Role of the hipBA Locus in Antibiotic Tolerance of

Uropathogenic Escherichia Coli

by Pooja Balani

B.Sc. in Microbiology

M.Tech. in Biotechnology

A dissertation submitted to

The Faculty of

the College of Science

Northeastern University

In partial fulfillment of the requirements

For the degree of Doctor of Philosophy

January 26, 2015

Dissertation directed by

Dr. Kim Lewis

Distinguished University Professor, Biology Department

ii

©2015

POOJA BALANI

ALL RIGHTS RESESRVED

iii

ABSTRACT OF DISSERTATION

Antibiotic sensitive bacterial communities produce phenotypic variants that are capable of

surviving killing by bactericidal antibiotics, without acquiring genetic mutations. Consequently,

these Persister cells are considered largely responsible for recurrent infections. The goal of this

study was to identify genes involved in the production of persister cells in Escherichia coli causing

urinary tract infections and to determine the role of HipBA toxin-antitoxin mediated persister

formation in vivo. We first developed a genetic screen where a culture of E. coli was chemically

mutagenized and mutants producing high numbers of persisters were enriched by repeated cycles

of antibiotic killing and regrowth. Whole genome sequencing of these mutants identified mutant

genes that were analyzed to find the probable high persister (hip) gene candidates. Out of several

identified hip gene candidates we further characterized 3 different mutations from the hipA gene.

In an otherwise wild type background 2 of the mutations conferred 1000-fold and 100-fold

increased tolerance to β-lactams which was similar to the phenotype conferred by a previously hip

associated allele of this gene (hipA7). This rediscovery of hipA from the screen confirmed that

hipA can be directly linked to a hip phenotype. We further wanted to test if high persister mutants

were enriched in UTI and commensal bacterial communities. We hypothesized that similar to our

in vitro method, cycles of antibiotic challenge and regrowth during treatment of a UTI infection

could select for high persistence in vivo. We tested the antibiotic susceptibility (Ciprofloxacin) of

a panel of 477 UTI and commensal isolates from different pathologies and saw a vast distribution

of persister phenotypes some having 10000 fold more persisters than a wildtype E. coli (MG1655).

All these strains were sensitive to the drug with no change in MIC to Ciprofloxacin. Based on our

findings from the genetic screen, we suspected that the hipBA locus of these isolates was involved

in the high persister phenotype. We sequenced the hipBA locus of these strains and found a high

iv

degree of sequence polymorphism in hipA and hipB. A striking discovery was the presence of two

of the hip alleles found in the in vitro mutants in some of the natural isolates. We further validated,

that the hipA7 mutation plays a major role in surviving antibiotic therapy in mouse urinary tract

infection and in human bladder cell tissue cultures. We also looked at the expression of the hipBA

locus in the presence of the hip mutations to find the mechanism by which HipA increases the

persister frequency in E. coli, and also the interaction of the HipBA proteins with each other.

HipA7 was found to increase the expression of the locus, by lowered binding affinity to the HipB

molecules and altered HipA-HipA interaction during the autoregulation of the operon. To further

characterize the hipA locus we characterized the phylogenetic group specific alleles of hipA from

the clinical isolates and determined the recombination patterns among the sequences using

bioinformatic tools. We identified group specific alleles that may result in altered regulatory

potential of the operon. Mapping these mutations onto the hipBA structures and testing their

persister phenotype in in vivo bladder cell culture assays will determine the structure-function

relationships of this clinically important persister locus.

v

ACKNOWLEDGEMENTS

Through all the years of my PhD, several people have stood by me to help me achieve this

milestone. My biggest thank you goes to my advisor, Kim Lewis for giving me this tremendous

opportunity to be part of this amazing team. Thank you for your advice and being so encouraging

and patient through all the times of failed experiments and hipA disasters. I would also like to

thank Marin Vulić my co-advisor and mentor. Thanks for all the advice and genetics lessons over

the years. I would have never been able to do this without you. Eric Stewart, my first contact with

the lab and committee member, thank you for all the feedback on the sequencing data. A big thank

you to all my committee members, Veronica Godoy, Yunrong Chai, collaborators Richard

Brennan and Maria Schumacher for your helpful feedback at the committee meetings.

I would also like to thank, Gabriele Casadei, Laura Fleck, Chao Chen and Alyssa Theodore,

for help with the animal studies. Alyssa Theodore, my bench and E. coli buddy, thanks for your

friendship and smiles for all these years. Sonja Hansen, for all the help with HipA protein data,

things make more sense talking to you. Tobias Dorr, Sarah Rowe and Ron Ortenberg for help with

cloning work. My undergraduate students, Dan Marsden , Gabriell Premkumar, Ruchita Chawla

and Nicholas Waters for all the help with my work. A special thanks to all the Lewis lab girls,

Katya Gavarish, Kathrin Fenn, Heather Torrey, Pallavi Murugkar, Caitlin and Sonja Kleffel, for

making this a wonderful place to work every day. Also to all the past and current members, Yue,

Autumn, Brian, Phil, Bijaya, Lauren, and Michael.

My husband and best friend Mayur, thank you for your support, encouragement and keeping

me sane through the years of my PhD and all your understanding while I wrote this dissertation.

And lastly, I want to thank my Grandma, Parents and Parents-in-law, for all the blessings, prayers

and support for following my dream.

vi

TABLE OF CONTENTS

ABSTRACT…...………………………………………………………………………………… iii

ACKNOWLEDGEMENTS………………………………………………………………………… v

TABLE OF CONTENTS………………………………………………………………………….. vi

LIST OF ABBREVIATIONS………...…………………………………………………………… vii

LIST OF FIGURES................………………………………...……………………………….... ix

LIST OF TABLES……….…………………………………………………………………........ xi

CHAPTER1: INTRODUCTION………………………………………………………………… 1

CHAPTER 2: MUTATIONS IN THE HIPA KINASE CAUSE ANTIBIOTIVVC TOLERANCE IN CLINICAL

ISOLATES OF BACTERIAL PATHOGENS……………………………………………...... 9

2.1 Introduction ……………………………………………………………….. 9

2.2. Results …………………………………………………………….……… 11

2.3. Discussion ………………………………………………………………... 36

2.4. Materials and Methods …………………………………………….…….. 39

CHAPTER 3: PHYLOGENETIC DISTRIBUTION OF HIPBA ALLELES AND THEIR INFLUENCE ON THE

PERSISTER PHENOTYPE OF NATURAL ISOLATES OF ESCHERICHIA COLI ………..........………...….... 48

2.1 Introduction ………………………………………………………………… 48

2.2. Results……………………………………………………………………... 51

2.3. Discussion & Future directions…………………………………………..... 63

2.4. Materials and Methods ………………………………………………...…... 66

CHAPTER 4: DISCUSSION…..…………………………………………………………………. 68

APPENDIX I: ADDITIONAL FIGURES ……….....………………………………………………… 70

APPENDIX II: ADDITIONAL TABLES ….………………………………………………………… 79

REFERENCES.…………………………………….…………………………………………….. 85

vii

LIST OF ABBREVIATIONS

Amp Ampicillin resistance marker

Cam Chloramphenicol resistance marker

Cfu Colony forming units

Cipro Ciprofloxacin

Cro E. coli commensal isolate from Croatia

E. coli Escherichia coli

FBS Fetal bovin serum

Genta Gentamycin

Hip High persister

Kan Kanamycin resistance marker

LBB/LBA Luria Bertani broth/agar

M E. coli commensal isolate from Mali

MIC Minimum inhibitory concentration

Minn E. coli Commensal isolate from University of Minnesota

O/N Overnight grown culture

OD Optical density

PCR Polymerase chain reaction

Phylogroup Phylogenetic group

ppGpp Guanosine pentaphosphate

QIR Quiescent intracellular reservoir

viii

TA Toxin-antitoxin systems

UPEC Uropathogenic Escherichia coli

Uropathogen Urinary tract infection causing bacteria

UTI Urinary tract infection

VDG E. coli commensal isolate from Val de Grace

W(number) E. coli clinical isolate from Washington university (number)

WT Wild type

ix

LIST OF FIGURES

Figure 1-1: Bisphasic killing of a bacterial culture …………………………………………. 2

Figure 1-2: Structure of HipA-HipB complexed with DNA and regulation of the operon…….. 5

Figure 1-3: Pathway of HipA-mediated persister formation ………………………………...... 6

Figure 2-1: A schematic of the Genetic screen. ………………………………………………. 13

Figure 2-2: Enrichment of persisters from EMS mutagenized cultures …………………….... 14

Figure 2-3: Tolerance of E. coli hip strains to antibiotics …………………………………… 17

Figure 2-4: Persister phenotype of knockout strains of the gat operon in exponential phase … 18

Figure 2-5: Knockouts of candidate persister genes showed no effect on persister formation. 20

Figure 2-6: Persister phenotype of the three hipA mutant alleles …………………………… 22

Figure 2-7: Validation of the persister phenotype of the three hipA mutant alleles ………….. 23

Figure 2-8: hipA7 allele increase the expression of the hipBA operon ……………………… 25

Figure 2-9: Crystal structure of a hipA showing all hipA mutations found in in vitro mutants... 27

Figure 2-10: Persister profiles of clinical and commensal strains with hipA7 mutations ……. 29

Figure 2-11: Validation of the hipA7 and P86L allele phenotypes in clinical strains of E. coli 30

Figure 2-12: A schematic overview of the bladder cell culture ……………………………… 32

Figure 2-13: Survival of hipA mutants in Bladder cell tissue cultures ……………………… . 33

x

Figure 2-14: Tolerance of hipA mutants to clinical doses of Ciprofloxacin in a mouse model

of UTI infection ………………………………………………………………… 34

Figure 3-1: E. coli natural isolate collection ………………………………………………….. 50

Figure 3-2: Persister profiles of 50 UTI isolates ……………………………………………… 52

Figure 3-3: A frequency distribution of persister levels of natural isolates of E. coli ……… 53

Figure 3-4: Persister profiles of 8 triplets of same patient recurrent UTI strains ……………. 53

Figure 3-5: hipA sequencing results ………………………………………………………….. 58

Figure 3-6: Distribution of 450 natural isolates of E. coli based on their phylogenetic groups 60

Figure 3-7: Phylogenetic tree based on the hipA sequences of natural isolates …………….. 61

Figure S1: Persister phenotype of ΔgatC, ΔgatD and ΔgatR strains in the stationary phase ... 70

Figure S2: Effect of gatC frameshift mutation with a glpR deletion …………………………. 71

Figure S3: Growth curve of the UTI isolates and their hipA mutants ……………………….. 72

Figure S4: Gel image of PCR profiles for the identification of the E. coli phylogenetic groups 73

Figure S5: A heatmap of the hipBA mutations ……………………………………………….. 74

Figure S6: Survival of CFT073 and its hipA mutants in mice ……………………………….. 77

Figure S7: Competition assay of CFT073 WT with CFT073 high persister hipA mutants ….. 78

xi

LIST OF TABLES

Table 2-1: A summary of the whole genome sequencing results ………………………….… 16

Table 2-2: List of strains, plasmids and primers ……………………………………………... 40

Table 3-1: A summary of mutations found in hipBA operon of 477 natural isolates of E. coli . 55

Table S1a: List of all changes in hipA in the UTI and commensal strains …………………… 79

Table S1b: List of all changes in hipB ……………………………………………………….. 82

Table S1c: hipBA operator site mutations ..………………………………………………… 83

Table S2: List of Primers used in this study …………………………………………………. 83

1

CHAPTER 1

Introduction

1.1 Persisters and the problem of recurrent infections:

Human beings are in a constant battle with microbes, with microbes winning some times

because of strategies we do not completely understand the mechanisms of. Chronic and recurrent

infections pose a threat to humans and the mechanisms by which bacteria evade the host responses

and the killing action of antibiotics is not fully understood for many infections. Most bacterial

populations can be eradicated with the use of antibiotics and with the help of the body’s immune

system. However, in most bacteria tested so far, a subpopulation of cells always survives, no matter

what the concentration of the antibiotic used (Lewis 2010) This small subpopulation of

phenotypically specialized cells in a bacterial culture serves the sole purpose of surviving the

killing action of antibiotics or other stresses. These “Persisters” do not die in the presence of the

antibiotic but also do not grow, unlike resistant mutants (Figure 1-1). Resistant mutants arise by

genetic modification, however persisters are not mutants but are phenotypic variants of the wild

type that were until recently thought to arise only due to stochastic fluctuations in the cell (Balaban,

Merrin et al. 2004). Cells of a population grown from the surviving persisters are as sensitive to

antibiotics as the original population (Bigger 1944) thus suggesting that the persister state is a

transient, non-heritable change (Keren, Kaldalu et al. 2004; Wiuff, Zappala et al. 2005). Recent

discoveries in the field, point to stress induced persister formation (Fridman, Goldberg et al. 2014).

. The first discovery of persisters was made in the early 1940s when Joseph Bigger observed

that cultures of Staphylococcus aureus could not be completely sterilized with Penicillin, but the

2

survivors were not resistant to the drug (Bigger 1944). The next major discovery in understanding

persisters, came several decades later when Harris Moyed and his group isolated persisters to

ampicillin and identified a gene hipA, was responsible for the phenotype. Several advances have

been made since then to understand the complex metabolic systems involved in persister

formation. Persisters have been shown to be non-growing (Balaban, Merrin et al. 2004) but

metabolically active and formed in response to antibiotic stress (Dörr, Lewis et al. 2009; Dörr,

Vulić et al. 2010). They can consume metabolites and even respire in this semi-quiescent state

(Luidalepp, Jõers et al. 2011)

Figure 1-1: Biphasic killing of a culture. An exponentially growing culture is treated with an

antibiotic. Majority of the cells (regular cells) die except a small subpopulation of antibiotic

tolerant cells that survive the treatment (persisters) but do not grow in the presence of the antibiotic

like resistant mutants. (Figure adapted from Lewis K., 2006)

1.2. Bacterial Toxin-antitoxin systems and their role in antibiotic tolerance:

3

Five types of toxin-antitoxin (TA) systems are present in bacteria. The Escherichia coli str.

K-12 genome encodes at least 36 putative TA systems, and according to biochemical and

bioinformatic analyses these majorly consist of type I and type II systems. Most have redundant

functions wherein they stop cell growth under different conditions (Tsilibaris, Maenhaut-Michel

et al. 2007). It is thought that they have an evolutionary advantage in surviving harsh conditions.

Many genes have been linked to persister cell formation and some of them are TA modules (Shah,

Zhang et al. 2006; Vazquez-Laslop, Lee et al. 2006). To date 16 type 2 TA systems have been

identified in E. coli (Pedersen, Christensen et al. 2002; Gerdes, Christensen et al. 2005). Many of

these toxins when overexpressed inhibit major cellular processes like transcription and translation

and inducing the stringent response by activating ppGpp, all resulting in reversible growth arrest

which can be rescued by the expression of their antitoxins (Pedersen, Christensen et al. 2002;

Christensen and Gerdes 2003; Korch and Hill 2006). Individual knockouts of these genes show no

change in phenotype. However, when 5 or more of these TA pairs are knockedout together, the

tolerance to antibiotics is reduced substantially (Maisonneuve, Shakespeare et al. 2011),

suggesting that TA systems have redundant and overlapping functions making these systems

excellent candidates for persister genes.

The first TA system to be linked to persisters was the hipBA locus that was identified in a

study targeted towards finding hip mutants of Escherichia coli (Moyed and Bertrand 1983). The

allele identified by this screen, hipA7, consisted of two point mutations in the hipA toxin gene

that increased the tolerance to β-lactams 1000-10000-fold as compared to the wild type (Moyed

and Bertrand 1983). Recent studies have made advances in finding other TA systems that are

important for persister formation.

4

1.3. Importance of the hipBA locus in the bacterial cell:

HipBA are a Type II toxin-antitoxin pair, where HipA is a toxic protein and HipB is its

antitoxin. From work done on hipA in the past decade we know that its protein product is toxic to

the cells in strains lacking a functional HipB (Black, Kelly et al. 1991). A study by Korch et. al.

showed that overexpression of hipA in a wild type culture caused a sharp increase in persister

formation (Korch and Hill 2006). In an initial effort to identify the role of hipA in the cell, a BLAST

search for hipA-like sequences revealed that HipA belongs to a phosphatidylinositol 3/4-kinase

superfamily. It was further characterized as a serine/threonine kinase (Correia, D'Onofrio et al.

2006). Sequence analysis of hipB revealed that HipB is a DNA binding protein that binds to 4

operator sites of the hipBA operon and regulates the expression of the operon. The sites are

composed of an 18 bp sequence, TATCC(N8)GGATA (N represents any nucleotide), the ends of

which are conserved. (Black, Kelly et al. 1991; Black, Irwin et al. 1994) (Figure 1-2).

The two molecules of HipB bind to 2 molecules of HipA and cooperatively bind to the

operator sites on the DNA (Figure 1-2 A, B). HipA is a toxin with a catalytic ATP binding core,

and is in the active state when ATP is bound to it. We know from evidence presented by

Schumacher and Min et al., that HipA is never in the active form when bound to HipB. HipA is

activated by its release from HipB and binding to ATP (Correia 2006). The active HipA then

phosphorylates its target glutamyl-tRNA synthetase (GltX) and inactivates it (Germain, Castro-

Roa et al. 2013). This in turn inhibits the aminoacylation of glutymyl-tRNA by GltX and results

in the binding of this incomplete tRNAGlu to the A-site of the ribosome. This triggers the activation

of the RelA toxin, which triggers the production of ppGpp. ppGpp causes the cell to be tricked

into a false starvation state, thus resulting in a slow growing or persister state (Figure 1-3)

(Magnusson, Farewell et al. 2005).

