research journal of biotechnology vol. res. j. biotech ...kumari rima*, kumar pankaj, sharma v.k....
TRANSCRIPT
Research Journal of Biotechnology Vol. 15 (4) April (2020) Res. J. Biotech
40
Molecular cloning, characterization and semi-quantitative expression of endochitinase gene from the
mycoparasitic isolate of Trichoderma harzianum Chaudhary Sorabh1*, Sagar Sushma1, Kumar Mukesh1, Lal Mehi2, Kumar Vinay3 and Tomar Akash4
1. Department of Agriculture Biotechnology, SVP University of Agriculture and Technology, Meerut-250110, INDIA
2. ICAR-Central Potato Research Institute Regional Station, Meerut-250 110, INDIA
3. ICAR-National Institute of Biotic Stress Management, Raipur- 493225 Chhattisgarh, INDIA
4. Department of Recombination Tech., SVP University of Agriculture and Technology, Meerut-250110, INDIA
Abstract Filamentous fungi from the genus Trichoderma are
well known for their biocontrol potential and have been
used as antagonistic agents as well as plant growth
promoters. Chitinases released by Trichoderma spp.
have been capable of hydrolyzing chitin by splitting
their β-1, 4-glucosidic bonds. The aim of the present
study was to isolate and characterize an endochitinase
gene from native Trichoderma harzianum isolate which
is involved in mycoparasitism. In total, twelve
Trichoderma isolates were screened for chitinolytic
activity via dual plate method and greenhouse studies.
T. harzianum isolate (SVPRT-THLi03) was selected as
a target for isolation, cloning, characterization and
expression profiling of an endochitinase gene due to its
high chitinolytic activity recorded by the degradation
of chitin substrates. The genomic DNA of Trichoderma
isolates was amplified and cloned in pGEMT cloning
vector.
The recombinant clones were confirmed through
colony PCR and restriction analysis. The sequenced
1223 bp clone nucleotide sequence of putative
endochitinase gene, ChitTh showed 99% homology to
T. harzianum chit-HAR2 endochitinase (AB041752.1)
with 0.0 E-value. The complete nucleotide sequence of
ChitTh contained a single ORF of 379 amino acids with
40.7 kDa molecular weight and theoretical pI 8.3.
The precursor protein contained 22 amino acids long
signal peptide at N terminus. Phylogenetic analysis
showed that ChitTh protein was clustered into group V
with other Trichoderma spp. Semi-quantitative
endochitinase gene expression was analysed for
different isolates viz. T. harzianum (SVPRT-THLi03
and SVPRT-47) and T. nigricans (SVPPP-7). Among
the three isolates, higher expression was observed in
SVPRT-THLi03 and SVPRT-47 whereas SVPPP-7
showed lesser gene expression with respect to the other
isolates.
Keywords: Endochitinase, cloning, T. harzianum, glycosyl
hydrolases, expression.
Introduction Trichoderma spp. are the microorganisms most commonly
used as biological antagonistic against various plant
pathogens and are presently marketed world-wide as active
ingredients of bio-fungicides, bio-fertilizers, growth
enhancers and stimulants of natural resistance62. In India,
~250 Trichoderma-based products are available for field
applications40. The antagonistic mechanism of Trichoderma
spp. involves a complementary action of antibiosis, nutrient
competition and cell wall degrading enzymes like β-1, 3-
glucanases, proteases and chitinases59. Since chitin and β-
1,3-glucan are the two major components of many plant
pathogenic fungal cell walls, therefore, β-1,3-glucanases,
proteases and chitinases produced extracellularly by
Trichoderma spp. play an important role in biocontrol.
Biological1,10,16,18 control of some soil-borne fungal diseases
has been correlated with level of chitinase production.
Additionally, it was also described that the presence of
Trichoderma is stimulating the expression of plant
chitinases54. Endochitinases (EC 3.2.1.1.14) are hydrolases,
able to lyase chitin at β-1,4-bonds into N-acetylglucosamine
oligomers distributed in bacteria, fungi, insects, plants and
animals with diverse roles11,14,34,44. Chitinases are divided
into families 18, 19 and 20 based on amino acid sequence
similarities60 where the chitinases in family 18 are of
bacteria, fungal, viral, animal and plant origin (class III and
V), while family 19 contains chitinases of plant origin from
class I, II and IV50 and N-acetylglucosaminidases
(GlcNAcases) belong to 20 family43.
The family 18 chitinases are divided into the categories of
endochitinase, exochitinase and acetylhexosaminidase23
having vital importance in agriculture as biocontrol agents
and in recycling of chitin back into ecosystem12,42. Besides,
chitinases play important roles in plant defence
mechanisms5,36 and fungal growth21,24.
Previously, several endo- and exo-chitinases such as ech42,
ech46, chit36, ech30, ech33 have been isolated and
characterized from Trichoderma spp.22,41,52,53,57,59 These
chitinases were either isolated via the genomic DNA or the
cDNA approach through the use of PCR amplification with
specifically designed primers30,58,60.
In this study, we examine the variation in the chitinolytic
activity of various Trichoderma spp. The best chitinase
Research Journal of Biotechnology Vol. 15 (4) April (2020) Res. J. Biotech
41
producer Trichoderma isolate was then used as a target for
endochitinase gene amplification, cloning and in silico
characterization to compare and contrast with other
Trichoderma spp. endochitinases.
The amino acid sequence of amplified products was
analysed for the presence of conserved motifs. Additionally,
for identification of the active domains, the protein was also
subjected to physicochemical, phylogenetic and structural
analysis. Furthermore, the expression profiling of the
endochitinase gene was examined in two representative
Trichoderma isolates viz., T. harzianum and T. nigricans in
order to check the expression level in these two different
isolates of Trichoderma spp.
Material and Methods Collection of Trichoderma spp. and their maintenance: A
total of thirty-one (31) Trichoderma isolates were obtained
from Department of Recombination Techniques, College of
Biotechnology, SVP University of Ag. and Tech., Meerut.
Out of the thirty one Trichoderma isolates, twelve isolates
(Table 1) were screened for chitinase activity studies based
on their antagonistic efficacy against plant pathogens
(Rhizoctonia solani, Fusarium spp. and Colletotrichum spp.)
via dual culture method, production of volatile and non-
volatile compounds as well as greenhouse studies9,49. These
isolates were maintained on PDA plates and slants at 4°C for
further use.
Preparation of colloidal chitin: Colloidal chitin was
prepared from commercial chitin (HiMedia) following the
method of Roberts and Selitrennikoff47 with slight
modification and supplemented in the chitinase assay as a
sole carbon source. For acid hydrolysis of chitin powder,
five grams of chitin powder were added into 60 ml of
concentrated HCl and left overnight at 4°C with vigorous
shaking. The mixture was added to 2 L of ice-cold ethanol
(95%) with rapid stirring and kept at 25°C for overnight. The
precipitant was collected by centrifugation at 5,000 rpm for
20 min at 4°C and washed with sterile distilled water until
the colloidal chitin became neutral (pH 7.0). Colloidal chitin
was collected and stored at 4°C until further use.
Preparation of chitin plates: Chitin plates were prepared
according to Kamil et al27. For 1 L media, 15.0 g Agar, 3.0
g colloidal chitin, 2.0 g (NH4)2SO4, 1.1 g Na2HPO4, 0.7 g
KH2PO4, 0.2 g MgSO4.7H20, 1.0 mg FeSO4 and 1.0 mg
MnSO4, were dissolved in 1 L of distilled water. Then the
media was autoclaved at 121°C for 15 minutes and cooled.
Twenty ml media was poured in each Petri-plate and
solidified.
Chitin plate assays: Trichoderma spores were harvested
from 7 days old culture plates in sterilized distilled water to
contain 1x108 spores/ml and 100 µl of spore suspension was
plated on chitin plates via spread plate method and incubated
at 28°C. After 4 days of incubation, the viable / germinating
spores per ml for each isolate were recorded.
Chitinolytic enzyme activity assay: Colloidal chitin
(derived from commercial chitin) supplemented broths were
inoculated with young actively growing mycelium plugs of
Trichoderma isolates and incubated at 28°C for 5 days at 150
rpm. After 5 days, post incubation cultural filtrates were
filtered through Whatmann(R) No. 1 filter paper and stored at
-20°C for further use. The culture filtrates were used as
enzyme solution for chitinase activity assay.
