium tuberculosis

Research Article

RT-PCR More Sensitive to Nested PCR for Fast Detection Tuberculosis InfectionArvind Shukla1*, Hemant Patil2, Amol Raut3 and Sameer Choudhary4

1Department of Biotechnology and Bioinformatics, D.Y. Patil University, India2REVA Institute of Science and Management, Bangalore University, India 3Department of Molecular Biology, gene Ombio Technologies Pvt. Ltd., India4Department of Bioinformatics, RASA Life Science Informatics, India

Abstract

Background: The development of assay which is fast targeting bacterial mRNA detection which provide status of mycobacterial infection. mycobacterial viability is detected amplification tests directed at DNA or rRNA targets, mRNA is more rapidly destroyed in cells than rRNA or genomic DNA . This study was carried out to optimize reverse transcriptase PCR (RT-PCR) targeting 85B gene for the rapid detection of viable Mycobacterium tuberculosis from sputum specimens of suspected TB patients in India and to detect MDR-TB circulating in this study population in India.

Methods: Sputum samples from clinically suspected tuberculosis patients (n=8) included in the study. The random sputum samples with different drug sensitive collected in treated containers with sterile diethyl pyrocarbonate (DEPC) and chilled with ice within 2 hours in the laboratory to prevent RNA degradation. 85B gene is targeting by RT- PCR of mycobacterial culture and other phenotypic drug sensitivity testing like streptomycin, isoniazid, rifampicin, ethambutol and pyrazinamide were done by BACTEC myco MGIT culture system for all the sputum samples.

Results: All the 5 sample, only MTB Suspension 3, 4, 5 RNA confirmed in Nested PCR, RNA confirmed in MTB Suspension 1, 2, 3 in Two Step Real Time PCR and finally MTB Suspension 4, 5 RNA confirmed in One Step Real Time PCR, were sensitive confirmed to all PCR Methods for RNA detection first-line anti-tuberculosis drugs by phenotypic drug susceptibility testing.

Interpretation & conclusions: Two steps RT-PCR, one step RT-PCR and Nested PCR targeting 85B gene of M. tuberculosis was a specific, rapid, reliable technique to detect the M. tuberculosis directly from sputum specimens. Our results showed that all PCR assays were performed simultaneously and it was observed that two step Real-Time mRNA Reverse Transcriptase PCR method was rapid and specific than reported Nested PCR method. Although, one step Real-Time mRNA Reverse Transcriptase PCR was quite more rapid than two step method but did not showed amplification in all the five pure suspension of M. tuberculosis isolates in the study population of India were MDR.

ABBREVIATIONSRT-PCR: Reverse Transcriptase PCR; MDR-TB: Multi-

Drug Resistant TB; TB: Tuberculosis; MTB: Mycobacterium Tuberculosis; OPD: Outpatient Department; DEPC: Diethyl Pyrocarbonate; AFB: Acid Fast Bacilli; ATT: Anti-Tuberculous Treatment

INTRODUCTION Tuberculosis (TB) is an infectious disease and major cause of

deaths worldwide due to its high risk of transmission, morbidity

and mortality [1]. World Health Organization estimated, 8.6 million people were infected by TB in 2012. Eighty percent of the world’s TB cases were reported from high TB burden countries. India is one of the high TB burden countries. Annually, one fourth of the world’s TB cases occurred in India [2].Therefore, rapid and accurate detection of tuberculosis in routine diagnostics especially in high burden countries is a challenging task [3]. Several methods have been developed for diagnosis of TB. Microscopic methods of TB examination, such as smear microscopy are rapid and inexpensive technique and are widely applicable in developing countries. However, this method have

Central

Shukla et al. (2015)Email:

Ann Clin Med Microbio 1(2): 1009 (2015) 2/10

several disadvantages such as its sensitivity is low when bacterial load is below than 10000 cells/ml., this method requires further sputum examinations which leads loss of sensitivity and delay in diagnosis and treatment [5]. In more developed countries smear microscopy for Tuberculosis detection is confirmed by culture but these assays require long incubation periods and are expensive. It also requires specialized equipment, trained personnel, enough water and electricity supply. However, Most of the resource poor countries lacks these facilities and therefore not reliable to perform these assays [6].