5

Figure 1-2: Structure of HipA-HipB complexed with DNA and regulation of the operon. A)

Crystal structure of the HipA-HipB-DNA structure. Two molecules of HipA (yellow) and two

molecules of HipB (cyan) complex with DNA (red). Arrows indicate the two hipA high persister

mutations P86L and hipA7 (G22S + D291A) B) The regulatory mechanism of the hipBA locus.

Orange ovals indicate HipA molecules and red ovals are HipB. The arrow indicates the promotor

region. [Adapted from (Schumacher, Piro et al. 2009)]

A

B

6

All these properties of hipA make it an excellent candidate for a persister gene. The important

questions that remain unanswered are - what is the exact mechanism of HipA mediated persister

formation and what are the possible implications of this in a clinical environment?

Figure 1-3: Pathway of HipA mediated persister formation. A scheme of events after the

release of free HipA in the bacterial cell, that result in persister formation. (Germaine et. al. 2013)

1.4. Urinary Tract infections caused by Escherichia coli:

Persisters have been implicated in antibiotic recalcitrance of chronic recurrent infectious

diseases like cystic fibrosis (Lewis 2007), tuberculosis (Barry, Boshoff et al. 2009), urinary tract

infections (Schilling and Hultgren 2002) and cancer (Sharma, Lee et al. 2010). Evidence

suggesting a link between persisters and chronic infections was discovered by Lewis lab members

7

in Candida albicans oral thrush infections in cancer patients and Pseudomonas aeruginosa

infections in cystic fibrosis patients (LaFleur, Qi et al. 2010; Mulcahy, Burns et al. 2010). In both

these studies, multiple isolates obtained over the course of the infection, from chronic P.

aeuroginosa infections and 8 week old oral candidiasis, were tested for the presence of persisters.

There was a significant increase in the number of persisters in the later isolates compared to the

ones from the early infection. It is possible that the antibiotic recalcitrance of other chronic

infections may also be the result of the presence of high persister levels.

Urinary tract infections (UTI) are the most common recurrent infections in humans and are

caused primarily by Escherichia coli. It has been suggested that persisters may be responsible for

the recurrent nature of UTI (Schilling and Hultgren 2002). Uropathogens, especially uropathogenic

E. coli (UPEC) are highly adaptable organisms and can survive in different environments from the

human gut to the vagina and the urinary system. In a UTI infection, UPEC enter via the urethra

and infect the outermost epithelial layer of Umbrella cells in the bladder. They can multiply and

form communities in these cells called intracellular bacterial reservoirs (IBC) (Schilling and

Hultgren 2002). The cells from the IBC are released in the inside luminary region of the epithelial

layer and the UPEC can now infect the inside layers of epithelia and form dormant rosettes of cells

that survive antibiotic treatment. YefM-YoeB, YbaJ-Hha and PasTI are 3 toxin-antitoxin modules

that have been identified as being important in different stages of the UTI infection of kidneys

(Norton and Mulvey 2012) However, no evidence is presented for the importance of TA loci in

surviving in the bladder where UPEC can form quiescent intracellular reservoirs and aid in

reinfection.

8

1.5. Contribution of evolution to selection of beneficial mutations in hipA and its relevance

to persister formation:

A molecular modelling study of the hipBA locus suggested that the HipA mediated persister

phenotype can be controlled by the fluctuation of the expression of the TA system (Koh and

Dunlop 2012). Chen et. al. also found that some genes (eg. virulence genes) can be positively

selected in E. coli for enhanced virulence functions (Chen, Hung et al. 2006). Identifying the

presence of evolutionary pressures acting on this locus will provide some proof indicating the

importance of the locus in UTI infections.

1.6. Objectives of this dissertation:

- Develop a novel screen for the selection of high persister mutants from chemically

mutagenized populations of E. coli and identify genes that are responsible for this phenotype.

- Screen for high persister mutants in clinical strains of E. coli from UTI infections.

- Screen for high persister mutations in the hipBA locus to identify clinically relevant mutations

that increase drug tolerance.

- Determine the significance and the mechanism of hipA mediated persister formation in vivo.

9

CHAPTER 2

Mutations in the HipA kinase cause antibiotic tolerance in clinical

isolates of bacterial pathogens

1Pooja Balani, 1,3Marin Vulić, 1,4Sonja Hansen, 2Maria Schumacher, 1Gabriele Casadei, 1,5Laura

Fleck, 2Richard Brennan, 1Kim Lewis

1 Antimicrobial Discovery Centre, Northeastern University, Boston, MA;

2 Duke University School of Medicine, Durham, NC;

3 Seres Health, Cambridge MA, USA (Current address)

4 Helmholtz Centre for Infection Research, Braunschweig, Germany (Current address)

5 BioHelix Corp., Beverly MA, USA (Current address)

(Part of this study is submitted to Nature)

2.1. INTRODUCTION

Bacterial cultures produce a small subset of cells that can survive stressful conditions like

antibiotic treatment and other harsh physiological stresses like high pH and temperature, without

altering their genomes or developing resistance characteristics. These ‘persister’ cells help in

restarting growth and carrying forward the population after the stress has passed. This study aims

to identify genes controlling persister cell formation in Escherichia coli and to understand how

these genes function in their relevant biological processes. We used a genetics based screening

10

method for screening in vitro generated mutants and coupled that with genome sequencing

methods to find the genes responsible for the high persister (hip) phenotype in Escherichia coli.

The majority of infectious disease in humans are caused by biofilms (Hall-Stoodley,

Costerton et al. 2004). It has been shown that biofilms and planktonic cells show similar killing

by antimicrobials. However, the persisters present inside the biofilms are protected from the

immune system (for example from engulfment by macrophages) due to the presence of an exo-

polysaccharide matrix. The presence of this matrix makes biofilms extremely recalcitrant to killing

by antimicrobials (Spoering A L 2001). Consequently, persister cells are considered to be

responsible for maintaining untreatable chronic infections (Lewis 2007).

We propose here that repeated application of high doses of antibiotics during treatment of an

infection could select for hip mutants (LaFleur, Qi et al. 2010; Mulcahy, Burns et al. 2010). Urinary

tract infections are the most common infections caused by extra-intestinal E. coli (Jakobsen,

Garneau et al. 2011). We obtained a collection of urinary tract infection and gut commensal strains

of E. coli and screened several strains to identify hip mutants. Many genes have been linked to

persister cell formation and some of them are toxin-antitoxin (TA) modules (Shah, Zhang et al.

2006; Vazquez-Laslop, Lee et al. 2006). To date 16 Type II TA systems have been identified in E.

coli (Pedersen, Christensen et al. 2002; Gerdes, Christensen et al. 2005). Many of these toxins

when overexpressed inhibit major cellular processes such as transcription and translation or cause

reversible growth arrest which can be rescued by the expression of their antitoxins (Pedersen,

Christensen et al. 2002; Christensen and Gerdes 2003; Korch and Hill 2006). The first TA system

to be linked to persisters in vitro was the hipBA TA locus that was identified in a study targeted

towards finding hip mutants of E. coli (Moyed and Bertrand 1983). The allele identified by this

screen, hipA7 consisted of two point mutations in the hipA toxin gene that increased the tolerance

11

to β-lactams 1000-10000-fold compared to wild type (Moyed and Bertrand 1983). These properties

of hipA make it an excellent candidate for a persister gene in a clinical setting. We sequenced the

hipBA operon of these natural isolates and found several mutations in the gene, which we further

confirm to be clinically relevant and necessary for surviving antibiotic treatments in vivo. We used

the fluoroquinolone antibiotic ciprofloxacin, because with the increase in resistance to the standard

trimethoprim-sulphamethoxizole drug therapy, Ciprofloxacin is becoming a preferred treatment

option for UTI. Using a clinically relevant antibiotic was crucial for this work in order to mimic

conditions in the clinical environment and find the link between persisters and high persister genes

in E. coli.

2.2. RESULTS

2.2.1. A novel genetic screen for high persister mutants in Escherichia coli

The goal of developing this screen was to identify genes involved in persister cell formation

in E. coli. We used a modified approach based on the first screen to identify a persister genes in

1983 (Moyed and Bertrand 1983). An Escherichia coli K12 MG1655 wild type strain was used for

the selection of in vitro hip mutants. As shown in Figure 1, we chemically mutagenized

exponentially growing cultures of E. coli using ethyl methanesulphonate (EMS) (Miller 1992), a

chemical mutagen that produces random nucleotide substitutions by guanine alkylation. Persisters

were then enriched by cyclic growth and antibiotic treatment, and high persister mutants selected

and validated by testing persister phenotype in exponential and stationary phase. The genomes of

clones with high persister levels in both phases of growth and with no alterations in MIC or growth

rate were sequenced by whole genome sequencing to identify the mutant genes.

12

We did three rounds of chemical mutagenesis and screening and selected 9, 7 and 24 high

persister mutants from each round. The time of exposure to EMS was reduced with each round to

optimize the mutagenesis. After mutagenesis the frequency of mutants to Rifampicin in the

mutagenized cultures was between 1.2 x 10-5 – 7.3 x 10-6 or 100 to 1000-fold higher than the

control wild type of 6.2 x 10-8, indicating effective mutagenesis. As different classes of antibiotics

have different targets, we used 2 major classes of antibiotics, β-lactams and fluoroquinolones, to

allow us to select hip mutants with a greater diversity of mutant genes. In the growth phase, the

persister fraction is highest in late exponential phase (Keren, Kaldalu et al. 2004). After growing

the mutagenized pools to late exponential phase to get maximum persisters, the cultures were

subjected to either a single antibiotic or a combination of two or three antibiotics (Figure 2-2).

After four rounds of antibiotic enrichment cycles the persister fraction increased by 300-fold,

wherein 90-100% of the population was high persister mutants. The cultures from the final

enrichment step were plated and individual clones were selected for further screening. A

characteristic of persisters is that they are multidrug tolerant cells, so the persister phenotype of

the selected clones was tested with two different antibiotics in exponential phase of growth and

stationary phase. The antibiotic tolerance of the selected clones in log and stationary phase is

shown in Figure 2-3.

13

Figure 2-1: A schematic of the Genetic screen. An exponentially growing culture is exposed to

EMS. Following the treatment, 4 cycles of antibiotic treatment and regrowth enrich for hip

mutants. Individual hip mutants are selected by plating the cultures and picking random colonies.

The selected hip mutants are tested for hip phenotype in exponential and stationary phase and sent

for whole genome sequencing.

1.E+031.E+041.E+05

1.E+061.E+07

1.E+081.E+09

1st 2nd 3rd 4th

cfu

/ml

Round of Antibiotic Challenge

Pre-treatment

Post-treatment

-3

-2

-1

0

PB

D1

PB

D2

PB

D3

PB

D4

PB

D5

PB

D6

PB

D7

PB

D8

PB

D9

PB

D1

0

PB

D1

1

PB

D1

2

PB

D1

3

PB

D1

4

PB

D1

5

PB

D1

6

PB

D1

7

PB

D1

8

PB

D1

9

PB

D2

0

PB

D2

1

PB

D2

2

PB

D2

3

PB

D2

4

hip

A7

100µg/ml Ampicillin in exponential phase

0

1

2

3

PB

D1

PB

D2

PB

D3

PB

D4

PB

D5

PB

D6

PB

D7

PB

D8

PB

D9

PB

D1

0

PB

D1

1

PB

D1

2

PB

D1

3

PB

D1

4

PB

D1

5

PB

D1

6

PB

D1

7

PB

D1

8

PB

D1

9

PB

D2

0

PB

D2

1

PB

D2

2

PB

D2

3

PB

D2

4

Wild

typ

e

hip

A7

5 µl/ml Ofloxacin in stationary phase

Wash to remove antibiotic

Plate on LBA to isolate individual clones

EMS mutagenesis

Select several colonies and restreak to isolate stable clones

Test persister phenotype of individual clones in exponential and stationary phase

Check growth rate & MIC to rule out resistant mutants

Recover O/N, dilute 1:100 & grow to late exponential

phase

Grow without antibiotic

Grow with antibiotic

4 cycles

MUTAGENESIS ENRICHMENT

SELECTION OF HIGH PERSISTER MUTANTS

WHOLE GENOME SEQUENCING

14

Figure 2-2: Enrichment of persisters from EMS mutagenized cultures. Mutagenized cultures

of E. coli K12 MG1655 were grown to late exponential phase and treated with high concentrations

of a single antibiotic or a combination of 2 or 3 antibiotics. The four groups of antibiotic treatment

were with 100µg/ml Ampicillin, 100µg/ml Ampicillin + 40µg/ml Piperacillin, 100µg/ml

Ampicillin and 5µg/ml Ofloxacin+ 5µg/ml Ciprofloxacin + 40µg/ml Nalidixic acid, respectively.

After every antibiotic treatment, the cells were allowed to recover from the antibiotic stress

overnight and the antibiotic treatment cycles were repeated 3 more times resulting in enrichment

of persisters. Persister levels were monitored after each round of selection by measuring cfu/ml.

2.2.2. Whole genome sequencing revealed multiple mutations in the high persister clones

Cultures with high antibiotic tolerance in both phases of growth from the screen (Figure 2-3)

were selected to identify the genes that were responsible for their phenotype. The genomes of these

clones were sequenced and mutations were identified by comparing to the wild type. SNP analysis

revealed several overlapping mutations. Screen 1 where the cultures were exposed to EMS for a

longer period of time showed an average of 63.4 mutations/clone with a maximum of 98 mutations

in one clone. The extremely high rate of mutation would make it difficult to pinpoint and analyze

the mutations conferring hip phenotype. Consequently, in the following batches we reduced the

EMS exposure time from 30 min to 15 min and 10mins and Screen 2 and 3 had an average of 9

1.E+04

1.E+05

1.E+06

1.E+07

1.E+08

1.E+09

Amp (100) Amp(100) + Pip(40) Amp(100) Cip(5) + Ofl(5) + Nal(40)

log

cfu

/ml

Enrichment groups

O/N Sel 1 O/N Sel 2 O/N Sel 3 O/N Sel 4

15

with a maximum of 16 mutations/clone and average of 7 and maximum of 16 mutations/clone,

respectively. To select individual genes for persister analysis, we compared the results of the three

screens and identified the genes that showed up with mutations in two or more screens (Table 2-

1), which would make them the most likely candidates. We found several independent mutations

in known persister genes, which validated our screen. We found a mutation in hns, which encodes

a nucleoid binding protein with global regulatory function. A knockout of the gene shows 4-fold

reduction in persister levels compared to wild type (Hansen, Lewis et al. 2008). Another gene,

plsX, was found to have a mutation. This gene has the same function as plsB, which is required for

the production of 1-acyl-glycerol-3-phosphate, an important component of cell wall fatty acid

biosynthesis. plsB has been identified as a candidate persister gene (Spoering, Vulic et al. 2006).

It has been found that although PlsB plays the principal role in 1-acyl-G3P production, PlsX also

has an important role in this production and is important for the optimal growth of E. coli

(Yoshimura, Oshima et al. 2007). A recent study based on the selection of high persister mutants

with tolerance by maintaining a longer lag phase, with no alteration to growth rate, identified a

mutation in the prs locus to be involved in the production of this phenotype. We also found the

exact same mutation in this locus. Finding these genes in our screen validates the method of the

screen for identifying persister genes.

A promising result from the screen was the rediscovery of hipA. hipA showed 3 independent

mutations in this locus in every round of screening. We found no mutations in any other Toxin

antitoxin modules.

16

Gene Annotation Screen

1

Screen

2

Screen

3

sfmD Salmonella fimbriase homologue 3 1

ybhJ Hypothetical protein, paralogue of a aconitase hydratase 2 2

cydC Transporter protein. Maintains redox balance 3 3

mdoG Regulates osmoregulated periplasmic glucan synthesis 1 2

galU Colanic acid building block biosynthesis. Mutant unable

to form biofilm in Salmonella

1 1

fnr FNR is the primary transcriptional regulator that

mediates the transition from aerobic to anaerobic

growth through the regulation of hundreds of genes

2 1

hipA Toxin of HipBA. High persister protein. Ser/Thr Kinase 4 1 4

ydbA Different mutations, uncharacterized 3 1

rfbA Cold shock protein 1 1

yehM No information 1 1

purF Denovo purine synthesis 3 1

cca Mutant shows slow growth 3 1

yihS Mannose isomerase 2 1

gatC Galacitol permease IIC 4

Table 2-1: A summary of the whole genome sequencing results. Whole genome sequencing

results from the three screens were compared and genes that showed mutations repeatedly in 2 or

more screens were selected for further analysis.

17

Figure 2-3: Tolerance of E. coli hip strains to antibiotics (A) Exponential cultures- Cells from overnight LB cultures were diluted

1:100 into fresh LB and grown to 108 cells/ml. After exposure to 100 µg/ml of ampicillin for 3 hours cells were pelleted, washed and

plated for CFU counts (B) Stationary cultures - Overnight LB cultures were exposed to 5 µg/ml of ofloxacin for 6 hrs, then pelleted,

washed and plated for CFU counts. The dotted line indicates wild type persister levels. All values are an average of three replicates

and the error bars indicate standard error.

Log

% S

urv

ival

A

B

18

2.2.3. The galactitol uptake (gat) operon does not play a role in persister formation

Six in vitro hip mutants from the nine sequenced in the first round of whole genome

sequencing had a +2 frame shift mutation at position 915 of gatC. gatC encodes the substrate-

specific domain IIC of a galactitol specific enzyme of the carbohydrate phosphotransferase system.

