Response of fibroblasts and chondrosarcoma cells to mechanical and chemical stimuli

Juha Piltti

Department of Integrative Medical Biology

Umeå 2017

Responsible publisher under Swedish law: the Dean of the Medical Faculty

This work is protected by the Swedish Copyright Legislation (Act 1960:729)

ISBN: 978-91-7601-710-4

ISSN: 0346-6612

New series No. 1896

Electronic version available at http://umu.diva-portal.org/

Printed by: UmU-tryckservice, Umeå University

Umeå, Sweden 2017

Dedicated to my family

i

Table of Contents

Table of Contents i Abstract iii Abbreviations v Tiivistelmä vii

List of original papers ix 1. Background 1

1.1 Cartilage tissue 1 1.2 Glycosaminoglycans 3

1.3 Proteoglycans 6

1.4 Osteoarthritis 11

1.5 Current osteoarthritis therapies 13

1.6 Strategies for novel osteoarthritis therapies 15

1.7 Mechanical stresses in articular cartilage 19

1.8 Oxygen tension in articular cartilage 24

1.9 Ras homolog gene family member A and Rho-associated protein kinase

signaling 27

2. Aims of the thesis 30 3. Materials and methods 31 3.1 Cyclic cell stretching (paper I) 31

3.2 Hypoxic cell cultures (paper III, IV) 32

3.3 Rho-kinase inhibitor Y-27632 treatments (paper II, IV) 32

3.4 Phosphoprotein enrichment 33

3.5 Two-dimensional gel electrophoresis and mass spectrometric protein

identification 33

3.6 Western blot analyses 34

3.7 Time-lapse cell monitoring 35

3.8 Immunofluorescence imaging 36

3.9 Mass spectrometric quantification with Orbitrap Elite 36

3.10 Mass spectrometric quantification with Synapt G2-Si HDMS 37

3.11 Bioinformatic protein analysis 37

3.12 Enzyme linked immunosorbent assay (ELISA) of type II collagen 38

3.13 Dimethylmethylene Blue assay (DMMB) for glycosaminoglycans 38

3.14 qRT-PCR analysis 38

3.15 Statistical analysis 39

4. Results 40

4.1 Cyclic stretching induced phosphoproteomic changes in HCS-2/8 cells

(paper I) 40

4.2 Effects of Rho-kinase inhibitor Y-27632 to fibroblasts (paper II) 40

4.3 Hypoxia-induced responses in the proteome of HCS-2/8 cells

(paper III) 43

ii

4.4 Hypoxia and Rho-kinase inhibitor Y-27632 induced cartilage matrix

production in chondrocytic cells (paper IV) 45

5. Discussion 49

5.1 The phosphoproteomic analysis of cyclically

stretched HCS-2/8 cells (paper I) 49

5.2 Cyclic stretching induced responses in chondrocytic cells (paper I) 50

5.3 Short-term Rho-kinase inhibition did not induce

chondrocyte-specific cartilage extracellular matrix production in

fibroblasts (paper II) 51

5.4 Rho-kinase inhibition induced fibroblast migration and transient

proliferation (paper II) 52

5.5 Increased cellular migration was potentially mediated by mDia and

Rho-kinase mediated signaling routes (paper II) 54

5.6 Long-term hypoxia supported chondrocyte specific gene

expression (paper III) 55

5.7 Long-term hypoxia induced known and novel protein responses

in chondrocytic cells (paper III) 55

5.8 A short-term Rho-kinase inhibition at normoxic or at hypoxic

conditions did not induce HCS-2/8 cell proliferation (paper IV) 58

5.9 A long-term exposure of the Rho-kinase inhibitor Y-27632

at hypoxic atmosphere enhanced cartilage extracellular matrix

production (paper IV) 59

5.10 Long-term Y-27632 exposure induced several-fold protein changes

at both oxygen tensions (paper IV) 59

5.11 Long-term exposure of the Rho-kinase inhibitor Y-27632 influenced

changes to S100 protein synthesis (paper IV) 61

6. Conclusions 65 Acknowledgements 67 References 68

iii

Abstract Osteoarthritis is an inflammation-related disease that progressively destroys joint cartilage. This disease causes pain and stiffness of the joints, and at advanced stages, limitations to the movement or bending of injured joints. Therefore, it often restricts daily activities and the ability to work. Currently, there is no cure to prevent its progression, although certain damaged joints, such as fingers, knees and hips, can be treated with joint replacement surgeries. However, joint replacement surgeries of larger joints are very invasive operations and the joint replacements have a limited lifetime. Cell-based therapies could offer a way to treat cartilage injuries before the ultimate damage of osteoarthritis on articular cartilage. The development of novel treatments needs both a good knowledge of articular cartilage biology and tissue engineering methods. This thesis primarily investigates the effects of mechanical cyclic stretching, a 5% low oxygen atmosphere and the Rho-kinase inhibitor, Y-27632, on protein responses in chondrocytic human chondrosarcoma (HCS-2/8) cells. Special focus is placed on Rho-kinase inhibition, relating to its potential to promote and support extracellular matrix production in cultured chondrocytes and its role in fibroblast cells as a part of direct chemical cellular differentiation. The means to enhance the production of cartilage-specific extracellular matrix are needed for cell-based tissue engineering applications, since cultured chondrocytes quickly lose their cartilage-specific phenotype. A mechanical 8% cyclic cell stretching at a 1 Hz frequency was used to model a stretching rhythm similar to walking. The cellular stretching relates to stresses, which are directed to chondrocytes during the mechanical load. The stretch induced changes in proteins related, e.g., to certain cytoskeletal proteins, but also in enzymes associated with protein synthesis, such as eukaryotic elongation factors 1-beta and 1-delta. Hypoxic conditions were used to model the oxygen tension present in healthy cartilage tissue. Long-term hypoxia changed relative amounts in a total of 44 proteins and induced gene expressions of aggrecan and type II collagen, in addition to chondrocyte differentiation markers S100A1 and S100B. A short-term inhibition of Rho-kinase failed to induce extracellular matrix production in fibroblasts or in HCS-2/8 cells, while its long-term exposure increased the expressions of chondrocyte-specific genes and differentiation markers, and also promoted the synthesis of sulfated glycosaminoglycans by chondrocytic cells. Interestingly, Rho kinase inhibition under hypoxic conditions produced a more effective increase in chondrocyte-specific gene expression and synthesis of extracellular matrix components by HCS-2/8 cells. The treatment induced changes in the synthesis of 101 proteins and ELISA analysis revealed a sixfold higher secretion of type II collagen compared to control cells. The secretion of sulfated glycosaminoglycans was simultaneously increased by 65.8%. Thus, Rho-kinase inhibition at low oxygen tension can be regarded as a potential way to enhance extracellular

iv

matrix production and maintain a chondrocyte phenotype in cell-based tissue engineering applications.

v

Abbreviations

2D PAGE Two-dimensional polyacrylamide gel

electrophoresis 4F2hc 4F2 cell-surface antigen heavy chain ACAN Aggrecan core protein ACI Autologous chondrocyte implantation

technique ADAMTS-5 A disintegrin and metalloproteinase with

thrombospondin motifs 5 (aggrecanase 5) Akt Protein kinase B (PKB) ATDC5 A teratocarcinoma derived chondrogenic cell

line ATP Adenosine triphosphate BCA Bicinchoninic acid BMP Bone morphogenetic protein CDC42 Cell division control protein 42 homolog CI Confidence interval CID Collision induced dissociation COL1A1 Collagen alpha-1(I) chain (type I collagen) COL2A1 Collagen alpha-1(II) chain (type II collagen) COX-2 Cyclooxygenase-2 DMEM Dulbecco's Modified Eagle Medium DMMB Dimethylmethylene Blue assay DMOAD Disease-modifying drug therapy for

osteoarthritis eEF Eukaryotic elongation factor ELISA Enzyme linked immunosorbent assay ERK Extracellular signal–regulated kinases ESI Electrospray ionization FAK Focal adhesion kinase FBS Fetal bovine serum FDA Food and Drug Administration FGF Fibroblast growth factor FOXO Forkhead box protein O GalNAc N-Acetylgalactosamine GlcNAc N-Acetylglucosamine GAP GTPase activating factor

GAPDH Glyceraldehyde 3-phosphate dehydrogenase GDI Guanosine nucleotide dissociation inhibitor GDP Guanosine diphosphate GTP Guanosine triphosphate HCS-2/8 Human chondrosarcoma cell line-2/8 HDAC6 Histone deacetylase 6 HIF Hypoxia-inducible factor HRP Horseradish peroxidase Hz Hertz (unit of frequency)

vi

IL Interleukin Inhba Inhibin beta A chain IPA® Ingenuity® Pathway Analysis LAT1 L-type amino acid transporter 1 LC Liquid chromatography MACI Matrix-assisted autologous chondrocyte

implantation mDia Mammalian diaphanous formin Mig6 Mitogen-inducible gene 6 MMP Matrix metalloproteinase MPa Megapascal mRNA messenger RNA MS/MS Tandem mass spectrometry m/z Mass-to-charge ratio NADH Nicotinamide adenine dinucleotide, reduced NDRG1 N-myc downstream regulated gene-1 ODDD Oxygen-dependet degradation domain PI3K Phosphatidylinositol 3-kinase PBS Phosphate buffered saline PKA Protein kinase A

pVHL von Hippel-Lindau tumor suppressor qRT-PCR Quantitative reverse transcription polymerase

chain reaction Rac1 Ras-related C3 botulinum toxin substrate 1 RAGE Receptor for advanced glycation endproducts RhoA Ras homolog gene family member A ROCK Rho-associated protein kinase RPLP0 60S acidic ribosomal protein P0 RVD Regulatory volume decrease SDS Sodium dodecyl sulfate sGAG sulfated glycosaminoglycan SOX5/6/9 Sex determining region Y -box 5/6/9

transcription factors TFA Trifluoroacetic acid TGF-β Transforming growth factor β TNF-α Tumor necrosis factor-α TOF Time-of-flight TRPV4 Transient receptor potential vanilloid 4 VCAN Versican core protein VEGFA Vascular endothelial growth factor A Y-27632 Rho-kinase inhibitor ((1R,4r)-4-((R)-1-

aminoethyl)-N-(pyridin-4-yl) cyclohexanecarboxamide)

vii

Tiivistelmä

Nivelrikko on nivelten tulehdussairaus, johon liittyy voimakkaita kipuja, ja

joka johtaa edetessään nivelruston vaurioitumiseen. Nivelten jäykkyyden

lisäksi nivelrikko aiheuttaa pahimmillaan liikerajoitteita vaurioituneissa

nivelissä. Tämän takia nivelsairaudet heikentävät elämänlaatua ja

nuoremmilla potilailla ne voivat aiheuttaa myös työkyvyn rajoittuneisuutta.

Nivelrikon tai vaurioituneiden nivelpintojen hoitoon ei toistaiseksi ole

käytettävissä sairauden parantavaa tai sen edistymisen pysäyttävää

lääkkeellistä hoitoa. Tavanomaiset nivelrikon yhteydessä käytetyt

lääkehoidot ovat kipua lievittäviä. Pahiten vaurioituneita niveliä esimerkiksi

polvissa, lantiossa tai sormissa voidaan hoitaa leikkauksilla, jolloin potilaan

oma vaurioitunut nivel korvataan keinonivelellä. Nämä operaatiot ovat

luonteeltaan invasiivisiä, ja menetelmien rajoitteena on mm. keinonivelten

rajallinen kesto ja haasteet niiden uusimisessa.

Uusien solupohjaisten terapioiden toivotaan mahdollistavan nivelvaurioiden

hoitamisen jo ennen niiden etenemistä vaikea-asteiseen tilaan, jossa

kudoksen alkuperäinen hyaliinirusto on tuhoutunut. Näiden uusien

hoitomuotojen kehittäminen edellyttää hyvää tietämystä sekä nivelrustosta

että erilaisista kudosteknologisista korjausmenetelmistä. Väitöskirjatyössäni

on selvitetty mekaanisen venytyksen, matalan happiosapaineen ja

rustokudoksen soluväliainetuotantoon liittyviä vasteita proteiinitasolla.

Väitöskirjatyön pääpainotus on liittynyt Rho-kinaasi-inhibiittori Y-27632:n

indusoimiin vasteisiin tukea rustosolujen ja niiden kaltaisten solujen

soluväliainetuotantoa sekä ylläpitää solujen ilmiasua. Rustosolujen

kasvattaminen in vitro -olosuhteissa johtaa niiden ilmiasun taantumiseen ja

rustosoluille tyypillisen soluväliainetuotannon loppumiseen. Rustospesifisen

ilmiasun säilyttäminen ja myös soluväliainetuotannon tehostaminen ovat

keskeisiä edellytyksiä solupohjaisten hoitomuotojen kehittämisessä.

Tässä väitöskirjatyössä käytettiin jaksoittaista 8 %:n venytystä 1 Hz:n

taajuudella mallintamaan mekaanisen venytyksen aiheuttamia muutoksia

rustosolujen kaltaisissa HCS-2/8-soluissa. Mekaaninen venytys välittyy

soluihin niiden rakenteen kautta, ja tutkitun kuormituksen havaittiin

aktivoivan soluissa ERK-solusäätelyreitin. Tämän lisäksi jaksoittainen

mekaaninen venytys indusoi muutoksia esimerkiksi tiettyihin

solutukirangan proteiineihin ja proteiinisynteesiin liittyviin eukaryoottisiin

elongaatiotekijöihin. Mekaanisen soluvenytyksen lisäksi väitöskirjatyössäni

selvitettiin rustokudoksessa pitkäaikaisesti vallitsevan matalan

happiosapaineen vaikutuksia rustosoluihin proteiinitasolla. Matala

happiosapaine indusoi muutoksia yhteensä 44:n proteiinin synteesitasoihin

viii

verrattaessa niitä vastaaviin tasoihin normaali-ilmakehässä.

Hypoksiaolosuhde lisäsi tyypin II kollagenin, aggrekaanin ja rustosolujen

erilaistumisastetta kuvaavien S100A1 ja S100B geenien ilmentymistä, mitkä

ovat suotuisia vasteita solujen rustonkaltaisen ilmiasun säilymiselle.

Ilmiasun ylläpidosta huolimatta näiden geenitason muutosten ei havaittu

kuitenkaan lisäävän soluväliainetuotantoa proteiinitasolla.

Rho-kinaasi-inhibition vaikutusten selvittäminen sekä fibroblastisoluissa

että rustosolujen kaltaisissa jatkuvakasvuisissa HCS-2/8-soluissa on ollut

keskeisessä osassa väitöskirjatyötäni. Lyhytaikaiset pari vuorokautta

kestäneet Y-27632-käsittelyt indusoivat erilaisia toiminnallisia vasteita

tutkituissa soluissa, mutta ne eivät indusoineet rustosolulle tyypillisen

soluväliainetuotannon käynnistymistä fibroblastisoluissa, eikä niiden

havaittu vaikuttavan kummankaan solutyypin ilmiasuun. Sen sijaan

pitkäaikaisen, neljä viikkoa kestäneen, hypoksiaolosuhteessa toteutetun Y-

27632-altistuksen havaittiin lisäävän rustosoluspesifistä tyypin II

kollageenin ja sulfatoitujen glykosaminoglykaanien soluväliainetuotantoa

HCS-2/8-soluissa. Pitkäkestoinen Y-27632-käsittely indusoi muutoksia

yhteensä 101:n proteiinin synteesitasoihin. Immunologisen ELISA-analyysin

perusteella Rho-kinaasin inhibitio 5 % happiosapaineessa lisäsi jopa

kuusinkertaisesti tyypin II kollageenituotantoa. Sulfatoitujen

glykosaminoglykaanien synteesi lisääntyi samaan aikaan noin 65 %.

Lopputuloksena voidaan todeta, että hypoksiaolosuhteissa toteutettava Rho-

kinaasi-inhibitio vaikuttaa potentiaalisesti sekä ylläpitää rustosolujen

ilmiasua että lisää niiden soluväliainetuotantoa, mitkä ovat keskeisiä

edellytyksiä kudosteknologisten rustonkorjausmenetelmien kehittämiselle.

ix

List of original papers

This thesis is based on the following studies, which are referred to in the text

by their Roman numerals

I. Piltti J, Häyrinen J, Karjalainen HM, Lammi MJ (2008)

Proteomics of chondrocytes with special reference to

phosphorylation changes of proteins in stretched human

chondrosarcoma cells. Biorheology 45(3-4), 323-335

II. Piltti J, Varjosalo M, Qu C, Häyrinen J, Lammi MJ (2015) Rho-

kinase inhibitor Y-27632 increases cellular proliferation and

migration in human foreskin fibroblast cells. Proteomics 15(17),

2953-2965

III. Piltti J, Bygdell J, Lammi MJ (2017) Effects of long-term

hypoxia in human chondrosarcoma cells. Manuscript submitted

IV. Piltti J, Bygdell J, Fernández-Echevarría C, Marcellino D,

Lammi MJ (2017) Rho-kinase inhibitor Y-27632 and hypoxia

synergistically enhance chondrocytic phenotype and change the

S100 protein profile in human chondrosarcoma cells.

Manuscript submitted

1

1. Background

1.1 Cartilage tissue

Cartilage is a special connective tissue that is predominantly present in the

skeletal system and joints, but is also in found in soft tissue-based organs,

such as the ears and nose. Three different cartilage types are expressed in the

human body, namely elastic cartilage, fibrocartilage and hyaline cartilage.

Elastic cartilage is found in soft tissues, while collagen fiber-based

fibrocartilage is found, e.g., in intervertebral discs, and the most common

cartilage type, hyaline cartilage is typical in diarthrodial joints. Hyaline

cartilage makes movements of joints possible and absorbs and also

distributes weight-bearing stress more evenly between skeletal bones (Tyyni

and Karlsson 2000). Articular cartilage tissue differs in its structure from the

other human tissues in a way that there are no blood vessels or nerves

present in cartilage. Moreover, cartilage tissue does not have lymph nodes.

Due to its avascularity, there is a relatively slow diffusion between synovial

fluid and cartilage tissue and this is the only mechanism for nutrient and

metabolite transport and for gas exchange. In accordance to these special

features of flexible connective tissue, the structural composition of cartilage

is divided into two phases, namely the solid extracellular matrix and a water

phase. The correct composition and structural organization of the

extracellular matrix components are important for the correct function of

healthy joints. The natural turnover rate of mature articular cartilage

components is slow. If cartilage tissue is damaged, the avascularity of

cartilage tissues reduces the activation and progression of an individual’s

own healing mechanisms. In addition to this, the surface of articular

cartilage is not covered by perichondrium, a dense and vascularized

connective tissue membrane of, e.g., tracheal cartilage. This type of

membraneous structure could offer a cell source of chondroblasts which

would be needed for new differentiated chondrocytes to support and/or

enhance the production of extracellular matrix. This type of mechanism

could provide, at least to some extent, repair to damaged articular cartilage.

Since this is missing in articular cartilage it means that it has poor ability to

self-repair any damage. The lack of proper self-repair mechanisms can lead

to the progression of outstanding damages, especially in articular cartilage.

Continuous mechanical loading can both induce and enhance the formation

of mechanical degenerative injuries especially in the case when joint

structure is not intact and lubrication is not sufficient. In addition to

mechanical factors, some genetic disorders and diseases can induce damages

in articular cartilage.

2

The structure and the composition of the extracellular matrix

Articular cartilage is a thin tissue, with a thickness of only few millimeters in

large joints like the knee and hip. The correct structure and organization of

specific zones is critical for its function. Articular cartilage consists of five

zones (Fig 1A), namely the superficial zone on the top of the tissue, then the

intermediate and middle zones, the deep zone and finally the calcified zone

that is located next to the subchondral bone (Sophia Fox et al. 2009). The

calcified zone connects articular cartilage to subchondral bone. Different

zones have specialized structural features. Chondrocytes are morphologically

more flattened in the superficial zone than in the other zones. In this zone,

collagen fibers are thin and they have a horizontal, surface-oriented

direction. The water content is highest in the superficial zone while the

proteoglycan concentration is the lowest. The orientation of collagen fibers

start to curve in the intermediate zone, and they are vertical in the deep

zone. The collagen fibers are also thicker in the middle and the deep zones

than in the superficial zone (Hedlund et al. 1993). Proteoglycan

concentration is the highest in the deep zone, and there the chondrocytes

located around the collagen fibers. A calcification line isolates the deep and

the calcified zone from each other.

Figure 1. The structure of articular cartilage (A). Type II collagen network

builds up the skeleton of cartilage tissue (B).

Collagen network

Chondrocytes synthesize and maintain the extracellular matrix of cartilage.

The extracellular matrix maintains the functional properties of cartilage.

Although, the number of the chondrocytes is relatively low, even less than

2% of the total volume of cartilage tissue, chondrocytes secrete and maintain

all the necessary extracellular matrix components in healthy cartilage

(Hunziker et al. 2002) The main structural components of extracellular

matrix are type II collagen [known also as procollagen alpha-1(II) chain] and

3

proteoglycans. The collagens form 20% of the wet weight of articular

cartilage, the proteoglycans approximately form 10%, and the remaining part

is water (Sophia Fox et al. 2009). The collagens build up the skeleton of

cartilage and regulate its structure and its dimensions (Fig 1B). The

proteoglycans provide the flexibility of cartilage. Type II collagen represents

roughly 90% of all collagens in articular cartilage and, therefore, it is referred

as cartilage- specific collagen type (Eyre et al. 2002). The synthesis of type II

collagen occurs in two steps. The first step involves the chondrocytes’

biosynthesis of procollagen, which are then secreted in the second step and

enzymatically modified to form type II collagen by the removal of certain

terminal propeptides (Prockop et al. 1979). The collagen chains are typically

assembled into triple helices, which form collagen fibril structures. These

collagen fibrils are further organized to form stronger collagen fibers, which

provide the excellent tensile strength of cartilage tissue. The other collagen

types in the articular cartilage are mostly types III, VI, IX and XI collagens,

however, there are also small amounts of types X, XII and XIV also present

in articular cartilage (Eyre et al. 2002). Collagen types IX and XI are needed

together with type II collagen to form a crosslinking network that functions

as the basic skeleton of cartilage tissue (Mendler et al. 1989, Wu et al. 1992,

Wu and Eyre 1995). The pericellular collagen type VI can connect the

collagen network to other extracellular matrix components (Eyre et al.

2002). The majority of the minor collagens take part in the formation of

different types of fibrillary structures present in cartilage tissue. However,

the precise role of minor cartilage collagens is not known.

1.2 Glycosaminoglycans

Glycosaminoglycans are long unbranched polysaccharides that are built-up

by repeated disaccharide units (Gandhi and Mancera 2008). These

disaccharide units contain one or two kinds of modified

hexosaminecarbohydrates, namely N-acetylgalactosamine (GalNAc) or N-

acetylglucosamine (GlcNAc), in addition to uronic acid, which can either be

glucuronic or iduronic acid. However, in keratan sulfate the uronic acid is

replaced by galactose. Glycosaminoglycans have highly negative charges and

their structure affects their viscosity. In articular cartilage five different types

of glycosaminoglycans are synthesized: chondroitin sulfate, dermatan

sulfate, heparin sulfate, keratan sulfate and hyaluronan. Chondroitin sulfate,

dermatan sulfate, keratan sulfate and hyaluronan are the most abundant and

are considered important glycosaminoglycans for cartilage structure and

function. Heparin, like heparan sulfate, is also found in articular cartilage

but this form might be connected to a variety of normal heparan sulfate

production in cartilage (Parra et al. 2012).

4

Chondroitin sulfate

Chondroitin sulfate is the most abundant glycosaminoglycan in articular

cartilage and it has a major role as a component of aggregating proteoglycan,

aggrecan (Kiani et al. 2002). It is a long, acidic and sulfated polysaccharide

chain that consists of repeating units of glucuronic acid and N-

acetylgalactosamine (Gandhi and Mancera 2008). Chondroitin sulfate

chains are covalently bound to core proteins via the hydroxyl groups of

serine residues. The sulfate groups of chondroitin sulfate are enzymatically

added by specific sulfotransferases primarily at the 4- and/or 6-position (C4

and/or C6) of galactosamine units, but non-sulfated disaccharide units are

also known to exist. The distribution of C4 and C6 chondroitin sulfates is

related to developmental status of articular cartilage. In mature human

articular cartilage tissue C6 chondroitin sulfate is the major form (Bayliss et

al. 1999). During maturation of articular cartilage, C4 content decreases and

C6 content increases, but after this step the proportion between C4 and C6

remains relatively stable. However, certain diseases, such as osteoarthritis,

change this ratio.

It is noteworthy to mention that chondroitin sulfate has been tested to treat

osteoarthritis, more specifically, to provide relief from osteoarthritis-related

pain. Several clinical studies involving chondroitin sulfate to treat

osteoarthritis have been performed. Although the first reports showed a

good bio-availability of chondroitin sulfate in humans, later studies ended up

with conflicting results providing doubt to its therapeutic potential (Mazieres

et al. 2001, Clegg et al. 2006, Roman-Blas et al. 2017). The most recent long-

term efficacy and safety evaluations of chondroitin sulfate and glucosamine

revealed that these agents are unable to heal cartilage injuries, unable to

improve function of damaged cartilage or relieve pain (Sawitzke et al. 2010,

Roman-Blas et al. 2017). These evaluations were based on comprehensive

double-blind placebo controlled studies. However, the potential of

chondroitin sulfate and glucosamine to treat damaged cartilage is still

frequently discussed (Hochberg et al. 2016, Bishnoi et al. 2016). Chondroitin

sulfate can be used as a prescribed medicine in some countries, however in

the United States, the Food and Drug Administration (FDA) has classified

chondroitin sulfate only as a dietary supplement.

Dermatan sulfate

Dermatan sulfate is a glycosaminoglycan that is a major component of small

non-aggregating proteoglycans in articular cartilage (Roughley and White

1989). This glycosaminoglycan is more abundant in connective tissues, such

as skin, the walls of blood vessels, heart valves and tendons. Dermatan

5

sulfate proteoglycans are involved, e.g., in wound healing, and it has

anticoagulant activity. In cartilage, dermatan sulfate proteoglycans function

is connected with collagen fibril organization and the inhibition of

fibrillogenesis. Structurally, dermatan sulfate is composed of glucuronic acid

and iduronic acid, and N-acetylgalactosamine. Two dermatan sulfate

epimerases can convert glucuronic acid into iduronic acid making iduronic

acid a major structural component of dermatan sulfate (Malmström et al.

2012). Sulfation occurs mainly at positions 4 and/or 6 of GalNAc, but

sulfation is also possible at position 2 of glucuronic or iduronic acid.

Keratan sulfate

Keratan sulfate is a highly abundant glycosaminoglycan in cornea but is also

abundantly present in articular cartilage and, to a smaller amount, in other

tissues, such as bone and the brain (Krusius et al. 1986, Funderburgh 2000).

Keratan sulfates consist of repeating galactose and N-Acetylglucosamine

units with the pattern -3Galβ1–4GlcNAcβ1-. Sulfation occurs at carbon 6

both at galactose and/or N-Acetylglucosamine. There are three different

known types of linking areas, which connect keratan sulfate to core proteins.

Differences in these linking areas are used to designate keratan sulfates to

either Type I, II or III (Krusius et al. 1986, Funderburgh 2002). Type I

keratan sulfate is the typical form in cornea, while type II is predominantly

in articular cartilage. Type III keratan sulfate is located in brain tissue.

Despite their relative abundancies, keratan sulfate types I to III are not

tissue-specific. Type I keratan sulfate (KS-I) is attached to asparagine

residue of core protein, type II keratan sulfate (KS-II) to serine or threonine

residues, and type III (KS-III) to serine residues. This amino acid-specific

binding mechanism is based on N- or O-links of specific carbohydrate

chains. KS-I attaches to asparagine via N-acetylglucosamine, KS-II attaches

to serine or threonine via N-acetylgalactosamine and KS-III to serine via

mannose (Funderburgh 2002).

Heparan sulfate and heparin

Heparan sulfate is a common glycosaminoglycan component of proteoglycan

structures and is found in the extracellular matrix of a number of tissues

(Sarrazin et al. 2011). Heparan sulfate consists of repeating units of

glucuronic acid or iduronic acid and N-acetylglucosamine (Garg et al. 2003).

Epimerization can convert glucuronic acids into iduronic acids similarly to

dermatan sulfate and this provides structural variability to heparan sulfate

chains. This epimerization needs C5-epimerase enzyme (Kreuger and Kjellén

2012). The sulfation of heparan sulfate can occur at N-acetylglucosamine

positions 3 and 6 (C3 and C6) and iduronic acid position 2 (C2). Heparin is

6

chemically similar to heparan sulfate, but its N- and O-sulfo groups of N-

acetylglucosamine are different. The ratio of glucuronic and iduronic acids is

different in heparan sulfate and heparin. Heparan sulfate contains more

glucuronic acid than heparin. Heparin does not have important role in

articular cartilage, but it acts as an efficient anticoagulant due to its binding

to antithrombin. The profound biological role of heparin might relate to

protection of injury sites from invading microorganisms. However, it is

notable that heparin is a highly sulfated molecule, which has the highest

density of negative charges among glycosaminoglycans. Heparin

disaccharide unit consists typically of 2-O-sulfated iduronic acid and 6-O-

sulfated, N-sulfated glucosamine (Garg et al. 2003).

Hyaluronan

Hyaluronan (also known as hyaluronic acid) is a nonsulfated

glycosaminoglycan molecule, which is not covalently attached to a protein

core (Bastow et al. 2008). It is an abundant glycosaminoglycan in articular

cartilage, but is also found in skin, synovial fluid and soft tissues (Fraser et

al. 1997). Hyaluronan consists of repeating units of glucuronic acid and N-

acetylglucosamine (Bastow et al. 2008). The nonsulfated nature of

hyaluronan differs from the other cartilage-specific glycosaminoglycans. Due

to the lack of sulfation, hyaluronan does not form disulfide bond based

crosslinks with other molecules. On the other hand, hyaluronan has an

important role together with glycoprotein lubricin and dipalmitoyl

phosphatidyl choline (DPPC) to reduce friction on hyaline cartilage surfaces

in synovial joints (Wang et al. 2013, Seror et al. 2015). Alhough hyaluronan

provides a clear role for synovial fluid viscoelasticity and lubrication, it also

has a structural role in the extracellular matrix of cartilage. Hyaluronan

molecules specifically bind to aggrecan and thereby assemble larger

aggregate structures. Unlike other glycosaminoglycans, hyaluronan synthesis

occurs at the plasma membrane, while other glycosaminoglycans are

synthesized in the Golgi apparatus (Prehm 1984). There are three

hyaluronan synthase enzymes that synthesize hyaluronan chains (Itano et al.

1999). These enzymes catalyze the synthesis of hyaluronan at different rates

and also affect the length of hyaluronan polymer chains.

1.3 Proteoglycans

Proteoglycans refers to macromolecules that consist of a protein core with at

least one glycosaminoglycan covalently attached (Hardingham and Fosang

1992). So-called lecticans form large aggregates with hyaluronan. The

proteoglycans have high density of negative charges under normal

physiological conditions due to their sulfate groups and glucuronic acid.

7

(Roughley et al. 2006). These negative charges have a great influence on

cartilage structure and function since they attract positively charged sodium

ions that produce the osmotic pressure that adjusts prevailing water phase in

articular cartilage. Water phase provides the typical swollen nature of

cartilage tissue and the network of collagen acts in a cohesive way to

maintain its firm structure. The water phase has an important role for the

elasticity of cartilage. Mechanical load pushes water out from tissue and

when the load is released, the osmotic pressure draws water back into tissue.

Aggrecan

Aggrecan is the most abundant proteoglycan in articular cartilage. It is a

typical proteoglycan in tissues exposed to high compression, such as

cartilage or intervertebral discs (Kiani et al. 2002, Sivan et al. 2014).

