role of the carboxyl terminus in stable expression of hamster udp

0 1994 by The American Society for Biochemistry and Molecular Biology, Inc. T H E JOURNAL OF BroLoC1c.a CHEMISTRY Vol. 269, No. 29, Issue of July 22, pp. 19108-19115, 1994

Printed in U.S.A.

Role of the Carboxyl Terminus in Stable Expression of Hamster UDP-G1cNAc:Dolichol-P GlcNAc-l-P Transferase*

(Received for publication, March 9, 1994, and in revised form, April 15, 1994)

Jane Zara and Mark A. Lehrmanl From the Department of Pharmacology, University of lkxas Southwestern Medical Center, Dallas, Texas 75235-9041

In order to examine the function of the carboxyl terminus of UDP-G1cNAc:dolichol-P GlcNAc-1-P transferase (GPT), an endoplasmic reticulum enzyme that syn- thesizes GlcNAc-P-P-dolichol and, thus, catalyzes the committed step for N-linked glycosylation, a series of carboxyl-terminal truncation mutations was examined. Removal of the last 11 amino acids (398-408) from GPT had no significant effect on catalytic activity, thermal stability, tunicamycin binding, reticular localization, or consumption of cellular dolichol-P. However, in the absence of residues 398-408, the removal of three additional residues (Phe3@6-SerSBs-Ile3B7), or their change to L e ~ ~ @ ~ - M e t ~ ~ - T r p ~ ~ ~ fully eliminated enzyme expression in vivo. By reattaching residues 398-408 to L e ~ ~ @ ~ - - M e t ~ ~ - Trp3@’, expression was restored. Thus, the carboxyl-terminal region of GPT is essential for stable expression. Either of two sequences (395-397 and 398-408) is sufficient for expression, but neither is necessary.

Expression of GPT in the absence of residues 398408 specifically required the PheS@S-SerSBs-Ile3@7 sequence, since most scramble and termination mutations within this sequence were inhibitory. One scramble mutant (Ile3B6-SerSBs-Phe3@7-Stops@8) was enzymatically active, but unusually thermolabile. Thus, the function of PhesB6- SerSB@-Ile307 may be to stabilize GPT.

Asparagine-linked (N-linked) oligosaccharides are commonly found on the secretory and membrane proteins of eukaryotic cells and serve a variety of diverse functions (reviewed in Ref. 1). A key step in their synthesis is the reaction catalyzed by UDP-G1cNAc:dolichol-phosphate GlcNAc-1-P transferase (GPT),’ an enzyme of the endoplasmic reticulum (ER) (2). GPT catalyzes the formation of GlcNAc-P-P-dolichol, the initial gly- cosyl acceptor for a series of reactions that generate a 1Csugar dolichol pyrophosphate-linked oligosaccharide. In the lumen of the ER, this oligosaccharide is transferred to asparagine residues on nascent polypeptides with the motif Asn-Xaa-Ser/Thr. The resulting asparagine-linked oligosaccharide is then modified by glycosidases and glycosyltransferases to generate a ma- ture glycan.

The synthesis of GlcNAc-P-P-dolichol is, in essence, the committed reaction for N-linked glycosylation and is highly regu- latable in vitro by lipids and other factors (2). This laboratory

GM38545 and Welch Foundation Grant 1-1168. The costs of publication * This work was supported by National Institutes of Health Grant

of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in ac- cordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ To whom correspondence should be addressed. Tel.: 214-648-2323; Fax: 214-648-2971. ’ The abbreviations used are: GFT, UDP-G1cNAc:dolichol-phosphate GlcNAc-1-P transferase; CAT, chloramphenicol acetyltransferase; ER, endoplasmic reticulum; G W Z , GlcNAc-1-P transferase terminated with amino acid number xyz; PCR, polymerase chain reaction; CHO, Chinese hamster ovary.

and others (3-5) have begun to characterize its properties by molecular cloning methods. Recent efforts have been directed at defining an accurate structure-function map of GPT, since only speculative models currently exist (3). Computer-assisted sequence analysis suggests that GPT has the potential for 10 transmembrane segments, but there has been no experimental confirmation for these predictions. With one exception (6), GPT is the only eukaryotic sugar transferase predicted to have a structure with multiple transmembrane segments. The only hypothetical transmembrane segments of GPT to be character- ized so far, numbered 2 and 7, have potential dolichol recognition sequences (2, 7). Each potential dolichol recognition sequence is necessary for catalytic activity of GPT in vitro and in vivo but not for the ability to confer resistance to tunicamycin in cells (8). However, there is no direct evidence that potential dolichol recognition sequences function by binding to dolichol-P (8, 9). Thus, another role for this motif is possible.

In this report, we describe the effects of a series of carboxyl- terminal truncations that span the last third of GPT, including the 10th predicted transmembrane segment. This region of hamster GPT was selected for analysis for several reasons. (i) It contains several segments of sequence that are highly con- served with the Saccharomyces cerevisiae enzyme, encoded by the ALG7 gene, suggestive of an essential function (3). (ii) I t is often desirable to modify the carboxyl termini of proteins with fusion tags to facilitate purification, immunoprecipitation, and other procedures, but it is first necessary to determine whether modifications of the carboxyl terminus are likely to block an essential function. (iii) The carboxyl termini of proteins are often involved in organellar retention and important post- translational modifications.

Our results show that the carboxyl-terminal region of GPT is necessary for expression in vivo. Both the extreme carboxyl- terminal segment (residues 398408) and an adjacent segment (residues 395-397) are suffkient to support expression, but neither is necessary in the presence of the other. The function of the 395-397 segment is sequence-specific and appears to involve stabilization of the enzyme.

EXPERIMENTAL PROCEDURES Materials-Oligodeoxynucleotides were synthesized in the Depart-

ment of Pharmacology, UT-Southwestern, using an Applied Biosystems 380B DNA synthesizer. [~r-~~SlThio-dATP (1500 Ci/mmol), [O~-~~PI~ATP (3000 Ci/mmol), [Y-~~PIATP (6000 Cilrnmol), and UDP-N-[3Hlacetyl-~- glucosamine (UDP-[3H]GlcNAc, 30 Cilmmol) were purchased from Du- Pont NEN. Commonly used DNA restrictiodmodification enzymes were from Boehringer Mannheim, Promega, or New England Biolabs. Ultra- pure agarose was from Life Technologies, Inc. Sequenase version 2.0 kits were from U. S. Biochemical Corp. Geneclean I1 was from BIO 101, Inc. Tunicamycin (catalog no. T7765), phenylmethylsulfonyl fluoride, leupeptin, and aprotinin were from Sigma. A rabbit polyclonal antibody denoted A722 was raised against a peptide corresponding to residues 42-56 of hamster GPT and has been described elsewhere (10).