Due to the possible polar effect of the gatC mutation, genes downstream to gatC in the operon,

gatD and gatR, were also tested.

Figure 2-4: Persister phenotype of knockout strains of the gat operon in exponential phase

(A) ΔgatR (B) ΔgatD and (C) ΔgatC. The strains were constructed using the Keio knockout

library. Strains were grown to late exponential phase and treated with 100µg/ml ampicillin; cells

were plated at each time point to determine CFU counts. All values are an average of three

replicates and the error bars indicate standard error.

19

gatD encodes an NAD dependent galactitol-1-phosphate dehydrogenase and gatR encodes a

repressor for the gat operon. Knockouts of the three strains were constructed in E. coli K12

MG1655 wild type background using the Keio collection (Baba, Ara et al. 2006). The Keio

collection is an ordered knockout library of nonessential single gene deletions replaced with a

Kanamycin cassette in E. coli K-12 BW25113. Deletion of gatC, gatD and gatR showed no

increase in persister levels compared to wild type in stationary phase with 5 µg/ml ofloxacin

(Figure S1-Appendix II). Exponentially growing cultures of ΔgatR and ΔgatD (Figure 2-4 A, B)

also showed wild type persisters levels with 100 µg/ml ampicillin, However, the ΔgatC strain

(Figure 2-4 C) showed 10-fold increase in persisters. The original in vitro hip mutants from the

screen with the gatC frameshift mutation produced 1000-fold more persisters compared to the wild

type in exponential phase (data not shown). The results from the gatC knockout experiments

indicate that gatC was only partially responsible for the hip phenotype of these in vitro mutants.

On further analysis it was found that the wild type used for the generation of the mutant pool in

the first screen also had a glpR mutation which resulted in the hip phenotype (Freddolino, Amini

et al. 2012). We also tested the phenotype of the mutation by transferring the double +2 frameshift

into a glpR+ and a glpR- MG1655 background, and found that when the glpR mutation was

removed there was no effect of gatC on persister formation. glpR is the repressor of the glycerol

utilization operon (Schweizer, Boos et al. 1985) and was shown by our group.

2.2.4. Knockouts of high persister candidate genes do not change persister phenotype

To test the roles of the overlapping genes between the screens (Table 2-1) we made knockouts of

the genes in an MG1655 background and included hns as a control. Surprisingly, except for hns in

20

exponential phase, no significant changes in phenotype were seen in exponentially growing or

stationary phase cells of these knockouts. So these genes were not looked into further

Figure 2-5: Knockouts of candidate persister genes showed no effect on persister formation.

Candidate persister genes were knocked out from a wild-type MG1655 strain to assess their effect

on persister formation. The persister phenotype was assessed in exponential phase with 100µg/ml

Ampicillin and in stationary phase with 5µg/ml Ofloxacin. The values are an average of 5

independent experiments and the error bars indicate standard deviation.

2.2.5. Characterization and validation of hipA mutations reveals an important role in

multidrug tolerance of E. coli

hipA was the first gene to be associated with persister formation in E. coli (Moyed and

Bertrand 1983). hipA is the toxin of the hipBA toxin antitoxin module. A knockout of this gene

shows no change in persister phenotype. However, the hipA7 allele of this gene (carrying two

mutations in hipA) increases the frequency of persisters tolerant to β-lactams by 1000-fold (Moyed

and Bertrand 1983). Also, it has been shown that overexpression of the wild type gene causes

growth arrest (Falla and Chopra 1998; Kaldalu, Mei et al. 2004; Correia, D'Onofrio et al. 2006;

-5

-4

-3

-2

-1

0

1

2

3

ΔgalU Δfnr ΔpurF ΔyehM ΔmdoG Δhns ΔydbA1 ΔybhJ ΔrfbA ΔsfmD WildType

hipA7

log

% s

urv

ival

Deletion mutants of candidate persister genes

Amp Oflo

21

Korch and Hill 2006). Thus the identification of a hipA mutation in the in vitro mutants validates

the screen.

To test the phenotype of the mutation we transferred this allele into a wild type background

by P1 transduction (Miller 1992). hipA mutations have been suggested to give dual tolerance, to

β-lactams and fluoroquinolones (Falla and Chopra 1998; Kaldalu, Mei et al. 2004). The SNP

analysis of the in vitro mutants revealed 3 independent mutations in the hipA toxin gene. We tested

the phenotypes of the three mutations, hipAP86L hipAG99D and hipAP66L, in a wild type

background by transferring the point mutations into an MG1655 strain. Our results show that the

hipAP86L mutation shows a dramatic increase in persisters to ampicillin by 1000-fold (Figure 2-

6A) and 100-fold to ciprofloxacin (Figure 2-6 B), which is similar to the phenotype of the

previously identified hipA7 high persister mutant. hipAG99D had a smaller effect on increase in

tolerance to ampicillin and ciprofloxacin (100 fold, 10 fold) (Figure 2-6A, B), but hipAP66L

cultures, although collapsed at a much slower rate than the wild type, finally reached to wild type

levels with both antibiotics (Figure 2-6A, B). Because, persister genes can increase tolerance to

antibiotics in all phases of growth, we also tested the phenotypes of these mutations in the

stationary phase of growth with ciprofloxacin and tobramycin and found wild type persister levels

for all three mutations (data not shown). Mechanistically, it is an important point that all three

mutations of hipA were found in mutants selected with high levels of Ampicillin treatment. This

may suggest that hipA mutations play a role in persister formation in the growth phase but not in

their maintenance through the stationary phase.

22

Figure 2-6: Persister phenotype of the three hipA mutant alleles. Time dependent killing of

cultures with hipAP86L, hipAG99D and hipAP66L alleles in an MG1655 wild type background.

Exponentially growing cultures were treated in late log phase with (A) 100 µg/ml ampicillin or

(B) 2 µg/ml ciprofloxacin. Cells were plated at 0,1,3,6 hrs during the antibiotic treatment to

determine CFU counts. All values are an average of atleast three individual experiments and the

error bars indicate standard deviation.

-4

-3

-2

-1

0

1

2

3

0 1 2 3 4 5 6

Log

% S

urv

ival

Time in hours

hipA7 hipAP86L hipAG99D

hipAP66L hipA wild type

-3

-2

-1

0

1

2

3

0 1 2 3 4 5 6

Log

% S

urv

ival

Time in hours

Ampicillin A

Ciprofloxacin B

23

Figure 2-7: Validation of the persister phenotype of the three hipA mutant alleles: A

comparison of time dependent survival of isogenic strains of E. coli with different alleles of hipA

to 0.1 μg/ml of ciprofloxacin in exponential phase in A) original in vitro hipAP86L mutant

(MV7505 P86LhipA), ΔhipA and wild type hipA in the same background (MV7505 ΔhipA &

MV7505 WThipA), E. coli MG1655 (Wild Type) and known high persister mutant (hipA7) B)

Similar deletion and WThipA strains as of original EMS mutant C20 (C20 hipAG99D) and C)

Original EMS mutant A1 (A1 P66L)

-3

-2

-1

0

1

A1 P66LhipA A1 ΔhipA A1 WThipA WT P66L WT hipA7

log

% s

urv

ival

-3

-2

-1

0

1

C20 G99DhipA C20 ΔhipA C20 WThipA WT G99DhipA WT hipA7

log

% s

urv

ival

C

A

-4

-3

-2

-1

0

1

7505 P86LhipA 7505 ΔhipA 7505 WThipA WT P86L WT hipA7

log%

su

rviv

al

B

P66L

G99D

P86L A

24

The phenotypes of these mutations were further validated by deletion of hipA in the original

EMS in vitro mutants and also by replacing the mutant hipA with a wild type copy of the gene.

Consistent with the published data (Korch, Henderson et al. 2003), a drop in persister levels was

seen by the deletion or addition of a wild-type copy of the gene in place of the mutant hipAP86L

and hipAG99D alleles. This confirms that these hipA alleles were responsible for the high persister

phenotype of the EMS mutants. The persister levels of the hipAP66L deletion and wild-type

replacement strains remained intact, which suggests other genes in that strain were responsible for

the phenotype (Figure 2-7).

2.2.6. HipA7 causes increased expression of the hip operon

From our in vitro screen of high persister mutants, we primarily discovered high persister

mutations in the hipA locus. The analysis of these mutations revealed that hipA plays a crucial role

in the persister phenotype of E. coli so we wanted to assess the mechanism by which these

mutations change the phenotype. HipA and HipB interact with each other and together control the

regulation of the hipBA operon by binding to the operator sites upstream, thus controlling promoter

activity. Hence a change in the expression levels of the proteins would suggest an alteration in the

binding affinity of the proteins to the DNA operator site or to each other. This work was primarily

done by Sonja Hansen, a post-doc in the lab (Unpublished data). We inserted a reporter plasmid

with the hipBA promoter transcriptionally fused to a fluorescent marker (Zaslaver, Bren et al.

2006), into a wild type, hipA7, hipAP86L and a ΔhipBA strain (Figure 2-8A). The cultures were

grown to exponential phase and individual cells were sorted through a cell sorter based on their

level of GFP expression, which would be indicative of the hipBA expression level.

25

Figure 2-8: hipA7 allele increase the expression of the hipBA operon. A GFP tagged hipA

promoter plasmid was inserted into wild type, hipA7, hipAP86L and ΔhipBA strain and 100000

events were sorted by FACS. A) Plasmid map of the reporter plasmid pUA66 with the hipA

promoter transcriptionally fused with GFP. B) Total events sorted divided into dim, mid and bright

fractions C) Number of cells expressing GFP in the three sorted cell fractions of the wild type,

hipA7, hipAP86L and ΔhipBA D) Survival of the sorted fractions of cells with 5µg/ml of Ofloxacin

(Sonja Hansen, unpublished)

D

C

D

C

-1.5

-1

-0.5

0

0.5

1

1.5

wt hipA7 hipA P86L ΔhipBA

Log

%Su

rviv

al

pUA66hipBAlow mid high

A B

26

The cells were divided into dim, mid and bright fractions and treated with Ofloxacin for

3 hrs to assess the level of persisters in each fraction. The initial sorting data revealed a positive

shift in the number of cells expressing GFP in hipA7 and ΔhipBA as compared to wild type, but

hipAP86L showed wild type expression (Figure 2-8 C). The ofloxacin treatment of the three

fractions of cells revealed maximum persisters in the bright fraction for all strains, with hipA7

showing 10-fold more persisters than the wild type (Figure 2-8 D). It should be noted that even

wild type hipA offers a small level of protection to antibiotics, which can be interpreted from the

2-3 fold drop in persisters in the hipA deletion strain. These results indicate that hipA7 is more

highly expressed than wild type hipA and this higher expression of the HipA7 also increases

tolerance to antibiotics. On the other hand hipAP86L shows a lower level of GFP expression and

the bright fractions shows a very small increase in persister. This may be indicative that hipAP86L

has a different mechanism of increasing persister formation in a culture.

2.2.7. HipA7 and HipAP86L have diminished binding to HipB

The next step in analyzing the mechanism of high antibiotic tolerance of hipA mutants was

to assess the binding affinity of the mutant HipA molecules to the HipB molecules and DNA

operator sites. The group of Dr.Schumacher and Dr.Brennan have elucidated the structure of the

HipB-HipA complex with the two operator sites. It was shown previously that 2 molecules of HipB

bind to each of the operator sites that are 10 base pairs apart (Schumacher et. al. 2009). This

binding of HipB changes the structure of the DNA as it bends at a 70° angle. 2 molecules of HipA

further bind to these HipB molecules bound to the operator sites. This bend in the DNA although

doesn’t cause the bound HipB molecules to interact with each other, results in interaction of the

adjacent HipA molecules that are bound to the HipBs. The HipA7 mutant is made up of two

27

modified amino acids at position 22 (G to S) and 291 (D to A). D291A of HipA7 is on the HipB

interaction surface (Schumacher et. al. 2009). G22S which is the first mutation of HipA7 and the

P86L mutation are present right at the point where the two molecules of HipA interact with each

other. These mutations cause the interaction between the two HipA molecules to loosen very

slightly thus resulting in an unstable HipA-HipB-DNA complex. This small change may result in

slightly elevated levels of free HipA but not result in a dramatic increase in the free-HipA levels,

which would result in growth arrest.

Figure 2-9: Crystal structure of a HipA molecule showing all hipA mutations found in in vitro

mutants. The molecule shown is the crystal structure of hipA and individual mutations (amino

acid substitutions) are highlighted in red with the mutation name next to them.

2.2.8. hipA mutations play a role in the increase in tolerance to antibiotics in clinical strains

of E. coli

It has been shown by several groups that persisters play an important role in infections. The

hipA allele plays a major role in the high antibiotic tolerance of E. coli. In order to assess if hipA

28

is also involved in the formation of persisters in vivo we obtained collections of clinical isolates of

E. coli which had a total of 284 isolates from urinary tract infections like cystitis, pyelonephritis

and parallel isolates from patients with 2-3 recurrent UTI infections (Ann Stapleton, University of

Washington). In addition we obtained a set of 120 commensal strains as a control group, some of

which were obtained from a tribe from Mali that has never been exposed to antibiotics synthesized

by humans (Duriez, Clermont et al. 2001). We first assessed if high persister mutants existed in

clinical strains of E. coli. Measurement of minimum inhibitory concentrations of ampicillin,

ciprofloxacin, piperacillin and ofloxacin for these isolates showed that many of the strains were

resistant to β-lactams but had wild type MICs to fluoroquinolones (data not shown). On

challenging the isolates with Ciprofloxacin in exponentially growing cultures, a very high

variability in the persister levels was seen, although they were all susceptible to ciprofloxacin

(Chapter 3). Some strains showed a 500-1000 fold higher persister level than a lab wild type strain

(E. coli K12 MG1655). We next amplified the hipA gene of all the isolates using the hipA-forward

and hipA-reverse primers (Marcusson et al. 2005) with a hotshot PCR and sequenced the gene.

The sequences were compared with the published hipA sequence of E. coli MG1655 to analyze

the mutations. Table 3-1 lists all the changes we found in the hipA sequences of the natural isolates

as compared to the lab wild type strain sequence. Along with several other changes, the most

exciting discovery was the identification of hipA7 and hipAP86L mutations in several strains.

Some of these strains also showed a high persister phenotype to 2µg/ml Ciprofloxacin, which is a

clinically relevant dose. Figure 2-10 shows the antibiotic tolerance of the natural isolates with the

hipA7 and hipAP86L mutations.

29

Figure 2-10: Persister profiles of clinical and commensal strains with hipA7 mutations:

Natural isolates with the hipA7 mutation were grown to exponential phase and treated with 2µg/ml

of Ciprofloxacin for 6 hrs. The black bar indicates the wild type strain and the gray is the hipA7

mutant as a positive control. The orange bar shows the strain selected for further testing. The graph

represents an average of the results of 5 repeats and error bars indicate standard deviation.

To further validate the role of these mutations in the persister phenotype, we selected the strain

with a hipA7 mutation and the highest antibiotic tolerance to 2µg/ml Ciprofloxacin (W226) and

deleted its hipA locus from the strain. As expected, similar to the in vitro mutants, the persister

levels of the isolate reduced by 1000-fold to MG1655 levels (Figure 2-11 B). We also tested the

effect of the mutations in another well-studied UTI strain, CFT073. The hipA of CFT073 has

several mutation compared to MG1655. Hence, in order to have isogenic strains for comparison,

we replaced the entire hipBA operon in the CFT073 strain with an MG1655 WT copy or an

otherwise MG1655 copy with the hipA7 or P86L mutations in them. The hipA7 and hipAP86L

alleles increased tolerance to Ciprofloxacin 100-500 fold in the CFT073 background also (Figure

2-11 A).

-5

-4

-3

-2

-1

0

1lo

g %

su

rviv

al

30

Figure 2-11: Validation of the hipA7 and P86L allele phenotypes in clinical strains of E. coli:

Persister survival in 2µg/ml of Ciprofloxacin of strains where the A) hipA of CFT073 UTI strain

was replaced with either a MG1655 hipA copy or a MG1655hipA with the hipA7 or hipAP86L

mutations B) hipA from a UTI strain W226 with a hipA7 mutation and high tolerance to

Ciprofloxacin was deleted. Because hipA only has a phenotype in exponential phase, the cultures

were grown to late log phase and hit with 2µg/ml of Ciprofloxacin and survivors were counted at

specified time points. The graphs are an average of three or more experiments and error bars

represent the standard deviation.