Instead, a molecular method such as Polymerase Chain Reaction (PCR) for TB detection is more rapid and sensitive than other methods [6]. Because the control of TB largely depends on its early diagnosis, PCR method involves amplification of gene specific to M. tuberculosis complex by using DNA as template has proven useful and widely accepted tool for Tuberculosis detection. However, PCR using DNA as template amplifies both the DNA from live as well as dead cells and therefore it is unable to detect viability of an organism which leads to false-positive results. Whereas, Reverse Transcriptase PCR approach is used for detection of viable and non-viable M. tuberculosis bacilli [7-1].

In earlier study, K. Lily Therese and co-workers reported a Nested Reverse Transcriptase PCR (STN RT-PCR) method for Active Tuberculosis detection from sputum. The study involves amplification of transcribed cDNA with the use of MRL41&42 as outer set primers which targets 540bp region and MRL43&44 as inner set primers targeting 216bp region of the 85B Antigen gene of Mycobacterium tuberculosis. The sensitivity of the STN RT-PCR was tested by amplification of cDNA of tenfold diluted RNA. The sensitivity for the active tuberculosis detection was reported to 107 fg /µl and was specific for TB detection by Nested RT-PCR. The primers reported in the study were specific for the targeting 85B Ag protein gene and gives higher sensitivity for TB detection [8]. Nino Mdivani and coworkers reported the 1000 copies/ml sensitivity of the plasmid incorporated 85B Ag fragment by applying TaqMan one step RT-PCR assay [10].

Although, the Nested PCR method is quite sensitive and specific, have several disadvantages, such as it is time consuming because of the requirement of two rounds of amplification and labor intensive. Also, the methods involves handling of amplified DNA which may leads contamination whereas, Real Time PCR method have several advantages over Nested PCR such as it is automated and less time consuming. Also, this method does not involve handling of amplified DNA which ultimately lowers the chances of contamination [12].

Thus, in present study we have used Inner set primers reported by Therese et al., MRL 43& 44 to check its specificity on Real Time PCR system because to our knowledge specificity of these primers on Real Time PCR has not still reported. The objective of the present study was to optimize the rapid and sensitive method for active tuberculosis detection. The study also comprises comparison of Nested PCR method [8], with one step and two step Real Time PCR assays by using the same primers. Five different M. tuberculosis pure suspension with concentration 106 cells per micro liter were included in study.

MATERIAL AND METHODS Collection of sputum Sample

A total of 8 sputum samples from clinically confirmed cases of tuberculosis patients attending the OPD and pathological diagnosis of Dr. D.Y. Patil Medical College, Hospital & Research Centre, Sant Tukaram Nagar, Pimpri, Pune, Maharastra, India , were included in the study. The collected sputum samples in sterile diethyl pyrocarbonate (DEPC) (Sigma Aldrich, India) with treated containers and chilled with ice within 2 hours in the laboratory to prevent RNA degradation after getting the patients approval. It based on clinical diagnosis (chest radiograph) and direct smear by the clinician into category I: chest radiograph and direct smear positive for acid fast bacilli (AFB), category II: chest radiograph positive and direct smear negative for AFB, category III: patients with prior anti-tuberculous treatment (ATT) were categorized given 8 sputum sample included in this study.

Prepare the pure Suspension

To obtain a mycobacterial tuberculosis pure suspension by sputum sample is taken by clinically suspected tuberculosis patients. Place each sputum sample in 5 ml microcentrifuge tubes containing glass beads and five drops of sterile distilled water and shake manually for 1 or 2 min before diluted with approximately 3 ml of sterile distilled water. the suspension is allow to stand for 30 – 60 second , the homogeneous portion is removed with a micropipette and transferred to a sterile 5 ml eppendorf tubes and visually compared with the standard. This is the so – called “Pure standard suspension “.

RNA extraction and cDNA conversion

RNA extraction was done by TRIzol method was done by TRIzol method (Chomczynski and Sacchi, 1987) with few modifications. Briefly, 800 μl of TRIzol reagent was added to 200 μl of M. tuberculosis culture solution and mixed well by vortexing to dissolve the culture in Trizol reagent. 200 μl of chloroform was added in this solution and mixed by vortexing vigorously for 5-10 sec followed by centrifugation at 10,000g for 10 min in a cooling centrifuge.