Cell Culture-Sera, culture media, penicillidstreptomycin mixture, trypsin (0.05%)-EDTA (0.53 m ~ ) solution, and G418-sulfate were from Life Technologies, Inc. Chinese hamster ovary (CHO-K1) cells were

19108

Carboxyl Terminus of GlcNAc-I-P Transferme 19109

, . . . , . . .

1' \

r .. c i o c) (ii LENGTH(^.^.)

- + -k i- EXPRESSION

FIG. 1. First and second series of carboxyl-terminal truncations. Schematic maps of the first ( u p p r p a n d ) a n d second llotwr pond) se r ies of GPT carboxyl-terminal truncation mutants are shown with the lengths o f protein coding sequence (shndrd wgmrnfs, in amino

tides (nf)). Using the 1.8-kilohase GPT cDNA (147 nucleotides o f 5'- acids (a.a. )) and 3'-untranslated sequence (open segments, in nucleo-

untranslated region, 408 amino acids of coding region, and 363 nucleotides o f 3"untranslated region) in pJZ2 as a positive control and pJZ1 vector alone as a negative control, expression was assessed in microsomes from COS-1 transfections. Each mutant was examined in at least two independent transfection experiments, and for enz-me assays the activity of the positive control was 2.5-6 times that o f the negative control, depending on the particular transfection experiment. A plus (+) sign indicates at least 50r'r of the positive control value in standardized enzyme assays (formation of I~"HIGlcNAc-P-P-dolichol in uifro) and a signal on immunohlots comparable with the positive control (material of M, = 34,000 or less, depending on the extent of the truncation); a minus t - ) sign indicates that, compared with the endogenous GPT o f COS-1 cells determined with the vector control, there was no additional enzyme activity or immunohlot simal.

described earlier (11) and routinely grown in F-12 medium containing 15 mM HEPES adjusted to pH 7.2 and supplemented with 2'% fetal calf serum, W'r calf serum, 100 unitdml penicillin, and 100 pdml streptomycin. COS-I cells were kindly provided by Dr. Suzanne Mumby (UT- Southwestern) and were grown in Dulhecco's modified Eagle's medium (Sigma) containing 10% fetal calf serum. 100 unitdm1 penicillin, and 100 p g h l streptomycin. CHO-K1 and COS-I cells were maintained in a water-saturated 37 "C incubator with 5rP CO,.

rDNAs n n d k t o r s - c D N A for hamster GPT (pTRG-22; GenRank accession no. ,JO5590) was described earlier (3). The cDNA was inserted into pTZ18U (Bin-Rad) for site-directed mutagenesis (8). pJR20. a eukaryotic expression vector carrying a cytomegalovirus promoter en- hancer and a G418 resistance marker was derived from pCMVl (12) and obtained from Dr. Pamela Beck (UT-Southwestern) as described (13). pJB20 was modified to create pJZ1 hy removing the small T intron and polylinker region by digestion with EroRI and BamHI, followed by insertion o f a new polylinker region flanked by EroRI- and RnmHI- compatihle ends. The upper and lower strands o f the new polylinker and useful restriction sites are as follows (termination signals underlined). The 1.84-kilohase EroRI-EroRI fragment of pTRG-22 was inserted into the EroRI site o f pJZ1 in the sense orientation to create pJZ2.

A f l I I XhoI

stream o f the translation termination signal I and thrn trratinp with- Ral-31 nuclease (0.5 units o f enzyme/5 pp of DSA in a volumc~ of 100 111 I

a t 0 T . Aliquots of 20 pI wrrr rrmovcsd a t 2-min intrnals (lonprst digestion. 10 minl. The reactions werr trrminatcd hy thr atltlitinn of Nn,EGTA(final concentration. 20 mvl, and all aliqunts bvrrr comhInrd. The TINAends were made hlunt hy incuhntion with Klrnow f r a p r n t 15 unitsi25 pll and 80 p~ concentrations of tlATP. dTTI'. dGTI'. a n t i d('T1' for 30 min at room temperaturr. rDSA f r a p r n t s w r w rrlrasrd from the vector by EroRI treatment and wrrr rrsnlvrd on a 1 .H"; aCnrosr T.AE gel (141 run a t 0.5 Vicm for 30 h. Suhfractinns ranbnp from hXO t o 1335 hase pairs in length, in increments of approxlm;ltrLly 150 h s r palm. were excised and purified using Grnrclran 11. I'urlfird f r a p r n t s wrrr ligated into pJZ1. predigested with EroRI and Ihl<\: and pvl-purifid, at an approximate stoirhiometry of 1 0 mol of insrrt. mol nf vrctor. Thr ligated material was transformrd into Esrhrrrrhrn rdr DH5-rt 1 L I f r Technologies. Inc.1. Ampicillin-rrslstant colnnirs wrrr idrntifirri with a "1'-lahelrd ( 15) GPT probe. and individual transfnrmants wrrr* charac- terized hy restriction enzyme dipestion and I)SA sequrnc~np t o d r t r r - mine the nature o f the truncation. llutants twminatinp a t amino :Ird codons 280. 288, 301, 322. 36.5, 369. 376. and 399 wrrv ohtalnrd.

The second series o f randrm truncations (FIE. 1. /ntwr p n d 1 was obtained by screening a collection of rrcomhinants. similar to that drscrihed ahove, for those that did not hyhridizr with oliponurlrotidr Fi'-GCACTCAGTCTTCAGGGM~~-3', corrrspondinp to nuclrot~drs 1375-1396 of GPT cDNA. hut did hyhridize with 5'-CGCTC;C'TC'A(;- GATCTGCAAA-3'. corresponding to nuclrotidrs 1302-1.321. l lu tan ts terminating at amino acid codons 3114.397.401, and 405 wrrr ohtalnrtl.