-3

-2

-1

0

1

2

3

0 1 2 3 4 5 6

Log

% S

urv

ival

Time in hours

CFT073 hipA7

CFT073 P86L

CFT073 WT hipA

CFT073

-4

-3

-2

-1

0

1

2

3

0 3 6 9 12 15 18 21 24

Log

% S

urv

ival

Time in Hours

W226

W226ΔhipA

CFT073

B

A

A

A

31

2.2.9. hipA mutants have higher tolerance to Ciprofloxacin in human bladder cell tissue

cultures

Having established the importance of hipA mutant alleles in the antibiotic tolerance of

clinical strains of E. coli to high concentrations of Ciprofloxacin in vitro, the next logical step was

to ascertain their clinical relevance in the infectious process and survival to antibiotic treatment in

vivo. We used the previously described W226 (hipA7) and W226 ΔhipA mutant strains and a W226

wt strain where the hipA7 allele in W226 was replaced with a MG1655 hipA, to infect human

bladder cell cultures. We also used several control strains to assess the infectivity and survival of

W226 strains in comparison to A) A widely studied UTI strain CFT073 and B) A commensal

isolate with a hipA7 mutation and its isogenic hipA knockout. We used a well-established protocol

for this test (Blango and Mulvey 2010) and Figure 2-12 shows a schematic representation of the

method. HTB-9 bladder cells were grown to 80% confluency and infected with the UTI E. coli

strains grown in static conditions overnight. The infection was allowed to develop for 14 hours

followed by treatment with 2 µg/ml of Ciprofloxacin for 6 hours. The cells were then lysed with

0.4% Triton-X 100 and dilutions were plated onto MacConkey agar plates to count surviving

bacteria. Control wells were infected but treated with 10µg/ml of Gentamycin. Gentamycin is a

large molecule and is unable to penetrate eukaryotic cells. Thus treatment with Gentamycin

ensured survival of bacteria only inside the bladder cells. The control wells showed recovery of

104 cfu/ml for the two UTI strains CFT073 and W226, indicating that W226 did not have any

growth or cell attachment defects in this environment. As expected, the commensal strain Cro4712

had severe growth deficiencies in the bladder cells, and very few cells survived even without

antibiotic treatment. The W226 strain that harbors the hipA7 mutation was able to survive to 10

fold higher levels than the W226ΔhipA and W226 wthipA strains. This was confirmed by statistical

32

analysis (Materials and Methods) to be a significant difference (shown as P values; values below

0.05 considered significant) and the result confirms the ability of hipA7 mutations to increase the

tolerance to clinical levels of antibiotics in vivo (Figure 2-13). The commensal isolate population,

which was already low before antibiotic treatment, completely collapsed after treatment.

Figure 2-12: A schematic overview of the bladder cell culture: A schematic representation of

bladder cell tissue culture method. A detailed description is provided in the materials and methods

section. Briefly, bladder cell cultures were grown in 24 well plates and infected with the UTI

strains. Extracellular bacteria were killed with Gentamycin after development of infection inside

the cells.

33

Figure 2-13: Survival of hipA mutants in Bladder cell tissue cultures: HTB-9 Bladder cell

tissue cultures were infected with test strains and treated with 2µg/ml of Ciprofloxacin for 8 hours.

Controls were treated with 10µg/ml of Gentamycin, to prevent replication of bacteria outside the

bladder cells. Error bars indicate standard deviation between 6 replicates. P-values below 0.05 are

considered statistically significant

2.2.10. hipA mutants have higher tolerance to clinical doses of Ciprofloxacin in a mouse UTI

infection

(This work was done in collaboration with Dr. Gabriele Casadei from Parma, Italy)

To corroborate our cell culture results further we aimed at understanding the clinical

significance of these high persister mutants by testing their drug tolerance in in vivo mouse models

of infections. All animal studies were conducted in accordance with IACUC guidelines at

Northeastern University. C3H/HeN 8 week old female mice were infected via transurethral

catheterization with 108 cells of W226 hipA7, W226 ΔhipA or W226 wt strains, cultures of which

were grown for 2 overnights in static conditions (Hung, Dodson et al. 2009).

1.00E+00

1.00E+01

1.00E+02

1.00E+03

1.00E+04

1.00E+05

Log

cfu

/ml

P=0.001 P=0.01

P=0.007

P=0.01

34

W226 C

on

tro

l

W226 C

ipro

W226 W

T C

ipro

W226

hip

BA

1 0 0

1 0 1

1 0 2

1 0 3

1 0 4

1 0 5

1 0 6

B la d d e r

Lo

g c

fu/

Bla

dd

er

0 .0 2

0 .0 0 0 7

0 .0 4 7

W226 C

on

tro

l

W226 C

ipro

W226 w

t C

ipro

W226

hip

A C

ipro

1 0 0

1 0 1

1 0 2

1 0 3

1 0 4

1 0 5

1 0 6

1 0 7

K id n e y

Lo

g c

fu /

2 k

idn

ey

s

0 .0 5

0 .0 4 4

0 .0 0 0 1

Figure 2-14: Tolerance of hipA mutants to clinical doses of Ciprofloxacin in a mouse model

of UTI infection. Bladders of C3H/HeN mice were infected with the uropathogenic strains W226

(hipA7 mutant), W226 wt (MG1655 allele of hipA) or W226 ΔhipA, treated with ciprofloxacin for

3 days and surviving bacterial loads were counted A) Bladder B) both Kidneys, of the mice. Each

point on the figures indicates bacterial counts from individual mice. The horizontal lines represent

median values for the group. P-values below 0.05 indicate statistically significant differences

between groups. Statistical analysis was done using a non-parametric, two tailed Mann-Whitney

U test in the GraphPad Prism 6 software.

A

A

B

A

35

24hrs post infection, animals were treated with 0.2mg/dose/mouse of ciprofloxacin 4 times a day

for 3 days (Jakobsen, Cattoir et al. 2012) and the control mice were given the same volume of

saline by sub-cutaneous injections. This dosing regime was chosen because it is most relevant to

clinical human dosing. Having a clinically relevant human dosing regimen was important to make

sure that any surviving bacteria were persisters to Ciprofloxacin and not a result of ineffective

doing. 6 hours after the last dose mice were euthanized, and their bladders and kidneys aseptically

harvested. The tissues were homogenized and assessed for bacterial titers by plating on

MacConkey’s agar (Hvidberg, Struve et al. 2000). Samples were also plated on MacConkey agar

plates containing MIC levels of Ciprofloxacin to determine the presence of any resistant mutants.

The control group infected with the W226 hipA7 strain showed high level of survival of the

bacteria, which indicated successful infection of the mouse bladders (Figure 2-14A). When the

mice infected with W226 hipA7 were treated with ciprofloxacin the number of surviving bacteria

in the bladders went down significantly (P=0.02). This indicates successful killing of the bulk of

the susceptible population and effective antibiotic therapy. However, deletion of hipA in the W226

strain caused it to lose its selective advantage during the ciprofloxacin treatment and the number

of persisters reduced significantly (P=0.047). It has been shown previously that deletion of a wild

type hipA in a UTI strain does not affect the drug tolerance of the strain (Norton and Mulvey 2012).

This finding helped us to ascertain that any reduction in persister levels in the W226 ΔhipA in the

animals would be due to the loss of the hipA7 mutation only and not a pleiotropic effect of the loss

of hipA itself. To further confirm this we also used the W226 wthipA strain, which also showed a

significant decline in survival (P=0.0007) as compared to its isogenic hipA7 strain (W226 hipA7).

The kidneys in the control mice showed very low cell numbers which indicated no signs of

pyelonephritis (Figure 2-14B). The discovery of hipA mutations in clinical strains of E. coli and

36

the data from these mice experiments, it can be concluded hipA plays a major role in the infectious

process and maintenance of infection through antibiotic treatment, establishing the link between

persister formation and the recalcitrance of chronic UTI infections.

2.3. DISCUSSION

We developed a novel approach to select for high persister mutants in E. coli with the goal

of identifying the genes involved in their hip phenotype. E. coli cultures were mutated and the

resulting mutant pool was enriched for clones with mutations in genes that predisposed them to

increased survival in antibiotics, by cyclic antibiotic treatment and growth. The final mutant pool

showed 100% persisters. Annotation of genomes of the individual in vitro selected hip mutants

was done by whole genome sequencing (Figure 2-1). 3 individual screens resulted in 40 individual

hip mutants and the results of the whole genome sequencing showed several SNPs in probable

persister genes (Table 2-1). Mutations were also identified in known persister genes of E. coli like

hns (global regulator), prs (responsible for tolerance by lag) and plsX (glycerol-3-phosphate

metabolism) in the SNP pool (Hansen, Lewis et al. 2008), (Fridman, Goldberg et al. 2014),

(Spoering, Vulić et al. 2006), (Yoshimura, Oshima et al. 2007), which validated the method of the

screen. Overlapping genes that had mutations in one or more rounds of the screen, showed no

phenotypes when they were knocked out in wildtype backgrounds and so were not analyzed further

(Table 2-1, Figure 2-3, 2-4).

A striking result from this screen was the discovery of 3 different mutations in the hipA

locus. This indicated that hipA probably plays a very important role in persister formation. We set

out to assess the role of these hipA mutations in E. coli and found that 2 of the three mutations

(hipAP86L and hipAG99D) increased persister levels to multiple antibiotics 100-1000 fold. This

37

phenotype was comparable to the previously identified hipA7 mutation (Moyed and Bertrand

1983). This promising discovery led us to further ascertain the mechanism by which these

mutations increase the level of persisters in vitro. hipA is part of a toxin antitoxin pair, where the

hipA toxin and the antitoxin hipB together autoregulate their operon by binding to operator sites

upstream of the genes (Black et al. 1994). Analysis of expression levels of the mutant HipA

proteins showed that HipA7 had an increased level of expression resulting in high numbers of

persisters. This result was corroborated by the protein structural studies from the Dr. Brennan lab

(unpublished data) that the G22S mutation of hipA7 and the P86L mutation were present at the

site of interaction of the two HipA molecules while they were bound to the operator sites. The

D291A mutation of HipA also lowers the interaction of HipA with its antitoxin HipB (Schumacher

et al. 2009). The cumulative effect of these mutations would be instability of the HipA-HipB-DNA

complex resulting in more unbound HipA in the cell. HipA would then be free to bind to its target

GltX (Glu-tRNA-synthetase) and inactivate it by phosphorylation. The inactivation of GltX

triggers (p)ppGpp synthesis and the stringent response and results in multidrug tolerance and the

hip phenotype (Germain, Castro-Roa et al.)

We hypothesized that similar to the selection process of the in vitro mutants, cycles of

antibiotic challenge and regrowth during treatment of an infection could select for high persistence

in vivo. Evidence suggesting a link between persisters and chronic infections was previously

established by the Lewis lab for Candida albicans oral thrush infections in cancer patients and

Pseudomonas aeruginosa infections in cystic fibrosis patients (LaFleur, Qi et al. 2010; Mulcahy,

Burns et al. 2010). In both these studies, multiple isolates taken over the course of the infection,

from chronic P. aeuroginosa infections and 8 week old oral candidiasis, were tested for the

presence of persisters. It was shown that there was indeed a significant increase in the number of

38

persisters in the later isolates as compared to the ones from the early infection. It is possible that

antibiotic recalcitrance of other chronic infections may also be the result of the presence of high

persister mutants.

Testing a panel of 450 clinical UTI and commensal strains revealed a high variability to

antibiotic treatment without alterations in the drug susceptibility, shown by MICs of the strains.

Some strains even showed a 100-1000 fold increase in survival to ciprofloxacin treatment. We also

tested 8 sets of parallel isolates from patients with 2 recurrent UTIs. One of the triplets showed

extremely high persistence i.e. a 1000-fold increase compared to wild type, in each of the three

isolates (Figure 3-4). Chronic and recurrent bacterial infections are a major problem in UTI

infections. Persisters have been implicated in the chronic nature of such infections, but it has

always been challenging to effectively eradicate these persistent infections. The Hultgren group

has shown the presence of quiescent reservoirs of bacteria in UTI infections that are non-growing

in nature and are thought to be the result of persisters (Mysorekar and Hultgren 2006). Studies

have also shown that deletion of some toxin-antitoxin modules like pasTI in E. coli leads to

reduced persister formation in mouse models of infections (Norton and Mulvey 2012). However,

a direct link between a clinical mutation and causality of infection was yet to be made.

Our results indicated that hipA and its mutant alleles are an important player in

increasing the tolerance of E. coli to antibiotic therapy. So we sequenced the hipA locus of the 450

natural isolates. Along with finding a high variability and a positive selection for certain alleles

(Chapter 3) of the hipA sequences in these strains, we also found the hipA7 and hipAP86L high

persister mutations in several strains. On deletion of the hipA7 mutant allele from clinical strain

W226, a sharp decrease was seen, in tolerance to clinical doses of ciprofloxacin (2µg/ml). We

further tested the phenotype of the uropathogenic strain by deleting its hipA and testing it in vivo

39

models of infection. Bladder cell tissue cultures infected with the W226hipA7 and W226ΔhipA

strain showed a 10 fold decrease in persisters in the deletion mutant. This was further corroborated

by the phenotype of these strains in mouse models of UTI infection. Mice infected with

W226ΔhipA showed significantly lower loads of surviving bacteria as compared to the

W226hipA7 strain. 3 decades after the discovery of hipA as a persister gene, our results finally

provide a direct causal link between this genetic mutation, found in a clinical setting, and formation

of persisters in vivo.

Further testing is required to determine the effect of these hipA mutations in the in vivo

persister formation process in acute and chronic infections. Although it has been shown that a hipA

deletion in E. coli does not have any effect on survival in mice, long term survival of E. coli is

increased in the absence of hipA (Kawano, Hirokawa et al. 2009). A proposed mechanism for the

method by which these mutations could increase the persister frequency is presented in Figure S4-

Appendix I.

2.4. MATERIALS AND METHODS

Strain construction

All deletion mutants and hipA mutants in the MG1655 background were created using the P1

transduction method (Miller 1992). All deletion mutants and hipA mutants in uropathogenic E.

coli W226 and CFT073 were created by using a modified lambda Red recombination method

(Datsenko and Wanner 2000). Instead of using a Kanamycin or Chloramphenicol antibiotic marker

used in this method, a Kan/parE cassette under the control of a Rhamnose promoter was used and

was obtained from the Gerdes Lab (Maisonneuve, Shakespeare et al. 2011). The colonies for this

were selected onto LBA+Kanamycin plates and confirmed by plating onto Minimal MOPS agar

40

plates containing 0.5% Rhamnose, where they shouldn’t grow. For replacement of the Kan/parE

cassette with a mutant hipA the allele was amplified using PCR from the parent strain and inserted

into target cells by electroporation. Colonies that successfully replaced the cassette with the new

hipA allele were selected on minimal-MOPS Rhamnose agar plates. The mutants used for sorting

were constructed by inserting a reporter plasmid (pUA66) with the hipA promoter transcriptionally

fused to a GFP. This plasmid was obtained from the E. coli promoter library (Zaslaver, Bren et al.

2006). The plasmids were inserted into a wild type MG1655 strain, MG1655 hipA7 strain,

MG1655 hipAP86L strain and MG1655 ΔhipBA strain. Transformants were selected onto

Kanamycin LBA plates.

Table 2-2: List of Strains, Plasmids and primers:

Primer Sequence Origin

hipBAO(KO)KanUP ATCCCGTAGAGCGGATAAGATGTGTTTCCAGA

TTGACTTTATTGTGTAGGCTGGAGCTGCTTCG

This study

hipBAO(KO)KanDW TTAACATAATATACATTATGCGCACCAACATA

AACCAAGGGACATATGAATATCCTCCTTA

This study

hipBAOUP AAATCCTCCTTTTTATCCGCGATC This study

hipBAODW GCATCACTCAGACATGATTTAACATAATATA This study

hipBAOKRPUP ACGCTATGCGACGCGAAAAATGCCTCGCCAGA

ATCAACAGAACAGCAAAATCTGGAGTGGTATC

AGAAGAACTCGTCAAGAAGG

This study

hipBAOKRPDW AAGAATCCAGTCGTTGGCGGTCATGATTGTCA

TGCTCATTAACAATGACCAAACCCCATATCCGT

CATCGCCATTAATTCACTG

This study

CFTKRPUP TATCCGCGATCGCGGATATCGCAGCGTTTATCC

CGTAGAGCGGATAAGATGTGTTTCCAGATTGA

CTTCAGAAGAACTCGTCAAGAAGG

This study

UTIhipAUP ATCAACAGAACAGCAAAATCTGGAG Marcusson

et. al. 2005 UTIhipADW GAATCCAGTCGTTGGCGGTCATG

UTIhipBUP TATCCGCGATCGCGGATATC

41

UTIhipBDW AATGGCAGCGAAAGTGACAACGG

UTIhipBUP2 CCA TTG AAC AGA CGT TTT TTA CGC This study

CFThipBAOUP

GGCCAGGTCATTAAGATTACAGAT

This study

Strains Relevant Genotype/Phenotype Origin

MG1655 (wild type) Zde-264::Tn10 This study

MG1655 hipA7 MG1655 zde-264::Tn10 hipA7 This study

W226 hipA7 Univ. of

Washington

W226 wt W226 ΔhipA7::MG1655 hipA This study

W226ΔhipA ΔhipBA operon::FRT This study

CFT073 (UTI isolate) - Scott

Hultgren

CFT073hipA7 chipBA operon::MG1655 operators+hipB+hipA7 This study

CFT073P86L ΔhipBA operon::MG1655 operators+hipB+hipAP86L This study

CFT073WT ΔhipBA operon::MG1655 operators+hipBA This study

EMS Mutants

7505

C20

A1

hipAP86L

hipAG99D

hipAP66L

This study

EMS mutant substitutions and deletions

7505ΔhipA ΔhipA::FRT This study

7505WThipA ΔhipA::MG1655hipA This study

WTP86L MG1655 hipAP86L This study

C20 ΔhipA ΔhipA::FRT This study

C20WThipA ΔhipA::MG1655hipA This study

WTG99D MG1655 hipAG99D This study

A1 ΔhipA ΔhipA::FRT This study

A1WThipA ΔhipA::MG1655hipA This study

WTP66L MG1655 hipAP86L This study

42

Mutagenesis of wild type E. coli to obtain high persister mutants

An Escherichia coli K12 MG1655 wild type strain was used in this screen for the selection of in

vitro hip mutants. We used a modified approach to the first screen for persisters by Moyed and

Bertrand in 1983 (Figure 2-1). Briefly, 4 wild type E. coli cultures were grown overnight from

single colonies streaked onto LB agar. The O/N cultures were diluted 1:500 in LBB and grown for

2 hrs to an optical density (OD)600 of 0.2. This culture was further diluted 1:50 in LBB and regrown

to a density of 0.2 and this step was repeated one more time. The serial dilutions and regrowth

helped dilute out any preexisting persisters (Keren, Kaldalu et al. 2004; Lewis, Spoering et al.