The aqueous layer was transferred to a new sterile (1.5 ml) vial and 500 μl of isopropanol was added, mixed well and incubated at 40°C for 20 min followed by centrifugation at 12,000 g for10 min in cooling centrifuge. It was run in an agarose gel. It show sample 2 and 3, RNA is detected (Figure 1).

Creating a serial dilution of cDNA

For preparation of Standard cDNA sample which is serial dilution of RNA isolated MTB Sample - 2 was taken from serial dilution of cDNA as described in (Table 8). After standardization of amount of RNA isolated with respect to sample was serially diluted, till 5.0 µL of cDNA sample was taken in eppendorf tube and to this 45.0 µL of SMQ was added for dilution. cDNA sample was diluted up to 10-4. Short spin was given to the samples and kept at room temperature. The cDNA sample which was diluted during serial dilutions of 10-1, 10-2 and 10-3 of the MTB Sample.

Central

Shukla et al. (2015)Email:

Ann Clin Med Microbio 1(2): 1009 (2015) 3/10

Methods followed for comparison of RT-PCR assays

In comparison of two steps Real-Time mRNA Reverse Transcriptase PCR assay and one step Real-Time mRNA Reverse Transcriptase PCR assay, we use same Primer and same PCR condition (Table 2).

Optimization of two step RT – PCR : In two steps Real-Time mRNA Reverse Transcriptase PCR assay, first mRNA to First Strand cDNA conversion was done in total volume of 20 μL using cDNA conversion kit (Applied Biosystems, USA). Real Time assays were performed with the 7900HT fast Real Time PCR System (Applied Biosystems, USA) using a 96-well format. PCR reactions were performed in a total volume of 25µl containing 5μl of transcribed cDNA, 1μl of each primer and 12.5 µl of SYBR green PCR Mix (Applied Biosystems). The thermal cycling conditions were a 2 min degradation of the templates at 94°C and then 40 cycles of denaturation at 94°C for 45 sec and annealing at 60°C and extension at 72°C for 45 sec.

Optimization of one Step RT – PCR: In one step Real-Time mRNA Reverse Transcriptase PCR assay , PCR reactions were performed in a total volume of 25µl containing 9 μl of RNA, 1μl of each primer, 12.5 µl of one step SYBR green PCR Mix (Applied

Biosystems) and 0.5 μl of Rox. The Reverse Transcription was done by using Superscript II enzyme mix (Applied Biosystems) and step involved incubation at 48°C for 45 min. The PCR cycling conditions included an initial denaturation of 94°C for 5 min followed by 45 cycles of denaturation at 94°C for 45 sec and annealing at 60°C and extension at 72°C for 45 sec.

Optimization of Nested RT- PCR: Total 8 samples, only 2 samples of clinically suspected tuberculosis patients S2 – S3. These 2 samples are again used for PCR amplification of only Oligonucleotides MRL- 43 and MRL-44. The 216 bp region of 85B gene was amplified using two sets of primers. The amplification was carries out in two stages. The first stage of amplification reaction in a 25 µl containing 5 μl of transcribed cDNA, 1μl of each outer set primer, 2.5 μl of 10 x Buffer, 0.75 μl of Mg2+, 0.5 μl dNTPs, 0.2 μl of Taq Polymerase (Applied Biosystems) and 14.05 μl of sterile water. The thermal cycling conditions were a 2 min degradation of the templates at 94°C and then 30 cycles of denaturation at 94°C for 45 sec and annealing at 60°C and extension at 72°C for 45 sec. The second stage of amplification reaction in a 25 µl containing 5 μl of first stage PCR product, 1 μl of each outer set primer, 2.5 μl of 10 x Buffer, 0.75 μl of Mg2+ , 0.5 μl dNTPs, 0.2 μl of Taq Polymerase (Applied Biosystems) and 14.05 μl of sterile water. The thermal cycling conditions were a 2 min degradation of the templates at 94°C and then 30 cycles of denaturation at 94°C for 45 sec and annealing at 60°C and extension at 72°C for 45 sec. The primer sequence for both PCR reactions (the final extension was reduced to 10 min instead of 30 min as mentioned by Jou et al.,13) are given in (Table 1) (Figure 2) .

RESULTS AND DISCUSSION Comparison of PCR Methods for RNA detection

All PCR assays were performed simultaneously and it was observed that two step Real-Time mRNA Reverse Transcriptase PCR method was rapid and specific than reported Nested PCR method. Although, one step REAL-TIME mRNA REVERSE-TRANSCRIPTION PCR was quite more rapid than two step method but did not showed amplification in all the five pure suspension (Table 3).