Aggrecan belongs to group of lecticans, which also contains versican and two

neuronal proteoglycans, brevican and neurocan. Structurally, aggrecan is a

high-molecular weight proteoglycan that consists of three globular domains,

an extended core protein, and contains more than 100 sulfated

glycosaminoglycan molecules. The average molecular weight of one non-

aggregated aggrecan monomer can vary from 1 to 3 million daltons. Two of

the globular domains are located at the N-terminus and one globular domain

at the C-terminus. The molecular weight of aggrecan core protein is roughly

300 kDa (Chandran and Horkay 2012). The C-terminal globular domain of

aggrecan contains one EGF-like domain, one lectin-like domain and one

CRP-like domain (Fülöp et al. 1993). The glycosaminoglycans attached to the

aggrecan core protein are chondroitin and keratan sulfates. One aggrecan

molecule contains roughly twice as many chondroitin sulfate molecules as

keratan sulfates. The non-globular domains of aggrecan also bind a variety of

different O- and N-linked oligosaccharides. The size of aggrecan aggregates

formed together with hyaluronan traps them inside the collagen network of

articular cartilage.

Versican

Versican is a large hyaluronan binding chondroitin sulfate containing

proteoglycan, which is expressed in various tissues (Zimmermann and

Ruoslahti 1989). Structurally, versican shares many similarities to aggrecan

although it lacks a second globular domain and its binding to hyaluronan

and its protein link occurs in a different manner (Matsumoto et al. 2003).

Versican binds fewer glycosaminoglycan chains than aggrecan and its C-

terminal globular region does not exhibit alternative splicing like aggrecan

(Grover and Roughley 1993). The C-terminal globular domain of versican

contains two EGF-like domains, one lectin-like domain and one CRP-like

8

domain (Zimmermann and Ruoslahti 1989). Versican has a role in articular

cartilage development, but its synthesis is decreased after this process

(Shibata et al. 2003). Instead of versican aggregates, mature cartilage tissue

matrix is based on aggrecan aggregates, and due to this reciprocal synthesis

profile, it is suggested that versican could act as a temporary matrix for

developing cartilage structure (Grover and Roughley 1993). Versican gene is

also expressed in mature articular cartilage, although its expression level is

substantially less than expression levels of aggrecan. Versican transcriptional

expression in mature cartilage tissue is suggested to specifically relate to a

role in articular cartilage surfaces (Matsumoto et al. 2006).

Small leucine-rich repeated proteoglycans

Biglycan, decorin, epiphycan, fibromodulin and lumican are minor

proteoglycans in articular cartilage that belong to a family of small leucine-

rich repeat (LRR) proteoglycans (Kobe and Deisenhofer 1994, Chakravarti S

and Magnuson T 1995, Grover et al. 1995). Depending on the type of

glycosaminoglycan substituents, the number of LRRs, and the gene

structures, small LRR proteoglycans are classified into different subfamilies

(Roughley 2006). Fibromodulin and decorin are the most abundant minor

proteoglycans in cartilage tissue. These two proteoglycans have ten LRRs

similar to biglycan and lumican. Structurally, biglycan and decorin share

close similarities due to the 8th exon structure, and they both are classified

as dermatan sulfate proteoglycans. Fibromodulin and lumican have

similarities in their 3rd exon and are classified as keratan sulfate

proteoglycans. More accurate than previous classification, decorin usually

contains one dermatan sulfate chain, which can also be a chondroitin sulfate

chain depending on its tissue origin. Biglycan has two glycosaminoglycan

chains, which can be either chondroitin or dermatan sulfates. Fibromodulin

and lumican have up to four N-linked keratan sulfates. Epiphycan has one

dermatan or chondroitin sulfate chain, and it has only seven LRRs, which is

less in compared to the other LRR protein family members presented here

(Johnson et al. 1997). The role of epiphycan relates to embryogenesis, when

it is expressed in epiphysis. Epiphycan is also suggested to stabilize cartilage

matrix and maintain joint integrity (Nuka et al. 2010). Decorin can bind to

collagens and interact with certain growth factors such as transforming

growth factor-β1 (TGF-β1) (Ferdous et al. 2007). The function of decorin and

fibromodulin was suggested to relate to the organization of collagen fibrils

and the further formation of collagen structure (Burton-Wurster et al. 2003).

9

Agrin and perlecan, basement membrane type proteoglycans

Agrin is a heparan sulfate proteoglycan, which is typically associated to the

development of neuromuscular junctions via low-density lipoprotein

receptor-related protein 4 (LRP4) or α-dystroglycan mediated cytoskeleton

and basement membrane connections (Zhang et al. 2008, Campanelli et al.

1996). However, this large proteoglycan has also been found in cartilage

tissue and the non-neuronal isoform (y0, z0) affects both chondrocyte

differentiation and cartilage formation in vivo (Eldridge et al. 2016). Agrin

mediates cartilage differentiation both in a LRP4- and α-dystroglycan-

dependent manner prior to the activation and upregulation of Sox9.

In articular cartilage, chondrocytes are surrounded by a thin layer of a

pericellular matrix. This pericellular matrix separates chondrocytes from the

extracellular matrix. Perlecan (also known as basement membrane-specific

heparan sulfate proteoglycan core protein) is a proteoglycan with several

domains containing a core protein and three glycosaminoglycan chains

(Costell et al. 1999). These glycosaminoglycans are typically heparan

sulfates, but chondroitin sulfate can also occur in some cases. Although

perlecan belongs to the minor set of proteoglycans of articular cartilage, it

has been demonstrated to play an essential role in the biochemical and

mechanical properties of the pericellular matrix in articular cartilage (Wilusz

et al. 2012).

Cell surface proteoglycans

Syndecans form a proteoglycan family, which consists of four structurally

close members, namely syndecan 1 (syndecan), syndecan 2 (fibroglycan),

syndecan 3 (N-syndecan) and syndecan 4 (amphiglycan/ryudocan) (Kim et

al. 1994, Elenius and Jalkanen 1994). Syndecans 1-3 are described to be

predominantly expressed in a tissue-specific manner, however syndecan 4,

also known as amphiglycan or ryudocan, is more commonly expressed in a

wide variety of tissues (Morgan et al. 2007). Syndecans are classified to

heparan sulfate proteoglycans, although syndecans 1 and 3 also contain

minor chondroitin sulfate chains in their membrane proximal regions.

(Gould et al. 1992, Kokenyesi et al. 1994). The syndecans have a single

transmembrane spanning core protein and their structural differences are

based upon the different lengths of extracellular regions and the variable

intracellular region unique to each member (Morgan et al. 2007). The core

proteins of syndecans interact with different kinds of ligands, such as

extracellular matrix glycoproteins and growth factors. Although the

syndecans are only minor proteoglycans in cartilage, both syndecan 1 and 4

have been detected in articular cartilage and their expression was observed

10

to change in osteoarthritis (Barre et al. 2000). Syndecan 3 is only transiently

expressed during certain stages of chondrogenesis (Hall and Miyake 2000).

When the expression of syndecan 1 was studied in a transgenic osteoarthritic

mouse model, it was suggested that syndecan 1 could be involved in cartilage

fibrillations and take part in this way to certain repair mechanism

(Salminen-Mankonen et al. 2005). However, this possible repair mechanism

is still unknown and further studies are needed. A recent study revealed that

inhibition of syndecan 4 in osteoarthritic cartilage reduced matrix

metalloproteinase 3 (MMP-3) expression and ADAMTS-5 aggrecanase

activity (Echtermeyer et al. 2009). Thereby, syndecan 4 inhibition can be

regarded as a potential target for therapeutic treatment of osteoarthritis.

Glypicans form another large heparan sulfate proteoglycan family (Filmus et

al. 2008). Mammals have a total of six glypicans (glypicans 1-6), which all

have a relatively similar size of their globular core protein. The core proteins

are not transmembrane spanning proteins, rather they are attached to cell

membranes via glycosyl phosphatidylinositol linkage (GPI). Glypicans act as

co-receptors and function to regulate Wnt, Hedgehog, fibroblast growth

factor and bone morphogenetic protein signals. Dependent on the biological

context, glypicans have either inducing or inhibiting roles. Glypican

expression has been detected in human articular chondrocytes, but with

much lower expression levels than in fibroblast cells (Grover and Roughley

1995).

Betaglycan (also known as transforming growth factor beta receptor III;

TGFBR3) is a chondroitin and heparan sulfate containing cell surface

proteoglycan (López-Casillas et al. 1994). The core protein of betaglycan acts

as a TGF-β receptor. The betaglycan gene is marginally expressed in human

chondrocytes and it has been suggested that endoglin betaglycan could form

a heteromeric complex that regulates TGF-β signaling in chondrocytes

(Grover and Roughley 1995, Parker et al. 2003). TGF-β signaling has an

important role in chondrocytes, one that induces both the proliferation and

the other that inhibits their differentiation to a hypertrophic stage (Li et al.

2005). A quite recent finding revealed that signaling of TGF-β/SMAD

pathway relates to the development of osteoarthritis (Shen et al. 2014).

In addition to syndecans, glypicans and betaglycan, cell surface

proteoglycans also contain two additional members, namely phosphacan and

chondroitin sulfate proteoglycan 4 (also known as neuron glial antigen 2;

CSPG4/NG2) (Iozzo and Schaefer 2015). Despite the general classification,

phosphacan is not a true transmembrane bound proteoglycan, but its splice

variant, transmembrane receptor protein tyrosine phosphatase beta,

(RPTPβ/PTPζ) is synthesized with a transmembrane spanning domain

11

(Maurel et al. 1994, Peles et al. 1998, Nishiwaki et al. 1998). Altogether,

phosphacan and its isoforms are chondroitin sulfate proteoglycans that are

typically expressed in nervous tissues. Chondroitin sulfate proteoglycan 4

contains chondroitin sulfate chains as the name suggests. This proteoglycan

is also primarily connected to interactions in nervous tissues, but it is

expressed both in human fetal and adult articular chondrocytes, although

cartilage specific function has not been recognized (Midwood et al. 1998).

1.4 Osteoarthritis

Osteoarthritis (OA) is an inflammation-related musculoskeletal disease,

which can lead to the progressive destruction of articular cartilage and,

ultimately, the entire joint. The etiology of this common articular cartilage

disease is complex even though many risk factors are known (Michael et al.

2010). Individual-related risk factors, such as age, gender and genetic

predisposition, can increase the likelihood of developing osteoarthritis.

Obesity, different kinds of joint traumas, such as impact injuries and lifestyle

habits can also increase the risk of developing osteoarthritis. Still, there is

usually not just one factor that causes osteoarthritis and hereditary factors

are considered to relate specifically to induction of osteoarthritis in majority

of cases (Valdes et al. 2008). Osteoarthritis causes pain, swelling and

stiffness of the joints and, in severe cases, it can limit the bending or the

movement of the injured articular joint (Hunter et al. 2008, Michael et al.

2010). The associated pain and the reduced joint function can restrict both

routine activities and the ability to work.

Osteoarthritis gradually destroys articular cartilage until the injury also

affects the underlying bone. Osteoarthritis typically develops in joints of the

knees, hips and fingers, but it may also occur in other synovial joints, such as

the lower back and neck (Nuki 1999). The normal maintenance of healthy

articular cartilage is based on the correct balance between anabolic and

catabolic activities. A correct balance is critical since the number of

chondrocytes is small and the normal turnover rate of extracellular matrix

components is slow. If the normal maintenance of articular cartilage is

disturbed, chondrocytes and synovial cells begin to produce and secrete

interleukin-1, tumor necrosis factor-alpha, chemokines and other factors

that upregulate the expression and activity of proteolytic enzymes (Goldring

and Otero 2011). Increased catabolic activity induces inflammation and the

gradual breakdown of cartilage tissue. Inflammation is a normal response to

tissue injury, but prolonged inflammation is harmful and can produce even

more damage. In addition, the small degraded matrix components of the

extracellular matrix act as feedback regulators, which further enhance

inflammation responses. Mechanistically the progress of osteoarthritis can

12

be divided into different steps (Dijkgraaf et al. 1995). If the extracellular

matrix structure is damaged, the proteoglycan content starts to decrease and

the water phase volume will increase. This kind of structural change makes

articular cartilage more vulnerable to abrasion and mechanical impacts. The

chondrocytes may respond to the change in environment by increasing the

production of extracellular matrix. However, all the risk factors cannot be

eliminated and at some point the chondrocytes are unable to maintain the

balance between anabolic and catabolic activities, and cartilage-degrading

processes start to predominate. Although the physiological responses to the

progressive osteoarthritis are mostly known, the comprehensive mechanism

of the origin of osteoarthritis is still not known in all parts. Thereby, it is

challenging to prevent and treat articular cartilage damage.

Diagnosis of osteoarthritis

Although pain is the most characteristic symptom of osteoarthritis, it does

not correlate well to the actual stage and radiographic findings of

osteoarthritis (Hannan et al. 2000). Pain is a subjective feeling; since

articular cartilage is aneural tissue, pain is mediated via the nerves of

surrounding tissues. Indirect sources of joint pain have been studied and it

has been suggested that there is a complex, even biopsychosocial framework,

which plays a role in osteoarthritis and pain sensation (Dieppe and

Lohmander 2005). The only reliable diagnosis of osteoarthritis is based on

interviews with patients and clinical investigation (Hunter et al. 2008).

Clinical examinations focus on movement ranges of joints. Commonly the

diagnosis is confirmed by radiography, but additional imaging techniques,

such as magnetic resonance imaging (MRI), ultrasound or optical coherence

tomography (OCT) can also be used nowadays (Braun and Gold 2012).

Radiography is still an important tool for osteoarthritis diagnosis, although

there are certain risks to misinterpret the radiographic findings. The

technique is commonly known to be insensitive to early stage changes of

osteoarthritic cartilage. On the other hand, all positive radiographic findings

do not explain the source of pain, which might be related, for example, to

bursitis (Hannan et al. 2000). However, in later stages of osteoarthritis,

radiography is a potential method that can reveal the narrowed joint spaces,

bony projections, known as osteophytes and possible subchondral sclerosis

and cysts in cartilage underlying bones (Hunter et al. 2008). Magnetic

resonance imaging is becoming more common in osteoarthritis diagnostics.

There are different kinds of contrast-agent methods for specific imaging

purposes, and the technique has been validated to identify cartilage lesions

(Braun and Gold 2012). Moreover, novel modifications in MRI imaging have

shown potency to even interpret the changes in a physiological context. This

kind of information may provide insight into the early stages of cartilage

13

breakdown. Laboratory testing can be used to support osteoarthritis

diagnosis, but it is important to remember that tests rather reveal

inflammation status of tissue than the actual progression of the injury.

The progression of osteoarthritis can be described using a five-stage

arthroscopic grading system that is based on International Cartilage Repair

Society (ICRS) guidelines (Brittberg and Winalski 2003). Normal healthy

articular cartilage is classified as grade 0. Grades 1 to 4 represent cartilage

injuries ranging from superficial wears to severe and completely damaged

cartilage tissue. The size and the thickness of the damage are the key factors

that determine the grade of the injury. Furthermore, the location of cartilage

damage and how the damage affects the function of the joint influence the

stage of osteoarthritis.

1.5 Current osteoarthritis therapies

Currently, there is no pharmacology-based therapy that can prevent or cure

osteoarthritis. Lifestyle changes, such as moderate physical exercise and

weight loss, might relieve symptoms. Anti-inflammatory and analgesic drugs

are commonly prescribed to patients to relieve pain and inflammation, yet,

these do not stop the progression of degenerating cartilage (da Costa et al.

2016). Certain patients get temporary relief by hyaluronan injections, which

most commonly are injected to a synovial capsule of a knee (Richette et al.

2015). Hyaluronan injections are used to increase lubrication, but these

might have additional beneficial effects since hyaluronan binds to CD44 and

could possibly take part in chondroprotective mechanisms (Altman et al.

2015). However, non-surgical methods are usually used to postpone invasive

surgical interventions. Early and middle stage cartilage damage can be

treated with microfracture surgery and by the use of autologous

osteochondral plugs or chondrocyte implantation methods (Falah et al.

2010). More severely or completely damaged joints are usually treated by

total joint replacement surgeries (Katz et al. 2010). Although replacement

surgeries are highly successful, the method is only applicable for certain

joints, the operations are large and rather invasive, and joint replacements

have a limited lifetime.

Microfracture surgery and autologous repair methods

Small lesions, less than 2 cm2 of cartilage, can be restored using

microfracture surgery (Gudas et al. 2005). This method is based on the

body’s own capability to restore injured tissue. The operation consists of

making arthroscopically small holes to the underlying bone of the damaged

cartilage. Blood transports both bone marrow-derived stem cells and growth

14

factors to the cartilage, which subsequently induce extracellular matrix

production and restoration of cartilage. The feasibility of this method is

usually limited since, instead of native hyaline cartilage, a functionally

weaker fibrocartilage repair tissue is normally produced during healing

(Knutsen et al. 2004). This method might have potential in young patients

with minor injuries, but the true evidence of long-term functionality are

exiguous (Asik et al. 2008, Mithoefer et al. 2009).

Osteochondral autografts offer a potent way to repair larger cartilage damage

than microfracture surgery (Patil and Tapasvi 2015). In this surgical

operation, a cylinder-shaped cartilage and bone plug, or several plugs, are

taken from a patient’s healthy and less weight-bearing cartilage and

transferred to the damaged area. When several plugs are transplanted, the

method is called mosaicplasty. Although the cartilage of the plugs is intact,

the method has its own challenges. The correct transplantation of several

plugs to a specific area to be treated is difficult. This can lead to an uneven

positioning, which exposes the plugs to loosening and rapid abrasion.

Secondly, the harvesting of the plugs produces permanent damage to a

patient’s articular cartilage and, if the treated area is large, there are

difficulties to obtain enough material to be harvested and transplanted

(Jakob et al. 2002). However, short-term response to mosaicplasty are

usually promising. A follow-up study of 19 patients demonstrated that the

transplanted osteochondral autografts worked well in the majority of

patients (Oztürk et al. 2006). On the other hand, another study using a

larger number of patients did not reveal an increase in long-term response

than what is achieved with microfracture surgeries (Krych et al. 2012). In a

10-year follow-up study, mosaicplasty operations were observed to have

great variability (Solheim et al. 2013). Some operations were successful, but

others were not at all. The main reasons for this variability were age, gender

and the original size of the damaged cartilage. Altogether, a recent review of

osteochondral autograft operations concluded that the method is practical

for young patients who have lesions less than 4 cm2 in their articular

cartilage (Richter et al. 2016).

Chondral and osteochondral damage can be also treated with an autologous

chondrocyte implantation technique (ACI) (Brittberg et al. 1994). This

method is based on the use of chondrocyte cells, which are isolated from

arthroscopic biopsies taken from the patient’s healthy cartilage in the less

weight-bearing areas, and later grown in culture until a number of cells is

large enough to be implanted in damaged cartilage. After implantation, the

chondrocytes are covered and sealed with a periosteal cover to maintain the

cells in the damaged area.

15

Alternatively, matrix-assisted ACI method (MACI) can be used (Kon et al.

2013). In MACI, harvested healthy cells are seeded directly into a matrix,

such as collagen. These matrices maintain the cells in the damaged area and

work as a structural support for implanted cells. The MACI method reduces

the need of operations in comparison to original ACI since it does not require

the isolation of an autologous periosteal cover.

These autologous chondrocyte implantation methods can be used to treat

damages to cartilage larger than those in which microfracture surgeries or

mosaicplasty are suitable. Although both ACI techniques are potentially

better to induce cartilage formation than previous methods, they have

certain challenges. The synthesis of new cartilage is a slow process and

operated joints will take several months to over a year to heal, in addition,

these tecniques require rehabilitation (Hambly et al. 2006). Therefore, the

true success of operations can only be evaluated after a long-term period of

monitoring. ACI-based techniques are expensive and need both invasive

operations and a special laboratory for in vitro cell culturing.

Evaluations of the outcomes of ACI operations have generally shown

promising results at early- and mid-term follow-ups, which shows suitability

of these methods to treat cartilage damages, e.g., in the knee (Ossendorf et

al. 2011). However, poor clinical results have also been observed which

indicate that more extensive and carefully designed long-term follow-up

studies are needed (Filardo et al. 2013, Kon et al. 2013). The predisposition

of MACI repair tissue to the onset of osteoarthritis is not known (Jacobi et al.

2011). The absolute comparison of the different surgical-based cartilage

repair methods is challenging since methods are technically quite different

and they are targeted for different kinds and sizes of lesions.

There has been no success to develop a cartilage-based therapy able to

restore all of the features of native hyaline cartilage, such as biologically

correct cartilage zones and the correct organization of extracellular matrix

components. One of the challenges also relates to poor attachment of repair

tissues to the treated area. Individual risk factors make it even more difficult

to develop an efficient cartilage therapy suitable for all patients. Therefore,

there is still a need for novel therapies that regenerate cartilage lesions and

injuries in an efficient way.

1.6 Strategies for novel osteoarthritis therapies

Present strategies to develop novel osteoarthritis treatments mostly rely on

improving an existing therapy or in developing a new strategy to treat

osteoarthritis and related tissue damages. The strategies are often divided

16

into pharmacological attempts, such as osteoarthritis drug development and

various regenerative therapies (Zhang et al. 2016). The group of the

regenerative therapies is extensive and includes stem cell applications,

autologous transplantation techniques and combinations of each with novel

biomaterials. A better understanding of the maintenance of articular

cartilage and the specific role of microenvironmental factors, such as

mechanical forces, a low oxygen atmosphere, growth factors, etc., could offer

cell-based cartilage therapies more effectiveness and simultaneously

recognize putative biomarkers for osteoarthritis.

The aims of disease-modifying drug therapies for osteoarthritis

There have been a lot of investment to develop disease-modifying drug

therepies for osteoarthritis (DMOADs). Unfortunately present approaches

have not succeeded to stop the progresion of osteoarthritis. It has been

speculated that previous attempts have not taken into consideration all

biological factors of articular cartilage and the surrounding tissues, such as

cytokine cascades, nitric oxide, proteinases, cellular senescence and

apoptosis (Qvist et al. 2008). Furthermore, the lack of proper biomarkers

impedes the monitoring of the progression of osteoarthritis in test subjects.

Although the need for applicable biomarkers has been recognized for a long

time, it is still one of the key issues to be solved (Karsdal et al. 2016). The

benefits of systemic and local dosing should also be taken into consideration.

Some previous pharmacotherapic failures have been related to improperly

executed clinical trials (Yu and Hunter 2015, Karsdal et al. 2016). These

kinds of failures are expensive setbacks and highlight the importance of

careful design of clinical studies to ensure the possibibility to reveal true

effects. Moreover, the complexity of osteoarthritis should be recognized and

it should be accepted that a single pharmacotherapy will not be effective for

all cases and patients. Articular cartilage has a close relationship to

subchondral bone. Therefore, it has been suggested that the subchondral

bone could also be a potential target of osteoarthritis pharmacotherapy

(Castañeda et al. 2012). For example, a potential pharmacotherapy could be

developed to inhibit both osteoclast activity and induce bone vascularization

(Tonge et al. 2014). The current DMOAD strategies and studies have been

primarily focused on molecules such as MMP inhibitors, aggrecanase

inhibitors (ADAMTS inhibitors), cytokine inhibitors, bisphosphonates,

calcitonin, cathepsin K inhibitors, strontium ranelate, bone morphogenetic

protein 7 (BMP-7), different growth factors and enzymes that can inhibit the

production of nitric oxide (Qvist et al. 2008, Tonge et al. 2014, Wang et al.

2015). The underlying purpose of these strategies is to maintain anabolic

responses and/or reduce any cartilage degrading catabolic activity with a

17

pharmacologically active molecule. These goals have proven to be difficult to

reach in practice, and DMOADs are still in experimental research use.

The studies of novel regenerative therapies for osteoarthritis

There are numerous ongoing studies relating to regenerative therapies for

osteoarthritis. Their main goal is to discover a cell-based solution, one that

would produce long-lasting, native-like repair tissue to replace damaged

articular cartilage. Regenerative cartilage therapies can be based on the use

of matrices and scaffolds, but there are also scaffold-free solutions. Scaffold-

free applications might enhance proteoglycan production, but they usually

have certain mechanical weaknesses (Duarte Campos et al. 2012). Matrices

and scaffolds can consist of both biological and synthetically manufactured

materials. Common natural materials used are collagens, fibrin, gelatins and

carbohydrate-based compounds, such as agarose, alginate, chitosan and

hyaluronan. Polyethylene glycol, N-isopropylacrylamide, polycaprolactone,

polyvinyl alcohol, polylactic acid and its’ derivatives are examples of

synthetic materials studied in cartilage tissue engineering (Duarte Campos et

al. 2012, Gentile et al. 2014). It is also possible to combine certain natural

and synthetic components to obtain hybrid materials. Material sciences

closely relate to tissue engineering, and it is suggested that novel

nanomaterials, such as specific carbon nanotubes, could be applicable for

efficient scaffold manufacturing (Antonioli et al. 2013). It is noteworthy that

nanotechnology is not only limited to structural applications, such as

scaffolds, but it might also offer a novel way to target drug delivery for

treatment of osteoarthritis and bone diseases (Kang and Im 2014). Scaffolds

are used as a three-dimensional support for cell growth, cell attachment and

migration aimed to facilitate the production of repair tissue (Duarte Campos

et al. 2012). An optimal scaffold structure should mimic the features of

natural cartilage tissue. One of the challenges relate to the development of

scaffold material, which would support cartilage structure until chondrocytes

can replace the scaffold with its own cartilage repair tissue. Thereby,

scaffolds should be made of safe and biologically degradable materials.

Although most of the matrices and scaffolds are designed to be used with

cells, different kinds of cell-free scaffold systems have also been tested to

treat damaged cartilage (Siclari et al. 2012, Di Martino et al. 2015). The true

long-term results of these studies are still awaited.

ACI technologies belong to regenerative therapies and they have been used

for over 20 years. During the past two decades the method has improved.

Instead of ACI, the MACI methods are currently used to avoid periosteal

delamination and to reduce hypertrophic differentiation and the number of

operations (Zhang et al. 2016). Although present ACI techniques appear to

18

work relatively well for a large amount of patients, there is still need for

improvement. A limited number of autologous chondrocytes restrict this

type of treatment. Arthroscopic biopsies cause damage to cartilage surfaces;

moreover, the chondrocytes tend to lose their phenotype during in vitro

expansion process. Novel cell-based strategies are considered to minimize

both the number of invasive surgical operations and the damage of less

weight-bearing areas during the collection of chondrocytes. Therefore, other

types of cell sources are actively studied.

Stem cells might solve many of the problems relating to the optimal cell

sources. Mesenchymal, embryonic and induced pluripotent stem cells are

considered potential cells for chondrogenic differentiation (Zhang et al.

2016). Embryonic stem cells could be an ideal cell source for cell-based

therapies since they have a wide capability to differentiate into many somatic

cell types and since they are not limited in their ability to proliferate. Both

scaffold-based and scaffold-free studies using embryonic stem cells have

been performed, but there are still several concerns that limit their medical

use. Today it is not known which is the best way to selectively differentiate

embryonic stem cells into chondrocytes and there is a risk of teratoma

formation. Furthermore, the source of blastocysts causes ethical questions.

The use of induced pluripotent stem cells offer certain source- and risk-

related benefits in comparison to embryonic stem cells, but the controlled

dedifferentiation of somatic cells to the induced pluripotent stage and

further redifferentiation to the chondrocytes is complex. The reprogramming

processes require virus-mediated gene transfers and/or complex cocktails of

different reprogramming factors, such as proteins, peptides, mRNAs,

miRNA and small molecules (Singh et al. 2015, Han et al. 2016). These

strategies are fascinating and probably achievable at some stage, but

currently their use is focused on experimental research instead of safe and

practical human studies. Furthermore, the risk of tumorigenesis also relates

to the induced pluripotent stem cells since tumorigenic genes of these cells

are not properly known (Zhang et al. 2012).

Thereby, more realistic expectations from stem cell-based therapies rely on

the use of mesenchymal stem cells, such as bone marrow- or adipose tissue-

derived stem cells. It has been demonstrated that these can be used with or

without different types of scaffolds to treat mild osteoarthritis in animal

models (Cui et al. 2009, Toghraie et al. 2012). Besides their use with

scaffolds, direct and simple intra-articular injections of mesenchymal stem

cells and their combinations with synthetic extracellular matrices have been

also tested (Liu et al. 2006, Jo et al. 2014). Mesenchymal stem cell injections

have revealed certain improvement in joint functions in addition to pain

relief and, in some cases, even hyaline-like cartilage formation (Koh et al.

19

2013, Jo et al. 2014). The influence of certain carrier media, such as platelet-

rich plasma, has also been studied for stem cell injection therapies. This

multifactorial component has been shown to promote type II collagen

synthesis, suppress apoptosis in chondrocytes and improve cell integration

to surrounding tissue and, thereby should be considered for additional trials

(Mifune et al. 2013). However, in one of the most recent reviews, it was

criticized that the outcome evaluation of injection studies were not long-term

and pointed to the need for true evidence of long-term efficacy of stem cell

injections to treat osteoarthritis (Freitag et al. 2016). Altogether, a large

amount of both preclinical and clinical human studies using mesenchymal

stem cells have been performed to treat osteoarthritis. Many results have

been promising, but certain drawbacks, such as the hypertrophic

differentiation of chondrocytes have also been observed. Therefore,

comprehensive long-term clinical trials are still needed until all the

advantages, disadvantages, and the safety of mesenchymal stem-based

therapies will be known.

1.7 Mechanical stresses in articular cartilage

The weight-bearing function and movement of joints expose chondrocytes to

increased hydrostatic pressure and mechanical stress, such as compression

and stretching. These mechanical factors induce secondary responses that

include fluid flow in cartilage tissue. Normal osmotic pressure produces a

constant hydrostatic pressure in articular cartilage (Urban 1994). The

mechanical forces cause structural tension to cartilage tissue while the

porous and permeable extracellular matrix restricts the rapid flow of the

fluid phase (water-based interstitial fluid) from the tissue (Sophia Fox et al.

2009). When a mechanical load is removed, the fluid phase returns to the

previously unloaded stage. This mechanism enhances the structural

resilience of cartilage tissue. Generally, the viscoelastic mechanisms of

articular cartilage can be divided into to flow-dependent and flow-

independent mechanisms. Flow-independent mechanisms are based on the

viscoelastic nature of collagen and proteoglycan networks.

Hydrostatic pressure

Hydrostatic pressure is considered to be one of the most important physical

factors together with mechanical compression in articular cartilage (Elder

and Athanasiou 2009a). Hydrostatic pressure is generated during

compression by the resistance of fluid flow in articular cartilage matrix. The

effects of hydrostatic pressure on chondrocytes and extracellular matrix have

been widely investigated. Models have been used to study the effects of

normal physiological loads in addition to higher, non-physiological, loads.

20

Depending on the experiment, both constant and cyclic hydrostatic pressure

loads have been applied. The lengths of the experiments have varied from a

few minutes to hours and even up to days or weeks. Long-term experiments

are usually based on the arrangements, in which a cyclic load is produced

during a certain time scale per day and the procedure is repeated for days or

even weeks using the same pattern. Due to high experimental variability, the

absolute comparison between experimental results is challenging. However,

even the low constant hydrostatic load, 0.25 kPa for three weeks induced a

proliferation of chondrocytes and revealed the mechanosensitive nature of

chondrocytes (Lee et al. 2005). A static and physiologically relevant

hydrostatic load (5-15 MPa) can support proteoglycan synthesis in

chondrocytes and cartilage explants, while those over 20 MPa have been

determined to be rather catabolic (Hall et al. 1991, Lammi et al. 1994).

Compression and cyclic hydrostatic loads produce a reversible re-

organization of the actin cytoskeleton, and this mechanism regulates the

mechanosensitivity of chondrocytes (Knight et al. 2006). Cyclic and

intermittent hydrostatic loads at physiological magnitudes can also control

synthesis of the extracellular matrix in cartilage explants and in

chondrocytes (Parkkinen et al. 1993, Smith et al. 2000). Intermittent

hydrostatic pressures (1, 5 and 10 MPa at 1 Hz) with time intervals of 4 h per

day for one or four days enhanced cartilage-specific extracellular matrix

production in normal human articular chondrocytes (Ikenoue et al. 2003).

Furthermore, long-term cyclic hydrostatic loading patterns supported the

development of self-assembled articular cartilage constructs (Hu and

Athanasiou 2006, Elder and Athanasiou, 2009b). It is obvious that

hydrostatic loading patterns with appropriate time scales can control

extracellular matrix production, but the optimal parameters for a full range

of extracellular matrix production and tissue assembly are unknown. It has

also been noticed that the anabolic responses continue after mechanical

loading has stopped (Tatsumura et al. 2013). This supports the hypothesis

that the role of hydrostatic pressure in controlling cartilage-specific matrix

production is a complex process.