2005). After the 3rd growth step cultures were diluted 2:1 in 125 mM HEPES/KOH buffer (pH 7)

in a 2ml tube and mutagenized with 15 µg/ml ethyl methanesulphonate (EMS) for 10 min at 37 °C

(Miller 1992). EMS is a chemical mutagen that produces random nucleotide substitutions by

guanine alkylation. Cultures were centrifuged, resuspended in LBB and grown overnight for the

cells to recover. We have done three batches of chemical mutagenesis and have selected 9, 7 and

24 high persister mutants from each batch respectively. The time of exposure to EMS was reduced

with each screen to optimize the mutagenesis. The method of only the 3rd screen is described here.

To calculate the mutation frequency, mutagenized pools were plated onto 100 µg/ml rifampicin

and LBA

Enrichment of hip mutants from the mutagenized pools

Persisters in the mutagenized pools were enriched by dilution of O/N cultures 1:750 in fresh

medium and growth to mid-log phase before treating them with an antibiotic or a combination of

antibiotics (Figure 2-2). The mutagenized pools were treated with antibiotic for 3 hrs. In Screen 1

cultures were treated with a combination of 100 µg/ml ampicillin and 50 µg/ml cefotaxime for 4

43

hr ; in Screen 2 cultures were treated with three different combinations of antibiotics - A.

Ampicillin (100 ug/ml), B. Ampicillin (100 ug/ml) + Piperacillin (40 ug/ml), C. Ampicillin (100

ug/ml); and in Screen 3 in addition to the three combinations used in Screen 2 cultures were also

treated with a combination of Ciprofloxacin (5 ug/ml ) + Ofloxacin (5 ug/ml ) + Nalidixic acid (40

ug/ml). The cells were then washed twice with 1% NaCl, resuspended in fresh medium and grown

overnight. This cycle of antibiotic treatment and regrowth was repeated two more times. The

persister fractions were measured at the end of every cycle by plating dilutions onto LBA.

Selection and Screening of in vitro hip mutants

After the final round of enrichment, 100 ul of the mutagenized pools were plated onto 4 LB plates

and incubated O/N for colonies to develop. 24 colonies were selected from each group of selection

(total 96 colonies). First the MICs of all clones were tested with ampicillin, piperacillin, ofloxacin

and ciprofloxacin in order to eliminate any resistant mutants. Further, the growth rates were tested

to eliminate mutants with growth abnormalities. All mutants exhibited MICs and growth rates

similar to the parent wild type strain. The hip phenotype of the clones was tested in exponential

phase with 100 µg/ml ampicillin, as well as in stationary phase with 5 µg/ml ofloxacin. From the

96 mutants screened, mutants with increased antibiotic tolerance in both exponential and stationary

phase were sent for whole genome sequencing to identify gene genes.

Growth rate measurement

The growth rates of the selected high persister mutants were measured in LB broth. Overnight

grown cultures were diluted 1:1000 in fresh media and grown for 6 hours. Growth of cultures was

measured every 30 min by plating dilutions onto LB agar and counting cfu/ml

44

Minimum inhibitory concentrations

To eliminate any resistant mutants from the selected high persister mutations the MICs of all

mutants were determined for Ampicillin, Pipperacilin, Ofloxacin and Nalidixic acid. The MIC

measurements were made by Standard MIC assays according to the Clinical and Laboratory

Standards Institute (CLSI) guidelines. Briefly, 2 fold dilutions of antibiotics were made in LBB in

96 well plates, in 50 µl volumes. Overnight grown cultures were diluted 1:10 in fresh LBB and

grown for an hour. These cultures were then diluted 1:2000 into fresh LBB and 50 µl of the cultures

were added to all wells. Plates were incubated at 37 °C static conditions for 18 hours. Growth was

measured by optical density measurements at 600nm.

Whole Genome Sequencing

DNA for whole genome sequencing was extracted suing a Qiagen DNEasy DNA extraction kit.

To identify the mutations responsible for hip phenotype in the selected in vitro hip mutants, whole

genome sequencing of these strains was done at the Broad Institute (Cambridge, MA) using 454

sequencing technology at the Broad Institute (Cambridge, MA). So far, 3 screens have been done

and mutants have been selected and sent for whole genome sequencing. Unlike the first two

batches of hip mutants, which consisted only of mutants selected with β-lactams, the third batch

also had hip mutants obtained with fluoroquinolone enrichment. The genomes of the sequenced

hip mutants were compared to the wild type parent strain to determine the SNPs generated by EMS

mutagenesis by the Broad institute and assembled sequences were sent to us.

45

Persister assays

Persister assays for exponential phase were done by diluting ON growing cultures 1:100 in fresh

medium and were grown to late exponential phase. An aliquot of cells was taken before the

addition of antibiotic to measure start cfu counts. Antibiotic was added at this point and aliquots

were removed at 1, 3, 6 and 24 hours (as indicated in each graph). The aliquots were washed in

1% NaCl and serially diluted. Dilutions were plated onto LBA or MacConkey’s agar wherever

indicated.

Sorting persisters expressing GFP using FACS

Bacterial cultures containing the reporter plasmid were grown O/N from freezer stocks. The ON

cultures were further diluted 1:100 in fresh medium containing Kanamycin and grown to late log

phase. At this stage cells were washed twice with sterile PBS and run through the FACS machine.

Individual cells were sorted based on their GFP expression levels. The total cell population was

divided into three fractions based on intensity of fluorescence (dim, mid and bright) and sorted

into three individual tubes. These were then individually treated with 5µg/ml ofloxacin containing

media for 3 hours and dilutions were plated to count cfu/ml

Bladder Cell cultures

HTB-9 Human bladder cells (ATCC 5637) were obtained from ATCC and grown to 80%

confluence in 24-well plates in RPMI1640 supplemented with 10% fetal bovine serum, 2 mM L-

glutamine, 10mM HEPES, 1mM sodium pyruvate, 4500 mg/L glucose, and 1500 mg/L sodium

bicarbonate and incubated at 37 °C in a 5% CO2 atmosphere. E. coli cultures for infection were

grown in LBB for 24 hrs at 37 °C in static conditions to induce type 1 pilus formation, which is

46

necessary for cell attachment. Once the cell cultures reached the desired confluency, the medium

was discarded and 1 ml of fresh medium with ~106 cells/ of the E. coli culture (10-15 cfu/bladder

cell) was added. The plates were centrifuged at 200 g for 5 min to synchronize the attachment of

E. coli in all the wells and incubated for 2hrs to allow attachment of bacteria to the bladder cells.

Cells were then washed with PBS2+ twice and incubated in fresh medium containing 100ug/ml

Gentamycin to kill the extracellular E. coli. After a 2 hr incubation and 2 washes with PBS2+, fresh

medium containing 10ug/ml gentamycin was added and plates were incubated for 14hrs to allow

the infection to develop and the low concentration of antibiotic would prevent the bacteria from

escaping from the cells, allowing to enumerate only the intra-cellular bacteria. Plates were then

washed twice with PBS2+ and fresh medium containing either 2ug/ml Ciprofloxacin or 10ug/ml

Gentamycin (control) was added to the appropriate wells to determine the persister fraction in the

infected cells. After 6 hr of incubation bladder cells were lysed with 1ml of 0.4% Triton X-100 +

PBS. All steps from lysis were carried out on ice, to prevent loss of bacteria. The lysates were

diluted and 10 ul of all dilutions were plated in triplicates on MacConkey agar to count survivors.

We also plated 500 ul of the lysates onto MacConkey’s agar plates to be able to count cells in

cultures with very low survival (Blango and Mulvey 2010).

Murine model of UTI infection

This study was done in accordance with IACUC guidelines. Briefly, 7-8 week old female

C3H/HeN mice were obtained from Charles River labs (Cambridge, MA) and housed 5/cage

undisturbed for 24 hrs before infection. Bacterial cultures for infecting mice were grown overnight

from glycerol stocks in 10 ml LBB in static conditions for 24 hrs at 37 °C. These cultures were

diluted 1:10 in 25 ml fresh LBB and grown 24hrs in static conditions at 37 °C. After growth, the

47

cultures were centrifuged and the cells were diluted with 1% PBS to 107-108 cfu / 50 ul. The mice

were anesthetized using Isoflurane and their bladders were inoculated with 50ul of the bacterial

suspension transurethrally at a constant pace of 10ul/sec to avoid kidney reflux. The inoculation

was done using sterile polyethylene tubing, PE10 (inner dimension 0.28 mm - 0.011 inch; outer

dimension 0.61 mm - 0.024 inch) catheters attached to 30G needles. Catheters were removed

immediately after inoculation and mice were kept on a heating pad to recover from the anesthesia.

After 24 hrs of infection the mice were given subcutaneous injections of 2 mg/dose Ciprofloxacin

4 times a day for 3 days, saline was used for the control mice (Jakobsen, Cattoir et al. 2012). 6hrs

after the last antibiotic dose, mice were euthanized and their bladders and kidneys were harvested

in sterile PBS. The tissues were kept on ice throughout the processing of the samples. The tissues

were homogenized using a bullet blender and homogenates were serially diluted with PBS. All

dilutions were plated onto MacConkey agar in triplicates to count surviving persisters and on

MacConkey agar plates containing MIC levels of Ciprofloxacin to identify any resistant mutants.

800µl of the remaining bacterial sample were spread onto two MacConkey agar plates, to be able

to count survivors from samples with very low cfu counts.

48

CHAPTER 3

Phylogenetic distribution of hipBA alleles and their effect on the

persister phenotype of natural isolates of Escherichia coli

1Pooja Balani, 1,2 Marin Vulić, 1Kim Lewis

1 Biology Department, Northeastern University, Boston MA

2 Seres Health, Cambridge MA (Current address)

(Manuscript in preparation)

3.1. INTRODUCTION

Urinary tract infections are one of the most common recurrent infections in the clinic and

Escherichia coli is a major contributor to this problem (Schilling and Hultgren 2002). Many

studies have been done to identify the resistance mechanisms involved in the infectious process of

these organisms, but very little is known about the persister profiles of clinical strains from UTI

infections and the genetic mechanism for their drug tolerance. It has been suggested that persisters

may be responsible for the recurrent nature of UTI (Schilling and Hultgren 2002)

Bacterial toxin-antitoxins (TA) are ubiquitous in all bacteria and highly abundant in

Escherichia coli. They are divided into 5 classes (I-V) and Type II TA systems in E. coli are the

most extensively studied (Yamaguchi and Inouye 2011). These TA operons encode a toxic protein

that can shut down cells or stop growth leading to drug and other stress tolerance. The antitoxin,

49

which is a protein or small-RNA, dampens the activity of the toxin protein. Successive deletion of

all 10 mRNA interferase TA loci of E. coli progressively reduces the level of persisters, suggesting

that persister formation is a phenotype contributed to by highly redundant TA loci.

Knowledge of the phylogenetic group of an E. coli strain can be useful in predicting the

extra-intestinal disease causing capabilities or resistance development patterns (Johnson, Delavari

et al. 2001; Johnson, Stell et al. 2001; Nazir, Cao et al. 2011). The same thought may be applied

for the prediction of high persister phenotype, since persistence and resistance are both adaptive

mechanisms developed by organisms in response to environmental or host stimuli ((Balaban,

Gerdes et al. 2013). In a recent study by (Fiedoruk, Daniluk et al. 2015) it was found that among

the various phylogenetic groups of E. coli the group to which most pathogenic strains belong (B2)

has the lowest frequency of type II TA systems (of the 16 known in E. coli), but the hipBA TA

system is most abundant in this group as compared to other phylogroups. This may imply that the

hipBA locus may have a role either in the infectious process or maintaining an infection. Results

from our studies (Chapter 2) have shown that mutant alleles of hipA play a major role in the

formation of persisters in E. coli in human bladder cell tissue culture infections and mouse acute

cystitis infections. This made it crucial for us to further assess the role of hipA in the clinical

manifestation of infections.

The hipBA allele is a toxin-antitoxin pair, where hipB produces a small 10-kDa antitoxin

(Black, Kelly et al. 1991). hipB is upstream of hipA with one overlapping base pair between them

(Black, Kelly et al. 1991). HipB is a DNA binding protein that negatively regulates the hipBA

operon by binding to the operator sites upstream. HipB complexed with DNA also binds HipA and

neutralizes it. Expression of hipA in a hipB knockout is toxic to the cells and ectopic expression of

hipB in these cells rescues them (Black, Irwin et al. 1994; Korch and Hill 2006). This suggests that

50

defects in HipB production or production of a defective protein with lower binding affinity to HipA

will result in a net increase in unbound HipA in the cell resulting in higher number of persisters

[as shown by hipA overexpression studies by (Keren, Shah et al. 2004)]

In this study we aimed to identify the presence of high persister mutants from recurrent

UTI infections and the importance of the hipBA locus, in these strains. We obtained a collection

of clinical and commensal strains of E. coli (Figure 3-1) and sequenced their hipA locus. We also

tested 285 strains of E. coli from UTI patients for the formation of hip mutants. Owing to the tight

interactions between hipB and hipA, we also sequenced the hipB gene of the isolates. We expected

to identify mutations in hipB that are coupled with specific mutations in hipA which might be

responsible for the high persister phenotype.

Figure 3-1: E. coli natural isolate collection. Our natural isolate collection consisting of 284

strains from different pathological types of urinary tract infections and 192 strains isolated from

guts of healthy humans and animals.

51

3.2. RESULTS

3.2.1. Ciprofloxacin sensitive clinical strains of E. coli exhibit extreme variability in drug

susceptibility

In our search for the existence of high persister mutants in clinical isolates of E. coli from

human urinary tract infections, we first tested the MICs of all isolates to Ciprofloxacin and

Ampicillin and found several isolates were resistant to ampicillin, but all had unchanged MICs for

Ciprofloxacin (data not shown). On testing the persister phenotypes of these strains with 2 µg/ml

of Ciprofloxacin, a large variability in the persister phenotype was seen among isolates with similar

MICs and some of the strains exhibited a very high persister phenotype indicating the importance

of persisters in a UTI infection. Figure 3-2 shows a summary of the high variability of persister

phenotypes of some of the isolates. The persister profiles of all the isolates are shown in Figure

S2. Some strains showed a 500-1000 fold higher persister level than the lab wild type strain

MG1655. A frequency distribution of persister levels of all isolates shows a distribution with

maximum strains with persister levels at 10 fold higher than MG1655 (Figure 3-3).

After confirming that clinical strains of E. coli can exhibit higher tolerance to drugs, we

further tested our hypothesis that strains from recurrent infections can evolve to have enriched

populations of persisters. Longitudinal isolates from patients with recurrent UTI infections were

tested for their ability to survive in clinical doses of Ciprofloxacin (2µg/ml). As shown in Figure

3-4, some isolates showed enrichment for persisters in the 2nd or 3rd infections. To confirm that

these strains were isogenic, we compared their phylogenetic groups and hipA sequences.

52

Time in hours

Figure 3-2: Persister profiles of 50 UTI isolates. The 50 UTI isolates from different pathological

groups (A) PAP antigen positive (B) cystitis (C) pediatric UTI (D) male UTI (E) pyelonephritis

were grown to late exponential phase and challenged with 2 µg/ml of ciprofloxacin. Black solid

lines indicate wild type E. coli K12 MG1655, dotted black lines show the hipA7 mutant used here

as a positive control for persister phenotype.

Log

% S

urv

ival

53

1 0 0 1 0 1 1 0 2 1 0 3 1 0 4 1 0 5 1 0 6 1 0 7 1 0 8 1 0 9

0

1 0

2 0

3 0

4 0

H is to g ra m o f p e rs is te r f ra c t io n s

o f 1 6 0 U P E C is o la te s

P e rs is te r fra c tio n (c fu /m l)

Nu

mb

er

of

str

ain

s

Figure 3-3: A frequency distribution of persister levels of natural isolates of E. coli: The

persister phenotype of 200 UTI and commensal strains was measured by killing exponentially

growing cultures with 2µg/ml of Ciprofloxacin. The surviving fraction of cells was measured after

6 hours as cfu/ml. The strains were grouped together by log increase in persisters. The wild type

MG1655 strain forms 5x102cfu/ml persisters.

Figure 3-4: Persister profiles of 8 triplets of same patient recurrent UTI strains: The colored

bars indicate the 8 sets of recurrent UTI strains, with 3 parallel isolates from each patient, the black

bar is wildtype MG1655 and the grey bar is MG1655hipA7. The strains were grown to late

exponential phase and treated with 2µg/ml of Ciprofloxacin. Surviving bacteria were plated onto

LB Agar after 8 hours of antibiotic treatment. The graph represents an average of 3 individual

experiments and the error bars indicate standard deviation.