Total chitinolytic activity was analysed by measuring the
release of reducing saccharides from colloidal chitin through
spectrophotometric assay following the method of Agrawal
and Kotasthane1 with some modifications. Briefly, the
reaction mixture containing 1 ml of culture extract, 0.3 ml of
1 M sodium acetate buffer, pH 4.6 and 0.2 ml of colloidal
chitin was incubated at 37°C for 15 hrs and then centrifuged
at 12,000 rpm for 5 min at 4°C. Collect the supernatant. An
aliquot of 0.75 ml of the supernatant, 0.25 ml of 1% solution
of dinitro-salicylic acid in 0.7 M NaOH and 0.1 ml of 10 M
NaOH were mixed and heated to boil for 5 min. After
cooling at room temperature, absorbance of the reaction
mixture was measured at 582 nm39.
Calibration curve with N-acetyl-β-D-glucosamine (NAGA)
was used as a standard to determine reducing saccharide
concentration. Chitinolytic activity was calculated in terms
of the concentration (mg/ml) of NAGA released. The
average of three replicate readings for each isolate was
recorded.
Isolation of fungal genomic DNA: Fungal cultures were
grown in 50 ml of PDB at 28°C in a rotary shaker at 120 rpm
for 2 to 4 days. After incubation, mycelium was harvested
on Whatmann(R) No. 1 filter paper in a Buchner funnel and
washed with 0.9% NaCl followed by distilled water. The
mycelium was frozen in liquid nitrogen and lyophilized. The
extraction was based on the Cetyl Trimethyl Ammonium
Bromide (CTAB) extraction method described by Doyle and
Doyle13 with slight modification. All DNA samples were
treated with RNase A (10 mg/ml) to remove RNA
impurities. The quality and quantity of purified DNA were
analysed both spectrophotometrically and in 0.8% agarose
gel stained with ethidium bromide. The purified DNA was
stored at -20°C for further use.
Amplification and cloning of endochitinase gene: The
specific primer sets F: ACGCAAACGCC
GTCTACTTCACCAA and R: GCATCCCAGAACA
TGCTGCCTCCCA5 were used to amplify the endochitinase
gene from genomic DNA of Trichoderma isolates.
Amplification reaction was carried out in a total volume of
25 μl reaction mixture containing 100 ng/μl of genomic
DNA, 20 pmol of each primer, 2.0 mM of MgCl2, 0.25 mM
of each dNTP, 1 U Taq DNA polymerase (Genei) and 10X
PCR buffer. The thermal cycler conditions were: 95°C for 5
min followed by 35 cycles of 94°C for 1.3 min, 58°C for 1
min and 72°C for 2 min and a final extension at 72°C for 7
min. Aliquots (10 μl) of the amplified products were
Research Journal of Biotechnology Vol. 15 (4) April (2020) Res. J. Biotech
42
analysed in 1.2% (w/v) agarose gel, stained with ethidium
bromide (1 μg/ml) and observed on a UV transilluminator
and photographed on gel documentation system.
After gel elution, the purified PCR product of ~1.2 kb (50
ng/μl) was ligated into pGEMT- Easy Vector System (3.0 kb
and 50 ng/μl). The ligated vector was transformed into E.
coli DH5α competent cells by heat-shock treatment at 42°C
for 2 min followed by immediate chilling for 5 min. Luria
broth (800 μl) was added and the mixture was incubated at
37°C at 200 rpm for 1 hr to allow bacteria to multiply and
express the antibiotic marker encoded by the plasmid. The
culture was centrifuged and the pellet was dissolved in 100
ul Luria broth and plated onto Luria Bertani agar plates
supplemented with ampicillin 100 μg, 5-Bromo-4-choloro-
3-indoyl-β-D-galactopyranoside (X-gal) 80 μg/ml and
isopropyl β-D-thiogalacto-pyranoside (IPTG) 0.5 mM.
The plates were incubated overnight at 37°C. The
recombinant clones were identified by blue/white
conformation assay. After incubation, white recombinant
colonies were picked and streaked on Luria Bertani agar
plates supplemented with Amp100, X-gal, IPTG and
incubated overnight at 37°C and checked for the presence of
construct through colony PCR and plasmid restriction
digestion with EcoR1.
Sequencing and in silico characterization of clones: The
recombinant clones were sequenced commercially using
M13 universal forward and reverse primers at Chromos
Biotech Pvt. Ltd., Bangalore, India by employing primer
walking technique. The vector sequence was removed
through VecScreen service at NCBI and the sequences were
analyzed in silico. Nucleotide sequences homology search
was conducted using BLAST search at
http://www.ncbi.nlm.nih.gov/BLAST3. To determine the
evolutionary relationship of putative endochitinase gene
with other reference sequences, a phylogenetic analysis was
performed using MEGA6.056. A total of 24 reference
endochitinases were retrieved and aligned using ClustalW.
Neighbour joining tree was constructed using bootstrap
value of 1000 replicates to investigate the distances among
these sequences.
The complete putative open reading frame (ORF) based on
nucleotide sequence was predicted using ExPASy server
(http://expasy.org/translate). Potential O-glycosylation sites
were determined using NetNGlyc 1.0 Server
(http://www.cbs.dtu.dk/services/NetNGlyc/). Molecular
weight, theoretical pI and amino acid composition were
analysed by ProtParam tool (http://us.expasy.org/
protparam/)15. Putative signal peptide sequence was
predicted by SignalP (Version 4.1) based on Neural Network
(NN) and Hidden Markov Models (HMM). InterProScan
modular architectural analysis programs
(http://www.ebi.ac.uk/interpro/search/sequence-search/)
were used to predict the domain architecture of the
proteins64.
Multiple sequence alignment and phylogenetic analysis:
Multiple alignment for homology search was performed
using Multialin (http://npsa-prabil.ibcp.fr/cgi-bin/npsa_
automat.pI?page=npsa_multalin.html). A phylo-genetic
analysis was performed using MEGA5.1
(http://www.megasoftware.net/)32 to investigate the
evolutionary relationship among the endochitinase proteins
available in the database and the isolated putative
endochitinase in this study. The search for complete protein
sequence was explored using the NCBI Blastp and a total of
43 reference endochitinases sequences from plant, fungi and
bacteria were downloaded and aligned using ClustalX. For
phylogenetic analysis, maximum parsimony tree was
constructed using bootstrap value of 1000 replicates to
examine the distance among these sequences.
Structure prediction of ChitTh: The structure prediction
of ChitTh was done by using automated modelling SWISS-
MODEL (http://swissmodel.expasy.org)7. Location and
number of helixes and sheets in a 2D representation
predicted by Psipred (http://bioinf.cs.ucl.ac.uk/psipred/)38
and a 3D model of the protein were built using I-TASSER
(http://zhanglab.ccmb.med.umich.edu/ITASSER/)48,63,65.
Gene expression analysis of endochitinase gene
Fungal total RNA extraction: Based on in vitro and in vivo
screening, two representatives of Trichoderma spp. viz. T. asperallum and T. harzianum were taken for the gene
expression analysis. Total RNA was extracted from the
frozen mycelium using Trizol (Invitrogen, USA) as
described by the manufacturer instructions. The RNA
samples were treated with DNase to make sure that no
genomic DNA was left in the samples. The integrity of RNA
was confirmed by running samples in 1.2% denaturating
agarose gel. First strand cDNA was synthesised from the
total RNA by reverse transcription reaction with oligo-(dT)
primers using Revert AidTM First Strand cDNA kit as
described by the manufacturer instructions.
Endochitinase gene expression analysis: Semi-
quantitative reverse transcription-polymerase chain reaction
(RT-PCR) was performed by using cDNA as template with
the primer set52 F: 5’ TCAGTGAATCATAGAATCTT 3’
and R: 5’ TAATGGATGCTAGACCTTTG 3’.
Amplifications were carried out in 25 µl reactions mixture
following the same PCR reaction conditions as in
conventional PCR for amplification of the endochitinase
gene. ITS 1 and ITS 461 were used to amplify the internal
transcribed sequence (ITS) region using cDNA as template
of the three Trichoderma isolates used as control for
comparing the expression. The endochitinase gene
expression levels of Trichoderma spp. were observed on
1.2% agarose gel stained with ethidium bromide with respect
to the control ITS amplification.
Results Screening of Trichoderma spp. based on chitinolytic
activity: Twelve (12) Trichoderma isolates of four
Research Journal of Biotechnology Vol. 15 (4) April (2020) Res. J. Biotech
43
representative species viz. Trichoderma harzianum, T. longibraciatum, T. nigricans and T. virens were shortlisted
for chitinolytic activity studies based on their antagonistic
efficacy. These isolates were cultured on chitin agar plates
to screen their chitinase activity. The results revealed that
among the twelve Trichoderma isolates, SVPRT-THLi03
and SVPRT-47 (Trichoderma harzianum) recorded
maximum viable/germinating spores ability (3x108 and
2x108 spores/ml respectively) (Table 1) that are correlated to
the better chitinase enzyme activity.