The role of intermittent hydrostatic pressure is not only limited to matrix

production in articular cartilage, but it is also connected to the chondrogenic

differentiation of cartilage progenitor cells (Li et al. 2016). A cyclic or

intermittent hydrostatic pressure, with low or physiological amplitudes,

support the maintenance of chondrocyte and cartilage phenotype by

increasing, e.g., type II collagen gene expression, proteoglycan synthesis,

decreasing the gene expression of the matrix degrading MMP-13 enzyme and

inducing other chondroprotective responses that counteract some

inflammatory agents (Wong et al. 2003, Lee et al. 2003, Gavénis et al. 2007).

Intermittent hydrostatic pressure regimens have proved to enhance the

21

differentiation of mesenchymal stem cells in differentiation supporting

conditions, such as in the presence of regulatory factors like TGF-β

(Miyanishi et al. 2006, Wagner et al. 2008). The combination of hydrostatic

pressure and low concentrations of TGF-β3 enhanced chondrogenesis and

additionally down-regulated the expression of Indian hedgehog and type X

collagen genes related to chondrocyte hypertrophy and terminal

differentiation (Vinardell et al. 2012). In addition to chondrogenic

differentiation, hydrostatic pressure can regulate both cellular proliferation

and stress fiber formation in mesenchymal stem cells (Zhao et al. 2015).

These mechanosensitive mechanisms appear to relate to Ras homolog gene

family member A (RhoA) and Ras-related C3 botulinum toxin substrate 1

(Rac) mediated pathways. Previous findings indicate that hydrostatic

pressure has many beneficial responses for development and maintenance of

cartilage tissue. Optimally, hydrostatic pressure and other supporting

factors, such as chondrogenic growth factors, could be used together to

enhance controlled extracellular matrix production in cell-based tissue

engineering applications.

Mechanical stretching

Mechanical forces mediated across diarthrodial joints tend to compress and

change the shape of cartilage tissue. During compression, the normal weight-

bearing function of cartilage, both tissue and chondrocytes are exposed to

different types of mechanical forces. In addition to compression, related fluid

flow increases in hydrostatic pressure and movement of charged molecules,

articular chondrocytes are exposed to tensile and shear stresses (Soltz and

Ateshian 2000, Jin et al. 2001).

The role of shear stress has been studied using different kinds of technical

arrangements. It has been shown to induce both type II collagen and

proteoglycan synthesis and to influence chondrocyte metabolism (Lane

Smith et al. 2000, Jin et al. 2001, Waldman et al. 2003). During mechanical

compression of joints, the form and volume of chondrocytes are stretched

towards an oval shaped morphology. These structural changes can be

visually detected using confocal microscopy (Guilak 1995). Visualization

showed that stretching does not only change the morphology of cells, but

also the shape of their nuclei. The precise mechanism, how the stretch affects

cells and their responses, is not completely known. However, it has been

suggested that chondrocytes can sense compression as stretching force since

compression leads to stretching of cellular membranes (Lewis et al. 2011). In

addition to mechanical compression, hypo-osmotic shocks increase volume

of chondrocytes and cause cellular stretching of chondrocyte plasma

membranes.

22

Changes in the ionic composition can also cause a shrinking of the cells.

Thereby, the chondrocytes require ion channels and aquaporins to actively

maintain their cellular volumes under different conditions (Lewis et al. 2011,

Barrett-Jolley et al. 2010). Moreover, ion channel function can modulate

proliferation, chondrogenic differentiation and cell death associated signals

(Wu and Chen 2000, Kurita et al. 2015). Cyclic mechanical stretch was

shown to induce the expression of large conductance potassium, BK

channels in chondrocytes, while the expression of transient receptor

potential vanilloid 4 (TRPV4) channels that are known to mediate metabolic

responses in chondrocytes was not affected (Hdud et al. 2014). The normal

function of TRPV4 channels is required for osmotransduction-related

responses and the channels have an important role in the maintenance of

healthy joints (Clark et al. 2010). Calcium signaling via TRPV4 channels can

enhance the chondrogenic differentiation of chondroprogenitor cells

(Muramatsu et al. 2007). The precise role of stretch-sensitive BK channels is

not known in chondrocytes. However, BK channels are known to allow

potassium ion efflux to decrease intracellular osmotic pressure and

potentially participate in regulatory volume decrease (RVD) (Mobasheri et

al. 2010).

In addition to ion channels, chondrocytes also have other mechanosensitive

mechanisms that can mediate and activate cellular responses. Primary cilia

are non-motile cellular structures that can mediate ATP-induced Ca2+

signaling in mechanically stressed chondrocytes (Wann et al. 2012).

Although they are ubiquitously expressed in eukaryotic cells, the cilia-

mediated control of ATP reception was first recognized in compressed

chondrocytes. Later, it was recognized that cyclic stretching activates cilia-

mediated hedgehog signaling in chondrocytes in two-dimensional cell

culture (Thompson et al. 2014). However, an increase in mechanical strain

from a 10% to 20% magnitude (stretching with 0.33 Hz frequency) led to a

reduction in cilia length and a further inhibition of hedgehog signaling and

ADAMTS-5 synthesis. These mechanosensitive responses were shown to

occur due to the decreased activity of histone deacetylase 6 (HDAC6), the

major tubulin deacetylase. This mechanism is suggested to act as a potential

chondroprotective response, which limits cartilage degrading enzymatic

activity under mechanically stressful conditions.

Integrins are heterodimeric transmembrane proteins that mediate both cell-

cell and cell-extracellular matrix interactions (Loeser 2014). Normal adult

chondrocytes primarily express seven different integrins, namely α1β1, α3β1,

α5β1, α10β1, αVβ1, αVβ3, and αVβ5. The expression pattern of integrins changes

in osteoarthritic tissue. Cyclical pressure-induced strain can induce

23

membrane hyperpolarization in chondrocytes and signal transduction is

mediated by the mechanosensitive type α5β1 integrin (Wright et al. 1997).

Previous studies demonstrated that mechanical tension can induce changes

in type II collagen expression, proteoglycan aggrecan synthesis, MMP

synthesis and cartilage related glycosaminoglycans, such as chondroitin-6-

sulfate, hyaluronan and dermatan sulfate in chondrocytes (Carvalho et al.

1995, Honda et al. 2000, Yu et al. 2015). Many different kinds of technical

arrangements and varying origins of chondrocytes have been used to study

the effects of mechanical loading. In some studies, the synthesis of cartilage

matrix components, type II collagen and aggrecan, have increased, while the

opposite has also been described even including catabolic responses (De Witt

et al. 1984, Fukuda et al. 1997, Fujisawa et al. 1999, Huang et al. 2007, Ueki

et al. 2008, Tanimoto et al. 2010).

Stretching-induced catabolic outcomes are typically associated with

increased expression of different MMPs (e.g. MMP-1, MMP-2, MMP-3,

MMP-9, and MMP-13), proinflammatory cytokine interleukin-1β (IL-1β),

cathepsin B, tumor necrosis factor α (TNF-α) and hyaluronidases (Fujisawa

et al. 1999, Honda et al. 2000, Doi et al. 2008, Tanimoto et al. 2010).

Moreover, a 7% cyclic stretching with 10 cycles per minute was found to

induce nitric oxide (NO) production and a further decrease in proteoglycan

synthesis (Matsukawa et al. 2004). Generally, short-term (less than 24

hours) stretching experiments with less than a 10% tension have shown

greater potential for an increased production of extracellular matrix

components compared to high frequency and high magnitude stretching (De

Witt et al. 1984, Fukuda et al. 1997, Zhou et al. 2007). A constant 3% tension

with 0.25 Hz frequency for 4-24 hours significantly inhibited IL-1β mediated

pro-inflammatory gene expression, including MMP-9 and MMP-13,

inducible NO synthase, cyclooxygenase-2 (COX-2), and potentially

supported anabolic responses in rat articular chondrocytes (Madhavan et al.

2006). Both the magnitude and frequency of stretching can modify

responses in chondrocytes (Ueki et al. 2008).

The exact parameters for beneficial stretching strain are difficult to

determine since stretching can has been found to induce both anabolic and

catabolic responses in chondrocytes at the same time. In addition, even small

changes in magnitude or frequency of the strain can induce a

downregulation of extracellular matrix-specific genes (Huang et al. 2007,

Mawatari et al. 2010). Certain stretch-induced catabolic effects can be

suppressed in experimental models through a pre-treatment of IL-4 (10

ng/ml) (Doi et al. 2008). This supports the idea for a combination of

mechanical stretching and biologically active small molecules to be used in

24

tissue engineering to enhance anabolic chondrocyte responses. In contrast to

hydrostatic pressure, the role of mechanical tension in chondrogenic

differentiation has not been widely studied. This might relate to the

controversial, or only partially known, role of tension strain to maintain or

induce anabolic responses in chondrocytes.

1.8 Oxygen tension in articular cartilage

Articular cartilage is structurally organized into different zones and cartilage

tissue is avascular, therefore, synovial fluid is the main supply of oxygen for

cartilage tissue. Normal oxygen tension of synovial fluid is estimated to be

roughly 10% in human knee joints (Zhou et al. 2004). Within the cartilage

tissue itself, it has been estimated to be in the range from 1% to 10% and is

dependent upon the oxygen content of synovial fluid (Brighton and

Heppenstall 1971). However, the lowest 1% oxygen level is considered less

frequent in healthy cartilage tissue than originally thought (Zhou et al.

2004). The actual level of oxygen depends on the zone of articular cartilage

and its depth, thereby oxygen levels are highest in the surface layers (6-10%)

and smallest in the deep zone (2-3%) (Zhou et al. 2004, Gibson et al. 2008).

An estimated average oxygen tension in articular cartilage is close to 5%.

Certain inflammatory diseases, such as rheumatoid arthritis, are known to

decrease oxygen tension in articular cartilage (Lund-Olesen 1970).

Hypoxia influences to chondrocytes

Low oxygen tension in articular cartilage is normal for chondrocytes and

they are adapted to this (Grimshaw and Mason 2000). A hypoxic

environment supports the maintenance of a normal chondrocyte phenotype

and enhances extracellular matrix production in comparison to a normoxic

environment (Lafont et al. 2008, Coyle et al. 2009, Ströbel et al. 2010). The

hypoxia-induced phenotype maintenance and cartilage matrix production is

based on a hypoxia-driven balance of both anabolic and catabolic responses

(Thoms et al. 2013). In addition to maintenance and synthesis of cartilage

extracellular matrix components, low oxygen tension also induces other

responses in chondrocytes. It can induce changes in energy production and

metabolism in addition to the expression of certain growth factors and

cytokine-based pro-inflammatory mediators (Fermor et al. 2010).

Morphologically, hypoxic conditions appear to support the preservation of

the typical round morphology of chondrocytes (Gibson et al. 2008).

Glycolysis is the main energy production mechanism in chondrocytes and

these cells only consume small amounts of oxygen (Lee and Urban 1997).

Although hypoxic conditions are natural for chondrocytes, and they can

survive even in anoxic conditions for a few days, chondrocytes need oxygen

25

to avoid the anoxia-induced negative Pasteur effect to maintain both

glycolysis and extracellular matrix production (Grimshaw and Mason 2000,

Lee and Urban 1997, Gibson et al. 2008). A 5% oxygen tension has been

suggested as the most optimal condition for chondrocyte energy production

since it induces higher ATP levels and lower pAMPK levels compared to

normoxic or strongly hypoxic (1%) environments (Fermor et al. 2007,

Fermor et al. 2010). In addition, a 5% oxygen tension appears to provide

some protection against IL-1 and nitric oxide-induced autophagy.

Furthermore, 5% oxygen tension has also reported to be beneficial for

cartilage specific extracellular matrix production (Gibson et al. 2008).

In addition to responses of the mature chondrocytes to hypoxia, the

role of the hypoxic conditions for the chondrogenesis has been

studied. The topic is interesting because hypoxia-driven chondrogenic

differentiation may be used for cell-based tissue engineering. Hypoxia

can support the chondrogenic differentiation of the mesenchymal stem

cells, and PI3K/Akt/FOXO signaling route was suggested to have a

role in this differentiation process (Lee et al. 2013, Shang et al. 2014).

Hypoxia also supported the chondrogenic differentiation of human

embryonic stem cells at certain level (Koay and Athanasiou 2008).

However, the applications, which would base purely on hypoxic

differentiation are not known.

Hypoxia inducible factors 1α and 2α are the central hypoxia mediators in

chondrocytes

Hypoxia-induced responses can be mediated by different mechanisms.

Hypoxia inducible factors HIF-1α and HIF-2α have a crucial role in oxygen

tension-related homeostasis and cellular responses in chondrocytes

(Schipani et al. 2001, Pfander et al. 2006, Lafont et al. 2008). Although these

two isoforms share many structural and functional similarities, they have

divergent, factor-specific, roles (Hu et al. 2003). There is also a third

member of HIF-α family: the HIF-3α, but this isoform does not contain a C-

terminal transactivation domain similar to HIF-1α and HIF-2α, therefore, it

probably is limited in its ability to act as a transcription factor (Hara et al.

2001, Heikkilä et al. 2011). In some cases, HIF-3α has been shown to inhibit

the other HIF α-isoforms, but some observations suggest that HIF-3α acts as

a transcription factor and increases HIF target gene expressions (Hara et al.

2001, Heikkilä et al. 2011, Zhang et al. 2014, Ravenna et al. 2016). Both HIF-

1α and HIF-2α transcription factors function by forming specific dimers with

constitutively expressed aryl hydrocarbon receptor nuclear translocator 1 or

2 (HIF-β1 and HIF-β2) and induce the nuclear hypoxia response elements

26

(HREs) of hypoxia-inducible genes (Wenger and Gassmann 1997). Oxygen

regulates the activity of all HIF α-isoforms. Both HIF-1α and HIF-2α

transcription factors are normally degraded by proteasomes when oxygen

tension is high. Instead, they are not degraded under hypoxic conditions.

The oxygen-controlled degradation of HIFs is based on specific oxygen-

dependent degradation domains (ODDDs) and iron-dependent von Hippel-

Lindau tumor suppressor (pVHL) E3 ligase complex-induced ubiquitylation

(Huang et al. 1998, Maxwell et al. 1999, Jaakkola et al. 2001). The

interaction of pVHL and the oxygen-dependent domains is enzymatically

regulated by HIF-α prolyl-hydroxylase, which can induce targeting of

specific hydroxylation of the HIF-α subunit. Due to the lack of another

hydroxylatable proline on the ODDD-domain, the normal normoxic

degradation of different variants of HIF-3α is suggested to be inefficient

(Ravenna et al. 2016).

In chondrocytes, the role of HIF-1α has been primarily connected to

mediating inhibitory actions against catabolic activities, while HIF-2α is

associated with Sox9-regulated synthesis of cartilage components (Thoms et

al. 2013). Transcription factor HIF-1α maintains cell survival of

differentiated cells under hypoxic conditions. Moreover, it has a role in

chondrocyte proliferation, differentiation and growth arrest. Hypoxic

conditions increase vascular endothelial growth factor A (VEGF-A)

expression in a HIF-1α-mediated manner in chondrocytes and

chondrosarcoma cells (Lin et al. 2004).

Hypoxia-induced up-regulation of extracellular matrix gene expression

involves HIF-2α activity. This up-regulation is based both on Sox9-

dependent and -independent mechanisms (Lafont et al. 2008, Thoms et al.

2013). HIF-2α-induced Sox9-independent factors participate to define the

differentiated chondrocyte phenotype, i.e., mitogen-inducible gene 6 protein

(Mig6; also known as ERBB receptor feedback inhibitor 1) and inhibin beta

A chain (InhbA). Although many studies have recognized a hypoxia-induced

anabolic role of HIF-2α in chondrocytes, this transcription factor appears to

have more complex and context-related role than previously thought. It has

been observed to induce both catabolic genes, such as different MMPs,

aggrecanase-1 and nitric oxide synthase-2, and to induce Fas-mediated

apoptosis of chondrocytes during the osteoarthritic process (Yang et al.

2010, Ryu et al. 2012). In addition, interleukin-6 has a central role in

mediating the catabolic activity of HIF-2α in osteoarthritic degeneration

(Ryu et al. 2011). Moreover, the overexpression of HIF-2α in joint tissues has

been observed and relate to the development of rheumatoid arthritis kinds of

changes (Ryu et al. 2014).

27

Hypoxia can also up-regulate HIF-3α gene expression and it has been

connected to chondrocyte redifferentiation, although the absolute roles of

various HIF-3α splice variants in chondrocyte biology are not known

(Schrobback et al. 2012). One of the most recent studies suggested that HIF-

3α could have a role in the regulation of chondrocyte hypertrophic terminal

differentiation, but further studies are needed to fully understand this

mechanism (Markway et al. 2015).

1.9 Ras homolog gene family member A and Rho-

associated protein kinase signaling

Rho-associated protein kinases (ROCKs) belong to the AGC family of serine-

threonine kinases (Pearce et al. 2010). The two isoforms of ROCKs, namely

ROCK1 and ROCK2, are synthesized in mammals and they share 65%

identity (Nakagawa et al. 1996). Rho kinases are key downstream mediators

for RhoA (Ras homolog gene family, member A; Figure 2) (Riento and Ridley

2003). Although ROCKs have an important role in RhoA signaling, RhoA

also has other downstream mediators, such as the mammalian diaphanous

formin (mDia), protein kinase N, focal adhesion kinase, Citron kinase,

phospholipase D1, myosin light chain and Rhophilin (Amano et al. 1996,

Kimura et al. 1996, Madaule et al. 1998, Cai et al. 2001, Kloc et al. 2014).

Small GTPases are enzymes that bind and hydrolyze guanosine triphosphate

molecules (GTPs). The small Rho family GTPases RhoA, Cdc42 and Rac1 are

well-known factors that mediate different kinds of actin polymerization and

reorganization signaling in cells (Sit and Manser 2011). Various factors, such

as G-protein connected cytokines, growth factors, hormones and receptors,

regulate the activity of RhoA and induce further cellular responses. Like

normal G-proteins, the active form of RhoA is RhoA-GTP and its activity is

controlled by reciprocally affecting guanine nucleotide exchange factors and

GTPase activating factors (GAPs) (Garcia-Mata et al. 2011). Guanine

nucleotide exchange factors catalyze a release of guanosine diphosphate

(GDP) and allow the replacement of GDP with GTP (Figure 2).

Controversially, GAPs induce hydrolysis of GTP to form inactive GDP. A

guanosine nucleotide dissociation inhibitor (GDI) is a third regulator and

participates in RhoA activation by binding to the GDP form of small GTPases

to suppress their activity. Moreover, GDI can affect the cellular localization

of small GTPases and also prevent their activity. A previous fibroblast

migration study indicated a complex spatio-temporal nature of RhoA

signaling route, which is based on crosstalk between Rho GTPases and

GTPase activities to regulate specific effector pathways (Martin et al. 2016).

However, the rapid kinetics of signaling makes it challenging to decipher all

of the components of the pathway and their specific roles.

28

Figure 2. The schematic figure of RhoA signaling has been build up from

previously published data of RhoA and ROCK mediated signaling pathways

(Watts et al. 2006, Garcia-Mata et al. 2011, Shum et al. 2011 and Kloc et al.

2014).

RhoA/ROCK signaling maintain chondrocyte differentiation

Common RhoA-mediated responses are linked to a reorganization of the

cellular cytoskeleton, the formation of actin stress fibers, actin

polymerization, cellular proliferation, cytokinesis, phagocytosis, and

vesicular transport in addition to the Rac1-coordinated formation

lamellipodia (Guilluy et al. 2011, Kloc et al. 2014). ROCKs have a crucial role

to maintain cellular morphology, which is defined by the organization of

actin cytoskeleton in chondrocytes and other cell types (Woods et al. 2005,

Sit and Manser 2011). Mechanical strains, such as hydrostatic pressure,

compression and osmotic pressure, are known to induce a rapid remodeling

of actin cytoskeleton in chondrocytes and this reorganization is linked to

changes in gene expression (Parkkinen et al. 1995, Chao et al. 2006, Knight

et al. 2006, Haudenschild et al. 2008). Actin remodeling occurs via a ROCK

downstream effector, LIM kinase, which phosphorylates cofilin (Maekawa et

al. 1999). The active and phosphorylated cofilin subsequently depolymerizes

actin filaments. RhoA/ROCK signaling is known to suppress hypertrophic

chondrocyte differentiation and a selective inhibition of this pathway

induces the expression of type X collagen (Wang et al. 2004). In

chondrogenic ATDC5 cells, the overexpression of Rac1 and Cdc42 induced

chondrocyte differentiation and expression of hypertrophic markers (Wang

and Beier 2005). There is an antagonistic signaling cascade between

RhoA/ROCK and Rac1/Cdc42/p38 modules. Inhibition of RhoA/ROCK

29

signaling induces the expression of hypertrophic markers, but it also affects

actin organization and increases gene expression of Sox9 transcription

factor, thereby inducing the expression of cartilage-specific extracellular

matrix genes in primary monolayer cultures (Woods et al. 2005, Woods and

Beier 2006). The selective ROCK inhibitor Y-27632 inhibited RhoA/ROCK

signaling and conserved a chondrocytic phenotype of cultured articular

chondrocytes (Matsumoto et al. 2012, Furumatsu et al. 2014). This molecule

inhibits both ROCK1 and ROCK2. Importantly, the Ki values for Y-27632 are

at least ten times less for ROCK1 and 2 than unspecific kinase targets

(Ishizaki et al. 2000).

RhoA/ROCK signaling has a central role in managing chondrogenesis and

conserving a chondrocyte phenotype. Osteoarthritis is known to increase the

expression of TGF-α and this has been linked to both RhoA/ROCK and

MEK/ERK signaling (Appleton et al. 2010). These signaling routes can be

considered potential targets to suppress osteoarthritic cartilage degradation.

The loss of RhoA activity and related depolymerization of actin filament

structures can induce transcriptional activities. Actin depolymerization

induces Sox9 gene expression via protein kinase A (PKA) signaling (Kumar

and Lassar 2009). In addition to PKA, ROCKs can directly phosphorylate

Sox9 in a LIM kinase-independent way at Ser181 and enhance the

transcriptional activity of Sox9 (Kumar and Lassar 2009, Haudenschild et al.

2010). It has been suggested that Sox9 may take part in its own gene

expression regulation in differentiated chondrocytes by a positive

autoregulatory loop mechanism. Moreover, it is suggested that ROCK- and

mDia-mediated RhoA signaling inhibits the activity of this autoregulatory

loop of Sox9 gene expression. Thereby, the inhibition of RhoA signaling can

induce Sox9-dependent chondrocyte differentiation and cartilage matrix

production. Sox9 is the main transcription factor for cartilage extracellular

matrix-specific genes, such as type II collagen and aggrecan (Bell et al. 1997,

Lefebvre and Dvir-Ginzberg 2017). The Sox9 transcription factor has two co-

activators, namely Sox5 and Sox6. This trio supports chondrogenesis and

also induces the expression of S100A1 and S100B, which appear to suppress

the terminal differentiation of chondrocytes (Saito et al. 2007). Previously,

S100A1 and S100B expression patterns have been suggested as potential

markers of human articular chondrocyte differentiation status (Diaz-Romero

et al. 2014).

30

2. Aims of the thesis

Currently, no pharmacological-based thearapy is available to cure cartilage

disorders. Although minor damages can be treated using microfracture

surgery and autologous cellular repair techniques, their ability to provide

native hyaline-like repair tissue is limited. Endoprosthesis surgeries are

reserved to treat severe and irreparable damage. Novel regenerative

medicine techniques are actively developed to improve currently available

treatment options. These applications require both a comprehensive

understanding of chondrogenic differentiation and the ability to maintain a

chondrocyte phenotype in culture. Mechanical strains and low oxygen

conditions both belong to the normal environment of chondrocytes.

RhoA/ROCK signaling has been demonstrated to play a crucial role in

chondrocyte differentiation status.

The aims of this thesis were to study the following topics

1. Mechanical stretching induced phosphoproteomic responses in

chondrocytic cells (paper I)

2. The effects of cartilage matrix supporting Rho-kinase inhibitor Y-27632

in fibroblast cells (paper II)

3. Long-term hypoxia induced protein responses in chondrocytic cells

(paper III)

4. The long-term maintenance of chondrocytic phenotype in hypoxic and

Rho-kinase inhibited conditions (paper IV)

31

3. Materials and methods

Human chondrosarcoma 2/8 cells (HCS-2/8) and human foreskin

fibroblasts were used in this thesis. HCS-2/8 cells were originally isolated

and characterized in Professor Masahiru Takigawa’s research group in

Okayama University (Takigawa et al. 1989). Fibroblasts (HFF-1, SCRC-

1041™) were purchased from ATCC®. HCS-2/8 cells were used in studies I,

III and IV and human fibroblasts in study number II.

3.1 Cyclic cell stretching (paper I)

The cyclic cell stretching experiments were performed using a High Strain

Cell Stretching Apparatus (Figure 3, Neidlinger-Wilke et al. 1994). The HCS-

2/8 cells were grown on silicone stretching plates (Elastosil 601-Me silicone;

Wacker Chemie) coated with 10 µg/ml poly-D-lysine for 72 hours before the

start of the experiment in order to allow sufficient adhesion of the cells.

Control cells were cultured on similar plates, but not exposed to stretching.

Figure 3. High Strain Cell Stretching Apparatus.

Cyclic biaxial 8% surface stretch was generated at a frequency of 1 Hz. The

stretching periods were either 2 hours for one day or 2 hours per day for a

total of three days. The stretching strain was modified from the previously

published study (Karjalainen et al. 2003). After completion of the stretching

experiments, the cells were harvested from the silicone stretching plates.

HEPES buffer (10 mM) was used for washing of the cell samples before

phosphoproteomic analysis. Chondrosarcoma cells were cultured in HyQ®

32

MEM Alpha modification (including L-glutamine, ribonucleosides and

deoxyribonucleosides) supplemented with 10% fetal bovine serum (FBS),

100 U/ml penicillin and 100 μg/ml streptomycin. Before the start of the

stretching experiments, the medium was removed and replaced by HyQ®

MEM Alpha modification supplemented with 1% FBS, 100 U/ml penicillin

and 100 μg/ml streptomycin. Culturing and stretching experiments were

performed in a humidified normoxic (5% CO2) environment at 37oC.

3.2 Hypoxic cell cultures (paper III, IV)

Hypoxic cell cultures were maintained in a humidified 5% oxygen

atmosphere using a Galaxy R incubator (RS Biotech Laboratory Equipment

Ltd.). The 5% hypoxic environment was used to model the average oxygen

strain in normal articular cartilage tissue (Zhou et al. 2004, Gibson et al.

2008). Fresh culture media was equilibrated to 5% oxygen conditions for 24

hours prior to its addition to hypoxic cultures. Culturing periods for

chondrosarcoma cells in hypoxic environment were 2 days, 7 days and 28

days. HCS-2/8 cells were cultured in high glucose (4.5 g/l) DMEM with 10%

FBS, 100 U/ml penicillin, 100 µg/ml streptomycin, 2 mM L-glutamine and

50 µg/ml 2-phospho-L-ascorbic acid trisodium salt. Temperature was

maintained at 37oC.

3.3 Rho-kinase inhibitor Y-27632 treatments (paper II, IV)

RhoA/ROCK signaling was inhibited with the selective Rho-kinase inhibitor

Y-27632. Solid Y-27632 was dissolved in phosphate-buffered saline (PBS)

solution and sterile-filtered before its use. The final concentration of Y-

27632 in culture media was 10 µM for all ROCK inhibition experiments. This

final concentration was chosen based of previous studies (Woods and Beier

2006, Matsumoto et al. 2012, Furumatsu et al. 2014). Moreover, a 10 µM Y-

27632 concentration was reported to result in the maximal inhibition of

ROCKs with a minimal loss of kinase specificity (Sahai et al. 1999, Zhou et al.

2010). Fresh medium was changed on every third day in culture. Human

fibroblast cells were grown in a low glucose (1.0 g/l) DMEM supplemented

with 10% FBS, 100 U/ml penicillin, 100 µg/ml streptomycin, 2 mM L-

glutamine, and 50 µg/ml 2-phospho-L-ascorbic acid trisodium salt. Human

chondrosarcoma cells were cultured in high glucose (4.5 g/l) DMEM

containing identical supplements to the low glucose medium used to cultre

fibroblasts. Cells were cultured either in a humidified incubator at normoxia

or at a 5% oxygen strain at 37°C temperature. Fibroblasts were cultured from

1 to 3 days in Rho-kinase inhibited conditions and HCS-2/8 cells 28 days.

33

3.4 Phosphoprotein enrichment Cells were lysed using the lysis buffer provided in the Pro-Q Diamond

Phosphoprotein Enrichment Kit (Molecular Probes) (paper I) and protein

concentrations were determined using a Bradford assay (Bradford 1976). A

total of one milligram per sample of total protein was applied to enrichment

columns and phosphoprotein enrichment was performed according to the

manufacturer’s instructions. The eluted phosphoprotein fractions were

pooled and concentrated with Vivaspin® filtration concentrators.

3.5 Two-dimensional gel electrophoresis and mass

spectrometric protein identification

Concentrated phosphoprotein samples were purified using the methanol-

chloroform precipitation method (Wessel and Flügge 1984). Dried protein

pellets were dissolved in rehydration buffer (8 M urea, 2% immobilized pH

gradient (IPG) buffer 3-10 NL, 0.5% Triton-X 100, 0.5% Biolyte 3-10, 0.2%

DTT and Bromophenol Blue stain). When the rehydrated proteins were

absorbed by the IPG strip gel material, isoelectric focusing was performed at

a total of 17,000 Volt-hours. Isoelectrically focused samples were reduced by

equilibration solution I [6 M urea, 50 mg/ml dithiothreitol, 0.06 M Tris-HCl

(pH 6.8), 10% glycerol, 2% SDS, Bromophenol Blue stain] and alkylated by

equilibration solution II [6 M urea, 45 mg/ml iodoacetamide, 0.06 M Tris-

HCl (pH 6.8), 10% glycerol, 2% SDS, Bromophenol Blue stain] prior to

second dimension electrophoretic protein separation on 12% SDS-

polyacrylamide gels (PAGE). Both Coomassie Brilliant Blue (CBB) and silver

nitrate staining were performed on 2D SDS-PAGE gels (Shevchenko et al.

1996). The CBB-stained PAGE gels were scanned and protein abundancies of

selected spots were compared using ImageJ software (National Institute of

Health). Protein spots of interest were excised from 2D gels and in-gel

digested using 1 µg/µl mass spectrometry grade trypsin (Promega) with

slight modifications to a previously published protocol (Shevchenko et al.

2007). The digested peptides were freeze-dried and reconstituted in 0.1%

trifluoroacetic acid (TFA). The digested peptides were freeze-dried and

reconstituted in 0.1% trifluoroacetic acid (TFA).

Ultimate/Famos capillary LC system (LC Packings) and reverse-phase

column (PepMap C18 precolumn, 300 mm i.d. 1 mm; Dionex) was used for

desalting and purification of trypsin-digested peptide samples. The peptide

separation was made using PepMap C18 analytical column (3 µm, 75 µm i.d.,

50 mm; Dionex), and the eluation was carried out using a linear gradient of

acetonitrile. This linear gradient of acetonitrile started from 0.1% formic

acid/5% acetonitrile rising to 30% of 0.1% formic acid/95% acetonitrile over

34

35 minutes. Finally, the gradient was increased to 100% of 0.1% formic

acid/95% acetonitrile for 40 minutes. The eluent flow rate was set to 200

nl/min, and the total time for one run was 80 minutes. The LC system was

connected to a nano-ESI ion source (MDS Sciex) of the QSTAR XL hybrid

quadrupole TOF instrument (Applied Biosystems). The mass spectra were

recorded in a positive ion mode using information dependent acquisition

(IDA) method. Tandem mass spectrometry data (MS/MS) was obtained for

sequence tag-approach (Mann and Wilm 1994). For each run, one second

time-of-flight (TOF) MS survey scans were recorded for mass range m/z

400–2000 followed by a four second MS/MS scans for the two most intense

2+ and 3+ charged ions. The voltage of the electrospray needle voltage was

set to 2.3-2.4 kV. Nitrogen was used as the curtain and collision gas.