-3

-2

-1

0

1

2

W1

66

W1

67

W1

68

W1

69

W1

70

W1

71

W1

72

W1

73

W1

74

W1

75

W1

76

W1

77

W1

78

W1

79

W1

80

W1

81

W1

82

W1

83

W1

84

W1

85

W1

86

W1

87

W1

88

W1

89 WT

hip

A7

Log

% S

urv

ival

54

3.2.2. hipBA locus sequencing analysis reveals high polymorphism in the locus and high

persister mutations

It has been established that hipA plays a major role in persister formation. We validated in

our previous work that two high persister alleles of hipA identified in vitro, hipA7 (Moyed and

Bertrand 1983), and hipAP86L (this study), confer 1000-10000 fold increase in tolerance to β-

lactams and 100 fold increase to fluoroquinolones. To test our theory, that high persister mutants

were present in clinical and commensal strains of Escherichia coli and that hipA mutations could

be responsible for this phenotype, we amplified the entire hipBA operon along with the operator

sites from these strains by using primers listed in Table S4. A hot-shot PCR approach was used to

extract DNA from isolates for PCR (Materials and methods) (Truett et. al. 2000). The sequences

were compared with the published hipBA operon sequence of MG1655 to identify the changes in

the sequences. Table S1A, B and C list all the changes we found in the hipBA operon sequences

and Table 3-1 presents a summary of the total mutations. An extremely high degree of

polymorphism and intragenic recombination was seen among the sequences. An example of the

polymorphism is presented in Table 3-1 and a detailed pattern of all mutations is shown in Figures

S5.

hipA sequencing results:

A striking discovery was the presence of in vitro hip mutations, hipA7 and hipAP86L, in 8

UTI isolates and 15 commensal strains. The presence of these hip alleles in natural isolates

established the first line of evidence to directly link a genetic mutation to persistence of strains in

a human. We have previously shown that these hipA mutations play a major role in survival of E.

coli during antibiotic treatment in an animal (Figure 2-14). This finding is the first discovery made

55

to directly link a mutation to the persister phenotype in the clinical environment. No mutations

were found in the active site, Mg2+ or ATP binding site of hipA, which suggests that a functional

hipA is important in the clinical strains. But truncated hipA was found in 1.5% of strains and 4

mutations were found in the HipB-HipA and HipA-HipA interaction sites. Weaker interactions

means lower binding and easier release of HipA from HipB, resulting in high persistence. 3 of

these mutations were validated to have high persister phenotypes (D291A, P86L, G22S and

V380L).

Type of Mutation Mutations in hipA Mutations in hipB Mutations in the

operator region

Synonymous changes 115 of 1323 bp 18 of 264bp -

Amino acid changes 80 of 441 aa in HipA 22 of 88 aa in HipB -

Deletions 5 0 0

Insertions 3 2 1

Stop Codons 0 2 -

Total bp changes found ~200 of 1323 bp 46 of 264 bp 20 of 100bp

dN/dS ratio 0.8 1.2 -

aa- amino acids; bp – base pairs; dN/dS= ratio of non-synonymous to synonymous mutations

Table 3-1: A summary of the mutations found in the hipBA operon of 477 natural isolates of

E. coli. The table lists a summary of the maximum number and type of changes found in the hipBA

operon of 477 sequenced clinical and commensal strains of E. coli as compared to the published

MG1655 hipBA operon sequence

56

hipB sequencing results:

No complete deletions of hipB were found in the strains sequenced. However, 2 strains had

a premature stop codon before the C-terminal region of HipB, but the original stop codon was also

changed to a glutamic acid residue, suggesting the presence of a truncated hipB missing the C-

terminal region and a longer hipA. In a wild type hipA background, truncation of the HipB does

not alter the ability of the mutant protein to bind HipA, but may lower the degradation of the

antitoxin by the Lon protease, thus making it more stable as shown by Hansen et. al.2012.

However, in this case the HipA is also longer, and may have a different structural conformation

and binding affinity to HipB. No mutations were found in the DNA binding sites of HipB. 96%

of similarly mutated hipB sequences showed homology with their mutant hipA counterparts. Only

1.4% of the WT hipB sequences were paired with a mutant hipA sequence and these were always

the same hipA sequences. In the reverse context, approximately 25% of WT hipA were paired

with a mutant hipB, but these were the same hipB sequences in all but 1 strain.

hipBA operator sites, O1 O2 O3 O4:

The hipBA operon is autoregulated by binding of the hipBA complex to operator sites

upstream of the promoter (Black et. al. 1994). The first two operator sites O1 and O2 are separated

by 10 bp and the O3 and O4 are further upstream. All operator sequences are made up of the

consensus sequence TATCC(N8)GGATA (Black et. al. 1994), where the underlined letters are

conserved. The sequencing results (Table 3-1, Table S2C) showed overlaps of mutations in several

strains but, none of these mutations were in the conserved part of the operator regions. In some of

the isolates the O4 operator was either missing or highly mutated, which was why we were unable

to sequence the operator regions and hipB locus using the standard primers. Overall, compared to

57

the hipA and hipB coding regions, the operator sites showed very low frequency of mutations. This

may be significant in maintaining control over the expression of the hipBA locus, so that cells do

not default to a persister state or vice versa due to a change in regulation of the operon, supporting

the hypothesis suggested by (Hansen et. al. 2012).

3.2.3. Phylogenetic analysis of hipBA mutations reveal a group dependent genotype

The vast variability in the sequences of the hipBA locus and the apparent grouping of hipA

sequences with their hipB counterparts led us to the question of two possible scenarios: either hipA

is completely non-functional in vivo (unless it has high persister mutations) and thus accumulates

random mutations or it is under high evolutionary selective pressure which would suggest that it

plays an important role in survival in the environment (Sokurenko, Hasty et al. 1999). A recent

study by (Paul, Million-Weaver et al. 2013) showed that genes present on the lagging strand of the

chromosome in Bacillus subtilis accumulate mutations faster due to more head-on replication

transcription conflicts. They also showed that longer genes (>200 bp) on the lagging strand

accumulated more mutations as compared to shorter ones on the same strand. This is probably the

evolutionary reason why some genes, where the positive selection for mutations is important (for

example virulence genes), are oriented in the head-on direction to replication. hipA is a long gene

(1323 bp) and is present on the lagging strand of the E. coli chromosome in the head-on orientation

of replication.

It has been suggested that knowledge of the phylogenetic group of an E. coli strain can be

useful in predicting the extra-intestinal disease causing capabilities or resistance development

patterns (Johnson, Delavari et al. 2001; Johnson, Stell et al. 2001; Nazir, Cao et al. 2011).

58

Figure 3-5: hipA sequencing results. Table showing the differences in the hipA locus of individual natural isolates as compared to E.

coli K12 lab wild type strain. Each column is a different natural isolate and each row shows a specific nucleotide position. Green boxes

indicate silent changes and red boxes indicate amino acid changes. The strains are grouped together by the phylogenetic groups (A, B1,

B2 & D) they belong to. Open blue, yellow and purple boxes around the nucleotide changes indicate changes specific to that phylogenetic

groups

59

The same thought may be applied to the prediction of high persoister phenotype, since persistence

and resistance are both adaptive mechanisms developed by organisms in response to

environmental or host stimuli. To better understand the variability in these sequences (Example in

Figure 3-5) we identified the phylogenetic groups of all the isolates and assessed if there was a

relationship between the mutations in the hipBA locus and the phylogenetic groups. The groups

of 180 strains were already known (Ochman and Selander 1984; Duriez, Clermont et al. 2001).

Phylogenetic group characterization can be done by traditional methods of sequencing 10 different

house-keeping genes, multi-locus enzyme electrophoresis or ribotyping (Clermont, Bonacorsi et

al. 2000; Gordon, Clermont et al. 2008), but all these methods are complex and time consuming.

We used a rapid method of phylogenetic group determination which involves a simple quadruplex

PCR, developed by the Clermont group (Clermont, Christenson et al. 2013). E. coli strains were

divided into 7 phylogenetic groups A, B1, B2, D, E, C and F, where group A, B1 and C are majorly

non-pathogenic and adapted to a variety of environments and hosts and group B2, D, E and F are

pathogenic and commensal human strains (Clermont, Bonacorsi et al. 2000). 80% of the strains

from the panel of natural isolates belonged to the B2 group (Figure 3-6A). This trend was followed

when we looked at the distribution in only the pathogenic strains (Figure 3-6B), where 50% of the

strains were present in the B2 group.

We saw several group specific patterns emerge in the hipBA sequences. Approximately, 90%

of the sequences in every group showed similar changes in hipA and some alleles appeared to be

group specific (indicated by colored open boxes in Figure 3-2 and open black boxes in Figure S5).

To get a more detailed picture of the relatedness of the hipA sequences with their phylogenetic

groups, a phylogenetic tree was constructed. The tree was unrooted and constructed by the

Maximum Parsimony method with bootstrapping (1000 replicates) in Mega 6 software using the

60

hipA sequences (Tamura, Stecher et al. 2013). Further examination of the tree, revealed, that most

strains clustered together based on their phylogenetic groups. The close clustering into 5 major

groups suggests presence of 5 major alleles. Several branches of different lengths from the same

node points towards recombination events within these groups. Few exceptions existed and when

the sequences of these strains were further examined, it looked like the deviation in the

phylogenetic trees, was due to allelic exchange events.

Figure 3-6: Distribution of 450 natural isolates of E. coli based on phylo-groups: Phylogroups

of 450 clinical and commensal strains of E. coli were determined by a quadruplex PCR method.

The figures show the percent distribution of these strains in each of the 7 phylogenetic groups A)

All isolates B) Only UTI strains

0

20

40

60

80

A B1 B2 D E F C

Pe

rce

nta

ge o

f st

rain

s

0

10

20

30

40

50

60

A B1 B2 D E F C UC

Pe

rce

nta

ge o

f st

rain

s

B

A

61

Figure 3-7: Phylogenetic tree based on the hipA sequences of the natural isolates: The hipA

sequences were aligned in ClustalX and the tree was constructed using the Maximum parsimony

method with bootstrapping (1000 replicates) in Mega 6. Each node is labelled with the taxa.

Numbers at node junctions represent percent reliability of relationship. Inlays a, b, c, d and e show

the 5 major clusters of grouping (taxa not labelled). Length of lines indicates distance relatedness.

d

C

a

.

c

d

.

e

a

C

b

b

C

c

C

e

C

e

.

a

C

e

C

d

C

c

C

b

C

62

3.2.4. Importance of group specific HipA expression compared to the E. coli genome

Phylogenetic grouping of the sequenced hipBA alleles revealed a large diversity in the

sequences which appeared to be a result of group specific allele exchange events. In E. coli, a

nucleotide change is more likely to happen by recombination or gene conversion rather than

mutation (Guttman and Dykhuizen 1994). Our goal was to identify the alleles of hipA that are

positively selected which would signify their importance for the functionality of hipA in the

organism. hipA being an important player in persister formation, these alleles may be responsible

for high persistence in vivo.

To test our hypothesis, we calculated the Relative Synonymous Codon Usage (RSCU) values

for all hipA grouped by their phylogenetic groups and compared that to the RSCU values of the

published MG1655 E. coli genome. RSCU values are the number of times a particular codon is

observed, relative to the number of times that the codon would be observed in the absence of any

codon usage bias. In the absence of any codon usage bias, the RSCU value would be 1.00. A

codon that is used less frequently than expected will have a value of less than 1.00 and vice versa

for a codon that is used more frequently than expected. We obtained the codon usage values for E.

coli and calculated the RSCU values by this method. We add up the total number of times that the

codons for a particular amino acid is observed, then divide that by the number of codons for the

amino acid. This gave us the expected number of times that the codons should be observed

(expected frequency). We obtained the RSCU values for the hipA sequences using the Online

Genome Codon Adaptation tool. Then for each codon, for each group, the frequency of observation

was divided by the expected frequency. If the frequency is greater than expected the values are

above one.

63

RSCU values are a good indicator for comparison of expression levels of the protein, and

are frequently used for the optimization of expression of recombinant proteins for industrial

productions (Sharp and Li 1987; Sharp, Emery et al. 2010). Comparing these values will give us

th difference in the levels of expression of HipA in the groups. Alleles with higher expression will

indicate more HipA in the cell, which could indicate higher persister formation. Alleles identified

by this way will be tested in a MG1655 background to confirm our hypothesis.

3.3. DISCUSSION AND FUTURE DIRECTIONS

Our goal was led by our hypothesis that like Pseudomonas cystic fibrosis and Candida

albicans chronic oral infections (LaFleur, Qi et al. 2010; Mulcahy, Burns et al. 2010), other clinical

environments prone to recurrent infection could enrich for high persister mutants due to cyclic

antibiotic dosing. We identified high persister mutants were present in some strains of the panel

of isolates tested. Of the 250 strains tested, 60% of the strains showed higher tolerance to clinically

relevant concentrations of Ciprofloxacin, even though all strained exhibited unchanged MICs to

the drug (Figure 3-3). It is also interesting to see the presence of high persister strains in the

commensal strains, which could be a good strategy to survive non-targeted antibiotic therapy. In

the recurrent UTI isolates, three sets of strains showed enrichment of persisters in the 2nd and 3rd

infection isolates (Figure 3-4). However, on analysis of the phylogenetic groups of these strains

only two of the set of strains (W166-W167-W168, W169-W170-W171) belonged to the same

phylogenetic group and had the same hipBA profile. These strains were sequenced by another

group and confirmed to be clonally related. The presence of these high-persister strains in a chronic

infection of E. coli confirmed that high tolerance to drugs, can be enriched in UTI infections.

64

We have shown that the hipBA locus in E. coli is an important contributor to drug tolerance

in vivo and mutations in this locus increase the chances of survival during in vivo drug therapy

(Figure 2-14). All strains harbored mutation in the hipA locus known to contribute to a high

persister phenotype. We screened this locus in all the UTI strains and found the presence of 2

previously identified high persister mutations. We also found several mutations in the hipB and

operator sites of the strains. In some strains the O4 operator site was deleted. From hipBA operator

studies done in our lab (Sonja Hansen, unpublished) we see that O3 and O4 operators are essential

for the optimal regulation of the operon. When all four operator sites are present, hipA is

completely repressed. The deletion of O4, which is the furthest upstream of the operon does not

affect the expression of the operon, however if O3 is also deleted, the operon is completely

derepressed and expression levels increase. One allele of hipB was found to be combined with a

MG1655 hipA in several strains. This poses an interesting question about the effect of this alternate

hipB on the expression of the operon in a wildtype background

From the sequencing of the hipBA locus and phylogenetic analysis, a significant variability

in the sequences was observed, but this was found to be highly correlated to the phylogenetic

groups of the strains. A modeling study of the hipBA regulatory network predicted that the optimal

frequency of persister formation events is closely related to the frequency of environmental

change [37]. Since HipBA autoregulate their operon the binding affinity of the two molecules to

each other plus DNA operator sites is a controller of expression levels. The polymorphism in the

hipBA sequences, points to a positive selection for high variability in the frequency of entry into

persistence. It is predicted that stochastic fluctuations in the cells are responsible for the formation

of persisters. (It is possible that the HipBA TA systems have adapted over the course of evolution

65

to maintain a perfect balance between growth and survival to stress, by positively selecting for

adaptive mutations that increase the stochastic probability of persister formation.

Future Directions:

All of the above mentioned methods will be used to test candidate hipA alleles from the natural

isolates. Wild type strains with the alleles of interest will be constructed (Benson, Cafarelli et al.

2011) and tested for hip phenotype. If any hip alleles are identified by this method it will useful to

see if the alleles have an effect on the regulation of the operon. As shown in Chapter 2, we can use

a fluorescence activated transcriptional reporter system to look at transcriptional levels of the

mutant hipA proteins.

We have previously shown that HipB is degraded by the Lon protease which results in free

HipA in the cell. The C-terminus of the HipB is very important for its degradation (Hansen et. al.

2012). We found one mutant with a truncated HipB and a long HipA. If this truncation results in

the loss of Lon-mediated degradation of HipB, it would mean that the strain had a strong bias to

growth rather than survival and could possibly indicate a role in establishing an infection.

Ex-vivo experiments done in tissue culture systems, give a clear understanding of the host

mediated stresses bacterial cultures face during the course of an infection, without necessitating

the use of animal models. The effects of the mutant hipA alleles identified in this study will be

validated in a bladder cell tissue culture model, where survival of these strains in bladder cells

would give us insight into the function of these mutations.

66

3.4. MATERIALS AND METHODS

Strains and plasmids:

Natural isolates of E. coli used in this study were obtained from the following sources: 235 UTI

infection E. coli strains were obtained from Dr. Ann Stapleton at Washington University (Strains

labelled W); 120 commensal gut E. coli strains were obtained from France which was a collection

of 40 strains from a hospital in France(VDG), 40 from Croatia (C) and 40 from a tribe in Mali that

has never been exposed to synthesized antibiotics (M); 50 UTI infection E. coli strains were

obtained from Dr. James Johnson at University of Minnesota; and 72 of the standard E. coli

reference strains of the ECOR collection. Plasmid pZS*24 was obtained from (Lutz and Bujard

1997). All primers were obtained from EMG Operon. Plasmids for cloning hipA/hipBA were

constructed by digesting with KpnI. Inserts were amplified from relevant strains by the hot-shot

PCR method and digested with KpnI. Digested inserts and plasmids were ligated using NEB Quick

Ligase. Relevant primers are listed in Table S4

Media and growth conditions:

All strains were grown in LB broth at 37 °C in a shaker O/N. For exponential phase persister

assays, strains were diluted from ON cultures 1:100 in LB broth and grown to late exponential

phase. For stationary phase assays ON cultures were used.