Figure 1 1% Agarose (w/v) Gel Electrophoresis: Isolated RNA Product of sputum samples from clinically suspected tuberculosis patients S1 – S8. It shows sample S2 and S3, RNA is detected.

Table 1: Primers used for Nested PCR Reaction.

Oligonucleotides Sequence (5’ – 3’) Melting Temp (oC) Number of cycles Product Size

Outer set Primers30 540 bpMRL 41 GAGTACCTGCAGGTGCCGTCGCCGTC

MRL 42 CCGGGTGTTGTTTGCGACCAGCTTGInner set Primers

30 216 bpMRL 43 GACTTACAAGTGGGAAACC 56MRL 44 CCGATCAGGCTAGGCCCC 62

Table 2: Primers used for Real Time PCR Reactions.

Oligonucleotides Sequence (5’ – 3’) Melting Temp (oC) Number of cycles Product Size

M. tuberculosis 85B primers for Real Time PCR Reactions

30 216 bpMRL 43 GACTTACAAGTGGGAAACC 56

MRL 44 CCGATCAGGCTAGGCCCC 62

Central

Shukla et al. (2015)Email:

Ann Clin Med Microbio 1(2): 1009 (2015) 4/10

Optimization of Nested PCR for detection of RNA After extraction of RNA, it was run in an agarose gel. It shows

following result. MTB Sample 2, 3, 4, and 5 shows the Confirmation of RNA A fragment of size of 216 bp is expected to be generated

by MRL - 43 and MRL - 44 respectively. Approximately 200 ng was used for PCR amplification (Figure 2, Table 4).

If the smearing was observe then RNA extraction protocol was repeated and treated with Turbo DNase by remove the contaminating DNA (Applied Biosystems, USA). The RNA concentration was quantitated by using spectrophotometer and if the concentration was between 25 and 50µg/µl, it was used for performing RT-PCR. The specificity of RT-PCR was checked, using all 5 MTB Sample.

Detection for sensitivity of RT-PCR

The standard curve of the slope and Rsq values was determine the sensitivity of the assay. If the standard curve of slope is lower than –3.322 (100% Efficiency) and Rsq is less than 0.985 , here data points indicate an upward trend in the standard curve plot at the lower template concentrations , this is indicate the reaction is reaching the threshold of sensitivity, i.e., more cycles

Figure 2 2%Agarose (w/v) Gel Electrophoresis of Oligonucleotides MRL- 43 and MRL-44 PCR Products: Ladder: 500 bp standard size; Lane 1 to Lane 5 – Patients RNA Nested PCR sample. It shows sample 1 to 5, Oligonucleotides MRL- 43 and MRL-44 is amplified.

Table 3: Comparison of PCR Methods for RNA detection.

Comparison of PCR Methods for RNA detection

Culture No.Method and ResultsNested PCR Two Step Real Time PCR One Step Real Time PCR

MTB Suspension 1 RNA not detected

RNA confirmed RNA not detectedMTB Suspension 2

RNA confirmedMTB Suspension 3

MTB Suspension 4 RNA confirmed

MTB Suspension 5 RNA not detected

Figure 3a Dissociation Curves of One step Real Time RT-PCR. It shows denaturation and reannealing of RNA.

Central

Shukla et al. (2015)Email:

Ann Clin Med Microbio 1(2): 1009 (2015) 5/10

Figure 3b Amplification plot of One step Real Time RT-PCR. It show amplification of RNA.

Table 4: Optimization of Nested PCR for detection of RNA.

Sample Well No. Observation Result

MTB Sample 2 2

216 base pair band observed RNA ConfirmedMTB Sample 3 3

MTB Sample 4 4

MTB Sample 5 5

MTB Sample 1 1 No bands observed RNA not detected

Table 5: Optimization of one step RT-PCR.