Monoisotopic peaks of 2+ and 3+ charged ions were calibrated with trypsin-

digested myoglobin and adrenocorticotropic hormone clip. The spectral data

was automatically processed with Analyst® QS software (Applied

Biosystems) and database searches were performed manually using

MASCOTSearch script (v1.6b13) on-line at www.matrixscience.com (Perkins

et al. 1999). The reliability of the mass spectral protein identifications were

estimated with Mascot score parameter, which was automatically calculated

from the mass values by Mascot search algorithms. The sequence coverages

of the identified proteins varied from 7 to 44%. Some protein identifications

were performed with MALDI-TOF mass spectrometry as a commercial

service by Alphalyse A/S.

3.6 Western blot analyses

Harvested cells were washed with PBS and lysed in RIPA buffer (1x PBS, 1%

Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 0.3% aprotinin, 100

µg/ml PMSF, 1 mM sodium orthovanadate) and protein concentrations were

determined using a Bradford assay (Bradford 1976) (paper I). Equal amounts

of each protein sample (15 µg) were denatured by boiling for 5 minutes with

electrophoresis sample buffer and then loaded on 10% SDS-PAGE gels.

Electrophoretically separated proteins were electrotransferred to Protran®

Nitrocellulose Transfer Membranes (Whatman) and the membranes were

blocked with either skimmed milk or bovine serum albumin. Blocked

membranes were incubated for 1 hour at room temperature, or overnight at

4ºC, with specific primary antibody (see Table 1 below). Glyceraldehyde 3-

phosphate dehydrogenase (GAPDH) was used as loading control.

Horseradish peroxidase (HRP)-labeled secondary antibodies for primary

antibody detection were manufactured by Santa Cruz Biotechnology. The

membranes were incubated with secondary antibody for 1 hour at room

temperature and developed after washing steps with SuperSignal West Pico

Chemiluminescent substrates (Pierce). CL-XPosure films (Pierce) were used

35

for detection and densitometric analyses of the proteins were performed

using ImageJ software (National Institute of Health).

Table 1. The primary antibodies for Western blot analysis.

Antibody Dilution Manufacturer

anti-MAP kinase (ERK1 + ERK2) 1:1000 Zymed

eEF1D (1-90) 1:1000 Abnova

EF-2 (C-14) 1:4000 Santa Cruz Biotechnology

GAPDH (horseradish peroxidase conjugated) 1:5000 Abcam

p-Akt1 (Ser-473) 1:200 Santa Cruz Biotechnology

p-PI 3-kinase p85α (Tyr-508) 1:250 Santa Cruz Biotechnology

p-ERK (E-4) 1:1000 Santa Cruz Biotechnology

3.7 Time-lapse cell monitoring

Time-lapse cell monitoring was performed with the Cell-IQ model v. 2

microscope system (CM Technologies) both for Y-27632-exposed fibroblasts

(paper II) and Y-27632 and/or hypoxia-exposed HCS-2/8 cells (papers III,

IV). Cell monitoring was based on automated phase contrast microscopy

using a tenfold magnification. The width of one monitoring grid was 974 µm

with a height of 732 µm. This monitoring technique was applied to observe

changes in cellular shapes, the lengths of actin filament-based filopodia and

structures, and cellular proliferation. Additionally, monitoring was also used

to evaluate scratch-wound assays and to quantify cellular migration. Human

primary fibroblasts were seeded at a density of 50,000 cells and the slowly-

dividing chondrosarcoma cells at 200,000 cells per a well in 6-well-plates.

Cells were imaged every 15 minutes with a total monitoring time of 72 hours

for cellular morphology and proliferation analysis. The scratch wound assays

were performed when monolayer cultures reached at least 90% confluency.

Cross-directional wound scratches were made to monolayer cultures by the

use of a narrow pipette tip. Monitoring intervals were every 15 minutes for

scratch-wound assays with a total length of 36 hours for fibroblasts and 60

hours for HCS-2/8 cells. When Rho-kinase inhibitor Y-27632 exposure was

studied in fibroblasts and HCS-2/8 cells, a 10 µM final concentration was

used and the medium was not changed during any time-lapse monitoring

experiment. The normoxic atmosphere was studied with both fibroblasts and

HCS-2/8 cells, while a hypoxic atmosphere was only evaluated with HCS-

2/8 cells. The normoxia atmosphere (5% CO2, 19% O2 and 76% N2) and the

hypoxic atmosphere (5% CO2, 5% O2 and 90% N2) were maintained with

premixed gases (Aga). The temperature was kept at 37°C at all times. The

36

data analysis for time-lapse imaging was performed using the Cell-IQ

analyser 4 Pro-write software (AN4.2.1 HW, CM Technologies). The

automatic cell recognition-related random errors of absolute cell number

determinations were corrected manually. The data from scratch-wound

assays were analyzed manually using the Cell-IQ analyser 4 Pro-write

software.

3.8 Immunofluorescence imaging

Cells were fixed with 4% w/v paraformaldehyde for immunofluorescence

imaging (paper II). Fixed cells were washed with PBS and permeabilized

with 0.1% Triton-X 100. Permeabilized cells were washed with PBS and

incubated with the murine monoclonal anti-vinculin (1:1000; Sigma-

Aldrich), the mouse monoclonal anti-integrins α2 (1:200, Millipore), β1

(1:200; Millipore), α5β3 (1:200; Millipore) primary antibodies for 2 hours.

The fluorescein isothiocyanatelabeled goat anti-mouse secondary antibody

(1:200; Chemicon) was incubated for 1 hour. Actin filaments were stained

with Alexa Fluor 594-conjugated phalloidin (Molecular Probes) for 30

minutes. The nuclei were stained with 4',6-diamidino-2-phenylindole

(DAPI) for 20 minutes at 37oC. Cells and immunolabeled cell structures were

visualized using an Olympus IX-70 fluorescence microscope.

3.9 Mass spectrometric quantification with Orbitrap

Elite

Proteins were extracted by lysing the cells in 200 µl of lysis buffer (100 mM

ammonium bicarbonate, 8 M urea, 0.1% RapiGest) and sonication for 5

minutes (paper II). Protein concentrations were determined using a BCA

assay (Thermo Fischer Scientific). Proteins were reduced with dithiothreitol

and alkylated with iodoacetamide prior to trypsin-digestion in 1 M urea

solution. The tryptic peptide digests were quenched using 10% TFA and

subsequently concentrated and purified by C18-reverse phase columns

(Varjosalo et al. 2013). The eluation buffer was 90% acetonitrile with 0.1%

TFA. Dried peptides were reconstituted in a 2% acetonitrile/0.1% TFA

solution, separated chromatographically by nLCII nanoflow HPLC system

(Thermo Scientific) and analyzed by Orbitrap Elite electron-transfer

dissociation mass spectrometer (Thermo Scientific). The mass spectral

analyses were performed in a data-dependent acquisition mode using a top

20 CID method. Dynamic exclusion time for the selected ions was 30 s.

There were not used lock masses. The maximal allowed ion accumulation

time on the Orbitrap Elite electron-transfer dissociation in CID mode was

100 ms for MSn in the ion trap and 200 ms in the Fourier-transform MS.

Intact peptides were detected in the Orbitrap at 60,000 resolution. Proteome

37

Discover software (Thermo Scientific) was used for peak extraction and

further protein identifications. SEQUEST search engine was used to search

the calibrated peak files from UniprotKB/SwissProt database

(www.uniprot.org). The error tolerances on precursor and fragment ions

were 15 ppm and ±0.6 Da, respectively. One missed cleavage was allowed.

The label-free protein quantification was based on a spectral counting

method, which assumes that protein abundances correlate with the number

of peptide fragmentation events (MacCoss et al. 2003, Liu et al. 2004).

3.10 Mass spectrometric protein quantification with Synapt G2-Si HDMS

For studies III and IV, protein extractions and trypsin-digestions for Synapt

G2-Si HDMS analyses were based mainly on previously published

procedures (Masuda et al. 2008). After trypsin-digestions, peptides were

cleaned-up using C18 STAGE-tips (Rappsilber et al. 2003). Peptide

concentrations were determined using a micro BCA kit (Thermo Fischer

Scientific) and 600 ng of each sample were loaded on the HSS T3 C18

analytical column (75 μm i.d. × 200 mm, 1.8 μm particles; Waters). The

peptides were separated using a linear 108 minute gradient of 5–41% solvent

B (3:1 acetonitrile/2-propanol) balanced with 0.1% aqueous formic acid

(solvent A) at a flow rate of 295 nl/min. The eluate was analyzed with a

nano-ESI equipped Synapt™ G2-Si HDMS mass spectrometer (Waters)

operating in resolution mode. All data were collected using ion-mobility MSE

with a scan-time of 0.5 sec. and mass-corrected using Glu-fibrinopeptide B

and Leucine Enkephalin as reference peptides. Data analysis was performed

with ProgenesisQI (Nonlinear Dynamics). Peptide identification was based

on built-in MSE search option, which employed a false discovery rate less

than 1% with a mass error cut-off of 10 ppm. Two missed cleavages were

allowed and carbamidomethylated cysteines were used as fixed

modifications. Methionine oxidation and asparagine and glutamine

deamidation were set as variable modifications. The relative protein

abundances were calculated with the Hi-N method of the ProgenesisQI

software.

3.11 Bioinformatic protein analysis Qualitative proteome annotations (paper III) were performed using DAVID

Bioinformatics resources 6.8 (National Institute of Allergy and Infectious

Diseases (NIAID), NIH) and Reactome Pathway Database (Huang et al.

2009a, Huang et al. 2009b, Croft et al. 2014, Fabregat et al. 2016). The

protein pathways analyses for the mass spectrometric protein screening data

(papers II, III, IV) were performed with the Ingenuity Pathway Analysis IPA

38

application (Ingenuity Systems). For pathway analyses, the cut-off value for

protein fold changes was set to 1.3 fold for both up- and downregulations.

Analysis filter was set to allow experimentally observed relationships, and all

tissues and primary cells were selected for the analyses.

3.12 Enzyme linked immunosorbent assay (ELISA) of

type II collagen The concentrations of secreted type II collagen were determined from the

culture media using a commercial ELISA Type II Collagen Detection Kit

(Chondrex Inc.) (papers III, IV). The medium samples (50 µl) were diluted

1:1 in dilution buffer provided by the ELISA kit. The analysis was performed

according to the manufacturer's instructions. Absorbances were determined

at 490 nm using a Vmax kinetic microplate reader (Molecular Devices) after

a one-hour incubation in o-phenylenediamine solution.

3.13 Dimethylmethylene Blue assay (DMMB) for sulfated glycosaminoglycans

Sulfated glycosaminoglycans (sGAGs) were quantified from culture medium

with the dimethylmethylene blue (DMMB) assay (papers III, IV). The assay

was modified from the original protocol (Farndale et al. 1986). Culture

medium samples (75 µl) were mixed with 250 µl of DMMB reagent in the

wells of a 96 well plate. The absorbances were immediately determined at

535 nm using a Vmax kinetic microplate reader. Shark chondroitin sulfate

was used as a standard and these samples were diluted in fresh culture

medium. The DMMB assay was linear in a range from 0 to 5.77 µg/ml (R2 ≥

0.97). Background noise from the medium was taken into consideration, and

the detection limit of the analyte (LOD) was determined on the basis of the

limit of blank (LOB) (Armbruster and Pry 2008). Both five independent

blank samples and the low concentration samples with total of 15 replicates

were used for LOB and LOD determination. The arbitrary limit of

quantification (LOQ) was not stated for this assay. All the compared sGAG

concentrations were at least three times higher than the LOD, which was

0.35 µg/ml in this spectrophotometric assay.

3.14 qRT-PCR analysis

The relative gene expression of target genes were analyzed using quantitative

polymerase chain reaction (qRT-PCR) analyses (papers II, III, IV). Total

RNA was extracted with TRI Reagent, and after the purification steps, 1 µg of

each RNA sample was converted into cDNA by using Thermo Scientific

Verso SYBR Green 2-Step qRT-PCR Kit. The qRT-PCR reactions were

39

performed either using a LightCycler 480® (Roche Diagnostics) or a CFX

Connect Real-Time System (Bio-Rad), and the master mixtures used were

either LightCycler 480® SYBR Green I Master mixture (Roche) or

SSoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad). The primers

(see Table 2) were purchased from Oligomer and Thermo Fisher. The RT-

PCR reaction conditions and cycle numbers were optimized for each primer

pair. Specific amplification efficiencies for each primer pair were determined

from the slopes of standard curves and the efficiencies only within the range

of 90–110% were accepted. The relative gene expression results have been

calculated using the Pfaffl-method (Pfaffl 2001). The specificities of PCR

products were determined by post-PCR melting curve analysis and by

agarose gel electrophoresis.

Table 2. The RT-PCR primers.

Gene Forward primer (5'→3') Reverse primer (5'→3')

ACAN CACTGTTACCGCCACTTCCC AACATCATTCCACTCGCCT

Col1A1 CAGCCGCTTCACCTACAGC TTTTGTATTCAATCACTGTCTTGCC

Col1A2 GGCAATAGCAGGTTCACGTACA CGATAACAGTCTTGCCCCACTT

Col2A1 AAGGTCATGCTGGTCTTGCT GACCCTGTTCACCTTTTCCA

RPLP0 AGATGCAGCAGATCCGCAT GTGGTGATACCTAAAGCCTG

S100A1 GCTCTGAGCTGGAGACGGCG GCCACTGTGAGAGCAGCCACA

S100A16 CAGGGAGATGTCAGACTGCTACAC CATCAGGCCAGTGCCTGGAA

S100B CCGAACTGAAGGAGCTCATC AGAACTCGTGGCAGGCAGTA

SOX9 GACTTCCGCGACGTGGAC GTTGGGCGGCAGGTACTG

VEGFA AGGAGGAGGGCAGAATCATCA CTCGATTGGATGGCAGTAGCT

VCAN CAAGCATCCTGTCTCACGAA CAACGGAAGTCATGCTCAAA

3.15 Statistical analysis

One-way analysis of variance (ANOVA) tests were performed for time-lapse

imaging data. One-way ANOVA with Fisher’s Least Significant Difference

post-hoc test was used for the qRT-PCR data analysis. Student’s t-test was

used for the paired data analysis of ELISA and DMMB results. The statistical

comparisons between corresponding protein samples and controls were

tested with a Student’s t-test (paper II). The statistical significance of the

mass spectrometry-based protein quantifications (papers III, IV) were

determined from the normalized arcsinh transformed data with one-way

ANOVA tests with ProgenesisQI software (Nonlinear Dynamics). The p-

values equal or less than 0.05 were considered significant. All experiments

were performed at least three times independently.

40

4. Results

4.1 Cyclic stretching induced phosphoproteomic changes in HCS-2/8 cells (paper I)

Human chondrosarcoma 2/8 cells were exposed to a cyclic 8% tension at a 1

Hz frequency for 2 hours per day during a three-day period. Cells were

immediately harvested for Western blot analysis after the end of the last

cyclic stretch experiment on day three. The stretching strain induced

phosphorylation of Extracellular signal-regulated protein kinases 1 and 2

(Erk1/2) (Fig. 1, paper I). The induction of phosphorylated Erk1/2 was

observed at all time points evaluated. The phosphorylation states of Akt

serine/threonine kinase 1 (p-Akt1) or Phosphoinositide-3-kinase (p-PI3K)

were found not to change in this study. When the stretching experiment was

performed only once and phosphorylated proteins were screened by

proteomics, changes in the expression levels of four proteins were observed

(Fig. 3., Table 1, paper I). The intensities of the eukaryotic translation

elongation factor 1 delta isoform 2 (eEF1D), moesin and prolyl-3-

hydroxylase 1 (leprecan) protein spots were increased and the intensity of

eukaryotic translation elongation factor 1 beta 2 (eEF1B) decreased. These

proteins were not previously known to be sensitive to mechanical stretching,

although moesin connects with ezrin and radixin proteins and cellular actin

filaments to the plasma membrane. In addition to these differentially

expressed proteins, we identified 15 other abundantly expressed

phosphoproteins in HCS-2/8 cells (Fig. 2., Table 1, paper I). Notably, four of

these were different protein disulfide isomerases, their precursors or

isoforms. All of the above mentioned proteins identified were statistically

significant compared to control conditions. Despite the phosphoprotein

enrichment strategy, the exact phosphorylation sites on each protein could

not be identified by 2D electrophoresis or further in-gel digestions and MS

protein identification.

4.2 Effects of Rho-kinase inhibitor Y-27632 to fibroblasts (paper II)

Proteomic analysis revealed that two days of exposure to the Rho-kinase

inhibitor, Y-27632, produced changes in 56 different proteins in human

fibroblasts (Fig. 1., paper II). A total of 39 proteins were up-regulated and 17

were down-regulated when a cut-off was set to a ±1.3 fold change. A

bioinformatic analysis of proteomic data using an IPA® pathway analysis

determined that the changes in protein expression were connected to

networks related to cellular assembly and organization, cellular morphology

41

and cellular function and maintenance (Fig. 2, paper II). Additionally, the

pathway analysis suggested an increase in cell proliferation based upon the

the expression profiles of annexin 2, calpain proteins, 14-3-3 protein

zeta/delta, eukaryotic translation initiation factor 3 and 6, vinculin, ezrin

and fibronectin. Altogether, the protein pathway analysis suggested that

Rho-kinase inhibition produces different types of functional responses in

fibroblasts.

These functional responses, including cell morphology, proliferation, actin

filament polymerization and migration were studied using time-lapse

imaging. Short-term exposure to 10 µM concentration of the Rho-kinase

inhibitor Y-27632 produced a transient, up to two-fold, increase in cellular

proliferation during the initial 6 hours of treatment. (Fig. 3 and 4A, paper

II). A depolymerization of actin filaments was inhibited and, thereby

validated the inhibition of this RhoA/ROCK pathway-related response by Y-

27632 in fibroblasts. The average length of actin filament networks per cell

was measured and the dynamic nature of actin filament polymerization and

depolymerization was described as the relative rate of cellular protrusion

formation/destruction (µm/h) (Fig. 4B and 4C, paper II). The largest

increase in the lengths of the protrusions induced by Y-27632 was observed

after 14 hours of Rho-kinase inhibition. At 14 hours, the average length per

cell was 105.9 ± 42.5 µm compared to 20.3 ± 6.3 µm in untreated controls

(mean ± 95% CI). The maximal difference between the average lengths of the

protrusions was over fivefold. After this maximal effect, the average length

slightly decreased and stabilized to around 80 µm/cell after 45 hours of

treatment. The average lengths in the control cells remained in the range of

20-25 µm/cell starting from 8 hours through the end of the experiment.

Scratch-wound assays, aimed to determine effects on cellular migration,

revealed that Y-27632 significantly increased the lateral migration of

fibroblasts. Rho-kinase inhibition produced a recovery of over 70% the

original wound area compared to less than 30% in untreated controls (Fig.

5A and 5B, paper II). Y-27632-treated cells reached close to confluency in 25

hours, whereas untreated cells took up to 36 hours. By comparing cell layer

filling rates (mm2/h) we determined that the Y-27632 effect on wound filling

was the fastest immediately after the addion of inhibitor to cell cultures (Fig.

5C, paper II). Untreated control cells reached their fastest wound filling rates

between 15 to 18 hours.

Filamentous actin was labelled with fluorescently-tagged phalloidin and both

long filaments and filamentous network structures were observed using

time-lapse imaging. Phalloidin staining of actin confirmed both the

differential orientation and inhibited depolymerization of filamentous actin

(Fig. 6A-B, 6E-F, paper II) by Y-27632. Immunofluorescence staining was

42

used to visualize the localization of vinculin and integrins α2, β1 and α5β3.

Vinculin-associated focal adhesion plaques were abundantly expressed in

control fibroblasts, but were almost entirely absent from Y-27632-treated

cells (Fig. 6C-D, 6G-H, paper II). The lack of focal adhesion plaques supports

the observation that Y-27632 increased the rate of cellular migration. Kinase

inhibition did not produce any changes in the expression or localization of

integrins (Figure 4).

Figure 4. Immunofluorescence visualization of integrins α2 (row A),

β1 (row B) and α5β3 (row C) in fibroblast cells. Scale bar 25 µm.

Quantitative RT-PCR analysis was performed to monitor phenotype-specific

gene expression in fibroblasts. The expression of the chondrocytic

phenotype-associated Sox9 transcription factor was decreased by 30%, when

fibroblasts were exposed to 10 µM Y-27632 for 48 hours (Fig. 7A, paper II).

Y-27632 treatment appeared to induce an increase in aggrecan gene

expression, but due to a high variability, statistical significance was not

reached (Fig. 7B, paper II). Basal expression levels of aggrecan mRNA was

low, as is to be expected in normal control fibroblasts. Type I collagen gene

expression (procollagen α2(I) chain) remained stable during kinase

inhibition and indicates a constant fibroblast phenotype (Fig. 7C, paper II).

Versican gene expression did not significantly change upon Y-27632

exposure (Fig. 7D, paper II).

43

4.3 Hypoxia-induced responses in the proteome of HCS-2/8 cells (paper III)

The main aim of the third paper was to evaluate protein responses produced

by a long-term (28 days) culturing period in a hypoxic environment. A

hypoxic environment is normal for chondrocytes. Although the oxygen strain

in articular cartilage is, on average, around 5%, many cell-based chondrocyte

studies are performed in normoxic, 19% oxygen tension. A total of 1453

differentially expressed proteins were identified in HCS-2/8 cells. A DAVID

Bioinformatics Resources 6.8 data analysis recognized 1438 of the identified

proteins. Functional annotations were performed to reveal information and

to divide the proteins in different cell organs and functional groups (Fig. 1

paper III). The majority of the identified proteins were associated to

metabolic activities, gene expression and signal transduction. Proteomic

analysis revealed 44 differentially synthetized proteins in a hypoxic

environment compared to normoxia. The cut-off to reach a significant fold

change was set to ±1.3. A total of 16 proteins were up-regulated and 28

proteins were down-regulated at hypoxia (Supplementary Table 2, paper

III). Fifteen with the greatest up-regulation or down-regulation are

presented in Figure 2, paper III. A long-term exposure to a 5% oxygen strain

revealed several hypoxia-associated proteins that have not previously been

connected to hypoxic conditions in chondrocytic cells (Table 1, paper III).

Protein S100-P had the highest fold change of the novel hypoxia-sensitive

findings. Hypoxia did not significantly change other S100 proteins. Many

S100 proteins are known to be involved in cartilage- and chondrocyte-

related functions (Yammani 2012). Therefore, we performed an additional

quantitative analysis that revealed the relative abundances of nine additional

S100 proteins in HCS-2/8 cells (Fig. 4., paper III). Notably, S100-A8 and

S100-A9 proteins were not detected in HCS-2/8 cells although these

proteins have been specifically connected to hypertrophic differentiation and

osteoarthritic cartilage degradation processes in chondrocytes (Yammani

2012).

In addition to these novel findings, we recognized several hypoxia-sensitive

proteins identified in previous studies. This group of previously recognized

proteins, up-regulated at hypoxia, included NADH dehydrogenase

[ubiquinone] 1 alpha subcomplex subunit 4-like 2, prolyl 4-hydroxylase

subunit alpha-1, protein NDRG1, macrophage migration inhibitory factor, L-

lactate dehydrogenase A chain, glycogen phosphorylase, prothymosin alpha,

thioredoxin reductase 1 (cytoplasmic), BAG family molecular chaperone

regulator 2, thioredoxin (mitochondrial), sequestosome-1, tumor necrosis

factor receptor superfamily member 1B, epoxide hydrolase 1. The

identification of these proteins validated the hypoxic exposure to HCS-2/8

44

cells. A protein pathway analysis was performed using the IPA® analysis

software. This analysis suggested that hypoxia-induced protein responses

were potentially related to cellular movement, hematological system

development and function, and humoral immune response. The protein

network depicting 19 related focus molecules is presented in Figure 3, paper

III. The additional networks suggested by IPA® pathway analysis had a

smaller number of focus molecules and were related to post-translational

modifications, cell cycle, cellular development, cellular function and

maintenance.

The protein pathway analysis identified that hypoxia activated transcription

regulator HIF-1α (activation z-score 2.537, p-value of overlap 1.12E-06).

Therefore, the hematological system development and function was

interpreted to refer to HIF mediated regulation of the hypoxia-induced

responses.

A quantitative RT-PCR analysis was performed to monitor chondrocytic

phenotype and cartilage matrix related gene expression during long-term

hypoxic environment. VEGFA gene expression was used as a positive control

to monitor hypoxic conditions. 5% oxygen tension induced more Sox9 gene

expression than normoxic control environment (Fig. 5, paper III). The

largest difference was observed after 28 days in culture, when the expression

of Sox9 was 1.77±0.15 higher at hypoxia than at normoxia (mean ± 95% CI,

p<0.05). There was a time-dependent decrease in basal levels of Sox9 gene

expression. Aggrecan and type II collagen are known targets of Sox9

transcription factor. Hypoxia produced an increase in ACAN and COL2A1

gene expression. However, these increases did not reach statistical

significance until 28 days in culture. At the end of the experiment, relative

COL2A1 gene expression was 4.40 ± 1.18 higher at hypoxia than at normoxia

and ACAN expression was 2.49 ± 0.31 higher at hypoxia than at normoxia

(mean ± 95% CI, p<0.05). The transcription factor Sox9 also regulates the

expression of S100A1 and S100B genes, two genes that have been linked to

chondrocyte phenotype and differentiation status (Saito et al. 2007). In this

study gene expression trends of S100B, but also S100A1 to a lesser extent,

shared similarities with the expression of aggrecan and type II collagen (Fig.

5, paper III). A 5% low-oxygen atmosphere increased COL1A1 gene

expression after one-week in culture, but the low, 1.33-fold change (1.33 ±

0.22; mean ± 95% CI, p<0.05) together with its transient nature, was

considered not to be biologically significant nor suggest any phenotypic

alteration. The expression of another extracellular matrix-related gene,

versican, could not be quantified due to its low expression in HCS-2/8 cells.

Hypoxia-induced VEGFA fold changes were 2.19 ± 0.11 at 2 days, 2.34 ± 0.18

at 7 days and 3.59 ± 0.35 at 28 days in culture (mean ± 95% CI, p<0.05).

45

VEGFA gene expression significantly increased at all time points and

validated hypoxic culturing conditions of HCS-2/8 cells (Fig. 5., paper III).

Short-term (72 hours) time-lapse imaging did not reveal any statistically

significant differences in cellular proliferation rates in this study. The

scratch-wound assays were also performed at both oxygen atmospheres and

did not show any influence on lateral migration rates of HCS-2/8 cells (data

not shown).

Although long-term hypoxia increased the gene expression of cartilage

matrix components, increased secretion of sulfated GAGs or type II collagen

could not be detected by DMMB or ELISA assays (data not shown).

4.4 Hypoxia and Rho-kinase inhibitor Y-27632

induced cartilage matrix production in chondrocytic cells (paper IV)

Previously, the Rho-kinase inhibitor Y-27632 was reported to promote the

gene expression of cartilage extracellular matrix components and influence

the differentiation status of chondrocytes. The main goals of this fourth

paper were to evaluate the combined effects of long-term Rho-kinase

inhibition by Y-27632 together with hypoxia in HCS-2/8 cells. The main

focus was placed on proteomic response and cartilage matrix production.

Preliminary short-term (72 hours) time-lapse imaging experiments were

performed to monitor cellular proliferation, morphology and lateral

migration of HCS-2/8 cells. 10 µM of the Rho-kinase inhibitor Y-27632 did

not produce changes in cellular proliferation at normoxic or hypoxic

atmospheres (Fig. 1A and C, Supplementary Fig. 1, paper IV). The incubation

of cells with Y-27632 inhibited actin depolymerization in both oxygen

atmospheres and validated a Rho kinase inhibition by 10 µM Y-27632 in

HCS-2/8 cells (Fig. 1B and D, Supplementary Fig. 1, paper IV). Scratch-

wound migration assays demonstrated that Y-27632 slightly increased

wound filling rates at early experimental time point. Following 12 hours of

inhibition, the relative filling rate was at least 1.5 times higher in Y-27632-

treated samples than controls at both oxygen tensions (Fig. 1E-F,

Supplementary Fig. 2, paper IV). At the end of 72 hour monitoring period,

Y-27632-treated cells at normoxia reached 75.4% ± 3.5% of confluency

compared to 78.9% ± 3.9% in control cells. Whereas at 5% oxygen tension,

Y-27632-treated cells reached only 66.7% ± 2.9% of confluency compared to

75.1% ± 3.5% of confluency in control cells.

46

A proteomic analysis revealed that long-term 10 µM Y-27632 treatment

produced changes in 109 proteins (62 up- and 47 down-regulated) at

normoxia (Fig. 2A, Supplementary Table 2, paper IV), while at hypoxia

changes were detected in 101 proteins (64 up- and 37 down-regulated) (Fig.

3A, Supplementary Table 3, paper IV). The cut-off for protein fold changes

was set to ±1.3. A protein pathway analysis (IPA® analysis) was performed

on MS protein data.

The IPA® pathway analysis suggested that Y-27632 activated four protein

networks under normoxic conditions. The first network related to cancer,

organismal injury and abnormalities (score 59, Fig. 2B, paper IV) while the

second and the third networks involved cell survival and death (scores 44

and 42). Cancer-related findings are most likely due to the chondrosarcoma

cell model used in this study. The fourth activated network (score 41)

referred to amino acid metabolism, hematological system development and

function and to tissue development. A further detailed inspection of the

networks by pathway analysis indicated those linked to a decrease of binding

of cells (activation z-score 2.418, p-value of overlap 9.62E-03), an increase in

apoptosis (activation z-score 1.645, p-value of overlap 1.12E-03) and an

increase in proliferation of cancer cells (activation z-score 1.588, p-value of

overlap 6.31E-03). The suggested increase in proliferation was slightly

controversial, since the pathway analysis also simultaneously suggested a

decrease in proliferation of prostate cancer lines (activation z-score -1.387,

p-value of overlap 9.29E-03).

Rho-kinase inhibition under hypoxic conditions produced changes in 31

proteins that followed similar up- or down-regulated tendencies as observed

at normoxia (Fig. 4B, paper IV). Any additional protein changes appeared to

have a hypoxia-sensitive nature. A protein pathway analysis primarily

connected differentially expressed proteins to molecular transport and to cell

death and survival (26 target molecules, score 59, Fig. 3B, paper IV). The

second network (score 39) related to cell cycle, cellular growth and

proliferation and to tissue morphology, while the third protein network

(score 34) referred to cancer and to organismal injury and abnormalities.

The inspection of the networks revealed protein fold changes were associated

to a potential decrease in the efflux of cholesterol (activation z-score -1.969,

p-value of overlap 1.71E-03) and in the transport of cholesterol (activation z-

score -1.501, p-value of overlap 3.53E-03). IPA® pathway analysis also

predicted hypoxia-induced VEGFA activation (activation z-score 1.491, p-

value of overlap 7.40E-06).

Long-term Y-27632 exposure and Rho-kinase inhibition produced

differential expression patterns of several S100 proteins (p<0.05) at both

47

oxygen atmospheres (Fig. 4A, paper IV). Y-27632 produced the up-

regulation of S100-B (8.26 ± 1.29), S100-A1 (2.11 ± 0.06), S100-A13 (2.03 ±

0.14), S100-P (1.98 ± 0.62) and S100-A4 (1.51 ± 0.32), and a down

regulation of S100-A16 (-1.33 ± 0.06) at normoxia. In a hypoxic

environment, Y-27632 produced the up-regulation of S100-B (3.73 ± 0.18),

S100-A1 (2.58 ± 0.43), S100-A13 (1.88 ± 0.06) and S100-P (1.87 ± 0.19), and

the down-regulation of S100-A6 (-1.79 ± 0.21) and S100-A16 (-1.68 ± 0.02).

Of all the S100 proteins, prolonged kinase inhibition increased S100-B

protein synthesis the most at both oxygen tensions, while S100-A4 up-

regulation was observed only at normoxia and S100-A6 down-regulation was

observed only with hypoxia.