Trichoderma isolates showed detectable chitinolytic activity
expressed in terms of conc. of NAGA (mg/ml) released in
colloidal chitin supplemented media. Released NAGA conc.
ranged from 41.33 (isolate SVPRT-LB06) to 126.67 (isolate
SVPRT-THLi01) mg/ml (Fig.1).
Cloning of gene encoding endochitinase and
confirmation of clones: An amplicon of 1223 bp was
obtained from genomic DNA of all T. harzianum isolates
with the specific primer set after PCR amplification where
other Trichoderma spp. were unable to amplify the expected
size PCR product except in two T. longibrachiatum isolates
where ~2 kb product was amplified (Fig. 2a). The PCR
products from two T. harzianum were excised and eluted
from gel and the eluted fragments were confirmed by 1.2%
agaroae gel electrophoresis. The eluted fragments were
ligated into pGEMT-Easy Vector and transformed to E. coli
DH5α separately. The recombinant E. coli DH5α was
maintained on Luria agar having Amp100 as a selection
pressure.
Recombinant cells were selected based on blue/white colony
confirmation assay (Supplementary Fig. 1). The
confirmation of positive clones was done by restriction
digestion and colony PCR amplification. The positive clones
gave ~1.2 kb amplicon using endochitinase gene specific
primer with colony PCR as described earlier for
amplification of endochitinase gene (Fig. 2b). Restriction
digestion analysis was done with EcoR1 which produced the
1.2 kb fragment insert from the pGEMT vector of ~3 kb (Fig.
3 a, b).
Sequencing and phylogenetic analysis of the clones: The
M13 primer was used to amplify the gene insert from the
pGEMT Easy Cloning Vector and the nucleotide sequence
of putative endochitinase (ChitTh) gene was obtained. The
complete ChitTh gene was obtained after processing the
sequences through GENE TOOL and VecScreen service.
The nucleotide sequences of ChitTh gene were subjected to
BLAST analysis for homology search; it showed 99%
homology with Hypocrea lixii isolate DLY1202
endochitinase 42 gene (accession #HQ286987.1),
Trichoderma harzianum chit-HAR2 endochitinase
(accession #AB041752.1) with 0.0 E-value. Based on 24
endochitinase nucleotide sequences belonging to different
organisms, ChitTh showed polyphyletic distribution
(Supplementary Fig. 1).
The endochitinase genes of various organisms were grouped
into three major clusters. Cluster I contained mainly
Trichoderma spp. endochitinase genes and was divided into
two sub-cluster. The first sub-cluster in clade I contained
ChitTh gene with other Trichoderma spp. endochitinase
gene. The clade II and III also showed a polyphyletic
distribution for selected reference endochitinase genes
belonging to bacteria and plants. The redundancy of the
chitinase gene distribution across different organisms or
even between Trichoderma species reflects their functional
difference between related proteins.
In silico analysis of ChitTh sequence: The ChitTh gene
sequence of 1223 bp was processed with ORF Finder which
revealed a single ORF (Open reading frame) with 379 amino
acid residues followed by a stop codon (Fig.4 A, B). Fig. 1B
shows the location of peptidase cleavage site and conserved
domains within the amino acids. Further, the protein was
subjected to BLASTp algorithm for homology analysis and
the sequence confirmed 65-99% identity to Trichoderma
endochitinases. Based on homology to available sequences
in the database, ChitTh appears to be an endochitinase with
an N-terminal signal peptide of 22 amino acids followed by
glycosyl hydrolase family 18 domains.
The SignalIP indicated the presence of a putative signal
sequence SSA/SP in the protein (Supplementary Fig. 2).
After processing of the 22 N-terminal amino acids, the
predicted molecular mass of ChitTh is 40.7 kDa with a
theoretical pI of 8.30 and the protein was deemed stable with
a net negative charge.
Chitin catalytic domain organization: The ChitTh amino
acid sequence was blasted against eleven reference amino
acid sequence of endochitinase genes from Trichoderma
spp., one Aspergillus spp. and one plant species (Elaeis
guineensis) available at NCBI database. The Multialin
analysis was performed for multiple alignments with default
parameters (Fig 5). Multiple alignment results revealed
several regions of homology as indicated by derived
consensus sequence in red. Comparison of ChitTh sequences
predicted that ChitTh shared a high degree of similarity
among fungal endochitinases and the regions of SIGGW and
FDGIDVDWE (Conserved domain are SxGG and
DxxDxDxE) which were highly conserved among chitinases
of the glycosyl hydrolase family 18.
Minimum variation was observed within the SxGG and
DxxDxDxE conserved domains of the amino acid sequences
whereas the variation was observed in the chitin binding
domain (SxGG) of Elaeis guineensis chitin-like protein and
the absence of the signature DxxDxDxE domain in the
putative endochitinase ECH30 (ech30) of T. atroviride.
Serine [Ser (S) 146] and glycine [Gly (G): 148,149] in the
conserved region (orange box) are hydrophilic and
hydrophobic in nature that are responsible for reacting with
the surface of chitin molecules during a hydrolysis reaction.
Research Journal of Biotechnology Vol. 15 (4) April (2020) Res. J. Biotech
44
The blue box was dominated by glutamic acid (E) and
aspartic acid (D) residues responsible for the acidic and
negatively charged nature of the ChitTh protein. In addition,
the InterProScan analysis of ChitTh revealed its close
relation to family 18 (GH18) of glycosyl hydrolases with N-
terminal signal peptide followed by non-cytoplasmic
domain (IPR017853) and chitinase insertion domain
(IPR029070) of glycoside hydrolase superfamily
(Supplementary Fig. 4).
The complete annotation of ChitTh protein showed presence
of 22 amino acids long signal peptide at N-terminal of
premature protein, a typical signature of proteins with
secretory nature and Serine [S] at position 23 was the first
amino acid of the mature protein. No O-glycosylation site
was observed in the protein which confirmed the secretory
nature of protein.
Phylogenetic analysis of ChitTh protein: Based on 43
reference endochitinase protein sequences belonging to
different organisms (plants, fungi and bacteria), ChitTh from
T. harzianum (SVPRT- THLi03) showed polyphyletic
distribution (Fig. 6). Class I contains endochitinases of plant
origin further divided into three sub-clades. These subclades
were then further separated into group Ia (acidic plant
chitinase) and group Ib (basic endochitinase). Class III
constituted chitinases belonging to the family 18 glycosyl-
hydrolases and are further divided in sub-clades where group
IIIa and IIIb contain fungal and plant origin endochitinases
respectively. Class IV and V constituted single clades.
Maximum Parsimony phylogenetic tree places ChitTh in
group V together with other Trichoderma spp.
endochitinases. Moreover, maximum likelihood and
UPGMA methods clustered ChitTh alone between group III
and V when analysis was conducted on the same set of
sequences (Supplementary Fig. 3 a, b).
Structural modelling of ChitTh: The secondary structure
of ChitTh protein consisted of 9 stands of parallel β-barrel
sheets within the 9 external α helices (Supplementary Fig.
4). A 3D modelling analysed through I-TASSER which was
based on top 10 PDB hits, revealed that the β-barrel sheets
are located within the barrel structure of the protein (Fig. 7).
The proposed model of T. harzianum ChitTh endochitinase
was predicted using 3g6m.1. A template of Clonostachys rosea chitinase CrChi1 revealed query coverage of 0.86 and
identity of 66.06%. The ligand binding pocket for T.
harzianum endochitinase contained 12 amino acids
including Leu19, Gly80, Trp81, Thr82, Asp119, Glu121,
Met187, Tyr189, Asp190, Tyr243, Arg245 and Trp334. The
QMEAN score of predicted model is -1.12 and normalized
Z-score 3.25 within the prescribed limits describing the
expected similarity to the native structure.
Semi-quantitative gene expression analysis: Based on the
antagonistic activity of Trichoderma spp. in vitro and in vivo
condition, two representatives of Trichoderma species viz. T.
harzianum and T. nigricans isolates were selected for the
gene expression analysis. Total RNA was extracted from
mycelium of all three Trichoderma isolates and cDNA was
used as a template in the RT-PCR. Expression analysis of
cDNA amplification of Trichoderma isolates showed higher
expression of endochitinase gene in T. harzianum (SVPRT-
THLi03 and SVPRT-47) and a marked lesser expression was
detected in T. nigricans (SVPPP-7) with respect to other two
isolates and internal transcribed spacer (ITS) sequence as
control (Fig. 8), as visualized under gel documentation
system.