Sample Ct Value Result

MTB Pure Sample 1

Undetermined RNA not detectedMTB Pure Sample 2

MTB Pure Sample 3

MTB Pure Sample 4 28.277643MTB RNA confirmed

MTB Pure Sample 5 36.078445

Table 6: Optimization of two Step RT-PCR

Sample Ct Value Result

MTB Pure Sample 1 30.945553

MTB RNA confirmedMTB Pure Sample 2 24.792305

MTB Pure Sample 3 34.583244

MTB Pure Sample 4 32.911312

MTB Pure Sample 5 Undetermined RNA not detected

Central

Shukla et al. (2015)Email:

Ann Clin Med Microbio 1(2): 1009 (2015) 6/10

Figure 4a Dissociation Curves of Two step Real Time RT-PCR. It shows denaturation and reannealing of RNA.

Figure 4b Amplification plot of two step Real Time RT-PCR. It show amplification of RNA.

Central

Shukla et al. (2015)Email:

Ann Clin Med Microbio 1(2): 1009 (2015) 7/10

are required to amplify ever decreasing amounts of template. In this case, further assay optimization or even redesign of the primers and probe may be necessary to extend the linear range. Alternatively, the points outside the linear range can be culled from the standard curve or Cts. However, MTB Samples in that concentration range may be trusted to give quantitative interpolation from that part of the standard curve, or Cts from that range should be used in RNA analysis. The Quantitative analysis of one RT-PCR for detection of RNA is shown by the data

generate a linear standard curve with a slope of – 4.401 (100 % Efficiency) which is well within the acceptable range, and an Rsq value of 1.0.

Optimization of one step RT-PCR for detection of RNADissociation Curves show the Pick at same Point of the

MTB Pure Sample 4 and 5 and Amplification Plot of MTB Pure Sample 4 and 5 is Crossing the threshold line at the point ( Ct Value ) is 28.277643 and 36.078445 .Hence there for MTB RNA is

Figure 5a Dissociation curve of MTB RNA detection by RT- PCR from different volumes. It shows denaturation and reannealing of RNA.

Table 7: MTB RNA detection by RT.

RNA detection from different volumes of M. tuberculosis suspension 2Volume of suspension taken for RNA isolation Result Ct Value

150 µl

RNA confirmed

26.707054

100 µl 30.417294

50 µl 31.412752

15 µl 34.073193

Table 8: RNA detection of diluted cDNA.

Volume of suspension taken for RNA isolation DilutionsOf cDNA Result Ct Value

150 µl 10-1

RNA confirmed

28.365713

100 µl 10-1 30.112

50 µl 10-1 32.361904

15 µl10-1 34.1243910-2 37.74880210-3 39.702652

Central

Shukla et al. (2015)Email:

Ann Clin Med Microbio 1(2): 1009 (2015) 8/10

Figure 5b Amplification Plot of MTB RNA detection by RT- PCR from different volumes. It show amplification of RNA.

Figure 6a Dissociation Curves of PCR of dilutions of cDNA of RNA from different volumes of cDNA of Pure Culture. It shows denaturation and reannealing of cDNA.

Central

Shukla et al. (2015)Email:

Ann Clin Med Microbio 1(2): 1009 (2015) 9/10

Figure 6b Amplification plot of PCR of dilutions of cDNA of RNA from different volumes of cDNA of Pure Culture. It shows amplification of cDNA.

confirmed (Figure 3: (A) (B) and Table 5).

Optimization of two step RT – PCR for detection of RNA

Dissociation Curves show the Pick at same Point of the MTB Pure Sample 1, 2, 3 and 4 and Amplification Plot of MTB Pure Sample 1,2, 3 and 4 is Crossing the threshold line at the point ( Ct Value ) is 30.945553, 24.792305, 34.583244 and 32.911312. Hence there for MTB RNA is confirmed (Figure 4: (A) (B) and Table 6).

MTB RNA detection by RT- PCR from different volumes of Pure Culture

The analytical sensitivity of two steps Real-Time mRNA Reverse Transcriptase PCR was analyzed by RNA extraction by taking different volumes of M. tuberculosis pure suspension culture (150 µl, 100 µl, 50 µl, 15 µl). mRNA from each was reverse transcribed to cDNA. Each cDNA was further diluted taken for PCR reactions (Figure 5: (A) (B) and Table 7).

MTB RNA detection by RT- PCR from diluted cDNA

The two steps REAL-TIME mRNA REVERSE-TRANSCRIPTION PCR was analyzed by RNA extraction by taking different volumes and dilution of cDNA from M. tuberculosis pure suspension culture. mRNA from each was reverse transcribed to cDNA. (Figure 6: (A) (B), and Table 8).