A quantitative RT-PCR analysis indicated that Y-27632 increased the

expression of the cartilage extracellular matrix production regulating

transcription factor Sox9 both at normoxic and hypoxic atmospheres (Fig. 5,

paper IV). The highest Sox9 expression level was observed after two days of

Rho-kinase inhibition. Despite this, the largest relative difference between

between treated and untreated controls of Sox9 gene expression was

observed after 28 days of exposure to Y-27632. Sox9 gene expression was

2.03 ± 0.24 times higher than controls at normoxia and 1.48 ± 0.10 times

higher at hypoxia. At 28 days, the combined effect of Y-27632 and hypoxia

induced a 2.60 ± 0.18 fold change (p<0.001) in Sox9 expression.

Similar to Sox9 gene expression, both aggrecan and type II collagen gene

expressions were increased the most after 28 days of exposure to Y-27632 at

both normoxia or hypoxia (Fig. 5, paper IV). The changes in ACAN and

COL2A1 were highest at hypoxia. Long-term Y-27632 exposure at a 5%

oxygen tension increased ACAN gene expression 5.33 ± 0.93 fold (p<0.001)

and COL2A1 gene expression 26.6 ± 4.14 fold (p<0.001) in comparison to

the corresponding untreated normoxic controls.

Versican gene expression was not possible to determine due to its low

expression level. Type I collagen slightly responded in a transient way to Y-

27632 exposure at either oxygen atmosphere. The observed changes were

considered to be minimal in comparison to COL2A1 gene expression.

Therefore, it is suggested that differences of COL1A1 expression could have

only a minor role for extracellular matrix production.

The proteomic analyses revealed several protein expression changes of S100

proteins at both oxygen atmospheres by Y-27632. Therefore, the gene

expression of S100A1, S100B and S100A16 were also determined by qRT-

PCR in this study. 10 µM of Y-27632 significantly increased S100A1 gene

expression at all time points at both atmospheres (Fig. 5, paper IV). The gene

48

expression profile of S100B shared similarities with S100A1 (Fig. 5, paper

IV). The gene expression profiles of S100A1 and S100B supported the results

obtained from the proteomic analyses. The S100B gene expression profile

also shared many similarities with aggrecan expression profile. A similar

trend was also found between S100B and type II collagen gene expression. In

contrast, long-term Y-27632 treatment at hypoxia significantly decreased

S100A16 gene expression. The fold change was 0.67 ± 0.06 (p<0.001)

between the treated cells and controls (Fig. 5, paper IV). VEGFA gene

expression was used as a positive control to monitor the hypoxic atmosphere

on HCS-2/8 cells. Hypoxia induced VEGFA gene expression was

independent of Rho-kinase inhibition.

An ELISA assay was performed to quantify secreted type II collagen from the

culture media. 10 µM of Y-27632 slightly increased secreted type II collagen

at normoxia but did not reach significance (Fig. 6A, paper IV). The

combination of prolonged Rho-kinase inhibition together with a hypoxic

environment increased the secretion of type II collagen by 6.2 ± 1.1 fold (Fig.

6A-B, paper IV). In addition, the production of sGAGs was estimated using

the DMMB assay. Long-term (28 days) exposure to Y-27632 at normoxia

increased the synthesis and secretion of sGAGs 31% ± 16% (Fig. 6C-D, paper

IV). Under hypoxic conditions, long-term Rho-kinase inhibition increased

the synthesis and secretion of sGAGs by 57% ± 9% compared to untreated

control cells.

49

5. Discussion

5.1 The phosphoproteomic analysis of cyclically stretched HCS-2/8 cells (paper I)

Proteomic analyses of cartilage samples are challenging since the major

components of the extracellular matrix are highly abundant in comparison to

cellular proteins. The insoluble and fibrillar type II collagens form networks

and larger aggregate structures with aggrecan and hyaluronan. Some other

proteins and glycoproteins can bind to these matrix networks, as well. The

proteome analysis of cartilage tissue samples requires the appropriate

tecniques for sample preparation, e.g., the use of strongly chaotropic agents

that can solubilize proteins prior to analysis (Wilson et al. 2008, Önnerfjord

et al. 2012). Both the highly anionic aggrecan and hyaluronan can be

precipitated by cationic cetyl pyridinium chloride, which can improve

protein separation when using the traditional two-dimensional gel

electrophoresis (Vincourt et al. 2006). Different kinds of sample preparation

and prefractioning strategies have been developed, but there are still

challenges to analyze the secretome and proteome of cartilage tissue

samples. The HCS-2/8 cell model was used in our cellular stretching related

phosphoproteomic study. The cell model was applicable for this kind of

purpose since it made it possible to study biaxial cell stretching directly with

chondrocytic cells and minimize additional sample preparation steps and

analytical challenges derived from interfererence from cartilage matrix

components.

A phosphoprotein enrichment strategy was chosen to purify cell lysates and

use the protein loading capacity of IPG strips for phosphorylated proteins as

efficiently as possible. Despite this target-orientated strategy, we could not

detect the actual phosphate groups of the proteins. The reasons for missing

phosphate groups relates most likely to inappropriate ionization methods for

labile phosphorylation side chains, limited sequence coverages of the

identified proteins and, in some cases, low amounts of extracted peptides.

Moreover, phosphorylation enrichment methods may work more effectively

for small peptides rather than larger and structurally more complex protein

structures (Fíla and Honys 2012). During the last years, novel

straightforward LC-MS based techniques have been developed that offer new

and better tools for phosphoproteomic screening and the detection of

phosphorylation sites. Despite these technological improvements,

phosphoproteomics is still regarded as challenging, both for qualitative and

quantitative analyses (Solari et al. 2015).

50

5.2 Cyclic stretching induced responses in chondrocytic cells (paper I)

The cyclic cellular stretching experiments were performed to evaluate

stretch-induced phosphoprotein responses in human chondrosarcoma cells.

Mechanical forces have been studied with regard to chondrocytes and

cartilage tissue for a long time. However, the role of mechanical stretching of

chondrocytes, an event that occurs during the compression of cartilage

tissue, has not been as well studied as other types of mechanical stresses

such as hydrostatic pressure. Previous stretching experiments have been

based upon highly variable parameters and experiments have ended up with

controversial results relating to the maintenance of cartilage matrix

production. The cyclic stretching study in this thesis had the goal to evaluate

stretch-induced phosphorylation changes in chondrocytic cells.

Mechanical stresses, such as compression, hydrostatic pressure and tension

have been shown to induce the activation of extracellular signal regulated

kinases (ERKs) in chondrocytes and chondrocytic cells (Fanning et al. 2003,

Takahashi et al. 2003, Kopakkala-Tani et al. 2004). In our stretching

experiments, a cyclic, 8% stretching at a frequency of 1 Hz activated ERKs,

detected by Western blot technique. The differential expression of

phosphorylated ERKs was not observed in Coomassie Blue-stained two-

dimensional gels likely due to the relatively low sensitivity of this staining

method and the low expression levels of ERK signaling mediators in the

cells. The activation of other signaling routes, such as PI3K and Akt were not

observed in this study. However, differentially expressed phosphoproteins

related to other cellular functions were detected in this study. These include

eukaryotic translation elongation factors 1 delta and 1 beta referred to as EF-

1 related GDP to GTP exchange. Moreover, eEF1D (isoform 2) which is also

known as eEF1BdeltaL (eEF1BδL) regulates heat shock-associated genes

(Kaitsuka and Matsushita 2015). This regulation is mediated via heat shock

transcription factors and heat shock promoter elements. The reciprocally

expressed isoforms of eukaryotic elongation factors had potentially specific

roles in HCS-2/8 cells, but they could not be recognized in this screening

study.

Moesin belongs to ERM proteins and forms complexes with ezrin and

radixin. ERM proteins can connect cytoskeleton to plasma membrane and

they are also present in cell adhesion sites. Moesin can also take part in other

cellular functions, such as endosome maturation and microvilli formation

(Oshiro et al. 1998, Chirivino et al. 2011). Hypotonic shocks induce actin

reorganization and recruitment of the actin monomers and phosphorylated

moesin to membrane protrusions (Tamma et al. 2007). It may be that the

51

mechanical cyclic stretching stress was transferred to the cellular

cytoskeleton and induced the expression of phosphorylated moesin.

Mechanosensitive up-regulation of phosphorylated moesin is a novel finding

and has not been previously described. The up-regulation of prolyl 3-

hydroxylase 1 (leprecan) was also identified as a novel stretch-induced

protein. Prolyl 3-hydroxylase 1 is known to catalyze the post-translational

modification of certain proline residues into (3S)-hydroxyproline (3-Hyp) on

the α-chains of different types of collagens (Vranka et al. 2004).

In addition to the differentially expressed proteins, a group of 15 other,

abundantly expressed phosphoproteins was identified in HCS-2/8 cells.

These proteins are linked to many different cellular functions, and include

structural roles, enzymatic roles and mitochondrial activities. Notably, four

different protein disulfide isomerases, or their precursors, were abundantly

expressed in HCS-2/8 cells. Protein disulfide isomerases are required to

catalyze the isomerization of disulfide bonds and they can work as subunits

for prolyl 4 hydroxylase enzyme, which has a crucial role for collagen

biosynthesis (Koivunen et al. 2004).

The cyclical stretching experiment revealed four novel tension-related

protein responses. These findings were not recognized to be associated with

cartilage extracellular matrix production. Due to the small number of

differentially expressed proteins and qualitative analyses of the study, it was

not possible to analyze activated protein networks of stretch-induced

signaling mechanisms. Although the full loading capacity of the IPG strips

was used for phosphoprotein loading, it is obvious that the

phosphoproteomic signaling analysis would have needed a more sensitive

detection method than Coomassie Blue staining. Further studies would be

needed to recognize the stretch-induced cellular signaling responses. A

clarification of these responses are still of great interest since the

mechanisms and roles of the different loading stresses for chondrocyte

maintenance are still not properly known, and even controversial results

have been reported.

5.3 Short-term Rho-kinase inhibition did not induce

chondrocyte-specific cartilage extracellular matrix production in fibroblasts (paper II)

In previous studies, Rho-kinase inhibition has been demonstrated to

promote chondrocyte-specific gene expression (Woods et al. 2005, Woods

and Beier 2006, Matsumoto et al. 2012, Furumatsu et al. 2014). Additionally,

a long-term exposure of fibroblast growth factor 2 (FGF-2) at hypoxic oxygen

tension has been reported to induce chondrocyte-specific extracellular

52

matrix production by fibroblasts (Page et al. 2009). The aim of the second

paper was to investigate the short-term (72 hour) Y-27632-induced

proteomic responses in fibroblasts and to study whether Rho-kinase

inhibition could induce chondrocyte-specific gene expression in fibroblasts.

A pharmacology-based induction of cartilage extracellular matrix production

would be of high interest since it could be useful for cell-based regenerative

cartilage repair applications. The fibroblast and chondrocyte cells appear to

have a relative straight-forward connection since chondrocytes cultured as

monolayers rapidly lose their chondrocyte-specific phenotype and start to

express fibroblast-specific type I and III collagens (von der Mark et al. 1977,

Duval et al. 2009). Thereby, a chondrogenic induction of fibroblasts could

potentially offer a novel strategy for direct pharmacological differentiation of

patient-derived fibroblasts to chondrocytes. Despite the previous report of

inducing effects of prolonged FGF-2 exposure under a hypoxic atmosphere

(Page et al. 2009), the Rho-kinase inhibitor Y-27632 was used instead of

FGF-2 growth factor in this study. FGF-2 was not used since it was shown to

also induce several catabolic responses, i.e., the suppression of aggrecan

gene expression and the induction of cartilage matrix degrading factors, such

as ADAMTS-5 and MMP-13, in chondrocytes (Ellman et al. 2013). However,

the precise role of FGF-2 may be more complex since some studies

performed in human mesenchymal stem cells have demonstrated that the

correct sequential dosing of FGF-2 and fibroblasts growth factors 9 and 18

could be used to support chondrogenic and osteogenic differentiation

(Correa et al. 2015).

Short-term Rho-kinase inhibition was not sufficient to induce chondrocyte-

specific cartilage extracellular matrix production in fibroblasts in this study.

Acute exposure to Y-27632 did not increase gene expression of the

transcription factor Sox9. Type I collagen and versican expressions remained

at relatively stable levels and the slight increase of aggrecan expression was

not statistically significant.

5.4 Rho-kinase inhibition induced fibroblast

migration and transient proliferation (paper II)

A short-term (72-hour) exposure of human fibroblasts to the Rho-kinase

inhibitor Y-27632 induced the differential expression of several proteins.

These changes in expression were analyzed and were determined to be

primarily associated to functional responses, such as cellular proliferation

and migration. The inhibition of Rho-associated coiled coil kinases

transiently increased during the first 12 hours of fibroblast proliferation. Y-

27632 treatment increased cell number up to two-fold during this period.

After an initial accelerated proliferation, the total number of kinase

53

inhibitor-exposed cells slightly decreased. The mechanism behind this

proliferation profile was not investigated in this mainly proteomic study.

The inhibition of actin depolymerization was an expected response and this

was experimentally confirmed in fibroblasts. Time-lapse imaging revealed

the dynamic nature of actin filament-based polymerization and

depolymerization processes and demonstrated a net increase of Y-27632-

induced cellular protrusions. Protein pathway analysis pointed out a number

of potential canonical signaling pathways. The most potential routes were

linked to protein 14-3-3 mediated signaling, actin cytoskeleton signaling and

calcium binding calpain protease regulated mechanisms. Calpain protease

can proteolytically degrade complexes of talin, paxillin and focal adhesion

kinase and lead to the further disassembly of cellular focal adhesions (Chan

et al. 2010, Cortesio et al. 2011). Rho-kinase inhibition depleted the vinculin-

associated focal adhesions in our experiments in fibroblasts. It was notable

that the synthesis of vinculin was simultaneously increased, therefore

suggesting that Y-27632 influenced the cellular localization of vinculin in a

crucial way. Reduced focal adhesions correlate well with the abserved

increase in cellular migration. The motility assay, for an acute single dose of

Y-27632, in primary foreskin fibroblast cells has not been previously

described in a time-dependent manner. The increase in cellular motility is

often considered a common response to Rho-kinase inhibition, especially

using scratch-wound models (Nobes and Hall 1999, Magdalena et al. 2003,

Hopkins et al. 2007, Shum et al. 2011, Breyer et al. 2012, Goetsch et al.

2014). However, increase in migration is not a global phenomenon, but

rather a cell type-specific response. It has previously been shown that the

Rho-kinase inhibitor Y-27632 can reduce the invasion of rat MM1 hepatoma

cells, while blocking the motility of human prostate cancer cells (Somlyo et

al.2000, Imamura et al. 2000). Moreover, Y-27632 exposure has been

demonstrated to inhibit the migration process of human corneal fibroblasts

(Zhou and Petroll 2010).

Cellular migration is based on the coordinated assembly and disassembly of

actin filaments. Increased motility of fibroblasts supports wound healing

processes that are apparently coordinated by small GTPases Rho, Rac, Cdc42

and Ras (Nobes and Hall 1999). Our time-lapse imaging indicated an

increased absolute number of cellular protrusions. The maximum difference

reached in lateral migration-based wound filling rates occurred three times

faster in Y-27632-treated cells than in untreated controls. However, the rate

decreased in a time-dependent manner during the experiment. Cellular

proliferation also had a potential role in the wound-filling process, but as the

proliferation only increased in a transient way at the beginning of the

54

experiment, it suggests that increased proliferation only had a limited role in

the overall wound-filling process.

5.5 Increased cellular migration was potentially mediated by mDia and Rho-kinase mediated signaling routes (paper II)

Rho-kinases are known to mediate signals via LIM kinases (type I and II) by

the phosphorylation of cofilin and by inducing the phosphorylation of

myosin light chain. These of both routes are connected to the reorganization

of the actin cytoskeleton and are both linked to actin stress fiber formation

and to cell motility (Magdalena et al. 2003). Rho-kinase-related signaling

routes have also additional regulatory mechanisms, like γ-actin, which can

be a potential upstream or direct regulator of the Rho-kinase signaling

system (Shum et al. 2011). It is known that a scratch-induced wound

activates Cdc42 that subsequently leads to the activation of Par6/aPKC

complex and a further GSK-3-mediated polarization of the microtubule

cytoskeleton (Cau and Hall 2005). In addition to this, the localized activation

of Cdc42 and Pak kinase has been proposed to connect to the scratch-

induced activation of βPIX. This would mediate the signal to the

downstream mediator Rac and ultimately lead to the polarization of actin-

dependent cellular protrusions. Fibroblast migration requires cellular

protrusions of the lamellipodium and actin filament disassembly is a

necessary part of this mechanism. Previous research has demonstrated the

key role of actin depolymerizing factors (ADF) and non-phosphorylated

cofilin for the polarized protrusion of lamellipodia structures (Dawe et al.

2003). Even though actin stress fibers and their connections to the

extracellular matrix form the basis for cellular migration, cellular motility

also needs dynamically controlled focal adhesions at different regions of the

cell (i.e., the front and the back) (Ridley et al. 2003). These focal adhesions

must be controlled in a coordinated way, which means that new adhesions

are formed in protrusions and older adhesions are disassembled to allow

cellular movement.

Vinculin is one of the actin filament-binding proteins that connect the actin

cytoskeleton to the extracellular matrix (Menkel et al. 1994). The regulation

of actin dynamics in focal adhesions is a complex process and a group of

actin-binding proteins, like talin, tensin and α-actinin, take part in this

regulation (Le Clainche and Carlier 2008). However, both vinculin and

formin (mDIA1) are known to involve the elongation step of actin filaments

in focal adhesions (Le Clainche et al. 2010). Rho has been proved to mediate

the signal to ROCKs and affect the localization of vinculin in different cell

types, as well as actin-myosin contractility that modulates the assembly

55

process of focal adhesions (Kotani et al. 1997, Dumbauld et al. 2010).

Furthermore, Rho has been shown to have a role in controlling Golgi polarity

and cell motility via mDIA (Satoh and Tomonaga 2001, Magdalena et al.

2003). In summary, we suggest that the increase in cellular migration of

primary human foreskin fibroblasts observed using a scratch-wound model

was produced by a Y-27632-mediated inhibition of RhoA activity. This

inhibition of RhoA can obviously increase cellular migration by affecting

both mDIA- and ROCK-mediated routes. Moreover, one previous study

demonstrated that Y-27632-mediated Rho inhibition especially affects

cellular motility via ROCK2 in myoblasts (Goetsch et al. 2014). A similar

mechanism is also possible in fibroblasts, although the exact signaling

pathway was determined from our experimental data.

5.6 Long-term hypoxia supported chondrocyte

specific gene expression (paper III)

A prolonged 28-day culture of HCS-2/8 cells at a 5% low-oxygen atmosphere

slightly enhanced the gene expression of the transcription factor Sox9.

Moreover, this long-term cell culture at hypoxia induced Sox9 regulated gene

expression of chondrocyte-specific type II collagen and aggrecan genes. In

addition, expression of the chondrocyte differentiation status S100A1 and

S100B genes were also increased after 28 days of exposure to a low oxygen

atmosphere. Despite the promising gene expression profiles, an actual

increase of cartilage extracellular matrix production was not detected in this

study. However, the gene expression results indicated that hypoxia was a

favorable factor for conserving a chondrocyte phenotype during prolonged in

vitro culture of HCS-2/8 cells. Data suggest that the co-administration of

some chondrocyte phenotype-supporting factor, or factors, at a hypoxic

atmosphere would help to prevent the loss of chondrocyte phenotype of

monolayer cultures and even promote cartilage extracellular matrix

production. These kinds of responses would be optimal for cell-based

regenerative cartilage repair techniques.

5.7 Long-term hypoxia induced known and novel

protein responses in chondrocytic cells (paper III)

A number of proteomic studies have been previously performed in normal

healthy and osteoarthritic chondrocytes, but our present study focused in

particular on long-term hypoxia-induced proteomic responses. Proteomic

analysis revealed 44 hypoxia-induced protein responses in chondrocytic

HCS-2/8 cells. A number of these differentially expressed proteins have

previously been recognized as hypoxia-sensitive responses, but this study

also revealed a novel group of hypoxia-related proteins. Many of the

56

previously recognized hypoxia-sensitive proteins, such as lactate

dehydrogenase, NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-

like 2, protein NDRG1 and macrophage migration inhibitory factor are

known to be regulated in a HIF-dependent manner. VEGFA gene expression

was used as a positive control to validate hypoxic culturing conditions, and

the protein pathway analysis suggested increased activation of HIF pathway.

A bioinformatic DAVID analysis identified three differentially expressed

proteins linked to regulation processes of reactive oxygen species (ROS). The

three proteins identified were thioredoxin 1, mitochondrial thioredoxin

(thioredoxin 2) and multifunctional cytochrome C. All of these proteins were

down-regulated in a hypoxic atmosphere. A strong down-regulation and a

decrease in the activity of thioredoxin 1 is a well-known hypoxia-induced

response (Naranjo-Suarez et al. 2012). Thioredoxin 1 involves the regulation

of ROS levels in cells, however its expression is regulated in a HIF-

independent manner. A further analysis of ROS production was not

performed in this study since our focus was directed towards identifying

factors involved in the maintenance of chondrocyte phenotype.

Articular cartilage is particular in its hypoxic nature and thereby

chondrocytes have adapted to low oxygen tension. Chondrocytes are known

to use glycolysis for their normal energy production, not only under hypoxic

conditions but also at normoxia, and the activity of lactate dehydrogenase is

a key enzyme in chondrocyte metabolism (Lee and Urban 1997). Thereby,

the increased expression of L-lactate dehydrogenase A chain at hypoxia

potentially relates to hypoxia-induced glycolytic energy production in HCS-

2/8 cells.

Long-term 5% oxygen strain notably increased gene expression of N-myc

downstream regulated gene-1 (NDRG1) in HCS-2/8 cells. Its expression was

up-regulated more than two-fold. Hypoxia-induced NDRG1 up-regulation is

a known response in many types of cancer cells and it has been considered as

a diagnostic marker for certain solid tumors (Fotovati et al. 2011). The

protein NDRG1 has several biological functions that involve hormonal

responses, cell growth, and differentiation. Interestingly, NDRG1 up-

regulation has also been connected to suppressing metastasis in certain types

of cancer cells and the molecular mechanisms behind this suppression have

been previously investigated (Wangpu et al. 2015). Hypoxia-induced up-

regulation of NDRG1 and its possible inhibition of oncogenic signaling

mechanisms most likely only have minor effects on actual metastasis

suppression of chondrosarcomas, but this possible anti-cancer response

would be an interesting topic for future studies.

57

The novel hypoxia-sensitive identified proteins were not observed to be

closely associated with each other. NADH dehydrogenase [ubiquinone] 1

beta subcomplex subunit 11 (mitochondrial) takes part in complex I of the

respiratory chain. Hypoxia-induced expression of this NADH dehydrogenase

enzyme might be related to other hypoxia-regulated NADH dehydrogenase

(ubiquinone) 1 alpha subcomplex, 4-like 2 enzyme, although this connection

has not been previously reported. The role of 40S ribosomal protein S26 has

been shown to involve p53 activity of damaged DNA, but chondrocyte-

specific roles have not been reported (Cui et al. 2014). Previous literature is

limited to connect either hypoxia or cartilage biology with protein CDV3

homolog, acyl-coenzyme A thioesterase 9 (mitochondrial) and tubulin beta-8

chain. Further studies are warranted to determine their biological roles in

chondrocytes. The hypoxia-sensitive role of CD166 antigen was also one of

the novel oxygen-dependent protein discoveries. The hypoxic atmosphere

decreased CD166 expression by over two-fold. The exact biological role of

this decrease remains unknown in the context of chondrocytes, although an

up-regulation of CD166 has been previously linked to chondrogenic

differentiation of pluripotent stem cells (Wu et al. 2013). This chondrogenic

connection has not been studied in detail; therefore, the putative role of

CD166 in chondrocyte differentiation and phenotype maintenance is worth

studying. Moreover, the decrease of TNF receptor superfamily member 1B

was observed in this long-term hypoxia study and identified as a novel

hypoxia-sensitive protein in chondrocytic cells. Oxygen tension affects the

expression of this protein via phosphorylation changes of forkhead box

protein O3 (Ding et al. 2009). Tumor necrosis factor receptor superfamily

member 1B acts as a receptor, which can mediate, for example, TNF-α

related metabolic effects.

Proteomic analysis of HCS-2/8 cells revealed in total 1458 different proteins.

These findings are unique since the proteins identified were based on at least

one unique peptide that allowed the separation of closely related proteins

and/or their isoforms from one another. Proteomes are mainly descriptive

data sets. However, the data of the HCS-2/8 proteome was collected as a part

of the third study since it could provide new information for the use of HCS-

2/8-based cellular models.

58

5.8 A short-term Rho-kinase inhibition at normoxic or at hypoxic conditions did not induce HCS-2/8 cell proliferation (paper IV)

The main goal of the fourth study focused on evaluating the long-term effects

of Rho-kinase inhibition both at normoxia and at cartilage tissue modelling

hypoxic conditions. The study began with a short-term (60-hour) single-dose

of Y-27632 to initially monitor cell morphology, the formation of cellular

protrusions and cell proliferation. This study was designed to evaluate and

determine the capability of Y-27632 to induce responses in chondrosarcoma

cells and to compare the functional responses with our previous short-term

experiments in fibroblasts. Visual monitoring revealed that Y-27632

inhibited the depolymerization of filamentous actin. Using a scratch-wound

model, results pointed to a short and transient oxygen-independent

acceleration in cellular migration by Y-27632. Y-27632-induced wound

filling rates decreased more rapidly than what was previously observed in

fibroblasts. In contrast to our previous study in fibroblasts, Y-27632

treatment in HCS-2/8 cells did not induce similar proliferation as observed

in fibroblasts (paper II). In addition to our own observations in fibroblasts,

Y-27632 has been reported to increase cellular proliferation in many other

cell types, such as astrocytes, limbal epithelial cells, keratinocytes and

mesenchymal stem cells (Yu et al. 2012, Chapman et al. 2014, Nakamura et

al. 2014, Sun et al. 2015). However, Y-27632 has not been noticed to increase

the proliferation of different types of cancer cells (Routhier et al. 2010, Jiang

et al. 2015, Wang et al. 2016). Inhibition of Rho-kinase coiled coil proteins

has been reported to inhibit cancer cell growth and invasion (Wang et al.

2016). There appears to be a tendency for Rho-kinase inhibition to promote

cellular proliferation of normal cells, but not in immortalized cancer cell

lines. Studies on the Rho-kinase related cancer invasiveness have

demonstrated that Y-27632 can suppress certain cancer growth and/or

invasion related responses (Imamura et al. 2000, Jiang et al. 2015, Wang et

al. 2016). An accurate mechanism of Y-27632-induced cell proliferation

differences between normal cells and cancer cells is still not well understood.

The potential proliferation decreasing effects of Y-27632 makes ROCK

inhibitors interesting subjects for cancer research.

59

5.9 A long-term exposure of the Rho-kinase inhibitor Y-27632 at hypoxic atmosphere enhanced cartilage extracellular matrix production (paper IV)

The gene expression of transcription factor Sox9 increased in all Y-27632-

treated samples and the expression of COL2A1 and ACAN were

simultaneously increased by long-term exposure of Y-27632, especially at

low oxygen tension. The effects were not so large at the level of secreted end-

product, although increases in type II collagen and sGAG supported the idea

of the increased production of extracellular matrix in Y-27632-treated cells

in a low oxygen atmosphere.

Type II collagen and aggrecan are the major structural components in

articular cartilage. The expressions of these macromolecules tend to

significantly decrease when chondrocytes are cultured in monolayers. This

study revealed an efficient way to support the maintenance of a chondrocytic

phenotype and to enhance the synthesis of type II collagen and aggrecan in

long-term cultures of chondrocytic cells. We found that 10 µM of the Rho-

kinase inhibitor Y-27632 at a 5% oxygen atmosphere was optimal. This

result is very interesting and gives a basis to investigate Rho-kinase

inhibition in healthy human primary chondrocytes. In addition, the use of

three-dimensional culture techniques in future experiments can be seen

appropriate, or even necessary, since this has been shown to significantly

affect cell behavior in a number of studies. Furthermore, three-dimensional

cultures are required in order to promote a proper assembly of newly

synthetized extracellular matrix components of cartilage.

5.10 Long-term Y-27632 exposure induced several-fold

protein changes at both oxygen tensions (paper IV)

Proteomic analysis together with a protein pathway analysis was performed

to determine protein responses and their roles in chondrocytic cells. The

analysis revealed that long-term Y-27632 exposure produced changes in

several proteins both at normoxia and at hypoxia. The long-term Y-27632

exposure at normoxia produced the highest increase in the synthesis of

S100-B, adseverin, S100-A1, S100-A13 and S100-P proteins. At hypoxia, the

highest increases were related to the translocator protein, Ras-related

protein Rab-11B, S100-B, S100-A1 and insulin-like growth factor-binding

protein 7. Rho-kinase inhibition decreased the expression of large neutral

amino acids transporter small subunit 1, retinoid-inducible serine

carboxypeptidase, 4F2 cell-surface antigen heavy chain, HLA class I

histocompatibility antigen, A23 alpha chain and spliceosome RNA helicase

DDX39B proteins the most at normoxia. In a hypoxic environment, Y-27632

60

decreased large neutral amino acids transporter small subunit 1, cyclin-

dependent kinase inhibitor 1, serine hydroxymethyltransferase (cytosolic),

S100-A6, glutaredoxin-1 and tubulin alpha-4A chain the most. Notably, Y-

27632 produced differential expression of several members of the S100

protein family. The tendencies of the changes in S100 proteins were

relatively similar at both atmospheres, although overall, in comparison, only

around 30% of all Y-27632-induced protein responses were similar at both

atmospheres.

Y-27632 treatment significantly induced cartilage extracellular matrix

production under hypoxic conditions, but the protein pathway analysis did

not recognize this response. Although the proteomic results did not reveal an

increase in type II collagen synthesis, it did detect an increase in the

synthesis of 3'-phosphoadenosine 5'-phosphosulfate synthase 1 and 2

enzymes at hypoxia. These enzymes have a crucial role in the GAG sulfation

process, thereby establishing a direct link to an increase in proteoglycan

production. The proteomic analysis was directed to cell samples, so it is

understandable that secreted cartilage extracellular matrix components may

not have been particularly well-identified. The accuracy and the explanatory

values from the protein pathway analysis would have benefited from a

simultanueous analysis of the secretome. Pathway analysis techniques are

improving and the content of bioinformatic databases is rapidly expanding.

Still, different pathway analysis techniques have their limitations, which can

lead even to the misinterpretion or undiscovered results (García-Campos et

al. 2015).

The main aim of this fourth study was related to cartilage phenotype and

extracellular matrix production. However, we also had an interest to identify

additional Y-27632-induced responses in HCS-2/8 cells at both oxygen

atmospheres. The potency of different classes of Rho-kinase inhibitors for

various therapeutic purposes (i.e., cancer, cardiovascular and neuronal

disease, diabetes-related complications) have been previously studied, and

some clinical trials are currently underway (Wei et al. 2016). Currently, Y-

27632 is not therapeutically used, but other modified Rho-kinase inhibitors,

such as fasudil and ripasudil, have been approved for human medical use

(Shibuya et al. 1992, Garnock-Jones 2014). The novel and therapeutically

favorable Y-27632-induced protein responses could direct Rho-kinase

inhibition studies in novel directions.

Interestingly, long-term (28-day) Y-27632 treatment decreased the synthesis

of the SLC7A2 (LAT1, CD98LC) and SLC3A2 (4F2hc, CD98HC) at both

oxygen atmospheres studied. Proteins SLC7A2 and SLC3A2 form a

heterodimeric amino acid transporter complex that transports large neutral

61

amino acids into cells (Fotiadis et al. 2013). This amino acid transporter can

also transport amino acid-like compounds and it has specific roles in L-

DOPA and triiodothyronine T3 and T4 transport in certain tissues. Previous

studies have shown that LAT1 or LAT1/4F2hc are overexpressed in many

cancers, and include triple negative breast cancer, different sarcomas,

malignant pleural mesothelioma, pancreatic cancer, renal cell carcinoma and

gliomas (Kaira et al. 2011, Furuya et al. 2012, Betsunoh et al. 2012, Kaira et

al. 2012, Koshi et al. 2015). LAT1/4F2hc transporter can mediate growth-

related responses and increased LAT1 or LAT1/4F2hc expression has been

correlated with malignant phenotype and tumor progressive activities.