Fig. 1: Chitinase activity of twelve Trichoderma isolates in colloidal chitin supplementary broth
0
5
10
15
20
25
Endochitinase activityUn
its/
ml
Trichoderma isolates
Research Journal of Biotechnology Vol. 15 (4) April (2020) Res. J. Biotech
45
Fig. 2(a): PCR amplification of endochitinase from Trichoderma spp. visualized on 1.2% agarose gel stained with
ethidium bromide. Lanes M contain the 1 Kb molecular ladder; Lane 1- Hypocrea virens, 2 and 4- T. longibrachiatum,
3 and 5- T. nigrican, 6-12- T. harzianum
Fig. 2 (b): Colony PCR analysis of the white/ blue (control) colonies to confirm the presence of the insert.
Lane 1-10 - White colonies; 11-14- Blue colonies; 15- Negative control (no colony); M- 1 kb marker
M 1 2 3 4 M
0.5
1.03.0
5.0
10
kb
0.5
1.0
3.0
5.0
10
kb
1 2 3 4 5 6 7 8 9 10 11 12 M kb
0.1
0.5
1.5
3.0
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 kb
1.0
3.0
10.0
M 1 2
0.5
10
5.0
kb
3.0
Fig. 3 (a): Recombinant Cloned Plasmid
isolated from two isolates of Trichoderma
harzianum. Lanes M: 1 Kb ladder,
Lane 1: SVPRT-THLi03, Lane 2: SVPRT-47
Figure 3 (b): Restriction analysis of the
cloned endochitinase gene Lanes M: 1 Kb
molecular ladder, Lane 1: Amplified
endochitinase gene, Lane 2: Cloned plasmid,
Lane 3 and 4: Restriction digestion of cloned
endochitinase gene from SVPRT-THLi03 and
SVPRT-47 digested with EcoR1
Research Journal of Biotechnology Vol. 15 (4) April (2020) Res. J. Biotech
46
(A)
(B)
Fig. 4: The putative endochitinase (ChitTh) gene. (A) The Nucleotide and Protein Sequences of ChitTh. (B) The
Amino Acid Sequence of ChitTh. The peptide cleavage site indicated in green bold underlined (SSA/SP) and
sequences that are highlighted are the conserved domains in different endochitinase genes.
Research Journal of Biotechnology Vol. 15 (4) April (2020) Res. J. Biotech
47
Fig. 5: Output of Multiple sequence alignments of endochitinases processed with Multialin. The boxed regions
represent the location of two conserved domains in the putative gene. Legend: ChitTH, AEF28834.1| Hypocrea lixii
isolate SG3303 endochitinase 42, AEF28830.1| Hypocrea lixii isolate DLY1202 endochitinase 42, AEF28839.1|
Hypocrea lixii isolate ZQ2302 endochitinase 42, AEF28842.1| Hypocrea lixii isolate NC3206 endochitinase 42
and77069.1| Hypocrea lixii chitinase (chit42), AEF28840.1| Hypocrea lixii isolate HA1102 endochitinase 42,
XP_024767653.1| Trichoderma harzianum CBS 226.95 glycoside hydrolase family 18 protein, ACJ38679.1| Hypocrea
lixii chitinase (chit42), PYH70597.1| Aspergillus vadensis cbs 113365 genomic scaffold, AFV30206.1| Elaeis guineesis
chitinase-like protein (Chit5-1), AAP81811.1| Trichoderma atroviride putative endochitinase ECH30 (ech30). The blue
boxes represent the conserved domain for all sequences.
Research Journal of Biotechnology Vol. 15 (4) April (2020) Res. J. Biotech
48
Fig. 6: Evolutionary relationship of ChitTh inferred based on amino acid sequence with other endochitinases with
Maximum Parsimony method. Analysis was conducted in MEGA5.1 and the percentage of replicate trees in which
the associated taxa clustered together in the bootstrap test (1000 replicates) are shown to the branches. The most
parsimonious tree with length = 670 is shown. The evolutionary distances were computed using the Substree-Pruning-
Regrafting (SPR) algorithm and are in the units of the number of amino acid substitutions per site.
The analysis involved 41 amino acids sequences retrieved from database. All positions containing gaps
and missing data were eliminated.
ChitTh
gi|38091825|emb|CAE53388.1| endochitinase Trichoderma lixii
gi|88191687|gb|ABD42924.1| endochitinase Trichoderma harzianum
gi|19073005|gb|AAL84699.1|AF395760 1 endochitinase class V precursor Trichoderma virens
gi|19073003|gb|AAL84698.1|AF395759 1 endochitinase class V precursor Trichoderma virens
gi|19073001|gb|AAL84697.1|AF395758 1 endochitinase class V precursor Trichoderma virens
gi|1435849967|gb|RDH17911.1| class V chitinase Aspergillus niger ATCC 13496
gi|1440845097|gb|RDK46183.1| class V chitinase Aspergillus phoenicis ATCC 13157
gi|477532312|gb|ENH83952.1| class III chitinase Colletotrichum orbiculare MAFF 240422
gi|32441473|gb|AAP81811.1| putative endochitinase ECH30 Trichoderma atroviride
gi|21264396|sp|P46876.2|CHI1 CANAX RecName: Full Chitinase 1 Flags: Precursor
gi|1399667060|gb|PYH78528.1| class III chitinase Aspergillus uvarum CBS 121591
gi|1168933|sp|P40954.2|CHI3 CANAL RecName: Full Chitinase 3 Flags: Precursor
gi|171334|gb|AAA34539.1| endochitinase Saccharomyces cerevisiae
gi|1198333454|ref|NP 001236631.2| class III acidic endochitinase precursor Glycine max
gi|23499326|gb|AAN37392.1|AF435029 1 class III chitinase Capsicum annuum
gi|670422815|ref|XP 008652267.1| acidic endochitinase Zea mays
gi|28848952|gb|AAO47731.1| acidic class III chitinase Rehmannia glutinosa
gi|118200080|emb|CAJ43737.1| class III chitinase Coffea arabica
gi|308212836|gb|ADO21646.1| class III chitinase partial Tamarindus indica
gi|432580|gb|AAB28479.1| acidic class III chitinase SE2 Beta vulgaris
gi|45934508|gb|AAS79333.1| endochitinase class III PR3 partial Malus domestica
gi|33413585|gb|AAM77132.1| endochitinase Trichoderma atroviride
gi|1399657756|gb|PYH69358.1| class III chitinase Aspergillus vadensis CBS 113365
gi|485925806|gb|EOD50296.1| class iii chitinase protein Neofusicoccum parvum UCRNP2
gi|953380201|ref|XP 014534369.1| Class III chitinase putative Penicillium digitatum Pd1
gi|526117633|ref|NP 001268075.1| class IV chitinase precursor Vitis vinifera
gi|2306811|gb|AAB65776.1| class IV endochitinase Vitis vinifera
gi|442564141|gb|AET86623.2| class IV endochitinase Dactylis glomerata
gi|315258225|gb|ADT91691.1| endochitinase Nicotiana attenuata
gi|19847|emb|CAA45822.1| chitinase B class I partial Nicotiana tabacum
gi|625295692|gb|AHY24796.1| endochitinase Triticum aestivum
gi|108708844|gb|ABF96639.1| Basic endochitinase Oryza sativa Japonica Group
gi|1144307|gb|AAB08443.1| chitinase class II Solanum lycopersicum
gi|307159110|gb|ADN39439.1| class I chitinase isoform 2 partial Castanea sativa
gi|728844414|gb|KHG23857.1| Endochitinase 1 Gossypium arboreum
gi|6573210|gb|AAF17593.1|AF202731 1 chitinase class I Glycine max
gi|545912031|gb|AGW81842.1| class I chitinase Theobroma cacao
gi|298106229|gb|ADI56257.1| class I chitinase Gossypium hirsutum
gi|4205741|gb|AAD11255.1| class I chitinase partial Gossypium hirsutum86
99
83
100
75
52
99
98
44
87
100
63
62
46
85
31
88
50
98
71
96
27
20
20
37
42
56
68
33
35
41
40
49
77
99
34
36
V
IIIb
IIIa
IV
Ia
Ib
Research Journal of Biotechnology Vol. 15 (4) April (2020) Res. J. Biotech
49
Fig. 7: The 3D Model of T. harzianum (SVPRT-THLi03) protein. 3D structure of ChitTh showing 9 β-sheets laid in
the middle surrounded by the helixes (as indicated by arrow). The 3D modelling of ChitTh used the following PDB
structures in prediction: 3g6mA, 3cheB, 1II6D, 1kfwA, 1itxA. The top 10 alignments (in order of their ranking) are
from the threading programs: 1: MUSTER, 2: FFAS-3D, 3: SPARKS-X, 4: HHSEARCH2, 5: HHSEARCH I, 6: Neff-
PPAS, 7: HHSEARCH, 8: pGenTHREADER, 9: wdPPAS and 10: PROSPECT2. The model presented was selected
based on the highest C-score of 1.23 (range -5 to 2). The C-score predicts the confidence score for estimating the
quality of models by I-TASSER. It is calculated based on the significance of threading template alignments and the
convergence parameters of the structure assembly simulation. In addition, the Z-score was also taken into
consideration where a normalized Z-score >1 means a good alignment.
