Proc. Natl. Acad. Sci. USAVol. 88, pp. 6481-6485, August 1991Genetics

Rhodopsin mutations in autosomal dominant retinitis pigmentosaCHING-HWA SUNG*, CAROL M. DAVENPORT*, JILL C. HENNESSEYt, IRENE H. MAUMENEE*,SAMUEL G. JACOBSON§, JOHN R. HECKENLIVELY¶, RODNEY NOWAKOWSKI II, GERALD FISHMAN**,PETER GOURAStt, AND JEREMY NATHANS*#**Howard Hughes Medical Institute, Department of Molecular Biology and Genetics, and Department of Neuroscience, Johns Hopkins University School ofMedicine, 725 North Wolfe Street, Baltimore, MD 21205; tNational Retinitis Pigmentosa Foundation, 1401 Mount Royal Avenue, Baltimore, MD 21217;tWilmer Ophthalmologic Institute, Johns Hopkins University School of Medicine, 600 E. Monument Street, Baltimore, MD 21205; §Bascom Palmer EyeInstitute, University of Miami School of Medicine, Miami, FL 33101; 1Jules Stein Eye Institute, University of California at Los Angeles School of Medicine,Los Angeles, CA 90024; 1School of Optometry, University of Alabama at Birmingham, Birmingham, AL 35294; **Department of Ophthalmology, Universityof Illinois College of Medicine, Chicago, IL 60612; and ttDepartment of Ophthalmology, Columbia University College of Physicians and Surgeons, New York,NY 10032

Communicated by Victor A. McKusick, April 22, 1991

ABSTRACT DNA samples from 161 unrelated patientswith autosomal dominant retinitis pigmentosa were screenedfor point mutations in the rhodopsin gene by using the poly-merase chain reaction and denaturing gradient gel electropho-resis. Thirty-nine patients were found to carry 1 of 13 differentpoint mutations at 12 amino acid positions. The presence orabsence of the mutations correlated with the presence orabsence of retinitis pigmentosa in 174 out of 179 individualstested in 17 families. The mutations were absent from 118control subjects with normal vision.

Human vision is mediated by four visual pigments.Rhodopsin, the pigment in rods, mediates vision in dim light;the red-, green-, and blue-sensitive pigments reside in thecones and mediate color vision. The visual pigments form afamily ofhomologous proteins encoded by the correspondingmembers of a family of genes (1, 2).The goal of the present study is to identify mutations in the

gene encoding human rhodopsin. In planning this study, wefirst considered the phenotypes that result from alterations inthe genes encoding the human cone pigments. One class ofrearrangements in the red and green pigment gene clusterpreserves the structural integrity of the encoded proteins andcauses the benign anomalies of color vision commonly re-ferred to as color blindness (3). A second class of mutationsis responsible for blue cone monochromacy, a dysfunction ofboth red and green cones that is associated in some individ-uals with a progressive degeneration of the cone-rich centralretina (4, 5); and a third type of mutation causes red conedysfunction and a progressive central degeneration (6). Re-cent experiments show that point mutations in the bluepigment gene lead to defective blue cone function (C. Weitzand J.N., unpublished results).By analogy with the known cone pigment gene defects, we

reasoned that rhodopsin gene mutations would produce adeficit in rod photoreceptor function (i.e., night blindness)and might lead to a progressive degeneration and consequentloss of function in the rod-rich peripheral retina. Nightblindness and progressive loss of peripheral vision are thehallmarks of retinitis pigmentosa, a group of inherited disor-ders that appear to affect the photoreceptors and underlyingpigment epithelium (7). Retinitis pigmentosa is known to begenetically heterogeneous, comprising X chromosomelinked, autosomal recessive, and autosomal dominant types(8). Within each genetic type there is marked individualvariation in natural history. Any particular mutation in a

given candidate gene is, therefore, unlikely to be present inmore than a fraction of the retinitis pigmentosa population.To search efficiently for rhodopsin mutations, our strategy

has been to collect DNA samples from a large number ofunrelated patients with retinitis pigmentosa, amplify therhodopsin gene exons by using PCR (9), and then assay theamplified products for sequence variation by using denatur-ing gradient gel electrophoresis (DGGE) (10). We focusedinitially on 161 unrelated patients with autosomal dominantretinitis pigmentosa (ADRP). This choice was prompted bythe report of McWilliam et al. (11) that in one large Irishfamily the gene responsible for ADRP cosegregates withmarkers tightly linked to the rhodopsin gene on the long armof chromosome 3 (2).Here we report that 39 out of 161 unrelated patients with

ADRP carry point mutations in the coding sequence of therhodopsin gene. The mutations produce 13 predicted aminoacid substitutions at 12 different positions in the rhodopsinmolecule. Related results have been reported by Dryja andBhattacharya and their colleagues (12-14) in screening forrhodopsin gene mutations in ADRP patients.