Mutagrnmis ofSprrifir G~c/ons--\Vith onr except~on. all sttr-dlrrctrd mutations were generated hy the PCR. Thr PC'R trmplatr was a (;PT cDNA fragment, typically the 1837-haw p a ~ r f r a m n r n t of pTRG-22. Thr upstream sense oligonucleotidr was S'-('T.,TA('TI\T(;T('T~~C',\T(;(;- CACTGCTT-3' (with theArrI site untlerlinrd. lnratrd a t rodon 1 3 1 1 1 . To make the GPT'"' mutant, the downstream oliponurlrotidr was 5'-C'T- T A G A T ~ C T C T A C C A C A ~ M G C T G A ( ' A ( ; C ( ; C T ( ; with :I

&/I1 site (underlined, to facilitate clon~ng. Similar ollponurlrotldrs with &/I1 sites were used to generate G 1 1 ' " . ( ; I T ' " , , (;PT ". Sei"K-Phe:'"7), and GPT'"'~Phr~"'"-llr''"'-Srr""~. Thr I'C'R was prrfnrmrd with denaturation at 94 for 5 min. annralinp at 55 C fnr 2 mln. and polymerization a t 72 for 3.5 min for 29 cyclrs and 10 min fnr the final (30th) cycle. Fragments were treated with Arc1 and Bc/ll lagarow prl- purified with Geneclean 111 and usrd in a trlplr llpatlon with t h v 3.06 kilohase ACCI-ArrI and 2.19-kilohasr Awl-IkdII fr;wnents of pJZ2. each also gel-purified.

One mutation. replacement of Phr'R''-Srr''~-llr'~- within GPT"'" with Leu-Met-Trp rGl"'"'~ Leu"'~~-?v1et"~-"q'" 1 ) . was grnrratrd hy nlipo-

AAGCTGGTATCGCCAC,~~MTGTGACA(;C'(;('TG-.'1' with a diap- nucleotide-directed mutagenesis with the antisenst. nliponuclwtidr~ .-I,-

nostic AsrI site underlinrdl using the lluta-C;rnr 2 kit ( i % l o - R n d ~ . :I.<

described earlier ,8~, hut with thr fnllowinp critlcal motiifiration. Thr 1.6-kilohase EroRI-PstI fragment of GPT was found to hr Inrt7irirntl.v converted to single-stranded DNA when ligated into thr phaprmid w r - tor pTZ18U. Most of the single-stranded viral DSA nhtalnrd Iarkrd both the GPT insert and a segment necessary fnr ampicillin rr.;ist;Inrr and/or growth tdata not shown~. Thus, phagrmids w~thnut Gr'T Insrrt were eliminated hy the requisite ampicillin srlrrtlon that followrd m u - tagenesis. However, to compensate for thr low amount of (;l'T-rnnt:lln- ing single-stranded template, the amount of o l ~ p ~ n t ~ r l ~ ~ o t i t i t ~ u.;rtl during mutagenesis was rrducrd by 50-fnld romparrd wlth thr w m r rnn-

(."1"-, ~u"'>"et''Y" 7 i p l ' l l l , ~,PT'I'"(Srr"'..-phr 8 . 8 ,, (;pT"", [ I r ''a'.-

sac11

B g l I I H i n d 1 1 1 EcoRV NheI Not1 KpnI ~'-AATTCAGATCTAAGCTTAAGGATATCTCGAGCTAGCGGCCGCGGTACCTAGGTAGATAGC

3'-GTCTAGATTCGAATTCCTATAGAGCTCGATCGCCGGCGCCATGGATCCATCTATCGCTAG

POI.YI.INKEH I

Random Carhoxvl-trrminal Duncations-In general, all procedures were carried out according to standardized protocols (14). One truncation mutation. which terminated a t codon 334 o f GPT. was created by digesting GPT cDNA (originating from pTRG-22) with EcoRI and D m l . followed by ligation of the EroRI-Dm1 fragment into pJB20 (which had been treated with Hind111 and then Klenow fragment with 80 p~ concentrations of dATP, dCTP, dGTP. and dTTP to create a blunt end) followed by EroRI digestion. In this construct, 9 fortuitous amino acids and a stop codon were downstream o f the DraI site.

The first series of random truncations (Fig. 1, upper panel) was created hy linearizing pJZ2 with EroNI (located 43 nucleotides down-

centratinn recommended hy the manufacturer. As a result. th r yield o f mutagrnized colonies was usually incrrnsrd hy at Irast l0-fnld.

For all mutants thr introdurtion of drtrimrntal spurious mutation.; during mutagenic procedures was rulrd out hy D S A srqurnrr analysis or. where indicated. by PCR rrstoration of inactivr mutants.

Cell 72ansfictions-Transient transfrrtinns wrrr prrfnrmrd in COS-I cells by the DEAE-dextran method as drsrrihrrl 14 I using 10 pp o f plasmidl0' cells. Transiently transfrrted crlls wrrr typically har- vested between 48 and 72 h following transfrrtion. Stahlr transfrrtionq with CHO-KI cells were performrd hy thr calrlum phosphntr mrthod

19110 Carboxyl Terminus of GlcNAc-1-P Dansferase

(14) using 10 pg of plasmid/106 cells. 1 mg/ml G418 was added 24 h after transfection, and G418-resistant colonies were picked after 14 days. Subclones were obtained by limiting dilution. The CHO-K1 GPT408 transfectant referred to throughout the text was isolated previously and designated Tn-10 (10).

Characterization of Dansfectants Containing GPT Mutants-% determine cellular resistance to tunicamycin, approximately 100-250 cells were plated per well into 48-well polystyrene plates (Costar Corp.) containing concentrations of tunicamycin ranging from 0 to 10 pg/ml as described above for CHO-Kl cells, except that 10% fetal calf serum was used. After 7 days, adherent cells were fixed and stained with Gram crystal violet (Difco). For the purpose of comparison, the highest concentrations of tunicamycin that did not inhibit growth were noted.

Cellular pools of dolichol-linked oligosaccharides were labeled with E3H1mannose as described earlier and fractionated on a silica high pres-

with 0.2% diaminobutane (8, 16). sure liquid chromatography column with an acetonitrile/water gradient

Confocal immunofluorescence microscopy was performed as described earlier with an antibody (A722) directed against residues 42-56 of GPT (10) at the Microscopy and Imaging Center, UT-Southwestern.

To assay GPT activity, COS-1 and CHO-K1 microsomes were pre- pared as described (111, and pellets were suspended in 20 mM Tris, pH 7.4, with 150 mM NaCl containing the protease inhibitors phenylmethylsulfonyl fluoride (2 pg/ml), leupeptin (1 pg/ml), and aprotinin (0.2 pg/ml). Protein concentrations were determined with the Bio-Rad protein assay reagent. The GPT assay was routinely performed with 10- or 20-pg aliquots of microsomes in the absence of detergent as described (11).