CONCLUSIONRT-PCR is quite sensitive and accurate method for detection of

M. tuberculosis viability over DNA-PCR [3-7]. Use of MRL primers

were proved specific for M. tuberculosis and give much sensitive detection on Nested PCR [4]. In this study, Inner set MRL 43 and 44 primers showed good sensitivity on Real Time PCR.

The primary objective of this study is to optimize RT-PCR method for rapid detection of M. tuberculosis viability. The two step Real Time PCR method have advantage over Nested PCR is that it takes less time and it is less labor intensive quite rapid and sensitive for viability detection which can used for daily routine diagnosis.

ACKNOWLEDGEMENTSI would like to gratefully and sincerely thank the deepest

gratefulness to my Research Project adviser, Dr. Amol D. Raut and Sameer Choudhary who gave me the golden opportunity to do this wonderful project in the gene Ombio Technologies Pvt. Ltd and RASA Life Science Informatics.

REFERENCES1. Lydia Kivihya-Ndugga, Maarten van Cleeff, Ernest Juma, Joseph

Kimwomi, Willie Githui, Linda Oskam. Comparison of PCR with the Routine Procedure for Diagnosis of Tuberculosis in a Population with High Prevalences of Tuberculosis and Human Immunodeficiency Virus. J. Clin. Microbiol. 2014; 42: 1012-1015.

2. TB India. 2014 – Annual Status Report.

3. van der Vliet GM, Schepers P, Schukkink RA, van Gemen B, Klatser PR. Assessment of mycobacterial viability by RNA amplification. Antimicrob Agents Chemother. 1994; 38: 1959-1965.

4. Perkins MD. New diagnostic tools for tuberculosis. Int J Tuberc Lung Dis. 2000; 4: 182-188.

5. Desikan P. Sputum smear microscopy in tuberculosis: is it still

Central

Shukla et al. (2015)Email:

Ann Clin Med Microbio 1(2): 1009 (2015) 10/10

relevant? Indian J Med Res. 2013; 137: 442-444.

6. Parsons LM, Somoskövi A, Gutierrez C, Lee E, Paramasivan CN, Abimiku A. Laboratory Diagnosis of Tuberculosis in Resource-Poor Countries:Challenges and Opportunities. Clin. Microbiol. Rev. 2011; 24: 314-350

7. Pai SR, Actor JK, Sepulveda E, Hunter RL Jr, Jagannath C.Identification of viable and non-viable Mycobacterium tuberculosis in mouse organs by directed RT-PCR for antigen 85B mRNA. Microb Pathog. 2000; 28: 335–342

8. Therese KL, Gayathri R, Dhanurekha L, Sridhar R, Meenakshi N, Madhavan HN, et al. Detection of Mycobacterium tuberculosis directly from sputum specimens & phenotypic drug resistance pattern of M. tuberculosis isolates from suspected tuberculosis patients in Chennai. Indian J Med Res. 2012; 135: 778-782.

9. Saraswat P,Swarankar ML, Bhandari A, Soni RR. Detection Of Active

Shukla A, Patil H, Raut A, Choudhary S (2015) RT-PCR More Sensitive to Nested PCR for Fast Detection Tuberculosis Infection. Ann Clin Med Microbio 1(2): 1009.

Cite this article

Female Genital Tuberculosis By Molecular Method. Int J Pharm. Bio. Sci. 2010; 1: 328-334.

10. Nino Mdivani, Haijing Li, MakaAkhalaia, Medea Gegia, Leila Goginashvili, Douglas S. Monitoring Therapeutic Efficacy by Real-Time Mycobacterium tuberculosis mRNA Detection in Sputum. ClinChem. 2009; 55: 1694–1700

11. Rana T, Singh UB, Kulshrestha V, Kaushik A, Porwal C, Agarwal N, et al. Utility of reverse transcriptase PCR and DNA-PCR in the diagnosis of female genital tuberculosis. J Med Microbiol. 2011; 60: 486-491.

12. Purcell MK, Getchell RG, McClure CA, Garver KA. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting. J Aquat Anim Health. 2011; 23: 148-161.

13. Jou NT, Yoshimori RB, Mason GR, Louie JS, Liebling MR. Single-tube, nested, reverse transcriptase PCR for detection of viable Mycobacterium tuberculosis. J Clin Microbiol. 1997; 35: 1161-1165.