MATERIALS AND METHODSSample Collection and Processing. Participants were re-

cruited by their ophthalmologists- (I.H.M., S.G.J., G.F.,J.R.H., and P.G.), optometrist (R.N.), or through the com-puterized Retinitis Pigmentosa Foundation National Registry(J.C.H.). Control samples were obtained from students at theUnited States Air Force Academy. DNA was prepared fromvenous blood by proteinase K digestion, followed by equilib-rium centrifugation in a cesium chloride density gradient (1).PCR Amplification and-DGGE. Seven segments of the

rhodopsin gene encompassing theentire coding region (1) wereamplified by PCR using the following primer pairs [the nota-tion (GC) indicates the sequence CGCCCGCCGCGC-CCCGCGCCCGCCCCGCCGCCCCCGCCC added to the 5'end of the oligonucleotide (10)]: exon 1 5' half (1L), TTCG-CAGCATTCTTGGGTGG and (GC)TGTGCTGGACGGT-GACGTAGAGCGTGAGGAA; exon 1 3' half (1R), ATGC-TGGCCGCCTACATGYT and (GC)AAGCCCGGGACTCT-CCCAGACCCCTCCATGC;exon2,TGCACCCTCCTTAGG-CAGTG and (GC)AGACACTACTGGG'TlGAGTCCTGA-

Abbreviations: ADRP, autosomal dominant retinitis pigmentosa;DGGE, denaturing gradient gel electrophoresis; amino acid substi-tutions are referred to by the single-letter amino acid designation ofthe wild-type residue, followed by its position number in the poly-peptide chain and the single-letter amino acid designation of themutant residue (e.g., P23H refers to the replacement of proline-23 byhistidine).#To whom reprint requests should be addressed.

6481

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Proc. Natl. Acad. Sci. USA 88 (1991)

CTGGAG; exon 3, GGCAGCCACCTTGGCTGTTC and(GC)AGATGCATGCTGGGGGCTGGACCCTCAGAGC;exon 4 5' half (4L), (GC)GTCTGAGGGTCCAGCCCCCAG-CATGCATCTG and ACGTAAAGCTTATGAAGATGG-GACCGAAGTTG; exon 4 3' half (4R), CCCGGGGAAT-TCACGCCAGCGTGGCATTCTAC and (GC)CCCTGC-CCTGGGAGTAGCTTGTCCTTGGCAG; exon 5,(GC)GAACGTGCCAGTTCCAAGCACACTGTGGGCAand GGGCCCAAGCTTCTGTGGCTGGGGGAAGGTG.Thirty rounds ofPCR amplification were performed by usinga Perkin-Elmer thermocycler. Seven microliters of each re-action mixture was analyzed on a 50-80o denaturing gradientgel (Green Mountain Laboratory Supply, Waltham, MA) asdescribed (10).

Sequence Analysis. Genomic DNA known to contain avariant sequence was amplified with a pair of primers car-rying two different restriction enzyme cleavage sites and thensubcloned into a plasmid vector. Six or more clones weresequenced from each sample to obtain multiple examples ofeach sequence alteration. PCR errors were encountered asisolated events at a frequency of one per several thousandnucleotides. In some instances, new bands were excisedfroma denaturing gradient gel, reamplified, and subcloned. Inthose cases, DNA templates for sequencing were preparedfrom pools of several hundred subclones.

Allele-Specific Oligonucleotide Hybridization. Four microli-ters of a PCR reaction mixture (-100 ng of DNA) wasdenatured and deposited onto a GeneScreenPlus filter (Du-Pont) under gentle vacuum. 5'-End-labeled 13-mers identicalto and centered about the mutant sequences were annealed in4x standard saline citrate (SSC)/100 salmon sperm DNA (at100 ,ug/ml)/5x Denhardt's solution/0.05% SDS for 5 hr at230C. The filters were washed in 0.4x SSC/0.1% SDS attemperatures between 250C and 400C to optimize the differ-ence between hybridization to wild-type and mutant se-quences.