Thermolability of GPT mutants was assessed by suspending microsomes at a concentration of 10 pg/20 pl in Tris-buffered saline containing leupeptin, aprotinin, and phenylmethylsulfonyl fluoride as described above and incubating them at 37,42, or 50 “C for times ranging from 0 to 120 min. The suspensions were then assayed immediately for GF’T activity by supplementing them with the remaining assay compo- nents (11) and incubating them for 15 min at 37 “C.

Blotting Methods-Total RNAwas purified from either CHO-K1 lines or COS-1 cells as described (171, and 10-pg aliquots were analyzed by Northern blot analysis (11, 14). GPT transcripts were detected with a double-stranded cDNA probe corresponding to nucleotides 1-1837 of pTRG-22 (3) labeled with [32PldATP as described (15). Actin transcripts were detected with a single-stranded [32P]probe (11). Where indicated, radioactivity was quantified with an Ambis image acquisition and analysis system.

For immunoblot analysis, 5-100 pg of microsomal protein was incu- bated in the presence of 2% SDS, 62.5 mM Tris-C1, pH 6.8,10% glycerol, and 1 M P-mercaptoethanol for 30 min at 42 “C and resolved on a 10% SDS-polyacrylamide gel as previously described; the use of these relatively mild denaturation conditions was essential for detection of GPT on immunoblots (10). Detection was usually with the ECL Western blotting detection kit (Amersham Corp.), and blots were directly ex- posed to X-Omat AR imaging film (Eastman Kodak Co.) for 5 s to 30 min, depending on the signal. In some experiments, the Bio-Rad alkaline phosphatase kit was used instead of chemiluminescence, and the blots were developed for 5-30 min at room temperature.

RESULTS

GPT Remains Active after Removal of 11 Residues from Its Carboxyl Terminus but Is Inactivated by Longer Tkunca- tions-As described under “Experimental Procedures,” nuclease digestion of GPT cDNA was used to create two series of truncated forms of GPT, which varied by the number of amino acid residues removed from the carboxyl terminus. The first series, consisting of nine different truncations that removed up to 128 amino acid residues, was tested by transient expression in COS-1 cells followed by analysis of microsomal membranes with enzyme assays and with immunoblots employing an anti- peptide antibody specific for residues 42-56 of GPT. As summarized in Fig. 1 (upper panel), all nine truncations prevented expression of GPT in microsomal membranes. I t was concluded that the peptide removed by the shortest truncation of this series (15 residues) must contain important information.

A second more focused series of mutants was then con- structed with elimination of 3, 7, 11, or 14 amino acid residues from the carboxyl terminus of GPT. As summarized in Fig. 1

(lower panel), microsomes from transfected COS-1 cells expressing a 397-residue enzyme (lacking 11 residues, Arg-Tyr- Gln-Leu-Val-Arg-Leu-Phe-Tyr-Asp-Val-COOH), designated GPT397, as well as longer forms of GPT, had at least 50% of the enzyme activity of microsomes from COS-1 cells expressing GPT408, the normal form of GPT. Immunoblot signals for GPT3” and GPT408 were indistinguishable (data not shown). By aver- aging the results from nine COS-1 transfections performed over a period of 12 months, G W g 7 exhibited approximately 70-80% of the activity of GP‘Po8. In contrast, expression of cDNAs encoding GPT394 or shorter forms of GPT repeatedly yielded no significant enzyme activity or immunoreactive material above those attributable to the endogenous GPT enzyme in COS cells. These results suggested that the tripeptide

The methods used to generate these truncations caused random amino acid residues (encoded by a polylinker positioned next to the 3‘ ends of the truncated cDNAs) to fuse with the carboxyl termini of GPT constructs. For example, Ser-Arg-Ala- Ser-Gly-Arg-Gly-Thr was fused to GPT3”, and Ser-Ser was fused to GPT397. However, as shown in Fig. 2, these random peptides did not account for the results since GPT394 (sample 4 ) and GPT397 (sample 3 ) generated by PCR methods with authen- tic translation termination signals gave the same GPT activities as the original mutants (samples 8 and 9, respectively). The PCR-generated GPT394 mutant did not lack activity as a result of a spurious mutation introduced during the PCR, since use of this construct as a template for an additional PCR to restore residues Phe395-Ser396-Ile397 restored activity (Fig. 2, sample 5).

In all subsequent experiments, only GPT mutants with defined termination codons immediately following the desired coding sequences were examined.

GPPg7 Functions Normally in Tkansfected CHO-Kl Cells- In order to determine whether any properties of GPT397 might be abnormal, stable transfectants of either GPT397 (subclone A) or GPT408 in CHO-K1 cells were created and compared (Table I). For these comparisons, CHO-K1 cells were generally transfected to GPT levels 5-10-fold over the endogenous enzyme and expressed similar levels of GPT mRNA. GPT397 and G W o 8 had similar enzymatic activities and apparent K,,, values for UDP- GlcNAc (Table I). Furthermore, there were no significant differences in the pH profiles, thermolability characteristics, or detection by immunoblotting (data not shown), demonstrating that GPT397 was not a highly unstable mutant.

The properties of GPT397 and GP‘Po8 in stably transfected CHO-K1 lines were also examined in vivo. These forms of GPT were equally effective at conferring resistance to tunicamycin, an indirect measure of tunicamycin binding (Fig. 3). Each caused an alteration of the pool of dolichol-linked oligosaccharides, shifting the usual Glc,Man,GlcNAc, pattern observed in control cells to primarily Man,GlcNAc, (data not shown). As described earlier (8, 10) this suggests that both enzymes had similar access to the cellular pool of dolichol-P, thus competing with the mannose-P-dolichol and glucose-P-dolichol synthases. This is an indication that GPPg7 was correctly sorting to the ER. This was supported by indirect immunofluorescence microscopy of G W g 7 and GPPo8 (Fig. 4), which revealed reticular staining patterns.

In summary (Table I), no functional differences between GPT397 and GPT408 were identified.

Is Not Stably Expressed in Vivo and Is Not a Domi- nant Negative Enzyme-After stable transfection into CHO-K1 cells, GPT394 was undetectable by enzyme assays and immunoblot analyses (data not shown) as well as growth in the presence of tunicamycin (Fig. 3) and indirect immunofluorescence

Phe395-Ser396-Ile397 was necessary for enzyme expression.