Fig. 8: Semi-quantitative gene expression of endochitinase of Trichoderma isolates. Lane 1: Trichoderma harzianum
(SVPRT-THLi03); 2: T. harzianum (SVPRT-47); and 3: T. nigricans (SVPPP-7) in comparison to internal transcribed
spacer (ITS) sequence.
Table 1
Details of Trichoderma spp. used in this study and their germinating spore/ml ability on chitin plate
Isolate Isolate Code Source and Place of collection GenBank
Accession No.
Germinating
spore/ml
T. harzianum SVPPP-12 Soil & Rice field, Meerut KU215922 3x108
Hypocrea lixii SVPRT-47 Soil & Rice field, Meerut JX232597 2x109
Hypocrea lixii SVPRT-36 Soil & Rice field, Meerut KX139407 3x107
Hypocrea lixii SVPRT-THLi04 Soil & Sugarcane field, Muzaffarnagar JX232596 2x108
Hypocrea lixii SVPRT-THLi03 Soil & Sugarcane field, Muzaffarnagar JX232595 4x108
Hypocrea lixii SVPRT-THLi02 Soil & Sugarcane field, Meerut JX232594 3x106
Hypocrea lixii SVPRT-THLi01 Soil & Sugarcane field, Meerut JX232593 1x108
Hypocrea virens SVPRT-TVir01 Soil & Rice field, Meerut JX908730 2x105
T. longibrachiatum SVPRT-LB02 Soil & Rice field, Meerut JX908722 3x105
T. longibrachiatum SVPRT-LB06 Soil & Rice field, Meerut JX908726 2x105
T. nigricans SVPPP-7 Soil & Rice field, Meerut KU215926 1x105
T. nigricans SVPPP-19 Soil & Rice field, Meerut KU215927 2x104
1 2 3a
ENDOCHITINASE
ITS CONTROL
β- sheets laid
within the helixes
Research Journal of Biotechnology Vol. 15 (4) April (2020) Res. J. Biotech
50
Supplementary Fig. 1: Phylogenetic relationship of endochitinase (ChitTh) gene of T. harzianum isolate
(SVPRT- THLi03) based on nucleotide sequence with other endochitinases using Neighbour Joining method.
Measure Position Value Cutoff Signal peptide?
max. C 23 0.250
max. Y 23 0.463
max. S 10 0.942
mean S 1-22 0.856
D 1-22 0.675 0.450 YES
Name=Sequence1 SP=’YES’ Cleavage site between pos. 22 and
23: SSA-SP D=0.675 D-cutoff=0.450 Networks=SignalIP-noTM
Supplementary Fig. 2: SignalIP results of putative chit42 protein
Research Journal of Biotechnology Vol. 15 (4) April (2020) Res. J. Biotech
51
Discussion Trichoderma spp. are commercially applied as antagonistic
agents against fungal plant pathogens. The chitinolytic
enzymes secreted by Trichoderma spp. play a vital role in
controlling the plant diseases. Due to importance of
chitinases in agricultural, environmental and industrial
sectors, a number of genes encoding hydrolytic enzymes
have been cloned, characterized and explored to developing
resistance in transgenic plants against fungal
pathogens34,37,45,51. Since the biocontrol potential, chitinase
activity and chitinase encoding genes2,30 of different
Trichoderma spp. and isolates of same species showed vast
variation, it is important to isolate and characterize
Trichodrma spp. from different geographical areas.
Keeping in view the relevance of chitinase enzymes, a total
of twelve Trichoderma isolates of four representative
species viz., T. hazianum, T. longibrachiatum, T. virens and
T. nigricans were screened for their chitinolytic activity.
Differences were observed among different isolates with
respect to chitinolytic activity in colloidal chitin
supplemented broth medium. A correlation was established
on the chitin utilization ability and chitinase activity i.e. high
CFU (high colonization) was indicative of high enzyme
activity. Among the twelve isolates, Trichoderma
harzianum isolate SVPRT-THLi03 and SVPRT-47 showed
high CFU ability and better chitinase activity (17.21μg/ml
and 13.11μg/ml respectively).
Supplementary Fig. 3 (a): A Phylogenetics analysis ChitTh inferred based on amino acid sequence
with other endochitinases with Maximum Likelihood method. Analysis was conducted in MEGA5.1
and the percentage of replicate trees in which the associated taxa clustered together in the bootstrap test
(1000 replicates) are shown to the branches.
gi|315258225|gb|ADT91691.1| endochitinase Nicotiana attenuata
gi|19847|emb|CAA45822.1| chitinase B class I partial Nicotiana tabacum
CAA45821.1 chitinase C class I Nicotiana tabacum
gi|1144307|gb|AAB08443.1| chitinase class II Solanum lycopersicum
gi|625295692|gb|AHY24796.1| endochitinase Triticum aestivum
gi|108708844|gb|ABF96639.1| Basic endochitinase 2 precursor putative expressed Oryza sativa Japonica Group
gi|545912031|gb|AGW81842.1| class I chitinase Theobroma cacao
gi|298106229|gb|ADI56257.1| class I chitinase Gossypium hirsutum
gi|4205741|gb|AAD11255.1| class I chitinase partial Gossypium hirsutum
gi|6573210|gb|AAF17593.1|AF202731 1 chitinase class I Glycine max
gi|307159110|gb|ADN39439.1| class I chitinase isoform 2 partial Castanea sativa
gi|728844414|gb|KHG23857.1| Endochitinase 1 Gossypium arboreum
gi|442564141|gb|AET86623.2| class IV endochitinase Dactylis glomerata
gi|526117633|ref|NP 001268075.1| class IV chitinase precursor Vitis vinifera
gi|2306811|gb|AAB65776.1| class IV endochitinase Vitis vinifera
gi|1399657756|gb|PYH69358.1| class III chitinase Aspergillus vadensis CBS 113365
gi|953380201|ref|XP 014534369.1| Class III chitinase putative Penicillium digitatum Pd1
EMR90463.1 putative class iii protein Botrytis cinerea BcDW1
gi|485925806|gb|EOD50296.1| putative class iii chitinase protein Neofusicoccum parvum UCRNP2
gi|1435849967|gb|RDH17911.1| class V chitinase Aspergillus niger ATCC 13496
gi|1440845097|gb|RDK46183.1| class V chitinase Aspergillus phoenicis ATCC 13157
gi|19073005|gb|AAL84699.1|AF395760 1 endochitinase class V precursor Trichoderma virens
gi|19073003|gb|AAL84698.1|AF395759 1 endochitinase class V precursor Trichoderma virens
gi|19073001|gb|AAL84697.1|AF395758 1 endochitinase class V precursor Trichoderma virens
ChitTh
gi|38091825|emb|CAE53388.1| endochitinase Trichoderma lixii
gi|88191687|gb|ABD42924.1| endochitinase Trichoderma harzianum
gi|33413585|gb|AAM77132.1| endochitinase Trichoderma atroviride
gi|477532312|gb|ENH83952.1| class III chitinase Colletotrichum orbiculare MAFF 240422
gi|32441473|gb|AAP81811.1| putative endochitinase ECH30 Trichoderma atroviride
gi|1399667060|gb|PYH78528.1| class III chitinase Aspergillus uvarum CBS 121591
EMR81997.1 putative class iii protein Botrytis cinerea BcDW1
gi|21264396|sp|P46876.2|CHI1 CANAX RecName: Full Chitinase 1 Flags: Precursor
gi|1168933|sp|P40954.2|CHI3 CANAL RecName: Full Chitinase 3 Flags: Precursor
gi|171334|gb|AAA34539.1| endochitinase Saccharomyces cerevisiae
gi|432580|gb|AAB28479.1| acidic class III chitinase SE2 Beta vulgaris
gi|45934508|gb|AAS79333.1| endochitinase class III PR3 partial Malus domestica
gi|308212836|gb|ADO21646.1| class III chitinase partial Tamarindus indica
gi|670422815|ref|XP 008652267.1| acidic endochitinase Zea mays
gi|28848952|gb|AAO47731.1| acidic class III chitinase Rehmannia glutinosa
gi|118200080|emb|CAJ43737.1| class III chitinase Coffea arabica
gi|1198333454|ref|NP 001236631.2| class III acidic endochitinase precursor Glycine max
gi|23499326|gb|AAN37392.1|AF435029 1 class III chitinase Capsicum annuum
100
99
99
98
97
91
85
76
75
72
64
58
57
53
94
63
89
88
77
74
53
79
55
100
65
55
I
II
III
IV
V
Research Journal of Biotechnology Vol. 15 (4) April (2020) Res. J. Biotech
52
Supplementary Fig. 3 (b): Phylogenetics analysis ChitTh inferred based on amino acid sequence with other
endochitinases with UPGMA method. Analysis was conducted in MEGA5.1 and the percentage of replicate trees in
which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown to the branches.