RESULTSScreening for Point Mutations by Using DGGE. Based upon

the human rhodopsin gene sequence (1), seven pairs of PCRprimers were synthesized to amplify the coding regions ofthefive exons and the adjacent 20-25 base pairs of intron and 5'and 3' noncoding DNA. The largest exons, exons 1 and 4,were amplified in two parts, referred to as L and R for 5' and3' halves, respectively. One member of each primer pairincluded a 39-base 5' extension consisting exclusively of Gand C (a "GC clamp"). The inclusion ofaGC clamp has beenshown to increase the sensitivity of DGGE (10).Blood samples were collected from one affected individual

in each of 161 families with ADRP. DGGE of rhodopsin genePCR products revealed in most instances a single bandcorresponding in mobility to that seen in wild-type controls.New bands were observed in some samples, and these weregrouped according to their patterns. Fig. 1 shows the DGGEprofile of one sample from each group. The electrophoreticpatterns consist of four bands as expected for PCR productsderived from heterozygotes: the lower two bands correspondto wild-type and variant homoduplexes and the upper twocorrespond to the two heteroduplexes.The nucleotide sequence of each type of variant band was

determined. The two most common variants, represented bysamples HS440 and HS1001, carry single nucleotide substi-tutions adenosine 269 -- guanosine and cytidine 5321adenosine in the 5' and 3' noncoding regions, respectively(see ref. 1 for the numbering system). These variants occurat gene frequencies of 14% and 13%, respectively, in ourADRP population and were also seen in unaffected subjects.They appear to represent polymorphisms in the population.Three infrequent variants, also presumed to represent poly-

IL IR 2

<Om can S~~~~m L U,I f0 Wu

W)LO U)0F F e ne ) cnupunum m I I 3 f3 I) :C 3 I I :1:

..A.R~~I~ . ak . *......II.. ::o...

3

o t0 utcn (nI I 31

4L 51 ~ 1 _,

t- 8 8 w

w '....

ti

FIG. 1. Examples of denaturing gradient gel patterns of variantand wild-type (WT) PCR products. Ethidium bromide staining pat-terns are shown as negative images. The two lower bands correspondto homoduplex variant and wild-type PCR products; the two upperbands correspond to heteroduplexes formed between variant andwild-type strands during the final PCR cycle. Subject number and, inparentheses, pedigree designation are indicated above each lane. Theexon numbers are indicated above the brackets. Variant bands inDNA from subjects HS440- (exon 1L), HS678 (exons 2 and 4L),HS600 (exon 5), and HS1001 (exon 5) correspond to-polymorphismsthat appear to be unrelated to retinitis pigmentosa.

morphisms, are represented by samples HS678 (exons 2 and4L) and HS600 (exon 5). The corresponding nucleotidesubstitutions are guanosine 2557 -+ adenosine, guanosine4142 -* adenosine, and guanosine 5145 adenosine; the firsttwo produce silent third position changes, and the third is inthe fourth intron.Each of the remaining 13 variant bands carries either a

single nucleotide substitution or, in one case (families H1 andH2), two adjacent nucleotide substitutions that producesingle amino acid substitutions (Fig. 2). None of the subjectscarries more than one rhodopsin gene mutation.

Pedigree and Population Analysis. To test the hypothesisthat the observed amino acid substitutions were causallyrelated to ADRP, we examined the cosegregation ofgenotypeand phenotype in 179 family members (including the affectedprobands) in 17 families (Figs. 3 and 4). Slot blot hybridiza-tion with allele-specific oligonucleotide probes (familiesA-L) or cleavage of an allele-specific Hpa II site (family M;data not shown) shows the presence of the proband's mutantallele in 99 of 100 affected family members tested. The oneexception (family B2, subject 8) reports a history of nightblindness; he has not had an ophthalmologic examination tofurther characterize the visual defect. Of 79 unaffected rel-atives who were tested, 75 do not carry the proband's mutantallele. The four exceptions (family G; subjects 5, 6, 7, and 8)report no visual disturbances, but they have not undergonevisual function testing.

6482 Genetics: Sung et A

_ A...+.

Proc. Natl. Acad. Sci. USA 88 (1991) 6483

ATi7M WT

A C G T AC G T

A C N- C

a 'm A

S EV87D WTAC G-T. A CGT

G _ - G

BWT P23H

A C G T AC G T

CN .l A

C - C~

__ -_ =

G89D WTA C G T A C G T

AGGG

_

CF45L WT

A C G T A C G T

T Ts__ _ TT- _6I. - - T

C _ T-_ i-

GW. GIO6W

A C G TA CG I.