A 110

50 40

30 20 10

106 - 80 -

49.5 -

32.5 - ' 27.5 - 18.5 -

S 2 3 4 5 6 7 8 9 S FIG. 2. GPT assays and immunoblots with microsomes from

COS-1 cells transfected with G P T mutants and controls. Upprr p o n d , r rsul ts of thrrr individual ('OS-1 transfection rxprriments (indicated by nprn, closed, or striprrf bnrs, are shown for: I, (;IT"", the positive control; 2, p J Z l vrctor. the ncgativr control; the truncation mutants .?, GPT'"'', 4. GPT:"", and 6 , G P T " ' ~ L " " " - M c t ' ~ " " - ~ ~ ' ' ' ~ ~ , rach with defined termination codons generated by the PCR; and .5 and 7, GPT"!" .:IC!' and C,qY'"' I.\IW .Y41 , resprctivrly, which arc PCR restoration controls expected to give products equivalent to GPT'"". In all cases the data were normalizrd to the results for GM""'. Error bars indicating standard deviations arr shown if assays were performrd in triplicatr; all other assays are reported as the averages of duplicate drtrrmina- t ions, and the duplicatrs did not vary hy more than 20';. INccvr pnnrl , alkaline phosphatase-stained immunohlots for the various mutants de- scrihrd in the upprr pnnd arr shown. Memhranes from a CHO-Kl transfrctant stahly expressing GF'T'"' (lone S ) ar r inc ludd for r r f r r - ence. GPT migrates aberrantly 1 IO) with an apparent M , of approximately 34.000 inrrorc,). Also shown are results fnr A', GPT""'. and 9, ~,"'I'''

carhoxyl-terminal extrnsions SRASGRGT and S S , respectively. An Rri , ohtainrd from the original screen (Fig. 1) with the spurious

polyacrylamide gel was used. and the positions of prrstained protrin standards (Bio-Rad) are shown with their rffrctive molecular wrights. In several exprrimrnts. an apparrnt oligomer of GPT is visihlr (srr lnnr S a n d Fig. 7), which may hen result ofthr mild denaturation conditions used.

microscopy (Fig. 4). However, Northern blot analysis of a collection of randomly chosen transfectants demonstrated that

and GPT"os (Fig. 5). CHO-K1 cells require GPT activity for viability, and the in-

ability to detect GI'T"9" expression in CHO-Kl transfectants could be explained by a dominant negative phenotype in which GW"9" somehow interfered with the function of the endogenous GPT in CHO-K1 cells. In this scenario, transfectants expressing high levels of GPT"!'" would not he viable, and only weak expressers of GPT""' mRNA would survive. However, the relative ease with which high expressers of GW""' mRNA were isolated indicates that GPT'""' was not acting in a dominant negative manner.

Random1.v Chosen Residues ut Positions 3.9fi7?.97 in GPF" Do Not Support Expression-The Phe"'-Sei'"'--Ile'"; sequence

GpT:i!lI mRNA was readily expressed compared with GPT""'

GPT 3971

0 0.33 1.25 5 L 395 M 3% w 3')7 (A)

0.16 0.63 2.5 10

[Tunicarnycin], p@ml Fir:. 3. Tunicamycin resistance of stable CHO-KI trannfec-

tants. Either untransfrctrd ( ' 1 1 0 crlls or ( ' 1 1 0 crlls stnhly trnnsfwted wi th th r GPT construct indicatrd wrrr testvd fnr rrsl.;t;lncr t r l tuo1ra- rnycin as dcscrihrd undrr "F.xperimental l'r~lcc~rl~rrc~.;."ftlr~ tlrsIgnatlnn.; for individual transfrctrd suhclonr.; arP In p r ~ r ~ * n t h r w u ; rnrrr.Gponrllng Northern blots of mRNA are shown in Fig. :i.

A. CHO-Kt C. GPT3g7

occurs a t t he carhoxyl rnd of the 10th (residues 379-397) of 10 predicted transmemhrane segmcnts in hamster GPT"" ( 3 1 . Thus, it was possible that their requirement simply reflectcd amino acid hulk or hydrophohic character (either o f which might he required to form an effrctive transmemhrane srg- ment). To test this, Phe"'~~-Ser''H'-lle!"' of GPT"" was rrplncrrl with three randomly chosen hydrophohic residues, 1,cu "'.'- Met"OF."I'rpiq'. This mutant, GPT""^( Leu ""'-Jlrt ""'-Trp"'' I. was undetectable (Fig. 2, samplc f i ~ in COS-I microaomrs hy rn-

19112 h

Carboxyl Terminus of GlcNAc-1-P Dansferase

FIG. 5. Northern blot analysis of CHO-Kl trannfectantn. 10-pg samples of total RNA from (,ither untransfrctrd CI lO-Kl crlls or various transfectants werr analyzed hy agarose gel elrctrophorrsis and blotting with a GPT prohe as drscrihed under "Experimrntal Proce- dures.'' In some cases multiple suhclones Idesignatrrl hy capitol Irttrrs

levels found in diffcrent transfectants. Note that the GPT"' transcript in pnrrnlhrsrs) were analyzed to illustrate thr typical rangrs of mRNA

was longer than thosr of the mutants since this included approximately 0.5 kilohases o f 3'-untranslated scquencc; this sequence was not necessary for expression ( see Fig. 1). All samples were suhjected to elec- trophoresis on the same gel and hlottcd and prohed togethrr with the exception of G I T " 1 . 4 , and thr accompanying GPT"' sample. which werr procrssetl as n pair in a srpnratc rxprr iment .

zyme assay and immunoblot analysis and, thus, was indistinguishable from GPT""'. After stable transfection into CHO-Kl cells, this triple replacement was undetectable by these criteria as well as indirect immunofluorescence microscopy (not shown) and growth in the presence o f tunicamycin (Fig. 3). A PCR restoration was used to rule out spurious mutations (Fig. 2, sample 7 ) .

Residues PhcJ!'S-Scr'""-Ilc."";Arc Not Essential in the Presence of Residlres S984OR"Residues 398-408 of GPT had no apparent function in the presence of Phe"-Sert"fi-Ile~"'' (Table I ) . To determine whether the presence of Phe"'~-Sert"-1le:" was somehow masking a function of 398-408, GPT"" was altered to

tide shown above to he unable to support expression in the absence o f residues 398-408. Surprisingly, after transient transfection in COS-1 cells, this construct (designated

vitro (data not shown). This was confirmed after stable transfection into CHO-K1 cells. GPT"(Leu~"l~'-Met'"'~-'kp'"l~) was expressed at normal levels as judged hy measurement o f enzymatic activity in vitro (Fig. 6 , upper panel). detection by immunoblot analysis (Fig. 6, crnterpanel ), and ability to confer resistance to tunicamycin (Fig. 6 , lower pane l ) . Thus, the carboxyl terminus had a level ofcomplexity that was not apparent from the truncation analysis described in Fig. 1. Either segment, 395-397 or 398-408, was sufficient to support expression o f GPT, but neither was necessary in the presence o f the other. Possible mechanisms to explain this redundancy in function are included under "Discussion."