Previous studies have pinpointed the crucial role of LAT1 for cancer related

activities and even as prognostic marker in certain cases (Kim et al. 2006,

Betsunoh et al. 2012, Furuya et al. 2012, Kaira et al. 2012). Thereby,

inhibition of LAT1/4F2hc complex and LAT1 have been suggested to be

potential targets for novel cancer treatments (Cormerais et al. 2016,

Marshall et al. 2016).

In this study, it was observed that the long-term Y-27632 treatment

decreased the protein synthesis of both components of the LAT1/4F2hc

transporter. Of the two, LAT1 was the most down-regulated component at

both oxygen atmospheres. This down-regulation of LAT1/4F2hc transporter

appears to be a novel Rho-kinase inhibition-related response. The decreased

expression of this transporter most likely limited the transport of essential

amino-acids in HCS-2/8 cells and thereby limited cellular growth and

proliferation. The mechanisms, or consequences, of this decreased

expression of LAT1/4F2hc transporter was not currently studied. However

Y-27632-induced LAT1 down-regulation provides new aspects to Rho-kinase

inhibition-related cancer research.

5.11 Long-term exposure of the Rho-kinase inhibitor

Y-27632 influenced changes to S100 protein synthesis (paper IV)

The S100 protein family consists of 24 members (Donato et al. 2013). The

majority of S100 proteins are linked to calcium signaling and have EF-hand

type helix-loop-helix calcium-binding sites. The roles of the different S100

proteins are divided to intracellular, intra- and extracellular, or extracellular

functions. The main roles of S100 proteins relate to various regulations of

cellular and signaling processes. As reviewed by Donato et al. (2013), S100

proteins are involved in processes, such as Ca2+-signaling, proliferation,

differentiation, metabolism, migration and apoptosis in many cell types.

62

Secreted S100 proteins can produce responses by binding to cell surface

receptors, such as receptors for advanced glycation end products (RAGE)

and toll-like receptors, G protein-coupled receptors, scavenger receptors and

even to some glycan structures (Yammani 2012, Donato et al. 2013). It has

previously been reported that the proteins S100-A1, S100-A2, S100-A4,

S100-A8, S100-A9, S100-A11 and S100-B are all commonly connected to

articular cartilage (Yammani 2012). A proteomic screening of human

chondrocytes isolated from non-arthropathic knee articular cartilage and

cultured in alginate, revealed that these chondrocytes expressed S100-A1,

S100-A4, S100-A6, S100-A10, S100-A11, S100-A13, and S100-B proteins

(Lambrecht et al. 2010). Another proteomic study using healthy human

chondrocytes revealed similar protein profiles with some slight differences

(Tsolis et al. 2015). In that study, the expression of S100-A16 protein was

observed as a new finding and the expression of the low expressed regulator,

S100-B, was not identified. These minor changes in proteomic profiles of

normal human chondrocytes may relate to different cell origins, different

culturing conditions or technical differences used for proteome analysis.

Our proteomic analysis (paper III) with monolayer-cultured HCS-2/8 cells

revealed that this chondrosarcoma cell line expresses S100-A1, S100-A4,

S100-A6, S100-A10, S100-A11, S100-A13, S100-A16, S100-B and S100-P

proteins. The S100 protein profile of HCS-2/8 cells was qualitatively similar

in comparison to normal chondrocyte S100 protein profiles. An exception to

this was observed with the S100-P protein, one that was not previously

reported to be expressed in chondrocytes. S100-P protein expression might

relate to cancer cell phenotype of HCS-2/8 cells, but more likely may relate

to an improved sensitivity of detection. Our study (paper III) revealed that

S100-P and S100-B proteins were the lowest expressed proteins of the S100

family in HCS-2/8 cells.

Long-term Y-27632 exposure produced the up-regulation of S100-A1, S100-

A13, S100-B and S100-P in HCS-2/8 cells. These up-regulation tendencies

were similar at both oxygen atmospheres, although S100-B protein was

significantly up-regulated to a greater extent at normoxia than at hypoxia.

However, a part of the strong S100-B up-regulation at normoxia was related

to higher variability of the results; therefore, the actual biological response

may be smaller than what was determined in the present study. Y-27632-

induced a down-regulation of S100-A16 and had a similar trend at both

oxygen tensions. Oxygen-dependent differential expression of some S100

proteins was observed, such that S100A4 was up-regulated at normoxia and

S100-A6 was down-regulated at hypoxia.

63

The S100 proteins have been reported to regulate many cellular responses.

In cartilage tissue, diverse S100 protein functions have been connected to

tissue maintenance, differentiation status, hypertrophic differentiation and

calcification processes (Yammani 2012, Diaz-Romero et al. 2014). Both

S100-A1 and S100-B proteins are targets of the transcription factor Sox9 and

its coactivators Sox5 and Sox6 (Saito et al. 2007). These S100 proteins have

been suggested to inhibit the terminal differentiation of chondrocytes. A

study investigating the roles of S100-A1 and S100-B in human articular

chondrocyte phenotype uncovered a divergent, but associated, role of these

proteins and their potential to act as markers for chondrocyte differentiation

status (Diaz-Romero et al. 2014). In this study, the increased protein

syntheses of S100-A1 and S100-B were proposed to be chondrocyte

phenotype supporting responses.

Protein S100-A4-based stimulation has been demonstrated to increase the

synthesis of the catabolic MMP-13 enzyme in chondrocytes (Yammani et al.

2006). The long-term Y-27632 exposure induced an increase in the synthesis

of S100-A4 at normoxia, but not at hypoxia. The actual expressions of the

secreted MMPs were not determined in this study, but it can be suggested

that Y-27632 treatment at a 5% low-oxygen tension was more favorable for a

chondrocytic phenotype since the normoxia-related risk of increased S100-

A4 was not observed.

Protein S100-A6, which is also known as calcyclin, was previously identified

in chondrocytes (Lambrecht et al. 2010, Tsolis et al. 2015). The localization

of S100-A6 has been associated to chondrocyte membranes, but its

chondrocyte-specific roles are not well known (Matta et al. 2015). It appears

to have a cell type-specific nature (Donato et al. 2013). Previous studies have

revealed that S100-A6 can interact with the calcyclin-binding protein/Siah-

1-interacting protein (CacyBP/SIP), which involves the regulation of the

Hsp90 chaperone (Schneider and Filipek 2011, Góral et al. 2016).

CacyBP/SIP has been linked to many cellular functions, such as

ubiquitination, proliferation, differentiation and cytoskeletal

reorganizations. Therefore S100-A6 may have a regulative role for these

cellular activities (Schneider and Filipek 2011). Other proteins that interact

with S100-A6 are caldesmon, calponin, kinesin light chain and tropomyosin

(Donato et al. 2013). The long-term Rho-kinase inhibition at hypoxic

environment significantly decreased S100-A6 expression, but this reduction

could not be connected to any specific cellular response in this study. The

expression of S100-A6 has been shown to belong to the normal chondrocyte

proteome. Therefore, the functional roles of the calcium-binding modulator

S100-A6 are worth further studies.

64

The expression of S100-A8 protein is low in healthy chondrocytes (Yammani

2012). The increase of S100-A8 expression has been connected to osteoblast

differentiation. Furthermore, the co-expression of S100-A8 and S100-A9

proteins has been reported to relate to the hypertrophic status of

chondrocytes and further calcification and bone formation processes

(Zreiqat et al. 2007). It was notable that Y-27632 treatments at normoxic or

at hypoxic atmospheres did not influence the expression of these

osteoarthritic inflammation and hypertrophy-related S100 proteins.

Protein S100-A13 is known to form a complex with fibroblast growth factor 1

(FGF-1) and p40 synaptotagmin and it has been proposed to function in

cellular signal transduction (Ridinger et al. 2000). Like in many cases of

S100 proteins, its cellular localization is relatively well-known and there are

suggested roles for S100-A13. Still, the precise role of this protein in

chondrocytes is currently unknown. It is possible that Y-27632-induced

S100-A13 expression is a stress response that could interact with FGF-1. In

endometriosis, S100-A13 and FGF-1 participate in vascular remodeling and

angiogenesis (Hayrabedyan et al. 2005). Due to the origin of HCS-2/8 cells

and similar S100-A13 expression tendencies at both normoxia and hypoxia,

the activation of angiogenesis was not proposed as a response in this context.

The actual functions of S100-A13 in articular chondrocytes and cartilage

tissue will require additional studies.

One of the activation mechanisms of ezrin (ERM protein) relates to the

calcium-dependent binding of ezrin and S100-P (Austermann et al. 2008).

This kind of activation is involved in the increased cellular migration and

metastasis of endothelial cells. Moreover, extracellular S100-P can bind to

RAGE receptors and mediate tumor growth and metastasis related signaling

(Arumugam and Logsdon 2011). In the chondrocyte or chondrosarcoma, the

specific role of S100-P has not been previously reported. The long-term Y-

27632 influence on cellular migration was not monitored in this study, while

the short-term time-lapse monitoring did not reveal a constant increase in

cellular migration.

65

6. Conclusions Both human chondrosarcoma HCS-2/8 cells and primary fibroblasts have

been used in this thesis as in vitro cell models. The following conclusions can

be made based on the observed results.

An 8% cyclic cell stretching at a frequency of 1 Hz produces protein

phosphorylation changes in HCS-2/8 cells. The stretching stress

activates extracellular regulated kinase (ERK) signaling cascades

and induces protein phosphorylation responses that can be linked,

e.g., to the cytoskeleton and translational activities.

Short-term (72 hour) Rho-kinase inhibition by Y-27632 does not

induce chondrocytic gene expression in human foreskin fibroblasts

but induces functional responses. These include inhibition of

depolymerization of filamentous actin, increases in proliferation,

reduction of focal-adhesion related vinculin plaques and stimulation

of lateral cell migration.

The long-term culture of chondrosarcoma cells at low 5% oxygen

tension promotes COL2A1 and ACAN gene expression thereby

supporting the conservation of their chondrocytic phenotype. A

hypoxic atmosphere, similar to that of articular cartilage, is not

sufficient to produce an enhancement in the synthesis of cartilage

extracellular matrix proteins in HCS-2/8 cells.

Long-term (28-day) Rho-kinase inhibition at normoxia supports the

cartilage extracellular matrix gene expression in HCS-2/8 cells but

does not increase type II collagen production at the protein level.

Long-term Y-27632 exposure at 5% oxygen tension supports type II

collagen and aggrecan expression at the protein level. This increased

production can benefit cell-based cartilage repair techniques that

require extended in vitro cell culture.

The HCS-2/8 cellular model combining hypoxia and Rho-kinase

inhibition support the previous suggestion that S100A1 and S100B

gene and protein expression correlate to chondrocyte differentiation

status and can be used as markers for extracellular matrix

production.

66

Long-Term (28-day) Rho-kinase inhibition decreases LAT1 and

4F2hc expression in HCS-2/8 cells. The overexpression of

heterodimeric LAT1/4F2hc transporter relates to many cancers.

Inhibiting this transporter is one of the goals of current cancer

studies. Therefore the observed Y-27632 down-regulation of

LAT1/4F2hc might provide a new direction for Rho-kinase

inhibition as a cancer suppressing therapy.

67

Acknowledgements

I thank the chief supervisor Mikko Lammi for a great possibility to perform

my PhD thesis project in your research group. I appreciate your way to teach

and support to perform scientific studies with positive attitude and patience.

Your forward-looking visions have given new sights to design experiments

and utilize versatile techniques to solve scientific problems.

I thank co-supervisor Jukka Häyrinen for great introduction to protein

chemistry with a special focus on mass spectrometric analyses. Your advices

and criticism have been constructive and thought me to appreciate tough

working and precise working methods. I thank possibilities to take part in

teaching in your protein chemistry courses.

I thank all co-workers and co-authors for their advices and efforts to conduct

the surveys of this thesis. Chengjuan Qu, Markku Varjosalo, Joakim Bygdell,

Cecilia Fernández-Echevarría, Daniel Marcellino and Hannu Karjalainen,

you all have done excellent work and made important contributions to help

me perform the studies. I am grateful to Daniel Marcellino for revising the

language of this thesis. I also thank technicians Elina Reinikainen, Sini

Miettinen and Hanna Eskelinen of skillful technical assistance.

I thank honestly all our research group members. Most importantly, Juha

Prittinen and Janne Ylärinne, you have been great friends and I appreciate

greatly our on-going collaboration with biomechanical cartilage studies.

Anita Dreyer-Perkiömäki, Anna-Lena Tallander and Selamawit Kefela, I

thank you all your administrative work. Thanks for Göran Dahlgren of IT

support. I thank my examiner Per Lindström of your constructive opinions

and Per-Arne Oldenborg for encouraging comments and advices to finish my

studies in Umeå University.

I thank senior lecturers Maria Halmekytö, Sanna Ryhänen and Annikka

Linnala-Kankkunen of rewarding teaching tasks. I thank staff, colleagues

and friends in the Departments of Integrative Medical Biology (Umeå

University) and Institute of biomedicine (University of Eastern-Finland) who

has supported my thesis project during the years.

Special thanks to my parents Pirjo and Timo for your encouraging support

during my studies.

I am grateful for financial support from Finnish Cultural Foundation.

68

References

Altman RD, Manjoo A, Fierlinger A, Niazi F, Nicholls M. The mechanism of

action for hyaluronic acid treatment in the osteoarthritic knee: a systematic

review. BMC Musculoskelet Disord. 16: 321, 2015.

Amano M, Mukai H, Ono Y, Chihara K, Matsui T, Hamajima Y, Okawa K,

Iwamatsu A, Kaibuchi K. Identification of a putative target for Rho as the

serine-threonine kinase protein kinase N. Science. 271(5249): 648-650,

1996.

Antonioli E, Lobo AO, Ferretti M, Cohen M, Marciano FR, Corat EJ, Trava-

Airoldi VJ. An evaluation of chondrocyte morphology and gene expression

on superhydrophilic vertically-aligned multi-walled carbon nanotube films.

Mater Sci Eng C Mater Biol Appl. 33(2): 641-647, 2013.

Appleton CT, Usmani SE, Mort JS, Beier F. Rho/ROCK and MEK/ERK

activation by transforming growth factor-alpha induces articular cartilage

degradation. Lab Invest. 90(1): 20-30, 2010.

Armbruster DA and Pry T. Limit of blank, limit of detection and limit of

quantitation. Clin Biochem Rev. 29 (Suppl 1):S49-S52, 2008.

Arumugam T and Logsdon CD. S100P: a novel therapeutic target for cancer.

Amino Acids. 41(4): 893-899, 2011.

Asik M, Ciftci F, Sen C, Erdil M, Atalar A: The microfracture technique for

the treatment of full-thickness articular cartilage lesions of the knee:

midterm results. Arthroscopy. 24(11): 1214-1220, 2008.

Austermann J, Nazmi AR, Müller-Tidow C, Gerke V. Characterization of the

Ca2+ -regulated ezrin-S100P interaction and its role in tumor cell migration.

J Biol Chem. 283(43): 29331-29340, 2008.

Barre PE, Redini F, Boumediene K, Vielpeau C, Pujol JP. Semiquantitative

reverse transcription-polymerase chain reaction analysis of syndecan-1 and -

4 messages in cartilage and cultured chondrocytes from osteoarthritic joints.

Osteoarthritis Cartilage. 8(1): 34-43, 2000.

Barrett-Jolley R, Lewis R, Fallman R, Mobasheri A. The emerging

chondrocyte channelome. Front Physiol. 1: 135, 2010.

69

Bastow ER, Byers S, Golub SB, Clarkin SE, Pitsillides AA, Fosang AJ.

Hyaluronan synthesis and degradation in cartilage and bone. Cell Mol Life

Sci. 65(3): 395-413, 2008.

Bayliss MT, Osborne D, Woodhouse S, Davidson C. Sulfation of chondroitin

sulfate in human articular cartilage. The effect of age, topographical position,

and zone of cartilage on tissue composition. J Biol Chem. 274(22): 15892-

15900, 1999.

Bell DM, Leung KK, Wheatley SC, Ng LJ, Zhou S, Ling KW, Sham MH,

Koopman P, Tam PP, Cheah KS. SOX9 directly regulates the type-II collagen

gene. Nat Genet. 16(2): 174-178, 1997.

Betsunoh H, Fukuda T, Anzai N, Nishihara D, Mizuno T, Yuki H, Masuda A,

Yamaguchi Y, Abe H, Yashi M, Fukabori Y, Yoshida K, Kamai T. Increased

expression of system large amino acid transporter (LAT)-1 mRNA is

associated with invasive potential and unfavorable prognosis of human clear

cell renal cell carcinoma. BMC Cancer. 13:509, 2013.

Bishnoi M, Jain A, Hurkat P, Jain SK. Chondroitin sulphate: a focus on

osteoarthritis. Glycoconj J. 33(5): 693-705, 2016.

Bradford MM. A rapid and sensitive method for the quantitation of

microgram quantities of protein utilizing the principle of protein-dye

binding. Anal Biochem. 72: 248-254, 1976.

Braun HJ and Gold GE. Diagnosis of osteoarthritis: imaging. Bone. 51(2):

278-288, 2012.

Breyer J, Samarin J, Rehm M, Lautscham L, Fabry B, Goppelt-Struebe M.

Inhibition of Rho kinases increases directional motility of microvascular

endothelial cells. Biochem Pharmacol. 83(5): 616-626, 2012.

Brighton CT and Heppenstall RB. Oxygen tension in zones of the epiphyseal

plate, the metaphysis and diaphysis. An in vitro and in vivo study in rats and

rabbits. J Bone Joint Surg Am. 53(4): 719-728, 1971.

Brittberg M, Lindahl A, Nilsson A, Ohlsson C, Isaksson O, Peterson L:

Treatment of deep cartilage defects in the knee with autologous chondrocyte

transplantation. N Engl J Med. 331(14): 889-895, 1994.

Brittberg M and Winalski CS. Evaluation of cartilage injuries and repair. J

Bone Joint Surg Am. 85-A (Suppl 2): 58-69, 2003.

70

Burton-Wurster N, Liu W, Matthews GL, Lust G, Roughley PJ, Glant TT, Cs-

Szabó G. TGF beta 1 and biglycan, decorin, and fibromodulin metabolism in

canine cartilage. Osteoarthritis Cartilage. 11(3): 167-176, 2003.

Cai S and Exton JH. Determination of interaction sites of phospholipase D1

for RhoA. Biochem J. 355(Pt 3): 779-785, 2001.

Campanelli JT, Gayer GG, Scheller RH. Alternative RNA splicing that

determines agrin activity regulates binding to heparin and alpha-

dystroglycan. Development. 122(5): 1663-1672, 1996.

Carvalho RS, Yen EH, Suga DM. Glycosaminoglycan synthesis in the rat

articular disk in response to mechanical stress. Am J Orthod Dentofacial

Orthop. 107(4): 401-410, 1995.

Castañeda S, Roman-Blas JA, Largo R, Herrero-Beaumont G. Subchondral

bone as a key target for osteoarthritis treatment. Biochem Pharmacol. 83(3):

315-323, 2012.

Cau J and Hall A. Cdc42 controls the polarity of the actin and microtubule

cytoskeletons through two distinct signal transduction pathways. J Cell Sci.

118(Pt 12): 2579-2587, 2005.

Chakravarti S and Magnuson T. Localization of mouse lumican (keratan

sulfate proteoglycan) to distal chromosome 10. Mamm Genome. 6(5): 367-

368, 1995.

Chan KT, Bennin DA, Huttenlocher A. Regulation of adhesion dynamics by

calpain-mediated proteolysis of focal adhesion kinase (FAK). J Biol Chem.

285(15): 11418-11426, 2010.

Chandran PL and Horkay F. Aggrecan, an unusual polyelectrolyte: review of

solution behavior and physiological implications. Acta Biomater. 8(1): 3-12,

2012.

Chao PH, West AC, Hung CT. Chondrocyte intracellular calcium, cytoskeletal

organization, and gene expression responses to dynamic osmotic loading.

Am J Physiol Cell Physiol. 291(4): C718-C725, 2006.

Chapman S, McDermott DH, Shen K, Jang MK, McBride AA. The effect of

Rho kinase inhibition on long-term keratinocyte proliferation is rapid and

conditional. Stem Cell Res Ther. 5(2): 60, 2014.

71

Chirivino D, Del Maestro L, Formstecher E, Hupé P, Raposo G, Louvard D,

Arpin M. The ERM proteins interact with the HOPS complex to regulate the

maturation of endosomes. Mol Cell Biol. 22(3): 375-385, 2011.

Clark AL, Votta BJ, Kumar S, Liedtke W, Guilak F. Chondroprotective role of

the osmotically sensitive ion channel transient receptor potential vanilloid 4:

age- and sex-dependent progression of osteoarthritis in Trpv4-deficient

mice. Arthritis Rheum. 62(10): 2973-2983, 2010.

Clegg DO, Reda DJ, Harris CL, Klein MA, O’Dell JR, Hooper MM, Bradley

JD, Bingham CO 3rd, Weisman MH, Jackson CG, Lane NE, Cush JJ,

Moreland LW, Schumacher HR Jr, Oddis CV, Wolfe F, Molitor JA, Yocum

DE, Schnitzer TJ, Furst DE, Sawitzke AD, Shi H, Brandt KD, Moskowitz RW,

Williams HJ. Glucosamine, chondroitin sulfate, and the two in combination

for painful knee osteoarthritis. N Engl J Med. 354(8): 795-808, 2006.

Cormerais Y, Giuliano S, LeFloch R, Front B, Durivault J, Tambutté E,

Massard PA, de la Ballina LR, Endou H, Wempe MF, Palacin M, Parks SK,

Pouyssegur J. Genetic disruption of the multifunctional CD98/LAT1

complex demonstrates the key role of essential amino acid transport in the

control of mTORC1 and tumor growth. Cancer Res. 76(15): 4481-4492, 2016.

Correa D, Somoza RA, Lin P, Greenberg S, Rom E, Duesler L, Welter JF,

Yayon A, Caplan AI. Sequential exposure to fibroblast growth factors (FGF)

2, 9 and 18 enhances hMSC chondrogenic differentiation. Osteoarthritis

Cartilage. 23(3): 443-453, 2015.

Cortesio CL, Boateng LR, Piazza TM, Bennin DA, Huttenlocher A. Calpain-

mediated proteolysis of paxillin negatively regulates focal adhesion dynamics

and cell migration. J Biol Chem. 286(12): 9998-10006, 2011.

Costell M, Gustafsson E, Aszódi A, Mörgelin M, Bloch W, Hunziker E,

Addicks K, Timpl R, Fässler R. Perlecan maintains the integrity of cartilage

and some basement membranes. J Cell Biol. 147(5): 1109-1122, 1999.

Coyle CH, Izzo NJ, Chu CR. Sustained hypoxia enhances chondrocyte matrix

synthesis. J Orthop Res. 27(6): 793-799, 2009.

Croft D, Mundo AF, Haw R, Milacic M, Weiser J, Wu G, Caudy M, Garapati

P, Gillespie M, Kamdar MR, Jassal B, Jupe S, Matthews L, May B, Palatnik S,

Rothfels K, Shamovsky V, Song H, Williams M, Birney E, Hermjakob H,

Stein L, D’Eustachio P. The Reactome pathway knowledgebase. Nucleic

Acids Res. 42(D1):D472-D477 2014.

72

Cui D, Li L, Lou H, Sun H, Ngai SM, Shao G, Tang J. The ribosomal protein

S26 regulates p53 activity in response to DNA damage. Oncogene. 33(17):

2225-2235, 2014.

Cui L, Wu Y, Cen L, Zhou H, Yin S, Liu G, Liu W, Cao Y. Repair of articular

cartilage defect in non-weight bearing areas using adipose derived stem cells

loaded polyglycolic acid mesh. Biomaterials. 30(14): 2683-2693, 2009.

Diaz-Romero J, Quintin A, Schoenholzer E, Pauli C, Despont A, Zumstein

MA, Kohl S, Nesic D. S100A1 and S100B expression patterns identify

differentiation status of human articular chondrocytes. J Cell Physiol.

229(8): 1106-1117, 2014.

Dieppe PA and Lohmander LS. Pathogenesis and management of pain in

osteoarthritis. Lancet. 365(9463): 965-973, 2005.

Echtermeyer F, Bertrand J, Dreier R, Meinecke I, Neugebauer K, Fuerst M,

Lee YJ, Song YW, Herzog C, Theilmeier G, Pap T. Syndecan-4 regulates

ADAMTS-5 activation and cartilage breakdown in osteoarthritis. Nat Med.

15(9): 1072-1076, 2009.

da Costa BR, Reichenbach S, Keller N, Nartey L, Wandel S, Jüni P, Trelle S.

Effectiveness of non-steroidal anti-inflammatory drugs for the treatment of

pain in knee and hip osteoarthritis: a network meta-analysis. Lancet.

387(10033): 2093-2105, 2016.

Dawe HR, Minamide LS, Bamburg JR, Cramer LP. ADF/cofilin controls cell

polarity during fibroblast migration. Curr Biol. 13(3): 252-257, 2003.

De Witt MT, Handley CJ, Oakes BW, Lowther DA. In vitro response of

chondrocytes to mechanical loading. The effect of short term mechanical

tension. Connect Tissue Res. 12(2): 97-109, 1984.

Di Martino A, Kon E, Perdisa F, Sessa A, Filardo G, Neri MP, Bragonzoni L,

Marcacci M. Surgical treatment of early knee osteoarthritis with a cell-free

osteochondral scaffold: results at 24 months of follow-up. Injury. 46 (Suppl

8): S33-38, 2015.

Dijkgraaf LC, de Bont LG, Boering G, Liem RS. The structure, biochemistry,

and metabolism of osteoarthritic cartilage: a review of the literature. J Oral

Maxillofac Surg. 53(10): 1182-1192, 1995.

73

Ding B, Kirkiles-Smith NC, Pober JS. FOXO3a regulates oxygen-responsive

expression of tumor necrosis factor receptor 2 in human dermal

microvascular endothelial cells. J Biol Chem. 284(29): 19331-19339, 2009.

Doi H, Nishida K, Yorimitsu M, Komiyama T, Kadota Y, Tetsunaga T,

Yoshida A, Kubota S, Tagikawa M, Ozaki T. Interleukin-4 downregulates the

cyclic tensile stress-induced matrix metalloproteinases-13 and cathepsin B

expression by rat normal chondrocytes. Acta Med Okayama. 62(2): 119-126,

2008.

Donato R, Cannon BR, Sorci G, Riuzzi F, Hsu K, Weber DJ, Geczy CL.

Functions of S100 proteins. Curr Mol Med. 13(1): 24-57, 2013.

Duarte Campos DF, Drescher W, Rath B, Tingart M, Fischer H. Supporting

Biomaterials for Articular Cartilage Repair. Cartilage. 3(3): 205-221, 2012.

Dumbauld DW, Shin H, Gallant ND, Michael KE, Radhakrishna H, García

AJ. Contractility modulates cell adhesion strengthening through focal

adhesion kinase and assembly of vinculin-containing focal adhesions. J Cell

Physiol. 223(3): 746-756, 2010.

Duval E, Leclercq S, Elissalde JM, Demoor M, Galéra P, Boumédiene K.

Hypoxia-inducible factor 1alpha inhibits the fibroblast-like markers type I

and type III collagen during hypoxia-induced chondrocyte redifferentiation:

hypoxia not only induces type II collagen and aggrecan, but it also inhibits

type I and type III collagen in the hypoxia-inducible factor 1alpha-dependent

redifferentiation of chondrocytes. Arthritis Rheum. 60(10): 3038-3048,

2009.

Elder BD and Athanasiou KA. Hydrostatic pressure in articular cartilage

tissue engineering: from chondrocytes to tissue regeneration. Tissue Eng

Part B Rev. 15(1): 43-53, 2009a.

Elder BD and Athanasiou KA. Effects of temporal hydrostatic pressure on

tissue-engineered bovine articular cartilage constructs. Tissue Eng Part A.

15(5): 1151-1158, 2009b.

Eldridge S, Nalesso G, Ismail H, Vicento-Greco K, Kabouridis P,

Ramachandran M, Niemeier A, Herz J, Pitzalis C, Perretti M, Dell’Accio F.

Agrin mediates chondrocyte homeostasis and requires both LRP4 and α-

dystroglycan to enhance cartilage formation in vitro and in vivo. Ann Rheum

Dis. 75(6): 1228-1235, 2016.

74

Elenius K and Jalkanen M. Function of the syndecans-a family of cell surface

proteoglycans. J Cell Sci. 107(Pt 11): 2975-2982, 1994.

Ellman MB, Yan D, Ahmadinia K, Chen D, An HS, Im HJ. Fibroblast growth

factor control of cartilage homeostasis. J Cell Biochem. 114(4): 735-742,

2013.

Eyre D. Collagen of articular cartilage. Arthritis Res. 4(1): 30-35, 2002.

Fabregat A, Sidiropoulos K, Garapati P, Gillespie M, Hausmann K, Haw R,

Jassal B, Jupe S, Korninger F, McKay S, Matthews L, May B, Milacic M,

Rothfels K, Shamovsky V, Webber M, Weiser J, Williams M, Wu G, Stein L,

Hermjakob H, D’Eustachio P. The Reactome pathway Knowledgebase.

Nucleic Acids Res. 44(D1): D481-487, 2016.

Falah M, Nierenberg G, Soudry M, Hayden M, Volpin G. Treatment of

articular cartilage lesions of the knee. Int Orthop. 34(5): 621-630, 2010.

Fanning PJ, Emkey G, Smith RJ, Grodzinsky AJ, Szasz N, Trippel SB.

Mechanical regulation of mitogen-activated protein kinase signaling in

articular cartilage. J Biol Chem. 278(51): 50940-50948, 2003.

Farndale RW, Buttle DJ, Barrett AJ. Improved quantitation and

discrimination of sulphated glycosaminoglycans by use of

dimethylmethylene blue. Biochim Biophys Acta. 883(2): 173-177, 1986.

Fíla J and Honys D. Enrichment techniques employed in

phosphoproteomics. Amino Acids. 43(3): 1025-1047, 2012.

Fraser JR, Laurent TC and Laurent UB. Hyaluronan: its nature, distribution,

functions and turnover. J Intern Med. 242(1): 27-33, 1997.

Ferdous Z, Wei VM, Iozzo R, Höök M, Grande-Allen KJ. Decorin-

transforming growth factor- interaction regulates matrix organization and

mechanical characteristics of three-dimensional collagen matrices. J Biol

Chem. 282(49): 35887-35898, 2007.

Fermor B, Christensen SE, Youn I, Cernanec JM, Davies CM, Weinberg JB.

Oxygen, nitric oxide and articular cartilage. Eur Cell Mater. 13: 56-65, 2007.

Fermor B, Gurumurthy A, Diekman BO. Hypoxia, RONS and energy

metabolism in articular cartilage. Osteoarthritis Cartilage. 18(9): 1167-1173,

2010.

75

Filardo G, Vannini F, Marcacci M, Andriolo L, Ferruzzi A, Giannini S, Kon E.

Matrix-assisted autologous chondrocyte transplantation for cartilage

regeneration in osteoarthritic knees: results and failures at midterm follow-

up. Am J Sports Med. 41(1): 95-100, 2013.

Filmus J, Capurro M, Rast J. Glypicans. Genome Biol. 9(5): 224, 2008.

Fotiadis D, Kanai Y, Palacín M. The SLC3 and SLC7 families of amino acid

transporters. Mol Aspects Med. 34(2-3): 139-158, 2013.

Fotovati A, Abu-Ali S, Kage M, Shirouzu K, Yamana H, Kuwano M. N-myc

downstream-regulated gene 1 (NDRG1) a differentiation marker of human

breast cancer. Pathol Oncol Res. 17(3): 525-533, 2011.

Freitag J, Bates D, Boyd R, Shah K, Barnard A, Huguenin L, Tenen A.

Mesenchymal stem cell therapy in the treatment of osteoarthritis: reparative

pathways, safety and efficacy - a review. BMC Musculoskelet Disord. 17: 230,

2016.