G _

- __

DWT T58R

A C G T A C G T

G-

A _ "M___

HWT R135L

A C G T AC G T

=- -

G _So T

_n -

IWT R135W

A C G T A C G T

_ T_oftok_-of GtC%-_

TC En:~

JWT YI78C

A C G T A C G T

C _.. -_ _C

A_ -

-- --

--= - ,T

__m

K LWT D190G Q344* WT

A C G T A C G T A C G T A C G T

ACTAGA CGAAG

G _-T-cC

_,,~~~~~I-i

MWT P347L

A C G T A C GIT

C - I.C~~~~~~~ TC.- --- - -- C

As an adjunct to the pedigree analysis, we compared thefrequency of each mutant allele in the ADRP population (n =161) and in a -control population of young adults with normalvision (n = 118). One mutant allele, P23H, is present in 24 of161 unrelated ADRP subjects and is absent from the 118control subjects. The other 12 mutations were found eitheronce or twice in the 161 ADRP subjects; they were not seenin the control population (Table 1). Altogether, rhodopsinmutations were observed in 39 of 161 ADRP subjects.

DISCUSSIONIdentification of Rhodopsin Mutations. The results pre-

sented here demonstrate that 24% of 161 unrelated ADRPpatients carry point mutations in the gene encodingrhodopsin. As the sample population in this study was almostexclusively Caucasian, this value may differ in other popu-lation groups. The presence or absence of rhodopsin muta-tions correlates with the presence or absence ofADRP in 174of 179 family members tested (including probands). The fourindividuals in one family who carry mutations but have novisual symptoms may represent examples of incompletepenetrance, delayed onset ofthe disease, or very mild diseaseexpression. For several alleles the pedigrees are too small forcosegregation to be statistically significant. Analysis of ad-ditional families or identification of a biochemical defect inthe mutated rhodopsins is needed to confirm a role for thesealleles in producing retinitis pigmentosa. The single mostcommon allele, P23H, was found in 15% of the ADRPfamilies. These data are in agreement with those of Dryja etal. (12) who found the P23H mutation in 17 of 148 unrelatedADRP subjects. In the present study no other allele wasfound in more than two families. For one-quarter of ADRP

FIG. 2. DNA sequences of wild-type and mutant PCR products. Foreach ofthe 13 different ADRP mutations, one example is shown ofwild-typeand mutant DNA sequences in the neighborhood of the mutation. Themutations are cytidine 344-* thymidine (C344T) (A), C362A (B), C427T (C),C467G (D), T554A (E), G560A (F), G610T (G), G2481T and G2482T (H),C2480T (I), A3815G (J), A3851G (K), C5261T (L), C5271 T (M).

families, it will now be possible to provide genetic counselingand prenatal diagnosis based on DNA analysis.

It is possible that some mutations escaped detection by thePCR/DGGE screening method employed in this study. Intronand flanking region mutations outside of the amplified seg-ments would not be detected. Deletions or other rearrange-ments encompassing one ofthe primer sites would also escapedetection because a normal PCR product would be producedfrom the wild-type chromosome. However, it is unlikely thatpoint mutations residing within the amplified regions would goundetected by DGGE. Sheffield et al. (10) showed that >90%oof single base changes produce a PCR product of variantmobility when amplification is performed with a GC clampprimer. Consistent with that observation, only 1 of 18 variantbands observed in the present study comigrated with the wildtype under the conditions employed (HS698; exon 1R; see Fig.1). Because each subject is likely to be heterozygous for thedominant mutation, heteroduplexes carrying a base mismatchare expected to form during the annealing step of the last PCRcycle. In each of the 18 variant patterns, the heteroduplexesshow a prominent decrease in mobility compared to thecorresponding homoduplexes.

Heterogeneity of Rhodopsin Mutations. In this study 13different mutations were observed at 12 amino acid positionswithin the rhodopsin coding region. This allelic heterogeneitysuggests a corresponding variability in biochemical defectsand in the natural history of the associated retinal disease.Factors other than heterogeneity at the rhodopsin locus mayalso contribute to phenotypic variability. Indeed, two recentstudies have found marked variation in natural history amongpatients with the P23H mutation (15, 16).