DNA Preparation for PCR by the hot-shot method:

67

Briefly, 5 µl of ON growing culture was added to 25µl lysis buffer and heated to 95°C for 20mins,

then cooled at 4°C for 10 mins. 25ul of neutralization buffer was added to this mixture and gently

mixed. 5µl of the DNA extract was used in a 30ul PCR reaction (Truett, Heeger et al. 2000)

Phylogenetic group identification:

Phylogenetic group identification was done by a modified Quadruplex PCR method as published

by Clermont et al (2013). The DNA for the PCR was prepared by the hot shot PCR Method. PCRs

were run on a 1.8% gels for 40mins at 90V for analysis of the bands.

hipBA locus Sequencing:

The hipA and hipB genes with the operator sites were amplified by PCR using Taq Polymerase

from Promega. PCR products were sequenced at Macrogen Corp (Cambridge, MA). Primers used

for the sequencing are listed in Table S4 in Appendix II.

68

CHAPTER 4

Discussion

Taken together, our data show that the hipBA locus plays a complex role in the formation of

persisters. We have shown that mutations in the hipA locus, play a major role in increasing the

chances of survival of uropathogenic E. coli inside a host. Redundant mechanisms and pathways

control the formation of persisters in bacteria, and most mechanisms are stress related. However,

our results indicate that hipA mutations increase persisters in different physiological environments

of artificial media, ex-vivo in bladder cell cultures and in animals.

We developed a genetic screen where a culture of E. coli was chemically mutagenized and

were able to enrich and isolate high persister mutants. However, other than the hipA gene, we were

unable to successfully identify more genes with an important role in the production of the

phenotype. One way forward would be to characterize these mutants with several different classes

of antibiotics (only 2 were used in this study) or assess their phenotype in a panel of stresses like

pH, temperature and long term survival in antibiotic treatments to select a larger pool of mutants

with potential persister gene candidates.

We also established that UTI and commensal isolates of E. coli can be enriched for a high

persister phenotype in the environment. The factors that select for these phenotypes, are yet to be

determined. Some recent research done on this subject has shown that low levels of antibiotics are

capable of inducing persister formation. We also saw a huge variation in the hipBA sequences in

all the isolates. Most of these changes could be attributed to genetic drift, however some mutations

69

in the locus (like hipA7 and hipAP86L) are positively selected for high persister formation. All

these strains were sensitive to Ciprofloxacin with no change in MIC to the drug.

The persistence of bacteria in the urinary tracts of patients suffering from recurrent

infections is possibly due to the presence of antibiotic tolerant persister cells. From our studies, we

can see that high persister mutants are present in clinically isolated strains of E. coli that were

treated with high doses of antibiotics for the infection. Also, none of the mice from our animal

infections show complete sterilization of the infection even after proper clinical dosing. Presence

of low or highly expressed alleles of hipA in these organisms could be modulators of driving the

persister phenotype. Mapping these mutations onto the hipBA structures and testing their persister

phenotype in in vivo bladder cell culture assays will determine the structure-functional

relationships of this clinically important persister locus.

70

APPENDIX I

Additional Figures

Figure S1: Persister phenotype of the ΔgatC, ΔgatD and ΔgatR strains in the stationary

phase. The strains were grown overnight (20-24 hrs) in LBB from glycerol stocks and treated with

5µg/ml of Ofloxacin for 6 hrs. Aliquots were taken at 6 hrs, washed with 1% NaCl and dilutions

plated to count log % survival. Error bars indicate standard deviation of 3 replicates.

-3

-2

-1

0

1

ΔgatC ΔgatD ΔgatR wild type

Log

% s

urv

ival

71

Figure S2: Effect of the gatC frameshift mutation with a glpR deletion: Blue bars represent

killing with 100µg/ml Ampicillin in exponentially growing cultures. Orange bars represent

survival with 5 µg/ml of Ofloxacin in stationary phase. Graph represents an average of 4 replicates

and error bars indicate the standard deviation of the mean

-2

-1

0

1

2

ΔgatC ΔglpR ΔgatC ΔglpR WT

Log %

su

rviv

al

Amp 100 Ofl 5

72

Figure S3: Growth curve of the UTI isolates and their hipA mutants: Cultures were grown

overnight and diluted 1:1000 in fresh medium and incubated at °C for upto 24 hrs. Aliquots of

the cells were diluted in PBS and plated onto LB agar to count cfu/ml A) W226 and

W226ΔhipA7 B) CFT073 wt, CFT073 hipAP86l and CFT073hipA7

1.00E+05

1.00E+06

1.00E+07

1.00E+08

1.00E+09

1.00E+10

0 3 6 9 12 15 18 21 24

Lo

g C

FU

/ml

Time in hours

W226

W226ΔhipA

1.00E+05

1.00E+06

1.00E+07

1.00E+08

1.00E+09

1.00E+10

0 30 60 90 120 150 180 210 240 270 300

Log C

FU

/ml

Time in minutes

CFT073 P86L

CFT073 hipA7

CFT073 WT

A

B

73

Figure S4: A gel image of the PCR profiles used for the identification of the E. coli

phylogenetic groups (Adapted from Clermont et. al. 2013)

E B2

2

A/C B2 E B1

1

A/C F A B2

Phylogenetic groups

74

Group A hipA alleles – 95 isolates

Group B1-103 isolates

Figure S5A: A heatmap of the hipA mutations

hip

A g

ene

1323 b

ase

pair

s h

ipA

gen

e 1323 b

ase

pair

s

Non-synonymous

mutations

Synonymous mutations

Deletions No-mutations

75

Group B2 – 160 isolates

Group B2 – 100 isolates

Figure S5A: A heatmap of the hipA mutations

hip

A g

ene

1323 b

ase

pair

s

hip

A g

ene

1323 b

ase

pair

s

Non-synonymous

mutations

Synonymous mutations

Deletions No-mutations

76

Group C Group D – 109 isolates

6 isolates

Group E Group F – 24 isolates

5 isolates

Figure S5A: A heatmap of the hipA mutations

hip

A g

ene

1323 b

ase

pair

s

hip

A g

ene

1323 b

ase

pair

s

Non-synonymous

mutations

Synonymous mutations

Deletions No-mutations

77

Figure S6: Survival of CFT073 and its hipA mutants CFT073 hipAP86L and CFT073 hipA7

in mouse urinary tract infections. 10 mice/group were inoculated with the relevant strain and

treated with 0.2mg of Ciprofloxacin per mouse/dose 4 times a day for 3 days. Control mice were

given the same volume of Saline. The mice were euthanized after treatment and bladders and

kidneys were homogenized and cfu/ml counts were made by plating onto MacConkey’s agar

plates. Each point is the values of recovered bacteria from an individual mouse. Bars represent

median for the group and P<0.05 was considered a significant difference. Statistical analysis was

done in GraphPad Prism 6 using the Mann Whitney U test.

78

WT

Salin

e

WT

str

ep

Salin

e

WT

CIP

WT

Str

ep

CIP

hip

A7C

IP

WT

Str

ep

CIP

hip

AP

86L

CIP

WT

Str

ep

Cip

1 0 0

1 0 1

1 0 2

1 0 3

1 0 4

1 0 5

1 0 6

Lo

g c

fu/B

lad

de

r

W T S a lin e

W T S tre p S a lin e

W T C IP

W T S tre p C IP

h ip A 7 C IP

W T S tre p C IP

h ip A P 8 6 L C IP

W T S tre p C IP

P = 0 .2 9 P = 0 .2 P = 0 .1 1 P = 0 .1 2

Figure S7: Competition assays: Competition assays of CFT073 WT with CFT073 high persister

hipA mutants A) in vitro assays. Cultures were either tested individually or in competition of wild

type and mutant. (+) indicates cultures were grown separately to exponential phase and mixed

together in a 1:1 ratio when they reached late exponential phase and antibiotic was added. (/)

indicates cultures were diluted 1:1 from O/N cultures into fresh medium and grown together and

antibitotic was added at late log phase. 2µg/ml of Ciprofloxacin was used. B) in mouse acute UTI

infections, Each point represents an individual mouse and P-values below 0.05 are significant.

Statistical analysis done in GraphPad Prism6 software using Mann-Whitney U test. Bars indicate

median values for the group.

1.00E+02

1.00E+03

1.00E+04

1.00E+05

1.00E+06

1.00E+07

Log

cfu

/ml

Mutant WT

B

A

79

APPENDIX II: ADDITIONAL TABLES

Table S1A: List of all changes in hipA in the UTI and commensal strains

Amino Acid

Change

Nucleotide

position

Nucleotide

change

Amino Acid

Change

Nucleotide

position

Nucleotide

Change

- 12 T - A - 513 A - G

- 36 G - T Gly172Arg 514 G - C

- 60 C - T - 519 A - T

Gly22Ser 64 G - A - 525 G - A

Pro30Ala 88 C - G - 528 G - C

90 G - T - 537 C - T

- 90 G - T - 540 T - C

Glu31Lys 91 G - A - 546 A - G

- 102 A - C - 555 C - G

Ser35Asn 104 G - A - 564 G - A

- 123 G - A Pro190Ser 568 A - C

Ser44Ala 130 T - G - 570 C - A

Ser44Leu 131 C - T - 582 C - T

- 144 G - A - 588 C - T

Gly50Arg 148 G - A - 597 C - T

- 162 T - A - 619 C - T

- 168 C - T - 622 C - T

Val57Gly 170 T - G Leu213Val 637 C - G

- 174 T - C - 639 T - C

Asn59Lys 177 C - A - 651 T - C

- 189 C - T Asp219Asn 655 G - A

- 190 C - T - 678 A - G

- 193 T - C Asn 227Arg

680 A - G

Pro69Ser 205 C - T 681 T - G

- 219 C - T Asn 227 Lys 681 T - G

Arg78His 233 G - A Val228Gly 683 T - G

- 243 C - T - 687 C - T

80

Ser84Lys 251 G - A Glu234Lys 700 G - A

252 A - G Ala242Thr 724 G - A

Pro86Leu 257 C - T Thr245Met 734 C - T

- 267 A - G - 735 G - A

- 279 A - T - 768 T - C

- 288 C - T Pro262Thr 784 C - A

Ala100Ser 298 G - T - 792 G - T

- 303 G - A - 819 A - C

- 306 G - A - 822 C - T

Leu103Ser 308 T - C Arg277 Gln

830 G - A

Ile104Leu 310 A - T 831 G - A

- 312 A - C - 834 C - T

Asp107Asn 319 G - A - 840 T - G

321 C - T - 846 G - A

- 321 C - T - 852 G - C

Val110Ile 328 G - A - 867 G - T

Thr111Met 332 C - T

Lys290 Arg

868 A - C

- 333 G - A 869 A - G

Hys112Cys 334 C - T 870 A - C

335 A - G Asp291Aln 872 A - C

Hys112Arg 335 A - G - 876 C - T

336 T - C Met296Ile 888 G - T

Hys112Arg 335 A - G - 891 A - G

- 336 T - C - 894 C - T

Lys119Gln 355 A - C - 897 G - A

- 360 T - C - 900 C - G

Ala123Val 368 C - T - 903 C - T

- 372 A - G - 924 G - A

- 375 T - A - 927 C - T

Ala134Val 401 C - T - 930 T - C

- 411 G - T - 978 A - G

- 412 C - T - 984 G - A

81

- 414 A - G - 993 C - T

Asp146Val 437 A - T - 1005 A - G

- 459 C - A Pro338Leu 1013 C - T

- 462 A - G - 1017 C - A

- 474 A - T - 1018 C - T

- 477 A - G - 1020 T - G

Leu161Phe 481 C - T - 1176 G - A

- 483 C - T Asp394Tyr 1180 G - T

Cys168Arg 502 T - C Ala396Ser 1186 G - T

- 1023 C - T Ile399Val 1195 A - G

- 1026 T - C - 1200 A - G

Thr343Ala 1027 A - G - 1203 A - G

1029 G - A - 1206 A - C

- 1032 A - G Asn405His

1213 A - C

- 1056 G - A 1215 C - T

- 1059 A - T Thr408Ser 1222 A - T

- 1065 G - A Thr408Asn 1223 C - A

Leu356Val 1066 C - T - 1245 G - A

Ala357Glu 1073 C - A Val418Leu 1252 G - T

- 1074 A - C Thr420Lys 1259 C - A

Thr364Met 1091 C - T Ser424Thr 1271 G - C

- 1095 A - C - 1284 G - A

Arg372Gln 1115 G - A - 1289 T - C

Phe374Tyr 1121 T - A Gly431Arg 1290 G - C

- 1123 T - C Gly431Arg

1291 G - C

Ala376Val 1127 C - T 1293 A - T

- 1128 G - T Gly431Asp 1292 G - A

Val380Leu 1138 G - T - 1293 A - T

Arg382 Lys 1145 G - A - 1296 G - C

- 1149 C - T Ser439Ile 1316 G - T

Glu385Gln 1153 G - C 1322 G - A

- 1174 C - T

82

Table S1B: List of all changes in hipB

Nucleotide

change

Amino Acid

Change

Nucleotide

Change

Amino Acid

change

G18A - T147A

C21A - G148A Asp 50 Asn

G26A Ser 9 Asn A157T Thr 53 Ser

C32T Thr 11 Met G159A

G39A - C162G

C41A Ala 14 Glu C164T Thr 55 Met

AT44/45GA Asn 15 Arg A168C

GCA46/47AAA Ala 16 Lys G177T Lys 59 Asn

C55A Leu 19 Met G193T Glu 65*STOP

C63T - G207A

T72C - G217A Ala 73 Thr

A89G Glu 30 Gly G219A

G90A - A222T Lys 74 Asn

C91T - T225A Asn 75 Lys

C95A Ala 32 Glu T238G Ser 80 Ala

T105C A241G Thr 81 Ala

G106T Gly 36 Cys C247A Gln 83 Lys

T108C A253G Asn 85 Asp

G123A C256T

C135T T262C Arg 88 Trp

A142T Asn 48 Tyr T265G STOP 84 Glu

C144T A266G

83

Table S1C: hipBA operator sites mutation: All positions marked as negative from first base of

hipB

Nucleotide change Nucleotide change Nucleotide change

C -5 G C -33 T A -89G

A -17 T T -43 G G -96C

C-18T T -62 C G -98 C

C-26A O -67+T

G -27 A G -74 A

A -28 T A -87G

Table S2: List of Primers

Primer Sequence Origin

hipBAoperon deletion

hipBAO(KO)KanUP

ATCCCGTAGAGCGGATAAGATGTGTTTCCAG

ATTGACTTTATTGTGTAGGCTGGAGCTGCTT

CG

This study

hipBAO(KO)KanDW TTAACATAATATACATTATGCGCACCAACAT

AAACCAAGGGACATATGAATATCCTCCTTA

This study

hipBAOUP AAATCCTCCTTTTTATCCGCGATC This study

hipBAODW GCATCACTCAGACATGATTTAACATAATATA This study

hipBAOKRPUP ACGCTATGCGACGCGAAAAATGCCTCGCCA

GAATCAACAGAACAGCAAAATCTGGAGTGG

TATCAGAAGAACTCGTCAAGAAGG

This study

hipBAOKRPDW AAGAATCCAGTCGTTGGCGGTCATGATTGTC

ATGCTCATTAACAATGACCAAACCCCATATC

CGTCATCGCCATTAATTCACTG

This study

CFTKRPUP TATCCGCGATCGCGGATATCGCAGCGTTTAT

CCCGTAGAGCGGATAAGATGTGTTTCCAGAT

TGACTTCAGAAGAACTCGTCAAGAAGG

This study

UTI isolate hipBA sequencing

UTIhipAUP ATCAACAGAACAGCAAAATCTGGAG

Marcusson

et. al. 2005

UTIhipADW GAATCCAGTCGTTGGCGGTCATG

UTIhipBUP TATCCGCGATCGCGGATATC

UTIhipBDW AATGGCAGCGAAAGTGACAACGG

UTIhipBUP2 CCA TTG AAC AGA CGT TTT TTA CGC This study

CFThipBAOUP GGCCAGGTCATTAAGATTACAGAT This study

84

gatC deletion

gatCdelUP

ATGTTTTCAGAAGTCATGCGTTATATTCTCG

ACCTCGGCCCTACGGTGATGCTGCCGATTAC

GCCCCGCCCTGCCAC

This study

gatCdelDW TTATTCTGCGAGAACGACTTTCTCTTGTTTAA

TAAAGCCACGCGCTCTACGCCAGGTCATTTA

TATTCCCCAGAACATC

This study

gatCverifUP CAGTGTCGGGTTAATGAAATA This study

gatcverifDW TGGGTAAATCGGAACCACATA This study

pZS*24 cloning

KpnIhipoperonUP1

AAAAAAAAAAGGTACCCCATTGAACAGACG

TTTTTTACGC

This study

KpnIhipoperonUP2 AAAAAAAAAAGGTACCTATCCGCGATCGCG

GATAT This study

KpnIhipoperonDW AAAAAAAAAACCATGGGAATCCAGTCGTTG

GCGGTCATG This study

KpnIhipAUP AAAAAAAAAAGGTACCATCAACAGAACAGC

AAAATCTGGAG This study

Clermont Phylogroup

PCR

chuA.1

chuA.2

yjaA.1b

yjaA.2b

TspE4C2.1b

TspE4C2.2b

AceK.F

ArpA1.r

GrpE.ArpAgpE.f

GrpE.ArpAgpE.r

GrpC trpAgpC.1

GrpC.trpAgpC2

trpBA.f Cntrl

trpBA.r Cntrl

ATGGTACCGGACGAACCAAC

TGCCGCCAGTACCAAAGACA

CAAACGTGAAGTGTCAGGAG

AATGCGTTCCTCAACCTGTG

CACTATTCGTAAGGTCATCC

AGTTTATCGCTGCGGGTCGC

AACGCTATTCGCCAGCTTGC

TCTCCCCATACCGTACGCTA

GATTCCATCTTGTCAAAATATGCC

GAAAAGAAAAAGAATTCCCAAGAG

AGTTTTATGCCCAGTGCGAG

TCTGCGCCGGTCACGCCC

CGGCGATAAAGACATCTTCAC

GCAACGCGGCCTGGCGGAAG

Clermont et.

al. 2013

85

REFERENCES

1. Baba, T., T. Ara, et al. (2006). "Construction of Escherichia coli K-12 in-frame, single-

gene knockout mutants: the Keio collection." Mol Syst Biol 2.