Fujisawa T, Hattori T, Takahashi K, Kuboki T, Yamashita A, Takigawa M.

Cyclic mechanical stress induces extracellular matrix degradation in cultured

chondrocytes via gene expression of matrix metalloproteinases and

interleukin-1. J Biochem. 125(5): 966-975, 1999.

Fukuda K, Asada S, Kumano F, Saitoh M, Otani K, Tanaka S. Cyclic tensile

stretch on bovine articular chondrocytes inhibits protein kinase C activity. J

Lab Clin Med. 130(2): 209-215, 1997.

Funderburgh JL. Keratan sulfate biosynthesis. IUBMB Life. 54(4): 187-194,

2002.

Funderburgh JL. Keratan sulfate: structure, biosynthesis, and function.

Glycobiology. 10(10): 951-958, 2000.

Furumatsu T, Matsumoto-Ogawa E, Tanaka T, Lu Z, Ozaki T. ROCK

inhibition enhances aggrecan deposition and suppresses matrix

metalloproteinase-3 production in human articular chondrocytes. Connect

Tissue Res. 55(2): 89-95, 2014.

Furuya M, Horiguchi J, Nakajima H, Kanai Y, Oyama T. Correlation of L-

type amino acid transporter 1 and CD98 expression with triple negative

breast cancer prognosis. Cancer Sci. 103(2): 382-389, 2012.

76

Fülöp C, Walcz E, Valyon M, Glant TT. Expression of alternatively spliced

epidermal growth factor-like domains in aggrecans of different species.

Evidence for a novel module. J Biol Chem. 268(23): 17377-17383, 1993.

Gandhi NS and Mancera RL. The structure of glycosaminoglycans and their

interactions with proteins. Chem Biol Drug Des. 72(6): 455-482, 2008.

García-Campos MA, Espinal-Enríquez J, Hernández-Lemus E. Pathway

Analysis: State of the Art. Front Physiol. 6: 383, 2015.

Garcia-Mata R, Boulter E, Burridge K. The 'invisible hand': regulation of

RHO GTPases by RHOGDIs. Nat Rev Mol Cell Biol. 12(8): 493-504, 2011.

Garg HG, Yu L, Hales CA, Toida T, Islam T, Linhardt RJ. Sulfation patterns

in heparin and heparan sulfate: effects on the proliferation of bovine

pulmonary artery smooth muscle cells. Biochim Biophys Acta. 1639(3): 225-

231, 2003.

Garnock-Jones KP. Ripasudil: first global approval. Ripasudil. Drugs. 74(18):

2211-2215, 2014.

Gavénis K, Kremer A, Von Walter M, Hollander DA, Schneider U, Schmidt-

Rohlfing B. Effects of cyclic hydrostatic pressure on the metabolism of

human osteoarthritic chondrocytes cultivated in a collagen gel. Artif Organs.

31(2): 91-98, 2007.

Gentile P, Chiono V, Carmagnola I, Hatton PV. An overview of poly(lactic-co-

glycolic) acid (PLGA)-based biomaterials for bone tissue engineering. Int J

Mol Sci. 15(3): 3640-3659, 2014.

Gibson JS, Milner PI, White R, Fairfax TP, Wilkins RJ. Oxygen and reactive

oxygen species in articular cartilage: modulators of ionic homeostasis.

Pflugers Arch. 455(4): 563-573, 2008.

Goetsch KP, Snyman C, Myburgh KH, Niesler CU. ROCK-2 is associated with

focal adhesion maturation during myoblast migration. J Cell Biochem.

115(7): 1299-1307, 2014.

Goldring MB and Otero M. Inflammation in osteoarthritis. Curr Opin

Rheumatol. 23(5): 471-478, 2011.

77

Góral A, Bieganowski P, Prus W, Krzemień-Ojak Ł, Kądziołka B, Fabczak H,

Filipek A. Calcyclin binding protein/Siah-1 interacting protein is a Hsp90

binding chaperone. PLoS One. 11(6): e0156507, 2016.

Gould SE, Upholt WB and Kosher RA. Syndecan 3: a member of the

syndecan family of membrane-intercalated proteoglycans that is expressed

in high amounts at the onset of chicken limb cartilage differentiation. Proc

Natl Acad Sci USA. 89(8): 3271-3275, 1992.

Grimshaw MJ and Mason RM. Bovine articular chondrocyte function in vitro

depends upon oxygen tension. Osteoarthritis Cartilage. 8(5): 386-392, 2000.

Grover J, Chen XN, Korenberg JR, Roughley PJ. The human lumican gene.

Organization, chromosomal location, and expression in articular cartilage. J

Biol Chem. 270(37): 21942-21949, 1995.

Grover J and Roughley PJ. Expression of cell-surface proteoglycan mRNA by

human articular chondrocytes. Biochem J. 309(Pt 3): 963-968, 1995.

Grover J and Roughley PJ. Versican gene expression in human articular

cartilage and comparison of mRNA splicing variation with aggrecan.

Biochem J. 291(Pt 2): 361-367, 1993.

Gudas R, Kalesinskas RJ, Kimtys V, Stankevicius E, Toliusis V, Bernotavicius

G, Smailys A. A prospective randomized clinical study of mosaic

osteochondral autologous transplantation versus microfracture for the

treatment of osteochondral defects in the knee joint in young athletes.

Arthroscopy. 21(9): 1066-1075, 2005.

Guilak F. Compression-induced changes in the shape and volume of the

chondrocyte nucleus. J Biomech. 28(12): 1529-1541, 1995.

Guilluy C, Garcia-Mata R, Burridge K. Rho protein crosstalk: another social

network? Trends Cell Biol 21(12): 718-726, 2011.

Hall AC, Urban JP, Gehl KA. The effects of hydrostatic pressure on matrix

synthesis in articular cartilage. J Orthop Res. 9(1): 1-10, 1991.

Hall BK and Miyake T. All for one and one for all: condensations and the

initiation of skeletal development. Bioessays. 22(2): 138-147, 2000.

78

Hambly K, Bobic V, Wondrasch B, Van Assche D, Marlovits S. Autologous

chondrocyte implantation postoperative care and rehabilitation: science and

practice. Am J Sports Med. 34(6): 1020-1038, 2006.

Han YC, Lim Y, Duffieldl MD, Li H, Liu J, Abdul Manaph NP, Yang M,

Keating DJ, Zhou XF. Direct reprogramming of mouse fibroblasts to neural

stem cells by small molecules. Stem Cells Int. 2016, doi:

10.1155/2016/4304916.

Hannan MT, Felson DT, Pincus T. Analysis of the discordance between

radiographic changes and knee pain in osteoarthritis of the knee. J

Rheumatol. 27(6): 1513-1517, 2000.

Hara S, Hamada J, Kobayashi C, Kondo Y, Imura N. Expression and

characterization of hypoxia-inducible factor (HIF)-3alpha in human kidney:

suppression of HIF-mediated gene expression by HIF-3alpha. Biochem

Biophys Res Commun. 287(4): 808-813, 2001.

Hardingham TE and Fosang AJ. Proteoglycans: many forms and many

functions. FASEB J. 6(3): 861-870, 1992.

Haudenschild DR, Chen J, Pang N, Lotz MK, D’Lima DD. Rho kinase-

dependent activation of SOX9 in chondrocytes. Arthritis Rheum. 62(1): 191-

200, 2010.

Haudenschild DR, Nguyen B, Chen J, D’Lima DD, Lotz MK. Rho kinase-

dependent CCL20 induced by dynamic compression of human chondrocytes.

Arthritis Rheum. 58(9): 2735-2742, 2008.

Hayrabedyan S, Kyurkchiev S, Kehayov I. FGF-1 and S100A13 possibly

contribute to angiogenesis in endometriosis. J Reprod Immunol. 67(1-2): 87-

101, 2005.

Hdud IM, Mobasheri A, Loughna PT. Effects of cyclic equibiaxial mechanical

stretch on α-BK and TRPV4 expression in equine chondrocytes.

Springerplus. 3: 59, 2014.

Hedlund H, Mengarelli-Widholm S, Reinholt FP, Svensson O. Stereologic

studies on collagen in bovine articular cartilage. APMIS. 101(2): 133-140,

1993.

79

Heikkilä M, Pasanen A, Kivirikko KI, Myllyharju J. Roles of the human

hypoxia-inducible factor (HIF)-3α variants in the hypoxia response. Cell Mol

Life Sci. 68(23): 3885-3901, 2011.

Hochberg MC, Martel-Pelletier J, Monfort J, Möller I, Castillo JR, Arden N,

Berenbaum F, Blanco FJ, Conaghan PG, Doménech G, Henrotin Y, Pap T,

Richette P, Sawitzke A, du Souich P, Pelletier JP, MOVES Investigation

group. Combined chondroitin sulfate and glucosamine for painful knee

osteoarthritis: a multicentre, randomised, double-blind, non-inferiority trial

versus celecoxib. Ann Rheum Dis. 75(1): 37-44, 2016.

Honda K, Ohno S, Tanimoto K, Iljuin C, Tanaka N, Doi T, Kato Y, Tanne K.

The effects of high magnitude cyclic tensile load on cartilage matrix

metabolism in cultured chondrocytes. Eur J Cell Biol. 79(9): 601-609, 2000.

Hopkins AM, Pineda AA, Winfree LM, Brown GT, Laukoetter MG, Nusrat A.

Organized migration of epithelial cells requires control of adhesion and

protrusion through Rho kinase effectors. Am J Physiol Gastrointest Liver

Physiol. 292(3): G806-G817, 2003.

Hu CJ, Wang LY, Chodosh LA, Keith B, Simon MC. Differential roles of

hypoxia-inducible factor 1alpha (HIF-1alpha) and HIF-2alpha in hypoxic

gene regulation. Mol Cell Biol. 23(24): 9361-9374, 2003.

Hu JC and Athanasiou KA. The effects of intermittent hydrostatic pressure

on self-assembled articular cartilage constructs. Tissue Eng. 12(5): 1337-

1344, 2006.

Huang da W, Sherman BT, Lempicki RA. Systematic and integrative analysis

of large gene lists using DAVID Bioinformatics Resources. Nat Protoc. 4(1):

44-57, 2009a.

Huang da W, Sherman BT, Lempicki RA. Bioinformatics enrichment tools:

paths toward the comprehensive functional analysis of large gene lists.

Nucleic Acids Res. 37(1): 1-13, 2009b.

Huang J, Ballou LR, Hasty KA. Cyclic equibiaxial tensile strain induces both

anabolic and catabolic responses in articular chondrocytes. Gene. 404(1-2):

101-109, 2007.

80

Huang LE, Gu J, Schau M, Bunn HF. Regulation of hypoxia-inducible factor

1alpha is mediated by an O2-dependent degradation domain via the

ubiquitin-proteasome pathway. Proc Natl Acad Sci U S A. 95(14): 7987-7992,

1998.

Hunter DJ, McDougall JJ, Keefe FJ. The symptoms of osteoarthritis and the

genesis of pain. Rheum Dis Clin North Am. 34(3): 623-643, 2008.

Hunziker EB, Quinn TM, Häuselmann HJ. Quantitative structural

organization of normal adult human articular cartilage. Osteoarthritis

Cartilage. 10(7): 564-572, 2002.

Ikenoue T, Trindade MC, Lee MS, Lin EY, Schurman DJ, Goodman SB,

Smith RL. Mechanoregulation of human articular chondrocyte aggrecan and

type II collagen expression by intermittent hydrostatic pressure in vitro. J

Orthop Res. 21(1): 110-116, 2003.

Imamura F, Mukai M, Ayaki M, Akedo H. Y-27632, an inhibitor of rho-

associated protein kinase, suppresses tumor cell invasion via regulation of

focal adhesion and focal adhesion kinase. Jpn J Cancer Res. 91(8): 811-816,

2000.

Iozzo RV and Schaefer L. Proteoglycan form and function: A comprehensive

nomenclature of proteoglycans. Matrix Biol. 42: 11-55, 2015.

Ishizaki T, Uehata M, Tamechika I, Keel J, Nonomura K, Maekawa M,

Narumiya S. Pharmacological properties of Y-27632, a specific inhibitor of

rho-associated kinases. Mol Pharmacol. 57(5): 976-983, 2000.

Itano N, Sawai T, Yoshida M, Lenas P, Yamada Y, Imagawa M, Shinomura T,

Hamaguchi M, Yoshida Y, Ohnuki Y, Miyauchi S, Spicer AP, McDonald JA,

Kimata K. Three isoforms of mammalian hyaluronan synthases have distinct

enzymatic properties. J Biol Chem. 274(35): 25085-25092, 1999.

Jaakkola P, Mole DR, Tian YM, Wilson MI, Gielbert J, Gaskell SJ, von

Kriegsheim A, Hebestreit HF, Mukherji M, Schofield CJ, Maxwell PH, Pugh

CW, Ratcliffe CJ. Targeting of HIF-alpha to the von Hippel-Lindau

ubiquitylation complex by O2-regulated prolyl hydroxylation. Science.

292(5516): 468-472, 2001.

Jacobi M, Villa V, Magnussen RA, Neyret P. MACI - a new era? Sports Med

Arthrosc Rehabil Ther Technol. 3(1): 10, 2011.

81

Jakob RP, Franz T, Gautier E, Mainil-Varlet P: Autologous osteochondral

grafting in the knee: indication, results, and reflections. Clin Orthop Relat

Res. 401: 170-184, 2002.

Jiang L, Wen J, Luo W. Rho-associated kinase inhibitor, Y-27632, inhibits

the invasion and proliferation of T24 and 5367 bladder cancer cells. Mol Med

Rep. 12(5): 7526-7530, 2015.

Jin M, Frank EH, Quinn TM, Hunziker EB, Grodzinsky AJ. Tissue shear

deformation stimulates proteoglycan and protein biosynthesis in bovine

cartilage explants. Arch Biochem Biophys. 395(1): 41-48, 2001.

Jo CH, Lee YG, Shin WH, Kim H, Chai JW, Jeong EC, Kim JE, Shim H, Shin

JS, Shin IS, Ra JC, Oh S, Yoon KS. Intra-articular injection of mesenchymal

stem cells for the treatment of osteoarthritis of the knee: a proof-of-concept

clinical trial. Stem Cells. 32(5): 1254-1266, 2014.

Johnson HJ, Rosenberg L, Choi HU, Garza S, Höök M, Neame PJ.

Characterization of epiphycan, a small proteoglycan with a leucine-rich

repeat core protein. J Biol Chem. 272(30): 18709-18717, 1997.

Kaira K, Oriuchi N, Takahashi T, Nakagawa K, Ohde Y, Okumura T,

Murakami H, Shukuya T, Kenmotsu H, Naito T, Kanai Y, Endo M, Kondo H,

Nakajima T, Yamamoto N. L-type amino acid transporter 1 (LAT1)

expression in malignant pleural mesothelioma. Anticancer Res. 31(12): 4075-

4082, 2011.

Kaira K, Sunose Y, Arakawa K, Ogawa T, Sunaga N, Shimizu K, Tominaga H,

Oriuchi N, Itoh H, Nagamori S, Kanai Y, Segawa A, Furuya M, Mori M,

Oyama T, Takeyoshi I. Prognostic significance of L-type amino-acid

transporter 1 expression in surgically resected pancreatic cancer. Br J

Cancer. 107(4): 632-638, 2012.

Kaitsuka T and Matsushita M. Regulation of translation factor EEF1D gene

function by alternative splicing. Int J Mol Sci. 16(2): 3970-3979, 2015.

Kang ML and Im GI. Drug delivery systems for intra-articular treatment of

osteoarthritis. Expert Opin Drug Deliv. 11(2): 269-282, 2014.

Karjalainen HM, Sironen RK, Elo MA, Kaarniranta K, Takigawa M,

Helminen HJ, Lammi MJ. Gene expression profiles in chondrosarcoma cells

subjected to cyclic stretching and hydrostatic pressure. A cDNA array study.

Biorheology. 40(1-3): 93-100, 2003.

82

Karsdal MA, Michaelis M, Ladel C, Siebuhr AS, Bihlet AR, Andersen JR,

Guehring H, Christiansen C, Bay-Jensen AC, Kraus VB. Disease-modifying

treatments for osteoarthritis (DMOADs) of the knee and hip: lessons learned

from failures and opportunities for the future. Osteoarthritis Cartilage.

24(12): 2013-2021, 2016.

Katz JN, Earp BE and Gomoll AH. Surgical management of osteoarthritis.

Arthritis Care Res. 62(9): 1220-1228, 2010.

Kiani C, Chen L, Wu YJ, Yee AJ, Yang BB. Structure and function of

aggrecan. Cell Res. 12(1): 19-32, 2002.

Kim CW, Goldberger OA, Gallo RL, Bernfield M. Members of the syndecan

family of heparan sulfate proteoglycans are expressed in distinct cell-, tissue-

and development-specific patterns. Mol Biol Cell. 5(7): 797-805, 1994.

Kim SG, Kim HH, Kim HK, Kim CH, Chun HS, Kanai Y, Endou H, Kim DK.

Differential expression and functional characterization of system L amino

acid transporters in human normal osteoblast cells and osteogenic sarcoma

cells. Anticancer Res. 26(3A): 1989-1996, 2006.

Kimura K, Ito M, Amano M, Chihara K, Fukata Y, Nakafuku M, Yamamori B,

Feng J, Nakano T, Okawa K, Iwamatsu A, Kaibuchi K. Regulation of myosin

phosphatase by Rho and Rho-associated kinase (Rho-kinase). Science.

273(5272): 245-248, 1996.

Kloc M, Li XC, Ghobrial RM. RhoA cytoskeletal pathway to transplantation.

J Immunol Clin Res. 2(1): 1012, 2014.

Knight MM, Toyoda T, Lee DA, Bader DL. Mechanical compression and

hydrostatic pressure induce reversible changes in actin cytoskeletal

organisation in chondrocytes in agarose. J Biomech. 39(8): 1547-1551, 2006.

Knutsen G, Engebretsen L, Ludviqsen TC, Drogset JO, Grøntvedt T, Solheim

E, Strand T, Roberts S, Isaksen V, Johansen O. Autologous chondrocyte

implantation compared with microfracture in the knee. A randomized trial. J

Bone Joint Surg Am. 86-A(3): 455-464, 2004.

Koay EJ and Athanasiou KA. Hypoxic chondrogenic differentiation of

human embryonic stem cells enhances cartilage protein synthesis and

biomechanical functionality. Osteoarthritis Cartilage. 16(12): 1450-1456,

2008.

83

Kobe B and Deisenhofer J. The leucine-rich repeat: a versatile binding motif.

Trends Biochem Sci. 19(10): 415-421, 1994.

Koh YG, Jo SB, Kwon OR, Suh DS, Lee SW, Park SH, Choi YJ. Mesenchymal

stem cell injections improve symptoms of knee osteoarthritis. Arthroscopy.

29(4): 748-755, 2013.

Koivunen P, Salo KE, Myllyharju J, Ruddock LW. Three binding sites in

protein-disulfide isomerase cooperate in collagen prolyl 4-hydroxylase

tetramer assembly. J Biol Chem. 280(7): 5227-5235, 2004.

Kokenyesi R and Bernfield M. Core protein structure and sequence

determine the site and presence of heparan sulfate and chondroitin sulfate

on syndecan-1. J Biol Chem. 269(16): 12304-12309, 1994.

Kon E, Filardo G, Di Matteo B, Perdisa F, Marcacci M. Matrix assisted

autologous chondrocyte transplantation for cartilage treatment: A systematic

review. Bone Joint Res. 2(2): 18-25, 2013.

Kopakkala-Tani M, Elo MA, Sironen RK, Helminen HJ, Lammi MJ. High

hydrostatic pressure induces ERK and PI3 kinase phosphorylation in human

HCS-2/8 chondrosarcoma cells. Cell Mol Biol. 50(4): 485-490, 2004.

Koshi H, Sano T, Handa T, Yanagawa T, Saitou K, Nagamori S, Kanai Y,

Takagishi K, Oyama T. L-type amino acid transporter-1 and CD98 expression

in bone and soft tissue tumors. Pathol Int. 65(9): 460-467, 2015.

Kotani H, Takaishi K, Sasaki T, Takai Y. Rho regulates association of both

the ERM family and vinculin with the plasma membrane in MDCK cells.

Oncogene. 14(14): 1705-1713, 1997.

Kreuger J and Kjellén L. Heparan sulfate biosynthesis: regulation and

variability. J Histochem Cytochem. 60(12): 898-907, 2012.

Krusius T, Finne J, Margolis RK, Margolis RU. Identification of an O-

glycosidic mannose-linked sialylated tetrasaccharide and keratan sulfate

oligosaccharides in the chondroitin sulfate proteoglycan of brain. J Biol

Chem. 261(18): 8237-8242, 1986.

Krych AJ, Harnly HW, Rodeo SA, Williams RJ 3rd: Activity levels are higher

after osteochondral autograft transfer mosaicplasty than after microfracture

for articular cartilage defects of the knee: aretrospective comparative study. J

Bone Joint Surg Am. 94(11): 971-978, 2012.

84

Kumar D and Lassar AB. The transcriptional activity of Sox9 in chondrocytes

is regulated by RhoA signaling and actin polymerization. Mol Cell Biol.

29(15): 4262-4273, 2009.

Kurita T, Yamamura H, Suzuki Y, Giles WR, Imaizumi Y. The ClC-7 chloride

channel is downregulated by hypoosmotic stress in human chondrocytes.

Mol Pharmacol. 88(1): 113-120, 2015.

Lafont JE, Talma S, Hopfgarten C, Murphy CL. Hypoxia promotes the

differentiated human articular chondrocyte phenotype through SOX9-

dependent and -independent pathways. J Biol Chem. 283(8): 4778-4786,

2008.

Lammi MJ, Inkinen R, Parkkinen JJ, Häkkinen T, Jortikka M, Nelimarkka

LO, Järveläinen HT, Tammi MI. Expression of reduced amounts of

structurally altered aggrecan in articular cartilage chondrocytes exposed to

high hydrostatic pressure. Biochem J. 304(Pt 3): 723-730, 1994.

Lambrecht S, Dhaenens M, Almqvist F, Verdonk P, Verbruggen G, Deforce

D, Elewaut D. Proteome characterization of human articular chondrocytes

leads to novel insights in the function of small heat-shock proteins in

chondrocyte homeostasis. Osteoarthritis Cartilage. 18(3): 440-446, 2010.

Lane Smith R, Trindade MC, Ikenoue T, Mohtai M, Das P, Carter DR,

Goodman SB, Schurman DJ. Effects of shear stress on articular chondrocyte

metabolism. Biorheology. 37(1-2): 95-107, 2000.

Laurent TC, Laurent UB, Fraser JR. The structure and function of

hyaluronan: An overview. Immunol Cell Biol. 74(2): A1-A7, 1996.

Le Clainche C and Carlier MF. Regulation of actin assembly associated with

protrusion and adhesion in cell migration. Physiol Rev. 88(2): 489-513,

2008.

Le Clainche C, Dwivedi SP, Didry D, Carlier MF. Vinculin is a dually

regulated actin filament barbed end-capping and side-binding protein. J Biol

Chem. 285(30): 23420-23432, 2010.

Lee CY, Liu X, Hsu HC, Wang DY, Luo ZP. A modified cell culture method

for autologous chondrocyte transplantation. Connect Tissue Res. 46(2):93-

99, 2005.

85

Lee HH, Chang CC, Shieh MJ, Wang JP, Chen YT, Young TH, Hung SC.

Hypoxia enhances chondrogenesis and prevents terminal differentiation

through PI3K/Akt/FoxO dependent anti-apoptotic effect. Sci Rep. 3: 2683,

2013.

Lee MS, Ikenoue T, Trindade MC, Wong N, Goodman SB, Schurman DJ,

Smith RL. Protective effects of intermittent hydrostatic pressure on

osteoarthritic chondrocytes activated by bacterial endotoxin in vitro. J

Orthop Res. 21(1): 117-122, 2003.

Lee RB and Urban JB. Evidence for a negative Pasteur effect in articular

cartilage. Biochem J. 321(Pt 1): 95-102, 1997.

Lefebvre V and Dvir-Ginzberg M. SOX9 and the many facets of its regulation

in the chondrocyte lineage. Connect Tissue Res. 58(1): 2-14, 2017.

Lewis R, Feetham CH, Barrett-Jolley R. Cell volume regulation in

chondrocytes. Cell Physiol Biochem. 28(6): 1111-1122, 2011.

Li TF, O’Keefe RJ, Chen D. TGF-beta signaling in chondrocytes. Front Biosci.

10: 681-688, 2005.

Li Y, Zhou J, Yang X, Jiang Y, Gui J. Intermittent hydrostatic pressure

maintains and enhances the chondrogenic differentiation of cartilage

progenitor cells cultivated in alginate beads. Dev Growth Differ. 58(2): 180-

193, 2016.

Lin C, McGough R, Aswad B, Block JA, Terek R. Hypoxia induces HIF-

1alpha and VEGF expression in chondrosarcoma cells and chondrocytes. J

Orthop Res. 22(6): 1175-1181, 2004.

Liu H, Sadygov RG, Yates JR 3rd. A model for random sampling and

estimation of relative protein abundance in shotgun proteomics. Anal Chem.

76(14): 4193-4201, 2004.

Liu Y, Shu XZ and Prestwich GD. Osteochondral defect repair with

autologous bone marrow-derived mesenchymal stem cells in an injectable, in

situ, cross-linked synthetic extracellular matrix. Tissue Eng. 12(12): 3405-

3416, 2006.

Loeser RF. Integrins and chondrocyte-matrix interactions in articular

cartilage. Matrix Biol. 39: 11-16, 2014.

86

López-Casillas F, Payne HM, Andres JL, Massagué J. Betaglycan can act as a

dual modulator of TGF-beta access to signaling receptors: mapping of ligand

binding and GAG attachment sites. J Cell Biol. 124(4): 557-568, 1994.

Lund-Olesen K. Oxygen tension in synovial fluids. Arthritis Rheum. 13(6):

769-776, 1970.

MacCoss MJ, Wu CC, Liu H, Sadygov R, Yates JR 3rd. A correlation

algorithm for the automated quantitative analysis of shotgun proteomics

data. Anal Chem. 75(24): 6912-6921, 2003.

Madaule P, Eda M, Watanabe N, Fujisawa K, Matsuoka T, Bito H, Ishizaki T,

Narumiya S. Role of citron kinase as a target of the small GTPase Rho in

cytokinesis. Nature. 394(6692): 491-494, 1998.

Madhavan S, Anghelina M, Rath-Deschner B, Wypasek E, John A, Deschner

J, Piesco N, Agarwal S. Biomechanical signals exert sustained attenuation of

proinflammatory gene induction in articular chondrocytes. Osteoarthritis

Cartilage. 14(10): 1023-1032, 2006.

Maekawa M, Ishizaki T, Boku S, Watanabe N, Fujita A, Iwamatsu A, Obinata

T, Ohashi K, Mizuno K, Narumiya S. Signaling from Rho to the actin

cytoskeleton through protein kinases ROCK and LIM-kinase. Science.

285(5429): 895-898, 1999.

Magdalena J, Millard TH, Machesky LM. Microtubule involvement in NIH

3T3 Golgi and MTOC polarity establishment. J Cell Sci. 116(Pt 4): 743-756,

2003.

Malmström A, Bartolini B, Thelin MA, Pacheco B, Maccarana M. Iduronic

acid in chondroitin/dermatan sulfate: biosynthesis and biological function. J

Histochem Cytochem. 60(12): 916-925, 2012.

Mann M and Wilm M. Error-tolerant identification of peptides in sequence

databases by peptide sequence tags. Anal Chem. 66(24): 4390-4399, 1994.

Markway BD, Cho H, Zilberman-Rudenko J, Holden P, McAlinden A,

Johnstone B. Hypoxia-inducible factor 3-alpha expression is associated with

the stable chondrocyte phenotype. J Orthop Res. 33(11): 1561-1570, 2015.

87

Marshall AD, van Geldermalsen M, Otte NJ, Anderson LA, Lum T, Vellozzi

MA, Zhang BK, Thoeng A, Wang Q, Rasko JE, Holst J. LAT1 is a putative

therapeutic target in endometrioid endometrial carcinoma. Int J Cancer.

139(11): 2529-2539, 2016.

Martin K, Reimann A, Fritz RD, Ryu H, Jeon NL, Pertz O. Spatio-temporal

co-ordination of RhoA, Rac1 and Cdc42 activation during prototypical edge

protrusion and retraction dynamics. Sci Rep. 6: 21901, 2016.

Masuda T, Tomita M, Ishihama Y. Phase transfer surfactant-aided trypsin

digestion for membrane proteome analysis. J Proteome Res. 7(2): 731-740,

2008.

Mawatari T, Lindsey DP, Harris AH, Goodman SB, Maloney WJ, Smith RL.

Effects of tensile strain and fluid flow on osteoarthritic human chondrocyte

metabolism in vitro. J Orthop Res. 28(7): 907-913, 2010.

Matsukawa M, Fukuda K, Yamasaki K, Yoshida K, Munakata H, Hamanishi

C. Enhancement of nitric oxide and proteoglycan synthesis due to cyclic

tensile strain loaded on chondrocytes attached to fibronectin. Inflamm Res.

53(6): 239-244, 2004.

Matsumoto E, Furumatsu T, Kanazawa T, Tamura M, Ozaki T. ROCK

inhibitor prevents the dedifferentiation of human articular chondrocytes.

Biochem Biophys Res Commun. 420(1): 124-129, 2012.

Matsumoto K, Kamiya N, Suwan K, Atsumi F, Shimizu K, Shinomura T,

Yamada Y, Kimata K, Watanabe H. Identification and characterization of

versican/PG-M aggregates in cartilage. J Biol Chem. 281(26): 18257-18263,

2006.

Matsumoto K, Shionyu M, Go M, Shimizu K, Shinomura T, Kimata K,

Watanabe H. Distinct interaction of versican/PG-M with hyaluronan and

link protein. J Biol Chem. 278(42): 41205-41212, 2003.

Matta C, Zhang X, Liddell S, Smith JR, Mobasheri A. Label-free proteomic

analysis of the hydrophobic membrane protein complement in articular

chondrocytes: a technique for identification of membrane biomarkers.

Biomarkers. 20(8): 572-589, 2015.

88

Maurel P, Rauch U, Flad M, Margolis RK, Margolis RU. Phosphacan, a

chondroitin sulfate proteoglycan of brain that interacts with neurons and

neural cell-adhesion molecules, is an extracellular variant of a receptor-type

protein tyrosine phosphatase. Proc Natl Acad Sci USA. 91(7): 2512-2516,

1994.

Maxwell PH, Wiesener MS, Chang GW, Clifford SC, Vaux EC, Cockman ME,

Wykoff CC, Pugh CW, Maher ER, Ratcliffe PJ. The tumour suppressor

protein VHL targets hypoxia-inducible factors for oxygen-dependent

proteolysis. Nature. 399(6733): 271-275, 1999.

Mazieres B, Combe B, Phan Van A, Tondut J, Grynfeltt M. Chondroitin

sulfate in osteoarthritis of the knee: a prospective, double blind, placebo

controlled multicenter clinical study. J Rheumatol. 28(1): 173-181, 2001.

Mendler M, Eich-Bender SG, Vaughan L, Winterhalter KH, Bruckner P.

Cartilage contains mixed fibrils of collagen types II, IX, and XI. J Cell Biol.

108(1): 191-197, 1989.

Menkel AR, Kroemker M, Bubeck P, Ronsiek M, Nikolai G, Jockusch BM.

Characterization of an F-actin-binding domain in the cytoskeletal protein

vinculin. J Cell Biol. 126(5): 1231-1240, 1994.

Michael JW, Schlüter-Brust KU and Eysel P. The epidemiology, etiology,

diagnosis, and treatment of osteoarthritis of the knee. Deutsch Arztebl Int.

107(9): 152-162, 2010.

Midwood KS and Salter DM. Expression of NG2/human melanoma

proteoglycan in human adult articular chondrocytes. Osteoarthritis

Cartilage. 6(5): 297-305, 1998.

Mifune Y, Matsumoto T, Takayama K, Ota S, Li H, Meszaros LB, Usas A,

Nagamune K, Gharaibeh B, Fu FH, Huard J. The effect of platelet-rich

plasma on the regenerative therapy of muscle derived stem cells for articular

cartilage repair. Osteoarthritis Cartilage. 21(1): 175-185, 2013.