Additional rhodopsin gene mutations are likely to exist inthe human gene pool. They may account for the retinaldegeneration or functional impairment in such disorders as

Genetics: Sung et al.

Proc. Natl. Acad. Sci. USA 88 (1991)

A Bi

3 67 9

10 11 12 13 14 6

C D

B2

Fl

2 3 4 5 6 7 8

9 10 It

F2

orI I';1 G

H2Hi

Ia2 1mA a A .,A67

I2 J K

vr or2 3I 4 2 3 4

569a1 1 m5 4 ? e 9 e0 5 6 t

M

4

L

FIG. 3. Pedigrees ofADRP families. A history of night blindness and/or visual field loss were considered diagnostic of retinitis pigmentosa.Most of the affected participants have been independently evaluated by an ophthalmologist. A question mark indicates an uncertain diagnosis.Numbers indicate the family members tested; arrows indicate probands. Families designated by the same letter carry the same mutation (e.g.,BI and B2). Subject 11 in family D and subjects 5, 6, and 7 in family L are classified as affected based upon measurements of rodelectroretinograms, dark adaptometry, and rhodopsin levels; they report no visual impairment.

autosomal recessive retinitis pigmentosa, Leber's congenitalamaurosis, or stationary night blindness. It will also beinteresting to determine that fraction of simplex retinitispigmentosa patients who carry new rhodopsin mutations.The present study indicates that neutral amino acid sub-

stitutions in rhodopsin are extremely rare. Of the 322rhodopsin genes screened, 39 carry mutations responsible forADRP and none carry aht amino acid substitution unrelated toADRP. This finding rules out rhodopsin gene polymorphismas a source of the reported common variation in the point ofmaximal sensitivity of human rod vision (17).

Naturally occurring variants have been extremely useful instudies of protein structure and function. The variantrhodopsins responsible for ADRP could be defective inprotein folding/stability, intracellular targeting, signal trans-duction, or as-yet-undefined functions. The availability oftissue culture expression systems for rhodopsin will permitthe production of each variant for detailed study (18, 19).

Implications for Large-Scale Genetic Screening of Hetero.geneous Disorders. For many inherited disorders, clinicalvariability suggests a corresponding heterogeneity in under-lying genetic defects. One approach to identifying the causal

6 ? 8

E

*2 3

II

I6'6

6484 Genetics: Sung et al.

2

Proc. Natl. Acad. Sci. USA 88 (1991) 6485

B2 E F2 H2 I1 J_ _

2* 3 -

_ 4* 5-

_ 6_ * 7 -

** 2

3

Fl

* 2* 10* 3*4

C 5*6

*2- 8*3 - *9

4 *10*5 - Ill

6 12*7 - *13

8 *1415

*1 18*2 19

-3 ' *204 215 *22

*6 *237 248 25

*9--- 26*10 - 27* 11

*12

* 34

5

*2

* 34

* 567

*23

* 45

* 68

G *9-- *10-

--2 12*3 _ *13

*4_ *14_ 5 15

6 _ *16- 8*_ 17

*19Hi 20

*21*1 - *22_*2 *23 -*3 _24_4- 25

26*6 - *27 -* 7 _ *28 -

*29 _30

*31 _*3233

* 2 _3

* 4 -

* 5* 6 -

* 7 -

* 8 -

9* 0 -

*23

* 456

* 78

I2 910

K* Iso* 2

34

* 567

L

* I-* 2* 3

4* 5-* 6* 7

FIG. 4. Segregation of rho-dopsin mutations in ADRP familiesby hybridization of mutant allele-specific 13-mers to PCR productsfrom family members indicated inFig. 3. Asterisks denote individu-als with retinitis pigmentosa.

mutations is to choose as candidates those genes whoseproducts are active in the relevant physiological processes.To overcome the problem of genetic heterogeneity, a largenumber of unrelated patients can be screened for mutationsin the candidate genes. As demonstrated in this study, thecombination ofPCR and DGGE is well suited for the efficientdetection ofpoint mutations in a large patient population. Theefficiency of these methods makes feasible the screening ofdisorders for which a genetic component is known but forwhich simple Mendelian inheritance has not been demon-strated.