Similar differences for chitinolytic activity among the Trichoderma isolates have been reported by other
workers1,31,41,52. Medium nutrient content is one of the
determinants of the levels of chitonylic enzymes production
and the presence of cell wall material has a significant
influence on the production of chitinase by many
Trichoderma isolates4,55.
Further, the amplicon of 1.2 kb has been amplified form
genomic DNA of different Trichodrma isolates by using a
pair of specific primers designed for Trichoderma spp.
endochitinase gene5. The amplicon of best chitinase
producing Trichoderma isolates was separately cloned into
pGEMT Easy Vector and sequenced commercially. The
resulting 1232 bp nucleotide sequence of ChitTh gene was
verified as an endochitinase gene through homologous
analysis via BLAST analysis which showed 99% homology
with Hypocrea lixii isolate DLY1202 endochitinase 42 gene
(accession #HQ286987.1). Phylogenetic analysis showed
that putative ChitTh endochitinase gene was clustered in
clade I with other Trichoderma spp. endochitinase gene.
A single ORF (open reading frame) with 379 amino acids
sequence was blasted against all protein sequences in the
NCBI database and returned 65-99% identity to
Trichoderma endochitinases. Comparison of the ChitTh
amino acid sequence showed conserved domain of the GH18
(glycosyl hydrolase, family 18) type II chitinases
hydrolyzing chitin. The glycosyl hydrolases GH18 includes
endochitinases that cleave the chitin into oligomers53.
gi|28848952|gb|AAO47731.1| acidic class III chitinase Rehmannia glutinosa
gi|670422815|ref|XP 008652267.1| acidic endochitinase Zea mays
gi|23499326|gb|AAN37392.1|AF435029 1 class III chitinase Capsicum annuum
gi|118200080|emb|CAJ43737.1| class III chitinase Coffea arabica
gi|1198333454|ref|NP 001236631.2| class III acidic endochitinase precursor Glycine max
gi|308212836|gb|ADO21646.1| class III chitinase partial Tamarindus indica
gi|432580|gb|AAB28479.1| acidic class III chitinase SE2 Beta vulgaris
gi|45934508|gb|AAS79333.1| endochitinase class III PR3 partial Malus domestica
gi|477532312|gb|ENH83952.1| class III chitinase Colletotrichum orbiculare MAFF 240422
gi|1399667060|gb|PYH78528.1| class III chitinase Aspergillus uvarum CBS 121591
EMR81997.1 putative class iii protein Botrytis cinerea BcDW1
gi|32441473|gb|AAP81811.1| putative endochitinase ECH30 Trichoderma atroviride
gi|21264396|sp|P46876.2|CHI1 CANAX RecName: Full Chitinase 1 Flags: Precursor
gi|1168933|sp|P40954.2|CHI3 CANAL RecName: Full Chitinase 3 Flags: Precursor
gi|171334|gb|AAA34539.1| endochitinase Saccharomyces cerevisiae
gi|33413585|gb|AAM77132.1| endochitinase Trichoderma atroviride
gi|1399657756|gb|PYH69358.1| class III chitinase Aspergillus vadensis CBS 113365
gi|953380201|ref|XP 014534369.1| Class III chitinase putative Penicillium digitatum Pd1
gi|485925806|gb|EOD50296.1| putative class iii chitinase protein Neofusicoccum parvum UCRNP2
EMR90463.1 putative class iii protein Botrytis cinerea BcDW1
gi|1435849967|gb|RDH17911.1| class V chitinase Aspergillus niger ATCC 13496
gi|1440845097|gb|RDK46183.1| class V chitinase Aspergillus phoenicis ATCC 13157
gi|19073003|gb|AAL84698.1|AF395759 1 endochitinase class V precursor Trichoderma virens
gi|19073001|gb|AAL84697.1|AF395758 1 endochitinase class V precursor Trichoderma virens
gi|19073005|gb|AAL84699.1|AF395760 1 endochitinase class V precursor Trichoderma virens
gi|38091825|emb|CAE53388.1| endochitinase Trichoderma lixii
ChitTh
gi|88191687|gb|ABD42924.1| endochitinase Trichoderma harzianum
gi|526117633|ref|NP 001268075.1| class IV chitinase precursor Vitis vinifera
gi|2306811|gb|AAB65776.1| class IV endochitinase Vitis vinifera
gi|442564141|gb|AET86623.2| class IV endochitinase Dactylis glomerata
gi|728844414|gb|KHG23857.1| Endochitinase 1 Gossypium arboreum
gi|298106229|gb|ADI56257.1| class I chitinase Gossypium hirsutum
gi|4205741|gb|AAD11255.1| class I chitinase partial Gossypium hirsutum
gi|545912031|gb|AGW81842.1| class I chitinase Theobroma cacao
gi|6573210|gb|AAF17593.1|AF202731 1 chitinase class I Glycine max
gi|307159110|gb|ADN39439.1| class I chitinase isoform 2 partial Castanea sativa
gi|315258225|gb|ADT91691.1| endochitinase Nicotiana attenuata
gi|19847|emb|CAA45822.1| chitinase B class I partial Nicotiana tabacum
CAA45821.1 chitinase C class I Nicotiana tabacum
gi|1144307|gb|AAB08443.1| chitinase class II Solanum lycopersicum
gi|625295692|gb|AHY24796.1| endochitinase Triticum aestivum
gi|108708844|gb|ABF96639.1| Basic endochitinase 2 precursor putative expressed Oryza sativa Japonica Group
100
100
100
100
100
100
97
94
100
94
100
94
92
88
100
83
75
100
71
97
100
51
68
51
49
46
41
40
31
100
100
100
89
88
26
47
0.00.20.40.60.81.01.2
I
II
III
V
Research Journal of Biotechnology Vol. 15 (4) April (2020) Res. J. Biotech
53
In phylogenetic analysis, the ChitTh endochitinase of T. harzianum isolate SVPRT-THLi03 was clustered in group V
along with other Trichoderma spp. endochitinases.
According to Henrissat and Bairoch23, endochitinase have
been divided into two families, 18 and 19 glycosyl
hydrolases. Family 18 chitinases contains plants, bacteria,
fungi (Classes III and V), mammals and viruses as
members46.
Supplementary Fig. 4: Secondary structure analysis of ChitTh protein by Psipred. Location and number of helixes
and sheets are shown.
Research Journal of Biotechnology Vol. 15 (4) April (2020) Res. J. Biotech
54
Chitinases from two different families do not share amino
acid sequence similarities and have completely different 3-
dimension structures and molecular mechanisms41. The
predicted size of the endochititnase is 40.7 kDa with N-
terminal signal peptide based on amino acid sequence. A
signal peptide of 31 amino acids for ech42 of T. virens2, 19
amino acids for ech30 and chiII of T. atroviridae and
Glaciozyma antartica30,44, 22 amino acids for ech42 of T. harzianum53 and 22 amino acids long in the present study for
T. harzianum ChitTh endochitinase revealed vast variation
in their size. The signal peptides between 16 and 30 amino
acids residues are usually nascent N-terminal extensions
composed of a hydrophilic, positively charged N-region,
followed by hydrophobic central H-region of 5-15 residues
and cleavage site for signal peptidase at C-region53.
The variation in size of signal peptide of endochitinases has
been reported for various species of Trichoderma6,26. The
signal peptides mediate targeting of protein within secretory
and membrane polypeptide chains28. The presence of N-
terminal signal peptides in chitinase suggested their
extracellular secretion.
The secondary and tertiary structure model of ChitTh
showed that β sheets are buried within the barrel structure of
the protein. This is as previously reported by other
researchers17,41. The active glutamic acid (Glu195) residue
and the negatively charged amino acids Asp188, Asp191 and
Asp193 (DxxDxDx) of class V, family 18 chitinases were
found within the catalytic domain in the barrel of the ChitTh.
The glutamic acid residues have been implicated in catalytic
activity by other researchers25,29. In addition to the highly
conserved amino acid Glu195, Asp188, Asp191, Asp193,
which have important roles in the enzyme function41, the I-
TASSER program also predicted active residues in Tyr189
and Try243. Both these residues are highly conserved in all
proteins analyzed for Trichoderma harzianum endochitinase
(ech42). This is expected as our BLAST analysis of ChitTh
returned highest homology to ech42 gene.