Function of Residnes .?95-?97 Involves a Specific Seqnence Requirement-In ordrr to elucidate what function these seg-

rep]ace ~ ~ ~ l ! l ~ ~ ~ e ~ i ! l l ~ ~ ~ ~ ~ ' l ~ l ~ with Leu:iqr"Mefl'lfi- Trf", the tripep-

GPTlllS( Leu:'~~~Met:I!l~-~p:'"')) had norm a 1 enzymatic activity in

B

c , : p . ." " . . x - . -" "-. L *> 5 .gj I 3

@ 2

e 1 0 0.33 1.25 5

0.16 0.63 2.5 10

runicamycin], pg/ml

ments might have, the simpler of the two (395-397 was examined further. Residues Phe'"'~-Srr""'-IIr''"' of GPT'!"' ( i . 1 8 . in th r absence o f residues 398-408) were scrambled to yield nrw com-

Ser""'"he"''', and tested by transient expression in COS-I crlls. Simple reversals of Ser""' with Ile'"" or Phe.!"" with Ser"" (Fig. 7, upper panel, samples 6 and R 1 rrsultrd in a complrtr loss of GPT activity in COS-1 microsomes. However. in contrast with

could be detected (Fig. 7 . lore-rr pnnel. samplc 6; and dntn not shown). This detection was highly variahlr among differrnt microsome preparations. In some cases npparrnt protenlytic degradation products wrre also ohsrned. One mutant. GPT""'r Ile""-Ser7""-Phel"' 1 ( sample 7 ). could he detrctrd to pnr- tial but variable extents with COS-I cnzymr assays (up to .'Wi o f normal) as well as hy immunohlotting. Mrssrngrr RNAs for all o f these constructs were readily detected hy Sorthern hlot analysis of the transfected COS-1 cells (srr Fig. 7 lrgrnd].

binations, Ph~'l~l'-II~l"l;-Se~'l'17, ser'l'Im>-phe !'"8-Ile'!'87, nnd llr"''-7-

Gm'ISl.1 , ~n ' some immunoblot analyses an innctivr polvprptidr

Carboxyl Terminus of GlcNAc-I-P lhnsfcrasc 19113

A 130 120

50 40 30 20 10

km 106. 80 .

49.5 . 32.5 . 27.5

18.5

S 1 2 4 5 6 7 FIG. 7. COS-1 transfections of GF'T mutants with altered se-

quences for amino acids 39.54397. Upprr pnnal, standard GPT assays were performrd for various (;PT mutant constructs transfrcted into COS-1 cells as described in the text. 1 , G W " ; 2, vector; 3, GPT"";

Ser'!"'-Phe'"); 8, GPT:'"'iSe~''"-Phe~'""-Ile"'' I. A compilation of four sepa- rate transfection experiments is shown (open, closed, cfou~nctorrl stripad, or rrpword .striprd hors); not all mutants were tested in each experiment. All data were normalized to the results for GPT'"', and the averages of triplicate determinations are shown with standard deviations indicated hy rrror hnrs. For some of these constructs at least one transfection was performed with douhle the normal quantity of cells; one half was used for preparation of microsomes and enzyme assays, and the other half was used for RNAextractions. Northern hlots of these RNA samples were hyhridized with a ."P-labeled prohe for GPT, quantified on an Amhis detector, stripped, hyhridized with a :"P-laheled prohe for actin, and requantified. For transfectant samples 1,2,4. and 6 - 8 , the following relative levels of GPT mRNA (normalized to actin mRNA) were obsrrvrtl, respectively: 1.00, 0.00, 0.40, 0.33, 0.R5, 0.RX. Thus, the complrte ahsrnce of detectable GPT activity for transfrctant samples 4 . 6 . and H could not he attrihuted to insufficient mRNA. I , n u w pnnrl, immunohlot (12/> gel; chemiluminescence detection) is shown for 50-pg samples of microsomes from several of the COS-1 transfections

of intact GPT. Idone S contains 5 pg of microsomes from a stable GPT4"' depicted in the upprr pot7rl. The arrow indicates the expected position

CHO-K1 transfrctant for reference. Antihody A722 was used. Note that the immunohlot results for CW""" and the scramble mutants, particu-

in different experiments with respect to the intensity of the signal for full-length protein and the absence or presence of possiblr proteolytic degradation products, presumably because these proteins were unstable. A typical hlot for GPT'"" was presented in Fig. 2.

4, GW'I'I6. .,j, GW'I"'1; 6, ~,~'l";(Ph~'l"F-Ile:l'"'-Sei'O:,; 7, GW?'I:( [Ic7'15-

larly c,pT"?l:( Ph~?'l'~-~le:l""Serl'~~) and ~~'l ' I~(~~~l ' ' '~~~"" '- I le: ' ' ' : ) , varied

Additional insight into the Phe"'--Ser~"-Ile:'~' tripeptide was gained by introducing termination codons after the Phe and Ser residues. Ile'"' was found to be particularly crucial for expression. In contrast to GPT:"", GPT""'(samp1e 4 ) had no detectable enzyme activity (Fig. 7, upper panel ), and recovery of immunoreactive protein was variable (Fig. 7, lower panel). Further- more, either Phe"' or Ser""' must also be important because their reversal to Ser'9'-Phe''fi in the presence of Ile"7 caused a complete loss of enzyme activity (Fig. 7, upper panel, sample 8 ).