We thank all of the ADRP subjects and their relatives for partic-ipating; Ms. Rosalind Palmer and her colleagues at the WilmerRetinitis Pigmentosa Center for assistance in identifying patients andcollecting blood samples; Ms. Pat Catlin, Drs. John Jernigan, andThomas Loftus and the cadets of the U.S. Air Force Academy for

Table 1. Frequency of rhodopsin mutations in ADRP andcontrol populations

Mutation ADRP Control

T17MP23HF45LT58RV87DG89DG106WR135LR135WY178CD19OGQ344stopP347L

Total

12411121221111

39

00000000000000

participating; Drs. Charles Weitz, Mark Gray, Monica Traystman,and Haig Kazazian for DGGE advice; Dr. Clark Riley, Ms. AnatoliCollector, Ms. Cynthia Wendling, and Ms. Jodie Franklin for syn-thetic oligonucleotides; Drs. David Valle, Daniel Nathans, DonaldZack, and Charles Weitz for helpful comments on the manuscript;and Ms. Teri Chase for expert secretarial assistance. This work wassupported by the Howard Hughes Medical Institute and the NationalRetinitis Pigmentosa Foundation.

1. Nathans, J. & Hogness, D. S. (1984) Proc. Nati. Acad. Sci. USA 81,4851-4855.

2. Nathans, J., Thomas, D. & Hogness, D. S. (1986) Science 232, 193-202.3. Nathans, J., Piantanida, T. P., Eddy, R. L., Shows, T. B. & Hogness,

D. S. (1986) Science 232, 203-210.4. Fleischman, J. A. & O'Donnell, F. E. (1981) Arch. Ophthalmol. 99,

468-472.5. Nathans, J., Davenport, C. M., Maumenee, 1. H., Lewis, R. A., Hejt-

mancik, F., Litt, M., Lovrien, E., Weleber, R., Bachynski, B., Zwas, F.,Klingaman, R. & Fishman, G. (1989) Science 245, 831-838.

6. Reichel, E., Bruce, A. M., Sandberg, M. A. & Berson, E. L. (1989) Am.J. Ophthalmol. 108, 540-547.

7. Heckenlively, J. R. (1988) Retinitis Pigmentosa (Lippincott, Philadel-phia).

8. Boughman, J. A. & Fishman, G. A. (1983) Br. J. Ophthalmol. 67,449-454.

9. Mullis, K. B. & Faloona, F. A. (1987) Methods Enzymol. 155, 335-350.10. Sheffield, V. C., Cox, D. R., Lerman, L. S. & Myers, R. M. (1989) Proc.

Nati. Acad. Sci. USA 86, 232-236.11. McWilliam, P., Farrar, G. J., Kenna, P., Bradley, D. G., Humphries,

M. M., Sharp, E. M., McConnell, D. J., Lawler, M., Sheils, D., Ryan,C., Stevens, K., Daiger, S. P. & Humphries, P. (1989) Genomics 5,619-622.

12. Dryja, T. P., McGee, T. L., Reichel, E., Hahn, L. B., Cowley, G. S.,Yandell, D. W., Sandberg, M. A. & Berson, E. L. (1990) Nature (Lon-don) 343, 364-366.

13. Dryja, T. P., McGee, T. L., Hahn, L. B., Cowley, G. S., Olsson, J. E.,Reichel, E., Sandberg, M. A. & Berson, E. L. (1990) N. Engl. J. Med.323, 1302-1307.

14. Inglehearn, C. F., Bashir, R., Lester, D. H., Jay, M., Bird, A. C. &Bhattacharya, S. (1991) Am. J. Hum. Genet. 48, 26-30.

15. Berson, E. L., Rosner, B., Sandberg, M. A. & Dryja, T. P. (1991) Arch.Ophthalmol. 109, 92-101.

16. Heckenlively, J. R., Rodriguez, J. A. & Daiger, S. P. (1991) Arch.Ophthalmol. 109, 84-91.

17. Alpern, M. (1987) Vision Res. 27, 1471-1480.18. Oprian, D. D., Molday, R. S., Kaufman, R. J. & Khorana, H. G. (1987)

Proc. Nati. Acad. Sci. USA 84, 8874-8878.19. Nathans, J., Weitz, C. J., Agarwal, N., Nir, I. & Papermaster, D. S.

(1989) Vision Res. 29, 907-914.

A*1

23

*4*5*6*7

B1

* 2 -3

* 4 -

5* 6 -

7* 8 -

9* 10 -

* 11 _

* 12 -13

* 14 -* 15 -

* 16 -

The frequency of each rhodopsin gene point mutation in 161unrelated subjects with ADRP and 118 subjects with normal visionis given. Mutations were detected as in Fig. 4.

Genetics: Sung et al.