A semi-quantitative expression profiling of endochitinase
gene of three Trichoderma isolates viz. SVPRT-THLi03 and
SVPRT-47 (T. harzianum) and SVPPP-7 (T. nigricans) was
analysed which showed variable expression levels of the
gene. Expression level was found to be high in T. harzianum
isolates in comparison to T. nigricans. Similar
overexpression of novel chitinase gene from T. harzianum
was also observed by other researchers8,52.
Conclusion In conclusion, the overall in silico characterization of ChitTh
revealed that it belongs to the family 18 hydrolases and
contains conserved repeats of amino acids (Glu, Asp and
Tyr) known to be conserved in family 18 endochitinases.
Comparative study of ChitTh revealed high similarity with
strongly conserved 42 kDa endochitinase of Trichoderma
spp.35 Evolutionary classification indicated that ChitTh is
likely a Class V fungal endochitinase.
However, ChitTh endochitinase gene of T. harzianum
SVPRT-THLi03 differs in its domain structure, protein
molecular weight and signal peptide length from other
endochitinases of Trichoderma spp., bacteria and plants
indicating variation in amino acid sequence.
References 1. Agrawal T. and Kotasthane A.S., Chitinolytic assay of
indigenous Trichoderma isolates collected from different
geographical location of Chhattisgarh in Central India, Springer
Plus, 1, 73 (2012)
2. Alias N., Mahadi N.M., Myrad A.M.A., Bakar F.D.A.,
Mahmood N.A.N. and Illias R.M., Expression and characterization
of Trichoderma virens UKM-1 endochitinase in Escherichia coli,
World J. Microbiol. Biotechnol., 25(4), 561-572 (2009)
3. Altschul S.F., Madden T.L., Schaffer A.A., Zhang J., Zhang Z.,
Miller W. and Lipman D.J., Gapped BLAST and PSI-BLAST: a
new generation of protein database search programs, Nucleic Acids
Res., 25, 3389-3402 (1997)
4. Andre S. and Monika S., Biology and biotechnology of
Trichoderma, Appl. Microbiol. Biotechnol., 87, 787-799 (2010)
5. Baek J.M., Howell C.R. and Kenerley C.M., The role of an
extracellular chitinase from Trichoderma virens GV29-8 in the
biocontrol of Rhizoctonia solani, Curr. Genet., 35, 41-50 (1999)
6. Baratto C.M., Dutra V., Boldo J.T., Leiria L.B., Vainstein M.H.
and Schrank A., Isolation, characterization and Transcriptional
Analysis of the Chitinase chi2 Gene (DQ011663) from the
Biocontrol Fungus Metarhizium anisopliae var. anisopliae, Curr.
Microbiol., 53, 217-221 (2006)
7. Biasini M., Bienert S., Waterhouse A., Anold K., Studer G.,
Schmidt T., Kiefer F., Gallo Cassarino T., Bertoni M., Bordoli L.
and Schwede T., SWISS-MODEL: modelling protein tertiary and
quaternary structure using evolutionary information, Nucleic Acid
Res., 42(W1), W252-W258 (2014)
8. Bolar J.P., Noreli J.L., Wong K.W., Hayes C.K., Harman G.E.
and Aldwinckle H.S., Expression of endochitinase from
Trichoderma harzianum in transgenic apple increases resistance to
apple scab and reduces vigour, Phytopathol., 90, 72-77 (2000)
9. Chaudhary S., Isolation and molecular characterization of
Rhizoctonia solani races causing sheath blight disease in Rice and
functional analysis of its biocontrol by Trichoderma spp., Ph.D.
Thesis, Sardar Vallabhbhai Patel University of Ag. and Tech.,
Meerut (2017)
10. Chet I. and Baker R., Isolation and biocontrol potential of
Trichoderma hamatum from soil naturally suppressive of
Rhizoctonia solan, Phytopathol., 71, 286-290 (1981)
11. Collinge D.B., Kragh K.M., Mikkelsen J.D., Nielsen K.K.,
Rasmussen U. and Vad K., Plant chitinases, Plant J., 3, 31-40
(1993)
12. Dahiya N., Tewari R. and Hoondal G.S., Biotechnological
aspects of chitinolytic enzymes: a review, Appl. Microbiol.
Biotechnol., 71, 773-782 (2006)
Research Journal of Biotechnology Vol. 15 (4) April (2020) Res. J. Biotech
55
13. Dolye J.J. and Doyle J.L., A rapid DNA isolation procedure for
small quantities of fresh leaf tissue, Phytochem. Bull., 19, 11-15
(1987)
14. Flach J., Pilet P.E. and Jolles P., What’s new in chitinase
research?, Experimenta, 48, 701-716 (1992)
15. Gasteiger E., Hoogland C., Gattiker A., Duvaud S., Wilkins
M.R., Appel R.D. and Bairoch A., Protein Identification and
Analysis Tools on the ExPASy Server, In The Proteomics
Protocols Handbook, Eds., Walker J.M., Humana Press, 571-607
(2005)
16. Geremia R.A., Goldman G.H., Jcobs D., Ardiles W., Vila S.B.,
Van Montagu M. and Herrera-Estrella A., Prb1, a gene specifically
expressed during simulated mycoparasitism by Trichoderma
harzianum, Mol. Microbiol., 8, 603-613 (1993)
17. Goody G.W., Aggressive and defensive roles for chitinases,
EXS., 87, 157-169 (1999)
18. Hadar Y., Chet I. and Henis Y., Biological control of
Rhizoctonia solani Damping-off with Wheat Bran Culture of
Trichoderma harzianum, Phytopathol., 69, 64-68 (1979)
19. Hamid R., Khan M.A., Ahmad M., Ahmad M.M., Abdin M.Z.,
Musarrat J. and Javed S., Chitinases: An update, J. Pharm. Bioall.
Sci., 5, 21-29 (2013)
20. Haran S., Schickler H., Oppenheim A. and Chet I., New
components of the chitinolytic system of Trichoderma harzianum,
Mycol. Res., 99, 441-446 (1995)
21. Harman G.E., Overview of mechanisms and uses of
Trichoderma spp., Phytopathol., 96, 190-194 (2006)
22. Harman G.E., Hayes C.K., Lorito M., Broadway R.M.,
DiPietro A., Peterbauer C. and Tronsmo A., Chitinolytic enzymes
of Trichoderma harzianum: purification of chitobiosidase and
endochitinase, Phytopathol., 83, 313-318 (1993)
23. Henrissat B. and Bairoch A., Updating the sequence-based
classification of glycosyl hydrolases, Biochem. J., 316, 695-696
(1996)
24. Hermosa M.R., Grondona I., Iturriaga E.A., Diaz-Minguez
J.M., Castro C., Monte E. and Garcia-Acha I., Molecular
characterization and identification of biocontrol isolates of
Trichoderma spp., Appl. Environ. Microbiol., 66, 1890-1898
(2006)
25. Hollis T., Monzingo A.F., Bortone K., Ernst S., Cox R. and
Robertus J.D., The X-ray structure of a chitinase from the
pathogenic fungus Coccidiodes immitis, Prot. Sci., 9, 544-551
(2000)
26. Ihrmark K., Asmali N., Ubhayasekera W., Melin P., Stenlid J.
and Karlsson M., Comparative Molecular Evolution of
Trichoderma Chitinases in Response to Mycoparasitic Interaction,
Evol. Bioinform., 6, 1-26 (2010)
27. Kamil Z., Rizk M., Saleh M. and Moustafa S., Isolation and
identification of Rhizosphere soil chitinolytic bacteria and their
potential in antifungal biocontrol, Global J. Mol. Sci., 2, 57-66
(2007)
28. Kapp K., Schrempf S. and Lemberg M.K., Post-targeting
functions of signal peptides, In Madame Curie Bioscience
Database, Austin (TX), Landes Biscience (2013)
29. Kim D.J., Jong M.B., Pedro U., Charles M., Kenerl Y., Douglas
R. and Crook, Cloning and characterization of multiple glycosyl
hydrolase gene from Trichoderma virens, Curr. Genet., 40, 374-
384 (2002)
30. Klemsdal S.S., Clarke J.L., Hoell, I.A., Eijsink V.G. and
Brurberg M.B., Molecular cloning, characterization and expression
studies of a novel chitinase gene (ech30) from the mycoparasite
Trichoderma atroviride strain P1, FEMS Microbiol. Lett., 256,
282-289 (2006)
31. Kovacs K., Szaleacs G., Pusztahelyi T. and Pandey A.,
Production of chitinolytic enzymes with Trichoderma
longibrachiatum IMI 92027 in solid substrate fermentation, Appl.