GP7"!'7(11~'1""S~r'"'-Phe""i) Is Unusually Thermolabile-The availability of a partially defective mutant, GP'F'9i(Ile'9'-Ser'q6- Phe")'), made it possible to examine the defect biochemically. Since GFT constructs with mutations in residues 395-397 appeared to give inactive polypeptides, one possibility was that

. -7

FII:. 8. Comparison of the relative thermolahilities of <;I"" and GP?""'(IIe:'~'--Ser'~'-Ph~'~~). >licrosomrs frum .st:lhlc C I I O - K l transfectants harboring either GPT' . 1opr.n .<~rnholsr o r (~1'T''"~lIr '.'- Ser'"''-Phc'"' I, suhclonr A f d o s r d ,s\.rnhol.~ I wrrr t r ra t r t l :It 37 C for thr times indicated and assayed as drscrihed undrr -F:xprnrnrnt:ll I'rncr- dures.* The comparison \vas prrfnrmrd f i v r t imrs wth s imi la r rrsults: the data shown here arr a compositr of two such compnrtwns ~ r ~ r r l r ~ s and trinnglrsl. Each point is t h r at.'rr:Igr of trlplic:Itr tlrtc~rm~nation.;. Data arr normalized to t h r zero timr a.;.;ay vn11lca. uhich was npproxl- mately 1100 cpm for GPT"'" rhoth comparison.;l and r i thcr .1110 Itrr- nrtglc~s) or 900 cpm frirrlrs) for thr mut:tnt. Thr hiphasic char:rctrr of the line for the mutant m;ty reflect thr contrihution of thv rtnhlr rndo- gcnous GPT of thr transfcvtant. 13y S n r t h r r n hlot :tn;llysl.G nf (;IT mRNA, normalization to actin mRS,\. and qunntlfic:ltinn o n an )\rnh!r system (average of 4 RNA samplrs~ . the mutant tr:lnsfrrt:lnt hnd 2-3 t imrs as much GPT mRSA a s t h r GPT'"' t ranrfrr tant .

residues 395-397 stabilized the enzyme. To tcsst this, GP"'"' Phe'"''~ \ v r w stnhly transfcctcd into

CHO-Kl cells and compared. As expected. the mutant was d r , - tectable by several criteria in CHO-KI crlls (Fig. 6, sornplv .7 I

but always to a lesser extent comparrd \vith (;P"'"' (Fig. 6, sample 2 ).

Fig. 8 shows a therrnolahility comparison. Residues 395-39i appear to stabilize GPT since the mutant w a s mnrr thcrmo- labile at 37 "C than the nativc rnzymc and lost most of its activity after 2 h. A similar effect was ohserved a t 42 'C (data not shown). Immunohlot analyses of samples incuhatcd for 0 or 2 h indicated that this inactivation was not dur to loss of polypeptide or apparent proteolysis data not shown ). By comparison, GPT"" and GI"'"" were equally thermolahilr. as wrrr the GPT activities in untransfected CHO-KI crlls and thc GPT'"'" transfectant (data not shown I .

and GPT:t'I;( Ile:1~19-t~er'l'81i-

DISCUSSION

Compared with other sugar transfwascs. GPT is unusual because i t contains a high fraction (48'; ) of apolar rcsiducs 1 . 7 1

and may have multiple transmembrane segments. Sincr GPT catalyzes a critical reaction in a s p a r a ~ n c - l i n k e d oligosnccha- ride synthesis and is highly regulatahle (21, it is plausihlr that these unusual features are related to its control. In this study the carboxyl-terminal third of GPT. which includrs the lo th predicted transmembrane segment, u'as c.xaminc*tl hy mutagenic techniques. The results, summarized in T:thlt. 11, indicate that the final 11 residues of GPT play no rssrntial rolr in the enzyme's biosynthesis or function. Compared with GP"'"' ( t h e native form of the enzyme), GPT'"" hchavcd normally with respect to catal-ytic activity, detection hy immunohlotting, and thermostability in oitro, as well as mRSA exprrssion, localization by indirect immunofluorcscrncc, resistancr to tunicnmy- cin, and competition with other dolichol phosphate-drpendcnt synthases in transfected crlls. The lack of a nwrssary function for the last 11 residues of hamster GPT is consistrnt with thr relatively poor conservation of this peptide within thr S. rcr- Poisiap enzyme sequence (3). a s wcll as thr prrvious finding that antibodies to this peptide wrrc capahlc of physically rc- moving hamster GPT from a soluhilizcd e x t r a c t hut did not

19114 Carboxyl Terminus of GlcNAc-1-P Dunsferase TABLE I1

Summary of GPT mutations +, detectable to an extent similar to GPT,,; -, undetectable; +/-,

intermediate detection.

In vitro In vivo

Constmct (COS-1 microsomes) (CHO-K1 cells)

Activity Immunoblot resiT&ce stalnlng ER G W o 8 (Normal)" + + + + GP'P94b - - - - GPT396 - -

GPT3$' + + + +

GPT408 ( L e ~ ~ ~ ~ - M e t ~ ~ " l ' r p ~ ~ ' ) + + + GPT3$' (Sel.396-Phe396-Ile397) - f

GP'P9' (Phe396-Ile396-SeP97) - f

GP'Pg7 (Ile395-Ser396-Phe397) -c + +

- f

GpT397 (Le~395"et3s"&p397) - - - -

The normal sequence for residues 395-397 is Phe-Ser-Ile. The normal sequence for residues 398-408 is Arg-Tyr-Gln-Leu-Val-Arg-Leu- Phe-Tyr-Asp-Val-COOH.

Data in COS-1 microsomes also applies to all shorter constructs as described in the text.

directly inhibit activity (10). All existing studies indicate that GPT is localized to the ER (21, and the data presented here suggest that a signal sufficient for retention of GPT in the ER must lie elsewhere in the protein. This finding contrasts with results for many other ER proteins, in which ER retention signals were localized to the carboxyl terminus (18-21). Fur- thermore, these results justify future experiments involving fusion of epitope tags to the carboxyl terminus of G W o 8 since such modifications are unlikely to affect enzyme function. Re- cently it has been shown that GPT remains active in COS-1 transfections after attachment of a "flag" epitope (Asp-Tyr-Lys- Asp-Asp-Asp-Asp-Lys, IBI Gorp.)' or a hexahistidine tag" to the carboxyl terminus.

In contrast, in the absence of the carboxyl-terminal 11 residues, the tripeptide Phe395-Se?96-Ile397 plays an important role in expression of GPT. There was no evidence for any expression of GPT394 or GPT397(Le~395-Met396-Trp3g7) even though the corresponding mRNAs were readily transcribed. However, expression of GPT397(Le~395-Met396-Trp397) was unexpectedly restored by reattaching the terminal 11 residues. Thus, with regard to segments 395-397 and 398-408, either is sufficient to support expression of GPT, but neither is necessary if the other is pres- ent. In other words, the carboxyl-terminal region of GPT appears to have a built-in functional redundancy. To understand how these two segments might function, the simpler of the two (395-397) was taken for further analysis (in the absence of 398-408). The sequence requirement for Phe395-SeP96-Ile397 is specific since all mutations in this tripeptide reduced or altered activity. Furthermore, by comparing GPT396 and GPT3", it was found that Ile397 was critical. In the presence of Ile397, reversal of Phe395 and Ser396 reduced enzyme expression, demonstrating that at least one of these residues is also important.

