A preliminary analysis of the molecular characterization and quantification of endemic Beauveria bassiana (Balsamo) Vuillemin populations within kudzu soils.

C.A. Carrillio1, C. Lewallen1, E.A. Scocco1, and W.A. Gardner2

1Department of Biology, Wingate University, Wingate, NC 281742Department of Entomology, University of Georgia, Griffin, GA 30223

Beauveria bassiana is an entomopathogen endemic to soils in the United States that cause natural epizootics in insect populations. The GHA strain of this fungus has been commercially formulated to control insect pest populations. One such insect pest that this fungus could control is the kudzu bug, Megacopta cribraria. M. cribraria is an invasive insect of kudzu and agronomic crops with no known natural enemies. However, one report indicated that a kudzu bug was naturally infected with B. bassiana in Georgia. This suggests a natural epizootic could be occurring in kudzu patches in North Carolina. Thus, this study aims to quantify B. bassiana in soil samples of kudzu bug infested kudzu. Genomic sequencing will provide strain specific characterization to determine species and pathogenic strains. Preliminary findings suggest low populations of B. bassiana in the soil ecosystem, which were recovered on Doberski and Tribe media. Therefore, addition of propagules to these endemic areas would increase infective propagules, thus, increasing infection and control of the kudzu bug.

Borah, B.K., and S.K. Dutta. 2002. Entomogenous fungus, Beauveria bassiana (Balsamo) Vuillemin: a natural biocontrol agent against Megacopta cribrarium (Fab.) Insect Environ. 8:7-8.Doberski JW and Tribe HT. 1980. Isolation of Entomogenous Fungi from Elm Bark and Soil with Reference to Ecology of Beauveria bassiana and Metarhizium anisopliae. Trans. Br. Mycol. Soc. 74 (1). 95-100.Cottrell, T.E., and D. Shapiro-Ilan. 2009. Chapter 2: Naturally Occurring Pathogens and Invasive Arthropods. In Use of Microbes for Control and Eradication of Invasive Arthropods. [eds. Hajek et al]. Springer. Pp.19-30.Eger, J.E., L.M. Ames, D.R. Suiter, T.M. Jenkins, D.A. Rider, and S.E. Halbert 2010. Occurrence of the Old World bug Megacopta cribraria (Fabricius) (Heteroptera: Plataspidae) in Georgia: a serious home invader and potential legume pest. Insecta Mundi. 0121:1-11Harrison, R.D. and W.A. Gardner. 1991. Occurrence of the entomogenous fungus Beauveria bassiana in pecan orchard soils in Georgia. J. Entomol. Sci. 26: 360-366.Ruberson, J.R., K. Takasu, G.D. Buntin, J.E. Eger Jr., W.A. Gardner, J.K. Greene, T.M. Jenkins, W.A. Jones, D.M. Olson, P.M. Roberts, D.R. Suiter, and M.D. Toews. 2012. From Asian curiosity to eruptive American pest: Megacopta cribraria (Hemiptera: Plataspidae) and prospects for its biological control. Japanese Soc. of App. Ent. And Zoo. DOI 10.1007/s13355-012-0146-2.Shapiro-Ilan, D.I., W.A. Gardner, J.R. Fuxa, B.W. Wood, K.B. Nguyen, B.J. Adams, R.A. Humber and M.J. Hall. 2002. Survey of entomopathogenic nematodes and fungi endemic to pecan orchards of the southeastern United States and their virulence to the pecan weevil (Coleoptera: Curculionidae). Environ. Entomol. 32: 187-195.

ABSTRACT

RESULTS

CONCLUSIONS

REFERENCES

• CFUs were most abundant at 3-d sampling and decreased over time (Fig. 5).• Day 7 sample day had significantly less CFUs than days previously sampled (Fig. 5).• Location of patches did not yield a significant difference in CFUs in soil (Fig. 6).• Amplification of ITS region occurred for all 10 samples resulting in 600 kb product (Fig. 8).

INTRODUCTIONMegacopta cribraria is an invasive insect species native to Southeast Asia, India, Australia, and Japan. Commonly called kudzu bugs or bean plataspids, these insects mainly feed on kudzu, but have been reported on soybean. These insects were initially described in Northeast Georgia (Jackson county) in large numbers aggregated on houses in 2009 (Eger et. al. 2010). Since 2009, the insect has spread throughout the Eastern United States (Fig. 1). Due to the bug’s rapid geographical expansion and increase in populations on kudzu (Fig. 2), some agronomic crops, specifically soybean, Glycine max (L.) Merr., have experienced yield loss due to feeding. However , the current control measures in agronomic fields are the use of organophosphates and pyrethroids (Ruberson et al. 2012). This bug is also an urban nuisance pest in residential areas, producing a bad odor as they aggregate on light colored buildings or within kudzu patches. As an invasive species, the kudzu bug appears to have no natural enemies in the U.S. (Ruberson et al. 2012); therefore, biological control with entomopathogens needs to be studied for a more benign approach of control, rather than using insecticides in urban areas. Beauveria bassiana GHA strain has been an effective biological control against many ground-dwelling coleopterans and lepidopterans (Cottrell and Shapiro-Ilan 2009). Borah and Dutta (2002) reported B. bassiana infecting adults and nymphs in the insect’s native range. There has been one report of B. bassiana infecting an adult kudzu bug in Georgia (Ruberson et al. 2012). The objective of this study is to survey soils for endemic populations of B. bassiana.