Biochem. Biotechnol., 118, 189-204 (2004)
32. Kumar S., Koichiro T. and Masatoshi N., MEGA3: Integrated
software for evolutionary genetics analysis and sequence
alignment, Brief Bioinform., 5, 150-163 (2004)
33. Liu M., Sun J., Zhu J., Xu T., Harman G.E. and Lorito M.,
Enhancing rice resistance to fungal pathogens by transformation
with cell wall degrading enzyme genes from Trichoderma
atroviride, J. Zhejiang Uni. Sci., 5, 133-136 (2004)
34. Liu Z.H., Yang Q., Hu S., Zhang J.D. and Ma J., Cloning and
characterization of a novel chitinase gene (chi46) from
Chaetomium globosum and identification of its biocontrol activity,
Appl. Microbiol. Biotechnol., 80, 241-252 (2008)
35. Loc N.H., Quang H.T., Hung N.B., Huy N.D., Phuong T.T.B.
and Ha T.T.T., Trichoderma asperellum Chi42 genes encode
chitinase, Mycobiol., 39, 182-186 (2011)
36. Lorito M., Hayes C.K., Di Pietro A., Woo S.L. and Harman
G.E., Purification, characterization and synergistic activity of a
glucan 1,3,-β-glucosidase and an N-acetyl-β-glucosaminidase
from Trichoderma harzianum, Phytopathol., 84, 398-405 (1994)
37. Lorito M., Woo S.L., Garcia I., Fernandez I.G., Colucci G.,
Harman G.E., PintorToro J.A., Fillippone E., Muccifora S.,
Lawrence C.B., Zoina A., Tuzun S. and Scala F., Genes from
mycoparasitic fungi as a source for improving plant resistance to
fungal pathogens, Proc. Natl. Acad. Sci., 95, 7860-7865 (1998)
38. McGuffin L.J., Bryson K. and Jones D.T., The PSIPRED
protein structure prediction server, Bioinform., 16, 404-405 (2000)
39. Miller G.L., Use of dinitrosalicylic acid reagent for
determination of reducing sugar, Anal. Chem., 31, 426-429 (1959)
40. Mukherjee M., Mukherjee P.K., Horwitz B.A., Zachow C.,
Berg G. and Zeilinger S., Trichoderm-Plant-Pathogen Interaction:
Advances in Genetics of Biological Control, Indian J. Microbiol.,
52, 522-529 (2012)
41. Nadarajah K., Ali H.Z. and Omar N.S., The isolation and
characterization of an endochitinase gene from a Malaysian isolate
of Trichoderma sp., Aust. J. Crop. Sci., 8, 711-721 (2014)
Research Journal of Biotechnology Vol. 15 (4) April (2020) Res. J. Biotech
56
42. Park J.K., Morita K., Fukumoto I., Yamasaki Y., Nakagawa T.,
Kawamukai M. and Matsuda H., Purification and characterization
of the Chitinase (chiA) from Enterobacter sp. G-1, Biosci.
Biotechnol. Biochem., 61, 684-689 (1997)
43. Perrakis A., Wilson K.S., Chet I., Oppenheim A.B. and Vorgias
C.E., Phylogenetic relationships of chitinases, In Chitin
Enzymology, Eds., Muzzarelli R.A.A., Atec, Italy, 217-232 (1993)
44. Ramli A.N., Mahadi N.M., Rabu A., Murad A.M., Bakar F.D.
and Illias M.R., Molecular cloning, expression and biochemical
characterization of a cold-adapted novel recombinant chitinase
from Glaciozyma antarctica PI12, Microb. Cell Fact., 10, 94
(2011)
45. Rana I.A., Loerz H., Schaefer W. and Becker D.,
Overexpression of chitinase and chitosanase genes from
Trichoderma harzianum under constitutive and inducible
promoters in order to increase disease resistance in wheat (Triticum
aestivum L.), Mol. Plant Breed, 3, 3659-3670 (2012)
46. Rifat H., Minhaj A.K., Mahboob A., Malik M.A., Malik Z.A.,
Javed M. and Saleem J., Chitinases: An update, J. Pharm. Bioall.
Sci., 5, 21-29 (2013)
47. Roberts W.K. and Selitrennikoff C.P., Plant and bacterial
chitinases differ in antifungal activity, J. Gen. Microbiol., 134,
169-176 (1988)
48. Roy A., Alper K. and Zhang Y., I-TASSER: A unified platform
for automated protein structure and function prediction, Nat.
Protoc., 5, 725-738 (2010)
49. Sagar S., Isolation and Molecular Characterization of
Colletotrichum falcatum races infecting Sugarcane varieties and its
in-vitro Management with Trichoderma spp., Ph.D. Thesis, Sardar
Vallabhbhai Patel University of Ag. and Tech., Meerut (2016)
50. Saito A., Fujii T., Yoneyama T., Redenbach M., Ohno T.,
Watanable T. and Miyashita K., High multiplicity of chitinase
genes in Streptomyces coelicolor A3(2), Biosci. Biotechnol.
Biochem., 63, 710-718 (1999)
51. Shah M.R., Mukherjee P.K. and Eapen S., Expression of a
fungal endocitinase gene in transgenic tomato and tobacco results
in enhanced tolerance to fungal pathogens, Physiol. Mol. Biol.
Plants, 16, 39-51 (2010)
52. Sharma P., Ramesh S.K., Kumar V., Singh D., Sharma M.,
Henry M.S. and Deep S., Cloning and semi-quantitative expression
of endochitinase (ech42) gene from Trichoderma spp., Afr. J.
Biotechnol., 11, 12930-12938 (2012)
53. Sharma V., Salwan R., Sharma P.N. and Kanwar S.S.,
Molecular cloning and characterization of ech46 endochitinase
from Trichoderma harzianum, Int. J. Biol. Macromol., 92, 615-624
(2016)
54. Shoresh M., Harman G.E. and Mastouri F., Induced systemic
resistance and plant responses to fungal biocontrol agents, Annu.
Rev. Phytopathol., 48, 21-43 (2010)
55. Sivan A. and Chet I., Degradation of fungal cell wall by lytic
enzymes of Trichoderma harzianum, J. Gen. Microbiol., 135, 675-
682 (1989)
56. Tamura K., Stecher G., Peterson D., Filipski A. and Kumar S.,
MEGA6.0: Molecular Evolutionary Genetics Analysis Version
6.0, Mol. Biol. Evol., 30, 2725-2729 (2013)
57. Ulhoa C.J. and Peberdy J.F., Purification and characterization
of an extracellular chitobiase from Trichoderma harzianum, Curr.
Microbiol., 23, 285-289 (1991)
58. Verena S., Bright H., Bernhard S. and Christain P.K., A
complete survey of Trichoderma chitinase reveals three distinct
subgroups of Family 18 chitinase, FEBS J., 272, 5923-5939 (2005)
59. Viterbo A., Haran S., Friesem D., Ramot O. and Chet I.,
Antifungal activity of a noval endochitinase gene (chit36) from
Trichoderma harzianum Rifai TM, FEMS Microbiol. Lett., 200,
169-174 (2001)
60. Viterbo A., Manuel A.M., Ramot O., Dana F., Enrique M.,
Antonio L. and Chet I., Expression regulation of the endochitinase
Chit36 from Trichoderma asperellum (T. harzianum T-203), Curr.
Genet., 42, 114-122 (2002)
61. White T.J., Bruns T., Lee S. and Taylor J., Amplification and
direct sequencing of fungal ribosomal RNA genes for
phylogenetics, In PCR Protocols: a guide to methods and
applications, Eds., Innis M.A., Gelfand D.H., Sninsky J.J. and
White T.J., Academic Press, San Diego, CA, 315-322 (1990)
62. Woo S.L., Ruocco M., Vinale F., Nigro M., Marra R.,
Lombardi N., Pascale A., Lanzuise S., Manganiello G. and Lorito
M., Trichoderma-based Products and their Widespread Use in
Agriculture, Open Mycol. J., 8, 71-126 (2014)
63. Yang J., Yan R., Roy A., Xu D., Poisson J. and Zhang Y., The
I-TASSER Suite: Protein structure and function prediction, Nature
Met., 12, 7-8 (2015)
64. Zdobnov E.M. and Apweiler R., InterProScan- an integration
platform for the signature-recognition methods in InterPro,
Bioinform., 17, 847-8 (2001)
65. Zhang Y., I-TASSER server for protein 3D structure
prediction, BMC Bioinform., 9, 40 (2008).
(Received 29th March 2019, accepted 18th June 2019)