Since several of the Phe395-Ser396-Ile397 mutants were charac- terized as catalytically inactive but immunologically detectable polypeptides, it appeared that the Phe395-Se$96-Ile397 sequence might aid in maintaining GPT in a stable, active conformation. This hypothesis was supported by the demonstration that GPT397(Ile395-Ser396-Phe397) was more thermolabile than GPpo8. In preliminary experiments, the resistance to tunicamycin in vivo was enhanced 2-4-fold by lowering the growth temperature from 37 to 32 "C for cells expressing GPT397(Ile395-Ser396- Phe397) but not GPT4°8.3 Given the nature of the carboxyl-ter-

N. Dan and M. A. Lehrman, unpublished observations. J. Zara and M. A. Lehrman, unpublished observations.

minal region of GPT, experiments involving extensive carboxyl- terminal truncations might not be plausible because the remaining amino-terminal segments may not exist in native conformations. For example, this caveat could apply to strate- gies that involve fusion of reporter polypeptides to truncated forms of the protein of interest to determine the protein's to- pology or to search for sorting signals.

For carboxyl-terminal truncations of more than 11 residues, it is presumed that the loss of immunologically detectable material was due to degradation of denatured GPT polypeptide within the ER. If the role of Phe395-Se1.396-Ile397 is to stabilize GPT, it is likely that this would occur by formation of a specific interaction with another part of GPT or another component of the ER. This could involve specific side chain interactions and/or formation of a particular structural element (a! helix, etc.). For example, if the putative membrane spans of GPT are required to form an ordered complex, then Phe395-Ser396-Ile397 might promote an interaction between the 10th and some other span. Alternatively, Phe395-Ser396-Ile397 might interact with another ER protein to form a complex with GPT. This would be analogous to the observation that certain T cell receptor sub- units must form a complex in the ER in order to avoid proteolytic degradation (22). However, the situation is likely to be complex because the residues in segment 398-408 can support expression in the absence of Phe395-Se1.396-Ile397, as shown for the GPT4°8(Le~395-Met396-Trp3g7) construct. The final 11 residues could be acting as a direct substitute for Phe395-Se1.396- Ile397 or, more likely, promote an independent compensatory interaction.

The results reported here bear an unexpected similarity to those reported recently by Robben and co-workers (23) regard- ing the properties of bacterial chloramphenicol acetyltransferase (CAT). The form of CAT studied, from E. coli transposon Tn9, is an enzyme of 221 amino acid residues that becomes inactivated by truncation to CATz1'. The native residues a t positions 213-214 are w13-Cys214, and activity is fully restored to CAT2lZ by addition of the closely related dipeptide Ty1.213-Ser214. I t was also noted that the addition of unrelated fusion peptides to CATz1' restores normal levels of CAT expression, compensating for the absence of w13-Cys214. There are similarities between the critical residues in CAT (w13-Cy~214) and GPT (Phe395-Se1.396), but since the tertiary structures of CAT, a soluble enzyme, and GPT are likely to be quite different, it is not clear whether these similarities are meaningful. How- ever, it is apparent that short di- and tripeptides near the carboxyl termini of both CAT and GPT stabilize truncated forms of these enzymes, but these effects are only evident in the absence of longer carboxyl-terminal extensions. Future studies will be required to determine whether this phenomenon applies to other proteins.

Acknowledgments-We thank Aurora Ylanna for assistance with con- struction of several truncation mutations, Biswanath Pramanik for assistance in isolating RNA and preparing cell culture media, Alex De-

Ware for performing analyses of dolichol-linked oligosaccharides, and Luca for performing confocal immunofluorescence microscopy, Felicia

Dr. Xiaying Zhu for advice concerning transfections and various analyses of GPT.

REFERENCES 1. Varki, A. (1993) Glycobiology 3,97-130 2. Lehrman, M. A. (1991) Glycobiology 1, 553-562 3. Zhu, X., and Lehrman, M. A. (1990) J. Bid. Chem. 265, 14250-14255 4. Scocca, J. R., and Krag, S. S. (1990) J. Biol. Chem. 266, 20621-20626 5. Rajput, B., Ma, J., Muniappa, N., Schantz, L., Naylor, S. L., Lalley, P. A., and

6. Strahl-Bolsinger, S., Immervoll, T., Deutzmann, R., and Tanner, W. (1993)

7. Albright, C. F., Orlean, P., and Robbins, P. W. (1989) Proc. Natl. Acad. Sci.

8. Datta, A. K., and Lehrman, M. A. (1993) J. Biol. Chem. 268, 12663-12668

Tijay, I. K. (1992) Biochem. J. 285,985-992

Proc. Natl. Acad. Sci. U. S. A. 90,8164-8168

U. S. A. 8 6 , 7366-7369

Carboxyl Terminus of GlcNAc-1-P Dansferase 19115 9. Schutzbach, J. S., Zimmerman, J. W., and Forsee, W. T. (1993) J. Biol. Chem.

10. Zhu, X., Zeng, Y., and Lehrman, M. A. (1992) J. Biol. Chem. 267,8895-8902 11. Lehrman, M. A,, Zhu, X., and Khounlo, S. (1988) J. Biol. Chem. 263, 19796-

12. Andersson, S. , Davis, D. L., Dahlback, H., Jornvall, H., and Russell, D. W.

13. Slonina, A. E., Scott, T. C., and Lehrman, M. A. (1993) J. Biol. Chem. 268,

14. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular C2oning:ALabo-

268,24190-24196

19803

(1989) J. Biol. Chem. 264, 8222-8229

67294733

ratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

15. Feinberg, A. P., and Vogelstein, B. (1983) Anal. Biochem. 132, 6-13 16. Zeng, Y., and Lehrman, M. A. (1991) Anal. Biochem. 193,266-271 17. Chomczynski, P., and Sacchi, N. (1987)Aml. Biochem. 162, 156-159 18. Munro, S., and Pelham, H. R. B. (1987) Cell 48,899-907

20. Nilsson, T., Jackson, M., and Peterson, P. A. (1989) Cell 58, 707-718 19. Mitoma, J.-y., and Ito, A. (1992) EMBO J. 11,41974203

21. Frangioni, J. V., Beahm, P. H., Shifrin, V., Jost, C. A,, and Neel, B. G. (1992)

22. Klausner, R. D., and Sitia, R. (1990) Cell 62, 611-614 23. Robben, J., Van der Schueren, J., and Volckaert, G. (1993) J. Biol. Chem. 268,

Cell 68,545-560

24555-24558

role of the carboxyl terminus in stable expression of hamster udp

Documents