•Shapiro-Ilan et al. (2003) and Harrison and Gardner (1991) reported isolating B. bassiana isolates from pecan orchard soils in Georgia, and determined that soil type was not important, which correlates to these findings.•This preliminary research suggests that B. bassiana is endemic in soil; therefore, bioassays using kudzu bugs should be conducted to determine which isolates are the most virulent. •The ITS amplicons will be sequenced to determine genetic relatedness to the GHA strain and other strains already molecularly identified. This will help to determine isolate populations within geographic areas (patches in counties)and correlate to similar virulent strains. •Further molecular identification of virulence factors will be tested using chitinase primers specific to fungal entomopathogens.

Fig. 2 Kudzu plant distribution map (invasive.org)

Fig. 6. Mean (± SE) CFUs per patch location. Means above bars with the same lower case letter are not significantly different (lsd, P=0.05).

95°C 120 sec95°C 30 sec55°C 30 sec72°C 60 sec72°C 120 sec

Fig. 4. Thermocycler conditions and PCR reagents used.

12.5µl Promega Go Taq® Mastermix0.5µl ITS1 (25 nmol)0.5µl ITS4 (25 nmol)5.0µl Nuclease free water2.0µl Fungal DNAAliquots had a total volume of 20µl.

Fig. 3. Internal transcribed spacer (ITS)region and primer sequences. Arrows denotes region of primer amplification.

Internal transcribed spacer region (ITS)ITS1 5’ – TCCGTAGGTGAACCTGCGG – 3’

ITS4 5’ – TCCTCCGCTTATTGATATGC – 3’

a

aab

b

a

a

aa

a a

a

61 61 61 61 57 57 57 57 LD 55 55 55 55 51 51 51 51 LD

Since kudzu patches vary in size, a 3 x 1 m2 along the periphery of the patch was sampled using a grid. Sampling cores (8 cm3) were taken at random within the grid using a soil auger (ASM; USA). Cores were transferred into 4L buckets for transport. To ensure cross-contamination did not occur, the auger was cleaned using a sodium hypochlorite solution after each sample taken. Soil cores were sampled from a total of seven kudzu patches (10 subsamples for each patch) from Mecklenburg, Cabarrus, Gaston, and Union Counties in North Carolina. Soil samples from each patch were pooled.

MATERIALS & METHODS

Soil cores were placed in plastic containers (30.5 x 15.25 cm; 1000 g/container) and allowed to air-dry for 48 hr. By air drying the soil, bacteria and nematodes were eliminated as variables in this study. Sterile autoclaved water was used to rehydrate the soil (5% v/v). To quantify fungal densities in soil, five one-gram of soil from each patch was individually added to 9 mL of SDW and vortexed for 60 s, serially diluted (10-1, 10-2, and 10-3), then was pipetted (250 µl) onto selective media that only allows the growth of B. bassiana (Doberski and Tribe 1980). Serial dilutions were conducted on day 1, 3, and 7-d post-rehydration of soil. Plates were incubated for 7-10-d at 25oC and then counted for fungal colony forming units (CFUs).

CFU counts were analyzed as a randomized block design, and were subjected to analysis of variance using the General Linear Models procedure (PROC GLM; SAS 2009). Before analysis, the numerical CFU data will be square-root transformed. All significant differences (P<0.05) among means were separated using least significant differences.

To identify species and strain specific isolates, polymerase chain reaction was conducted using fungal specific primers of a conserved nuclear region of DNA. Fungal colonies that were grown on Doberski and Tribe media from serial dilutions were sub-cultured to Sabouraud’s dextrose agar plus 1% yeast extract (SDAY), and incubated 7-10-d at 25oC. The fungi was harvested and placed in a desiccator. Twenty milligrams of dry fungal mass was used for DNA extraction using E.Z.N.A.® HP Fungal DNA kit (Omega bio-tek; USA, GA). Glass beads (0.5 mm) (Sarstedt Inc., USA; Newton, NC) were added to the dry fungal mass and cells were mechanically disrupted using a bead beater (Genie Disruptor; Scientific industries; NY, USA). Polymerase chain reaction conditions and primer sequences are listed in figures 3 and 4, respectively. A gradient PCR was conducted to determine ITS primer pair annealing temperature. Electrophoresis using a 1% agarose gel was conducted with both gradient and conventional PCR products (Fig. 7 & 8); different DNA ladders were used. Gel products were excised using a E.N.Z.A® Gel Extraction Kit. Amplified products will be sent for sequencing.

SAMPLING PLOTS

SERIAL DILUTIONS

MOLECULAR IDENTIFICATION

STATISTICAL ANALYSIS

Fig. 8.Amplification of fungal DNA using ITS primer set (LD= 100 bp ladder, C=control, and numbers correlate

to isolates from each patch).

Fig. 7. Gradient PCR. Four samples were used for each temperature. An annealing temperature of 55°C was chosen for conventional PCR with the ITS primer set (numbers indicate annealing temperatures and the abbreviation LD

is for a large mass DNA ladder).

ITS1 ITS25.8S rDNA18S rDNA 28S rDNA

LD C 1 2 3 4 6 7 8 9 10 11 12

Fig. 1 Kudzu bug distribution map

Fig. 5. Mean (± SE) CFUs per day. Means above bars with the same lower case letter are not significantly different (lsd,

P=0.05).

600 kb