2. Balaban, N. Q., K. Gerdes, et al. (2013). "A problem of persistence: still more questions

than answers?" Nat Rev Micro 11(8): 587-591.

3. Balaban, N. Q., J. Merrin, et al. (2004). "Bacterial Persistence as a Phenotypic Switch."

Science 305(5690): 1622-1625.

4. Barry, C. E., H. I. Boshoff, et al. (2009). "The spectrum of latent tuberculosis: rethinking

the biology and intervention strategies." Nat Rev Micro 7(12): 845-855.

5. Benson, R. W., T. M. Cafarelli, et al. (2011). "SOE-LRed: A simple and time-efficient

method to localize genes with point mutations onto the Escherichia coli chromosome."

Journal of Microbiological Methods 84(3): 479-481.

6. Bigger, J. (1944). "Treatment of Staphylococcal infections with Penicillin with inertmittent

sterilisation." The Lancet 244(6320): 497-500.

7. Black, D. S., B. Irwin, et al. (1994). "Autoregulation of hip, an operon that affects lethality

due to inhibition of peptidoglycan or DNA synthesis." J. Bacteriol. 176(13): 4081-4091.

8. Black, D. S., A. J. Kelly, et al. (1991). "Structure and organization of hip, an operon that

affects lethality due to inhibition of peptidoglycan or DNA synthesis." J. Bacteriol.

173(18): 5732-5739.

9. Blango, M. G. and M. A. Mulvey (2010). "Persistence of Uropathogenic Escherichia coli

in the Face of Multiple Antibiotics." Antimicrobial Agents and Chemotherapy 54(5): 1855-

1863.

86

10. Chen, S. L., C.-S. Hung, et al. (2006). "Identification of genes subject to positive selection

in uropathogenic strains of Escherichia coli: A comparative genomics approach."

Proceedings of the National Academy of Sciences 103(15): 5977-5982.

11. Christensen, S. K. and K. Gerdes (2003). "RelE toxins from Bacteria and Archaea cleave

mRNAs on translating ribosomes, which are rescued by tmRNA." Molecular Microbiology

48(5): 1389-1400.

12. Clermont, O., S. Bonacorsi, et al. (2000). "Rapid and Simple Determination of the

Escherichia coli Phylogenetic Group." Appl. Environ. Microbiol. 66(10): 4555-4558.

13. Clermont, O., J. K. Christenson, et al. (2013). "The Clermont Escherichia coli phylo-typing

method revisited: improvement of specificity and detection of new phylo-groups."

Environmental Microbiology Reports 5(1): 58-65.

14. Correia, F. F., A. D'Onofrio, et al. (2006). "Kinase Activity of Overexpressed HipA Is

Required for Growth Arrest and Multidrug Tolerance in Escherichia coli." J. Bacteriol.

188(24): 8360-8367.

15. Datsenko, K. A. and B. L. Wanner (2000). "One-step inactivation of chromosomal genes

in Escherichia coli K-12 using PCR products." Proceedings of the National Academy of

Sciences 97(12): 6640-6645.

16. Dörr, T., K. Lewis, et al. (2009). "SOS Response Induces Persistence to Fluoroquinolones

in Escherichia coli." PLoS Genet 5(12): e1000760.

17. Dörr, T., M. Vulić, et al. (2010). "Ciprofloxacin Causes Persister Formation by Inducing

the TisB toxin in Escherichia coli." PLoS Biol 8(2): e1000317.

87

18. Duriez, P., O. Clermont, et al. (2001). "Commensal Escherichia coli isolates are

phylogenetically distributed among geographically distinct human populations."

Microbiology 147(6): 1671-1676.

19. Falla, T. J. and I. Chopra (1998). "Joint Tolerance to beta -Lactam and Fluoroquinolone

Antibiotics in Escherichia coli Results from Overexpression of hipA." Antimicrob. Agents

Chemother. 42(12): 3282-3284.

20. Fiedoruk, K., T. Daniluk, et al. (2015). "Type II toxin–antitoxin systems are unevenly

distributed among Escherichia coli phylogroups." Microbiology 161(Pt 1): 158-167.

21. Freddolino, P. L., S. Amini, et al. (2012). "Newly Identified Genetic Variations in Common

Escherichia coli MG1655 Stock Cultures." Journal of Bacteriology 194(2): 303-306.

22. Fridman, O., A. Goldberg, et al. (2014). "Optimization of lag time underlies antibiotic

tolerance in evolved bacterial populations." Nature 513(7518): 418-421.

23. Gerdes, K., S. K. Christensen, et al. (2005). "Prokaryotic toxin-antitoxin stress response

loci." Nat Rev Micro 3(5): 371-382.

24. Germain, E., D. Castro-Roa, et al. "Molecular Mechanism of Bacterial Persistence by

HipA." Mol Cell 52(2): 248-254.

25. Germain, E., D. Castro-Roa, et al. (2013). "Molecular mechanism of bacterial persistence

by HipA." Mol Cell 52(2): 248-254.

26. Gordon, D. M., O. Clermont, et al. (2008). "Assigning Escherichia coli strains to

phylogenetic groups: multi-locus sequence typing versus the PCR triplex method."

Environmental Microbiology 10(10): 2484-2496.

27. Guttman, D. and D. Dykhuizen (1994). "Clonal divergence in Escherichia coli as a result

of recombination, not mutation." Science 266(5189): 1380-1383.

88

28. Hall-Stoodley, L., J. W. Costerton, et al. (2004). "Bacterial biofilms: from the Natural

environment to infectious diseases." Nat Rev Micro 2(2): 95-108.

29. Hansen, S., K. Lewis, et al. (2008). "Role of Global Regulators and Nucleotide Metabolism

in Antibiotic Tolerance in Escherichia coli." Antimicrob. Agents Chemother. 52(8): 2718-

2726.

30. Hung, C.-S., K. W. Dodson, et al. (2009). "A murine model of urinary tract infection."

Nature Protocols 4(8): 1230-1243.

31. Hvidberg, H., C. Struve, et al. (2000). "Development of a Long-Term Ascending Urinary

Tract Infection Mouse Model for Antibiotic Treatment Studies." Antimicrob. Agents

Chemother. 44(1): 156-163.

32. Jakobsen, L., V. Cattoir, et al. (2012). "Impact of low-level fluoroquinolone resistance

genes qnrA1, qnrB19 and qnrS1 on ciprofloxacin treatment of isogenic Escherichia coli

strains in a murine urinary tract infection model." Journal of Antimicrobial Chemotherapy

67(10): 2438-2444.

33. Jakobsen, L., P. Garneau, et al. (2011). "Microarray-based detection of extended virulence

and antimicrobial resistance gene profiles in phylogroup B2 Escherichia coli of human,

meat and animal origin." Journal of Medical Microbiology.

34. Johnson, J. R., P. Delavari, et al. (2001). "Phylogenetic Distribution of Extraintestinal

Virulence-Associated Traits in Escherichia coli." Journal of Infectious Diseases 183(1):

78-88.

35. Johnson, J. R., A. L. Stell, et al. (2001). "Phylogenetic and Pathotypic Similarities between

Escherichia coli Isolates from Urinary Tract Infections in Dogs and Extraintestinal

Infections in Humans." Journal of Infectious Diseases 183(6): 897-906.

89

36. Kaldalu, N., R. Mei, et al. (2004). "Killing by Ampicillin and Ofloxacin Induces

Overlapping Changes in Escherichia coli Transcription Profile." Antimicrob. Agents

Chemother. 48(8): 3213-.

37. Kawano, H., Y. Hirokawa, et al. (2009). "Long-Term Survival of <I>Escherichia coli</I>

Lacking the HipBA Toxin-Antitoxin System during Prolonged Cultivation." Bioscience,

Biotechnology, and Biochemistry 73(1): 117-123.

38. Keren, I., N. Kaldalu, et al. (2004). "Persister cells and tolerance to antimicrobials." FEMS

Microbiology Letters 230(1): 13-18.

39. Keren, I., N. Kaldalu, et al. (2004). "Persister cells and tolerance to antimicrobials." FEMS

Microbiol Lett 230(1): 13-18.

40. Keren, I., D. Shah, et al. (2004). "Specialized Persister Cells and the Mechanism of

Multidrug Tolerance in Escherichia coli." J. Bacteriol. 186(24): 8172-8180.

41. Koh, R. and M. Dunlop (2012). "Modeling suggests that gene circuit architecture controls

phenotypic variability in a bacterial persistence network." BMC Systems Biology 6(1): 47.

42. Korch, S. B., T. A. Henderson, et al. (2003). "Characterization of the hipA7 allele of

Escherichia coli and evidence that high persistence is governed by (p)ppGpp synthesis."

Molecular Microbiology 50(4): 1199-1213.

43. Korch, S. B. and T. M. Hill (2006). "Ectopic Overexpression of Wild-Type and Mutant

hipA Genes in Escherichia coli: Effects on Macromolecular Synthesis and Persister

Formation." J. Bacteriol. 188(11): 3826-3836.

44. LaFleur, M. D., Q. Qi, et al. (2010). "Patients with Long-Term Oral Carriage Harbor High-

Persister Mutants of Candida albicans." Antimicrob. Agents Chemother. 54(1): 39-44.

90

45. Lewis, K. (2007). "Persister cells, dormancy and infectious disease." Nat Rev Micro 5(1):

48-56.

46. Lewis, K. (2010). "Persister cells." Annu Rev Microbiol 64: 357-372.

47. Lewis, K., A. Spoering, et al. (2005). Persisters: specialized cells responsible for biofilm

tolerance to antimicrobial agents. Biofilms, Infection, and Antimicrobial Therapy. J. Pace,

M. E. Rupp and R. G. Finch. Boca Raton, London, New York, Singapore, Taylor &

Francis: 241-256.

48. Luidalepp, H., A. Jõers, et al. (2011). "Age of Inoculum Strongly Influences Persister

Frequency and Can Mask Effects of Mutations Implicated in Altered Persistence." Journal

of Bacteriology 193(14): 3598-3605.

49. Lutz, R. and H. Bujard (1997). "Independent and tight regulation of transcriptional units in

Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements." Nucleic

Acids Res 25(6): 1203-1210.

50. Magnusson, L. U., A. Farewell, et al. (2005). "ppGpp: a global regulator in Escherichia

coli." Trends Microbiol 13(5): 236-242.

51. Maisonneuve, E., L. J. Shakespeare, et al. (2011). "Bacterial persistence by RNA

endonucleases." Proc Natl Acad Sci U S A 108(32): 13206-13211.

52. Miller, J. (1992). A Short Course in Bacterial Genetics: A Laboratory Manual

53. and Handbook for Escherichia coli and Related Bacteria. Cold Spring Harbor, Cold Spring

Harbor Laboratory Press

54. Miller, J. H. (1992). A short course in bacterial genetics. Plainview, NY, Cold Spring

Harbor Laboratory Press.

91

55. Moyed, H. S. and K. P. Bertrand (1983). "hipA, a newly recognized gene of Escherichia

coli K-12 that affects frequency of persistence after inhibition of murein synthesis." J

Bacteriol 155(2): 768-775.

56. Moyed, H. S. and K. P. Bertrand (1983). "hipA, a newly recognized gene of Escherichia

coli K-12 that affects frequency of persistence after inhibition of murein synthesis." J.

Bacteriol. 155(2): 768-775.

57. Mulcahy, L. R., J. L. Burns, et al. (2010). "Emergence of Pseudomonas aeruginosa Strains

Producing High Levels of Persister Cells in Patients with Cystic Fibrosis." J. Bacteriol.

192(23): 6191-6199.

58. Mysorekar, I. U. and S. J. Hultgren (2006). "Mechanisms of uropathogenic Escherichia

coli persistence and eradication from the urinary tract." Proceedings of the National

Academy of Sciences 103(38): 14170-14175.

59. Nazir, H., S. Cao, et al. (2011). "Can phylogenetic type predict resistance development?"

Journal of Antimicrobial Chemotherapy 66(4): 778-787.

60. Norton, J. P. and M. A. Mulvey (2012). "Toxin-Antitoxin Systems Are Important for

Niche-Specific Colonization and Stress Resistance of Uropathogenic Escherichia coli."

PLoS Pathogens 8(10): e1002954.

61. Ochman, H. and R. K. Selander (1984). "Standard reference strains of Escherichia coli

from natural populations." J Bacteriol 157(2): 690-693.

62. Paul, S., S. Million-Weaver, et al. (2013). "Accelerated gene evolution through replication-

transcription conflicts." Nature 495(7442): 512-515.

92

63. Pedersen, K., S. K. Christensen, et al. (2002). "Rapid induction and reversal of a

bacteriostatic condition by controlled expression of toxins and antitoxins." Molecular

Microbiology 45(2): 501-510.

64. Schilling, J. D. and S. J. Hultgren (2002). "Recent advances into the pathogenesis of

recurrent urinary tract infections: the bladder as a reservoir for uropathogenic Escherichia

coli." International journal of antimicrobial agents 19(6): 457-460.

65. Schumacher, Maria A., J. Min, et al. "Role of Unusual P Loop Ejection and

Autophosphorylation in HipA-Mediated Persistence and Multidrug Tolerance." Cell

Reports 2(3): 518-525.

66. Schumacher, M. A., K. M. Piro, et al. (2009). "Molecular Mechanisms of HipA-Mediated

Multidrug Tolerance and Its Neutralization by HipB." Science 323(5912): 396-401.

67. Schweizer, H., W. Boos, et al. (1985). "Repressor for the sn-glycerol-3-phosphate regulon

of Escherichia coli K-12: cloning of the glpR gene and identification of its product."

Journal of Bacteriology 161(2): 563-566.

68. Shah, D., Z. Zhang, et al. (2006). "Persisters: a distinct physiological state of E. coli." BMC

Microbiology 6(1): 53.

69. Sharma, S. V., D. Y. Lee, et al. (2010). "A chromatin-mediated reversible drug tolerant

state in cancer cell subpopulations." Cell 141(1): 69-80.

70. Sharp, P. M., L. R. Emery, et al. (2010). Forces that influence the evolution of codon bias.

71. Sharp, P. M. and W. H. Li (1987). "The codon Adaptation Index--a measure of directional

synonymous codon usage bias, and its potential applications." Nucleic Acids Research

15(3): 1281-1295.

93

72. Sokurenko, E. V., D. L. Hasty, et al. (1999). "Pathoadaptive mutations: gene loss and

variation in bacterial pathogens." Trends in Microbiology 7(5): 191-195.

73. Spoering A L, L. K. (2001). "Biofilms and planktonic cells of Pseudomonas aeruginosa

have similar resistance

74. to killing by antimicrobials." J. Bacteriol. 183: 6746–6751.

75. Spoering, A. L., M. Vulic, et al. (2006). "GlpD and PlsB Participate in Persister Cell

Formation in Escherichia coli." J. Bacteriol. 188(14): 5136-5144.

76. Spoering, A. L., M. Vulić, et al. (2006). "GlpD and PlsB participate in persister cell

formation in Escherichia coli." J Bacteriol 188(14): 5136-5144.

77. Tamura, K., G. Stecher, et al. (2013). "MEGA6: Molecular Evolutionary Genetics Analysis

Version 6.0." Mol Biol Evol 30(12): 2725-2729.

78. Truett, G. E., P. Heeger, et al. (2000). "Preparation of PCR-quality mouse genomic DNA

with hot sodium hydroxide and tris (HotSHOT)." BioTechniques 29(1): 52, 54.

79. Tsilibaris, V., G. Maenhaut-Michel, et al. (2007). "What is the benefit to Escherichia coli

of having multiple toxin-antitoxin systems in its genome?" J Bacteriol 189(17): 6101-6108.

80. Vazquez-Laslop, N., H. Lee, et al. (2006). "Increased Persistence in Escherichia coli

Caused by Controlled Expression of Toxins or Other Unrelated Proteins." J. Bacteriol.

188(10): 3494-3497.

81. Wiuff, C., R. M. Zappala, et al. (2005). "Phenotypic Tolerance: Antibiotic Enrichment of

Noninherited Resistance in Bacterial Populations." Antimicrob. Agents Chemother. 49(4):

1483-1494.

82. Yamaguchi, Y. and M. Inouye (2011). "Regulation of growth and death in Escherichia coli

by toxin–antitoxin systems." Nat Rev Micro 9(11): 779-790.

94

83. Yoshimura, M., T. Oshima, et al. (2007). "Involvement of the YneS/YgiH and PlsX

proteins in phospholipid biosynthesis in both Bacillus subtilis and Escherichia coli." BMC

Microbiology 7(1): 69.

84. Zaslaver, A., A. Bren, et al. (2006). "A comprehensive library of fluorescent transcriptional

reporters for Escherichia coli." Nat Methods 3(8): 623-628.