Mithoefer K, McAdams T, Williams RJ, Kreuz PC, Mandelbaum BR: Clinical

efficacy of the microfracture technique for articular cartilage repair in the

knee: an evidence-based systematic analysis. Am J Sports Med. 37(10):

2053-2063, 2009.

89

Miyanishi K, Trindade MC, Lindsey DP, Beaupré GS, Carter DR, Goodman

SB, Schurman DJ, Smith RL. Effects of hydrostatic pressure and

transforming growth factor-beta 3 on adult human mesenchymal stem cell

chondrogenesis in vitro. Tissue Eng. 12(6): 1419-1428, 2006.

Mobasheri A, Lewis R, Maxwell JE, Hill C, Womack M, Barrett-Jolley R.

Characterization of a stretch-activated potassium channel in chondrocytes. J

Cell Physiol. 223(2): 511-518, 2010.

Morgan MR, Humphries MJ, Bass MD. Synergistic control of cell adhesion

by integrins and syndecans. Nat Rev Mol Cell Biol. 8(12): 957-969, 2007.

Muramatsu S, Wakabayashi M, Ohno T, Amano K, Ooishi R, Sugahara T,

Shiojiri S, Tashiro K, Suzuki Y, Nishimura R, Kuhara S, Sugano S, Yoneda T,

Matsuda A. Functional gene screening system identified TRPV4 as a

regulator of chondrogenic differentiation. J Biol Chem. 282(44): 32158-

32167, 2007.

Nakagawa O, Fujisawa K, Ishizaki T, Saito Y, Nakao K, Narumiya S. ROCK-I

and ROCK-II, two isoforms of Rho-associated coiled-coil forming protein

serine/threonine kinase in mice. FEBS Lett. 392(2): 189-193, 1996.

Nakamura K, Yoshimura A, Kaneko T, Sato K, Hara Y. ROCK inhibitor Y-

27632 maintains the proliferation of confluent human mesenchymal stem

cells. J Periodontal Res. 49(3): 363-370, 2014.

Naranjo-Suarez S, Carlson BA, Tsuji PA, Yoo MH, Gladyshev VN, Hatfield

DL. HIF-independent regulation of thioredoxin reductase 1 contributes to

the high levels of reactive oxygen species induced by hypoxia. PLoS One.

7(2): e30470, 2012.

Neidlinger-Wilke C, Wilke HJ, Claes L. Cyclic stretching of human

osteoblasts affects proliferation and metabolism: a new experimental

method and its application. J Orthop Res. 12(1): 70-78, 1994.

Nishiwaki T, Maeda N, Noda M. Characterization and developmental

regulation of proteoglycan-type protein tyrosine phosphatase zeta/RPTPbeta

isoforms. J Biochem. 123(3): 458-467, 1998.

Nobes CD and Hall A. Rho GTPases control polarity, protrusion, and

adhesion during cell movement. J Cell Biol. 144(6): 1235-1244, 1999.

90

Nuka S, Zhou W, Henry SP, Gendron CM, Schultz JB, Shinomura T, Johnson

J, Wang Y, Keene DR, Ramírez-Solis R, Behringer RR, Young MF, Höök M.

Phenotypic characterization of epiphycan-deficient and epiphycan/biglycan

double-deficient mice. Osteoarthritis Cartilage. 18(1): 88-96, 2010.

Nuki G. Osteoarthritis: a problem of joint failure. Z Rheumatol. 58(3): 142-

147, 1999.

Oshiro N, Fukata Y, Kaibuchi K. Phosphorylation of moesin by rho-

associated kinase (Rho-kinase) plays a crucial role in the formation of

microvilli-like structures. J Biol Chem. 273(52): 34663-34666, 1998.

Ossendorf C, Steinwachs MR, Kreuz PC, Osterhoff G, Lahm A, Ducommun

PP, Erggelet C: Autologous chondrocyte implantation (ACI) for the

treatment of large and complex cartilage lesions of the knee. Sports Med

Arthrosc Rehabil Ther Technol. 3:11, 2011.

Oztürk A, Ozdemir MR, Ozkan Y. Osteochondral autografting (mosaicplasty)

in grade IV cartilage defects in the knee joint: 2- to 7-year results. Int

Orthop. 30(3): 200-204, 2006.

Page RL, Ambady S, Holmes WF, Vilner L, Kole D, Kashpur O, Huntress V,

Vojtic I, Whitton H, Dominko T. Induction of stem cell gene expression in

adult human fibroblasts without transgenes. Cloning Stem Cells. 11(3): 417-

426, 2009.

Parker WL, Goldring MB and Philip A. Endoglin is expressed on human

chondrocytes and forms a heteromeric complex with betaglycan in a ligand

and type II TGFbeta receptor independent manner. J Bone Miner Res. 18(2):

289-302, 2003.

Parkkinen JJ, Ikonen J, Lammi MJ, Laakkonen J, Tammi M, Helminen HJ.

Effects of cyclic hydrostatic pressure on proteoglycan synthesis in cultured

chondrocytes and articular cartilage explants. Arch Biochem Biophys.

300(1): 458-465, 1993.

Parkkinen JJ, Lammi MJ, Inkinen R, Jortikka M, Tammi M, Virtanen I,

Helminen HJ. Influence of short-term hydrostatic pressure on organization

of stress fibers in cultured chondrocytes. J Orthop Res. 13(4): 495-502, 1995.

Parra A, Veraldi N, Locatelli M, Fini M, Martini L, Torri G, Sangiorgi L, Bisio

A. Heparin-like heparan sulfate from rabbit cartilage. Glycobiology. 22(2):

248-257, 2012.

91

Patil S and Tapasvi SR. Osteochondral autografts. Curr Rev Musculoskelet

Med. 8(4): 423-428, 2015.

Pearce LR, Komander D, Alessi DR. The nuts and bolts of AGC protein

kinases. Nat Rev Mol Cell Biol. 11(1): 9-22, 2010.

Peles E, Schlessinger J, Grumet M. Multi-ligand interactions with receptor-

like protein tyrosine phosphatase beta: implications for intercellular

signaling. Trends Biochem Sci. 23(4): 121-124, 1998.

Perkins DN, Pappin DJ, Creasy DM, Cottrell JS. Probability-based protein

identification by searching sequence databases using mass spectrometry

data. Electrophoresis. 20(18): 3551-3567, 1999.

Pfaffl MW. A new mathematical model for relative quantification in real-

time RT-PCR. Nucleic Acids Res. 29(9): e45, 2001.

Pfander D, Swoboda B, Cramer T. The role of HIF-1alpha in maintaining

cartilage homeostasis and during the pathogenesis of osteoarthritis. Arthritis

Res Ther. 8(1): 104, 2006.

Prehm P. Hyaluronate is synthesized at plasma membranes. Biochem J.

220(2): 597-600, 1984.

Prockop DJ, Kivirikko KI, Tuderman L, Guzman NA. The biosynthesis of

collagen and its disorders (first of two parts). N Engl J Med. 301(1): 13-23,

1979.

Qvist P, Bay-Jensen AC, Christiansen C, Dam EB, Pastoureau P, Karsdal MA.

The disease modifying osteoarthritis drug (DMOAD): Is it in the horizon?

Pharmacol Res. 58(1): 1-7, 2008.

Rappsilber J, Ishihama Y, Mann M. Stop and go extraction tips for matrix-

assisted laser desorption/ionization, nanoelectrospray, and LC/MS sample

pretreatment in proteomics. Anal Chem. 75(3): 663-670, 2003.

Ravenna L, Salvatori L, Russo MA. HIF3α: the little we know. FEBS J.

283(6): 993-1003, 2016.

Richter DL, Tanksley JA, Miller MD. Osteochondral Autograft

Transplantation: A Review of the Surgical Technique and Outcomes. Sports

Med Arthrosc. 24(2): 74-78, 2016.

92

Richette P, Chevalier X, Ea HK, Eymard F, Henrotin Y, Ornetti P, Sellam J,

Cucherat M, Marty M. Hyaluronan for knee osteoarthritis: an updated meta-

analysis of trials with low risk of bias. RMD Open. 1(1): e000071, 2015.

Ridley AJ, Schwartz MA, Burridge K, Firtel RA, Ginsberg MH, Borisy G,

Parsons JT, Horwitz AR. Cell migration: integrating signals from front to

back. Science. 302(5651): 1704-1709, 2003.

Ridinger K, Schäfer BW, Durussel I, Cox JA, Heizmann CW. S100A13.

Biochemical characterization and subcellular localization in different cell

lines. J Biol Chem. 275(12): 8686-8694, 2000.

Riento K and Ridley Y. Rocks: multifunctional kinases in cell behavior. Nat

Rev Mol Cell Biol. 4(6): 446-456, 2003.

Roman-Blas JA, Castañeda S, Sánchez-Pernaute O, Largo R, Herrero-

Beaumont G, CS/GS Combined Therapy Study group. Combined treatment

with chondroitin sulfate and glucosamine sulfate shows no superiority over

placebo for reduction of joint pain and functional impairment in patients

with knee osteoarthritis: A six-month multicenter, randomized, double-

blind, placebo-controlled clinical trial. Arthritis Rheumatol. 2016, 69(1): 77-

85, 2017.

Roughley PJ. The structure and function of cartilage proteoglycans. Eur Cell

Mater. 12: 92-101, 2006.

Roughley PJ and White RJ. Dermatan sulphate proteoglycans of human

articular cartilage. The properties of dermatan sulphate proteoglycans I and

II. Biochem J. 262(3): 823-827, 1989.

Routhier A, Astuccio M, Lahey D, Monfredo N, Johnson A, Callahan W,

Partington A, Fellows K, Ouellette L, Zhidro S, Goodrow C, Smith A, Sullivan

K, Simone P, Le L, Vezuli B, Zohni M, West E, Gleason D, Bryan B.

Pharmacological inhibition of Rho-kinase signaling with Y-27632 blocks

melanoma tumor growth. Oncol Rep. 23(3): 861-867, 2010.

Ryu JH, Chae CS, Kwak JS, Oh H, Shin Y, Huh YH, Lee CG, Park YW, Chun

CH, Kim YM, Im SH, Chun JS. Hypoxia-inducible factor-2α is an essential

catabolic regulator of inflammatory rheumatoid arthritis. PLoS Biol. 12(6):

e1001881, 2014.

93

Ryu JH, Shin Y, Huh YH, Yang S, Chun CH, Chun JS. Hypoxia-inducible

factor-2α regulates Fas-mediated chondrocyte apoptosis during

osteoarthritic cartilage destruction. Cell Death Differ. 19(3): 440-450, 2012.

Ryu JH, Yang S, Shin Y, Rhee J, Chun CH, Chun JS. Interleukin-6 plays an

essential role in hypoxia-inducible factor 2α-induced experimental

osteoarthritic cartilage destruction in mice. Arthritis Rheum. 63(9): 2732-

2743, 2011.

Saas J, Lindauer K, Bau B, Takigawa M, Aigner T. Molecular phenotyping of

HCS-2/8 cells as an in vitro model of human chondrocytes. Osteoarthritis

Cartilage. 12(11): 924-934, 2004.

Sahai E, Ishizaki T, Narumiya S, Treisman R. Transformation mediated by

RhoA requires activity of ROCK kinases. Curr Biol. 9(3): 136-145, 1999.

Saito T, Ikeda T, Nakamura K, Chung UI, Kawaguchi H. S100A1 and S100B,

transcriptional targets of SOX trio, inhibit terminal differentiation of

chondrocytes. EMBO Rep. 8(5): 504-509, 2007.

Salminen-Mankonen H, Säämänen AM, Jalkanen M, Vuorio E, Pirilä L.

Syndecan-1 expression is upregulated in degenerating articular cartilage in a

transgenic mouse model for osteoarthritis. Scand J Rheumatol. 34(6): 469-

474, 2005.

Sarrazin S, Lamanna WC and Esko JD. Heparan sulfate proteoglycans. Cold

Spring Harb Perspect Biol. 3(7), a004952, 2011.

Satoh S and Tominaga T. mDia-interacting protein acts downstream of Rho-

mDia and modifies Src activation and stress fiber formation. J Biol Chem.

276(42): 39290-39294, 2001.

Sawitzke AD, Shi H, Finco MF, Dunlop DD, Harris CL, Singer NG, Bradley

JD, Silver D, Jackson CG, Lane NE, Oddis CV, Wolfe F, Lisse J, Furst DE,

Bingham CO, Reda DJ, Moskowitz RW, Williams HJ, Clegg DO. Clinical

efficacy and safety of glucosamine, chondroitin sulphate, their combination,

celecoxib or placebo taken to treat osteoarthritis of the knee: 2-year results

from GAIT. Ann Rheum Dis. 69(8): 1459-1464, 2010.

Schipani E, Ryan HE, Didrickson S, Kobayashi T, Knight M, Johnson RS.

Hypoxia in cartilage: HIF-1alpha is essential for chondrocyte growth arrest

and survival. Genes Dev. 15(21): 2865-2876, 2001.

94

Schneider G and Filipek A. S100A6 binding protein and Siah-1 interacting

protein (CacyBP/SIP): spotlight on properties and cellular function. Amino

Acids. 41(4): 773-780, 2011.

Schrobback K, Klein TJ, Crawford R, Upton Z, Malda J, Leavesley DI. Effects

of oxygen and culture system on in vitro propagation and redifferentiation of

osteoarthritic human articular chondrocytes. Cell Tissue Res. 347(3): 649-

663, 2012.

Seror J, Zhu L, Goldberg R, Day AJ, Klein J. Supramolecular synergy in the

boundary lubrication of synovial joints. Nat Commun. 6:6497, 2015.

Shang J, Liu H, Li J, Zhou Y. Roles of hypoxia during the chondrogenic

differentiation of mesenchymal stem cells. Curr Stem Cell Res Ther. 9(2):

141-147, 2014.

Shen J, Li J, Chen D. TGF-β signaling and the development of osteoarthritis.

Bone Res. 2, 14002, 2014.

Shevchenko A, Tomas H, Havlis J, Olsen JV, Mann M. In-gel digestion for

mass spectrometric characterization of proteins and proteomes. Nat Protoc.

1(6): 2856-2860, 2007.

Shevchenko A, Wilm M, Vorm O, Mann M. Mass spectrometric sequencing

of proteins silver-stained polyacrylamide gels. Anal Chem. 68(5): 850-858,

1996.

Shibata S, Fukada K, Imai H, Abe T, Yamashita Y. In situ hybridization and

immunohistochemistry of versican, aggrecan and link protein, and

histochemistry of hyaluronan in the developing mouse limb bud cartilage. J

Anat. 203(4): 425-432, 2003.

Shum MS, Pasquier E, Po’uha ST, O’Neill GM, Chaponnier C, Gunning PW,

Kavallaris M. γ-Actin regulates cell migration and modulates the ROCK

signaling pathway. FASEB J. 25(12): 4423-4433, 2011.

Siclari A, Mascaro G, Gentili C, Cancedda R, Boux E. A cell-free scaffold-

based cartilage repair provides improved function hyaline-like repair at one

year. Clin Orthop Relat Res. 470(3): 910-919, 2012.

Singh VK, Kalsan M, Kumar N, Saini A, Chandra R. Induced pluripotent

stem cells: applications in regenerative medicine, disease modeling, and

drug discovery. Front Cell Dev Biol. 3:2, 2015.

95

Sit ST and Manser E. Rho GTPases and their role in organizing the actin

cytoskeleton. J Cell Sci. 124(Pt5): 679-683, 2011.

Sivan SS, Wachtel E, Roughley P. Structure, function, aging and turnover of

aggrecan in the intervertebral disc. Biochim Biophys Acta. 1840(10): 3181-

3189, 2014.

Shibuya M, Suzuki Y, Sugita K, Saito I, Sasaki T, Takakura K, Nagata I,

Kikuchi H, Takamae T, Hikada H and Mitsuyoshi N. Effect of AT877 on

cerebral vasospasm after aneurysmal subarachnoid hemorrhage. Results of a

prospective placebo-controlled double-blind trial. J Neurosurg. 76(4): 571-

577, 1992.

Smith RL, Lin J, Trindade MC, Shida J, Kajiyama G, Vu T, Hoffman AR, van

der Meulen MC, Goodman SB, Schurman DJ, Carter DR. Time-dependent

effects of intermittent hydrostatic pressure on articular chondrocyte type II

collagen and aggrecan mRNA expression. J Rehabil Res Dev. 37(2): 153-161,

2000.

Solari FA, Dell’Aica M, Sickmann A, Zahedi RP. Why phosphoproteomics is

still a challenge. Mol Biosyst. 11(6): 1487-1493, 2015.

Solheim E, Hegna J, Øyen J, Harlem T, Strand T. Results at 10 to 14 years

after osteochondral autografting (mosaicplasty) in articular cartilage defects

in the knee. Knee. 20(4): 287-290, 2013.

Soltz MA and Ateshian GA. A Conewise Linear Elasticity mixture model for

the analysis of tension-compression nonlinearity in articular cartilage. J

Biomech Eng. 122(6): 576-586, 2000.

Somlyo AV, Bradshaw D, Ramos S, Murphy C, Myers CE, Somlyo AP. Rho-

kinase inhibitor retards migration and in vivo dissemination of human

prostate cancer cells. Biochem Biophys Res Commun. 269(3): 652-659,

2000.

Sophia Fox AJ, Bedi A ja Rodeo SA: The basic science of articular cartilage:

structure, composition, and function. Sports Health. 1(6): 461-468, 2009.

Ströbel S, Loparic M, Wendt D, Schenk AD, Candrian C, Lindberg RL,

Moldovan F, Barbero A, Martin I. Anabolic and catabolic responses of

human articular chondrocytes to varying oxygen percentages. Arthritis Res

Ther. 12(2): R34, 2010.

96

Sun CC, Chiu HT, Lin YF, Lee KY, Pang JH. Y-27632, a ROCK inhibitor,

promoted limbal epithelial cell proliferation and corneal wound healing.

PLoS One. 10(12): e0144571, 2015.

Takahashi I, Onodera K, Sasano Y, Mizoguchi I, Bae JW, Mitani H,

Kagayama M, Mitani H. Effect of stretching on gene expression of beta1

integrin and focal adhesion kinase and on chondrogenesis through cell-

extracellular matrix interactions. Eur J Cell Biol. 82(4): 182-192, 2003.

Takigawa M, Tajima K, Pan HO, Enomoto M, Kinoshita A, Suzuki F, Takano

Y, Mori Y. Establishment of a clonal human chondrosarcoma cell line with

cartilage phenotypes. Cancer Res. 49(14): 3996-4002, 1989.

Tamma G, Procino G, Svelto M, Valenti G. Hypotonicity causes actin

reorganization and recruitment of the actin-binding ERM protein moesin in

membrane protrusions in collecting duct principal cells. Am J Physiol Cell

Physiol. 292(4): C1476-C1484, 2007.

Tanimoto K, Kitamura R, Tanne Y, Kamiya T, Kunimatsu R, Yoshioka M,

Tanaka M, Tanaka E, Tanne K. Modulation of hyaluronan catabolism in

chondrocytes by mechanical stimuli. J Biomed Mater Res A. 93(1): 373-380,

2010.

Tatsumura M, Sakane M, Ochiai N, Mizuno S. Off-loading of cyclic

hydrostatic pressure promotes production of extracellular matrix by

chondrocytes. Cell Tissues Organs. 198(6): 405-413, 2013.

Thompson CL, Chapple JP, Knight MM. Primary cilia disassembly down-

regulates mechanosensitive hedgehog signalling: a feedback mechanism

controlling ADAMTS-5 expression in chondrocytes. Osteoarthritis Cartilage.

22(3): 490-498, 2014.

Thoms BL, Dudek KA, Lafont JE, Murphy CL. Hypoxia promotes the

production and inhibits the destruction of human articular cartilage.

Arthritis Rheum. 65(5): 1302-1312, 2013.

Toghraie F, Razmkhah M, Gholipour MA, Faghih Z, Chenari N, Torabi

Nezhad S, Nazhvani Dehghani S, Ghaderi A. Scaffold-free adipose-derived

stem cells (ASCs) improve experimentally induced osteoarthritis in rabbits.

Arch Iran Med. 15(8): 495-499, 2012.

97

Tonge DP, Pearson MJ, Jones SW. The hallmarks of osteoarthritis and the

potential to develop personalised disease-modifying pharmacological

therapeutics. Osteoarthritis Cartilage. 22(5): 609-621, 2014.

Tsolis KC, Bei ES, Papathanasiou I, Kostopoulou F, Gkretsi V, Kalantzaki K,

Malizos K, Zervakis M, Tsezou A, Economou A. Comparative proteomic

analysis of hypertrophic chondrocytes in osteoarthritis. Clin Proteomics.

12(1): 12, 2015.

Tyyni A and Karlsson J. Biological treatment of joint cartilage damage.

Scand J Med Sci Sports. 10(5): 249-265, 2000.

Ueki M, Tanaka M, Tanimoto K, Nishio C, Honda K, Lin YY, Tanne Y,

Ohkuma S, Kamiya T, Tanaka E, Tanne K. The effect of mechanical loading

on the metabolism of growth plate chondrocytes. Ann Biomed Eng. 36(5):

793-800, 2008.

Urban JP. The chondrocyte: a cell under pressure. Br J Rheumatol. 33(10):

901-908, 1994.

Valdes AM, Doherty M, Spector TD. The additive effect of individual genes in

predicting risk of knee osteoarthritis. Ann Rheum Dis. 67(1): 124-127, 2008.

Varjosalo M, Sacco R, Stukalov A, van Drogen A, Planyavsky M, Hauri S,

Aebersold R, Bennett KL, Colinge J, Gstaiger M, Superti-Furga G.

Interlaboratory reproducibility of large-scale human protein-complex

analysis by standardized AP-MS. Nat Methods. 10(4): 307-314, 2013.

Vinardell T, Rolfe RA, Buckley CT, Meyer EG, Ahearne M, Murphy P, Kelly

DJ. Hydrostatic pressure acts to stabilise a chondrogenic phenotype in

porcine joint tissue derived stem cells. Eur Cell Mater. 23: 121-132, 2012.

Vincourt JB, Lionneton F, Kratassiouk G, Guillemin F, Netter P, Mainard D,

Magdalou J. Establishment of a reliable method for direct proteome

characterization of human articular cartilage. Mol Cell Proteomics. 5(10):

1984-1995, 2006.

von der Mark K, Gauss V, von der Mark H, Müller P. Relationship between

cell shape and type of collagen synthesised as chondrocytes lose their

cartilage phenotype in culture. Nature. 267(5611): 531-532, 1977.

98

Vranka JA, Sakai LY, Bächinger HP. Prolyl 3-hydroxylase 1, enzyme

characterization and identification of a novel family of enzymes. J Biol

Chem. 279(22): 23615-23621, 2004.

Wagner DR, Lindsey DP, Li KW, Tummala P, Chandran SE, Smith RL,

Longaker MT, Carter DR, Beaupre GS. Hydrostatic pressure enhances

chondrogenic differentiation of human bone marrow stromal cells in

osteochondrogenic medium. Ann Biomed Eng. 36(5): 813-820, 2008.

Waldman SD, Spiteri CG, Grynpas MD, Pilliar RM, Kandel RA. Long-term

intermittent shear deformation improves the quality of cartilaginous tissue

formed in vitro. J Orthop Res. 21(4): 590-596, 2003.

Wang G and Beier F. Rac1/Cdc42 and RhoA GTPases antagonistically

regulate chondrocyte proliferation, hypertrophy, and apoptosis. J Bone

Miner Res. 20(6): 1022-1031, 2005.

Wang G, Woods A, Sabari S, Pagnotta L, Stanton LA, Beier F. RhoA/ROCK

signaling suppresses hypertrophic chondrocyte differentiation. J Biol Chem.

279(13): 13205-13214, 2004.

Wang K, Xu J, Hunter DJ, Ding C. Investigational drugs for the treatment of

osteoarthritis. Expert Opin Investig Drugs. 24(12): 1539-1556, 2015.

Wang M, Liu C, Thormann E, Dėdinaitė A. Hyaluronan and phospholipid

association in biolubrication. Biomacromolecules. 14(12): 4198-4206, 2013.

Wang ZM, Yang DS, Liu J, Liu HB, Ye M, Zhang YF. ROCK inhibitor Y-

27632 inhibits the growth, migration, and invasion of Tca8113 and CAL-27

cells in tongue squamous cell carcinoma. Tumour Biol. 37(3): 3757-3764,

2016.

Wangpu X, Yang X, Zhao J, Lu J, Guan S, Lu J, Kovacevic Z, Liu W, Mi L, Jin

R, Sun J, Yue F, Ma J, Lu A, Richardson DR, Wang L, Zheng M. The

metastasis suppressor, NDRG1, inhibits "stemness" of colorectal cancer via

down-regulation of nuclear β-catenin and CD44. Oncotarget. 6(32): 33893-

33911, 2015.

Wann AK, Zuo N, Haycraft CJ, Jensen CG, Poole CA, McGlashan SR, Knight

MM. Primary cilia mediate mechanotransduction through control of ATP-

induced Ca2+ signaling in compressed chondrocytes. FASEB J. 26(4): 1663-

1671, 2012.

99

Watts KL, Cottrell E, Hoban PR, Spiteri MA. RhoA signaling modulates

cyclin D1 expression in human lung fibroblasts; implications for idiopathic

pulmonary fibrosis. Respir Res. 7: 88, 2006.

Wei L, Surma M, Shi S, Lambert-Cheatham N, Shi J. Novel Insights into the

Roles of Rho Kinase in Cancer. Arch Immunol Ther Exp (Warsz). 64(4): 259-

278, 2016.

Wenger RH and Gassmann M. Oxygen(es) and the hypoxia-inducible factor-

1. Biol Chem. 378(7): 609-616, 1997.

Wessel D and Flügge UI. A method for the quantitative recovery of protein in

dilute solution in the presence of detergents and lipids. Anal Biochem.

138(1): 141-143, 1984.

Wilson R, Belluoccio D, Bateman JF. Proteomic analysis of cartilage

proteins. Methods. 45(1): 22-31, 2008.

Wilusz RE, Defrate LE, Guilak F. A biomechanical role for perlecan in the

pericellular matrix of articular cartilage. Matrix Biol. 31(6): 320-327, 2012.

Wong M, Siegrist M, Goodwin K. Cyclic tensile strain and cyclic hydrostatic

pressure differentially regulate expression of hypertrophic markers in

primary chondrocytes. Bone. 33(4): 685-693, 2003.

Woods A and Beier F. RhoA/ROCK signaling regulates chondrogenesis in a

context-dependent manner. J Biol Chem. 281(19): 13134-13140, 2006.

Woods A, Wang G, Beier F. RhoA/ROCK signaling regulates Sox9 expression

and actin organization during chondrogenesis. J Biol Chem. 280(12): 11626-

11634, 2005.

Wright MO, Nishida K, Bavington C, Godolphin JL, Dunne E, Walmsley S,

Jobanputra P, Nuki G, Salter DM. Hyperpolarisation of cultured human

chondrocytes following cyclical pressure-induced strain: evidence of a role

for alpha 5 beta 1 integrin as a chondrocyte mechanoreceptor. J Orthop Res.

15(5): 742-747, 1997.

Wu JJ and Eyre DR. Structural analysis of cross-linking domains in cartilage

type XI collagen. Insights on polymeric assembly. J Biol Chem. 270(32):

18865-18870, 1995.

100

Wu JJ, Woods PE, Eyre DR. Identification of cross-linking sites in bovine

cartilage type IX collagen reveals an antiparallel type II-type IX molecular

relationship and type IX to IX bonding. J Biol Chem. 267(32): 23007-23014,

1992.

Wu L, Bluguermann C, Kyupelyan L, Latour B, Gonzalez S, Shah S, Galic Z,

Ge S, Zhu Y, Petrigliano FA, Nsair A, Miriuka SG, Li X, Lyons KM, Crooks

GM, McAllister DR, Van Handel B, Adams JS, Evseenko D. Human

developmental chondrogenesis as a basis for engineering chondrocytes from

pluripotent stem cells. Stem Cell Reports. 1(6): 575-589, 2013.

Wu QQ and Chen Q. Mechanoregulation of chondrocyte proliferation,

maturation, and hypertrophy: ion-channel dependent transduction of matrix

deformation signals. Exp Cell Res. 256(2): 383-391, 2000.

Zhang B, Luo S, Wang Q, Suzuki T, Xiong WC, Mei L. LRP4 serves as a

coreceptor of agrin. Neuron. 60(2): 285-297, 2008.

Zhang G, Shang B, Yang P, Cao Z, Pan Y, Zhou Q. Induced pluripotent stem

cell consensus genes: implication for the risk of tumorigenesis and cancers in

induced pluripotent stem cell therapy. Stem Cells Dev. 21(6): 955-964, 2012.

Zhang P, Yao Q, Lu L, Li Y, Chen PJ, Duan C. Hypoxia-inducible factor 3 is

an oxygen-dependent transcription activator and regulates a distinct

transcriptional response to hypoxia. Cell Rep. 6(6): 1110-1121, 2014.

Zhang W, Ouyang H, Dass CR, Xu J. Current research on pharmacologic and

regenerative therapies for osteoarthritis. Bone Res. 4: 15040, 2016.

Zhao YH, Lv X, Liu YL, Zhao Y, Li Q, Chen YJ, Zhang M. Hydrostatic

pressure promotes the proliferation and osteogenic/chondrogenic

differentiation of mesenchymal stem cells: The roles of RhoA and Rac1. Stem

Cell Res. 14(3): 283-296, 2015.

Zhou C and Petroll WM. Rho kinase regulation of fibroblast migratory

mechanics in fibrillar collagen matrices. Cell Mol Bioeng. 3(1): 76-83, 2010.

Zhou S, Cui Z, Urban JP. Factors influencing the oxygen concentration

gradient from the synovial surface of articular cartilage to the cartilage-bone

interface: a modeling study. Arthritis Rheum. 50(12): 3915-3924, 2004.

101

Zhou Y, Millward-Sadler SJ, Lin H, Robinson H, Goldring M, Salter DM,

Nuki G. Evidence for JNK-dependent up-regulation of proteoglycan

synthesis and for activation of JNK1 following cyclical mechanical

stimulation in a human chondrocyte culture model. Osteoarthritis Cartilage.

15(8): 884-893, 2007.

Zimmermann DR and Ruoslahti E. Multiple domains of the large fibroblast

proteoglycan, versican. EMBO J. 8(10): 2975-2981, 1989.

Zreiqat H, Howlett CR, Gronthos S, Hume D, Geczy CL. S100A8/S100A9

and their association with cartilage and bone. J Mol Histol. 38(5): 381-391,

2007.

Yammani RR. S100 proteins in cartilage: role in arthritis. Biochim Biophys

Acta 1822(4): 600-606, 2012.

Yammani RR, Carlson CS, Bresnick AR, Loeser RF. Increase in production of

matrix metalloproteinase 13 by human articular chondrocytes due to

stimulation with S100A4: Role of the receptor for advanced glycation end

products. Arthritis Rheum. 54(9): 2901-2911, 2006.

Yang S, Kim J, Ryu JH, Oh H, Chun CH, Kim BJ, Min BH, Chun JS.

Hypoxia-inducible factor-2alpha is a catabolic regulator of osteoarthritic

cartilage destruction. Nat Med. 16(6): 687-693, 2010.

Yu HS, Kim JJ, Kim HW, Lewis MP, Wall I. Impact of mechanical stretch on

the cell behaviors of bone and surrounding tissues. J Tissue Eng.

6:2041731415618342, 2015.

Yu SP and Hunter DJ. Emerging drugs for the treatment of knee

osteoarthritis. Expert Opin Emerg Drugs. 20(3): 361-378, 2015.

Yu Z, Liu M, Fu P, Xie M, Wang W, Luo X. ROCK inhibition with Y27632

promotes the proliferation and cell cycle progression of cultured astrocyte

from spinal cord. Neurochem Int. 61(7): 1114-1120, 2012.

Önnerfjord P, Khabut A, Reinholt FP, Svensson O, Heinegård D.

Quantitative proteomic analysis of eight cartilaginous tissues reveals

characteristic differences as well as similarities between subgroups. J Biol

Chem. 287(23): 18913-18924, 2012.