research journal of biotechnology vol. res. j. biotech ...kumari rima*, kumar pankaj, sharma v.k....

Research Journal of Biotechnology Vol. 15 (4) April (2020) Res. J. Biotech

40

Molecular cloning, characterization and semi-quantitative expression of endochitinase gene from the

mycoparasitic isolate of Trichoderma harzianum Chaudhary Sorabh1*, Sagar Sushma1, Kumar Mukesh1, Lal Mehi2, Kumar Vinay3 and Tomar Akash4

1. Department of Agriculture Biotechnology, SVP University of Agriculture and Technology, Meerut-250110, INDIA

2. ICAR-Central Potato Research Institute Regional Station, Meerut-250 110, INDIA

3. ICAR-National Institute of Biotic Stress Management, Raipur- 493225 Chhattisgarh, INDIA

4. Department of Recombination Tech., SVP University of Agriculture and Technology, Meerut-250110, INDIA

*[email protected]

Abstract Filamentous fungi from the genus Trichoderma are

well known for their biocontrol potential and have been

used as antagonistic agents as well as plant growth

promoters. Chitinases released by Trichoderma spp.

have been capable of hydrolyzing chitin by splitting

their β-1, 4-glucosidic bonds. The aim of the present

study was to isolate and characterize an endochitinase

gene from native Trichoderma harzianum isolate which

is involved in mycoparasitism. In total, twelve

Trichoderma isolates were screened for chitinolytic

activity via dual plate method and greenhouse studies.

T. harzianum isolate (SVPRT-THLi03) was selected as

a target for isolation, cloning, characterization and

expression profiling of an endochitinase gene due to its

high chitinolytic activity recorded by the degradation

of chitin substrates. The genomic DNA of Trichoderma

isolates was amplified and cloned in pGEMT cloning

vector.

The recombinant clones were confirmed through

colony PCR and restriction analysis. The sequenced

1223 bp clone nucleotide sequence of putative

endochitinase gene, ChitTh showed 99% homology to

T. harzianum chit-HAR2 endochitinase (AB041752.1)

with 0.0 E-value. The complete nucleotide sequence of

ChitTh contained a single ORF of 379 amino acids with

40.7 kDa molecular weight and theoretical pI 8.3.

The precursor protein contained 22 amino acids long

signal peptide at N terminus. Phylogenetic analysis

showed that ChitTh protein was clustered into group V

with other Trichoderma spp. Semi-quantitative

endochitinase gene expression was analysed for

different isolates viz. T. harzianum (SVPRT-THLi03

and SVPRT-47) and T. nigricans (SVPPP-7). Among

the three isolates, higher expression was observed in

SVPRT-THLi03 and SVPRT-47 whereas SVPPP-7

showed lesser gene expression with respect to the other

isolates.

Keywords: Endochitinase, cloning, T. harzianum, glycosyl

hydrolases, expression.

Introduction Trichoderma spp. are the microorganisms most commonly

used as biological antagonistic against various plant

pathogens and are presently marketed world-wide as active

ingredients of bio-fungicides, bio-fertilizers, growth

enhancers and stimulants of natural resistance62. In India,

~250 Trichoderma-based products are available for field

applications40. The antagonistic mechanism of Trichoderma

spp. involves a complementary action of antibiosis, nutrient

competition and cell wall degrading enzymes like β-1, 3-

glucanases, proteases and chitinases59. Since chitin and β-

1,3-glucan are the two major components of many plant

pathogenic fungal cell walls, therefore, β-1,3-glucanases,

proteases and chitinases produced extracellularly by

Trichoderma spp. play an important role in biocontrol.

Biological1,10,16,18 control of some soil-borne fungal diseases

has been correlated with level of chitinase production.

Additionally, it was also described that the presence of

Trichoderma is stimulating the expression of plant

chitinases54. Endochitinases (EC 3.2.1.1.14) are hydrolases,

able to lyase chitin at β-1,4-bonds into N-acetylglucosamine

oligomers distributed in bacteria, fungi, insects, plants and

animals with diverse roles11,14,34,44. Chitinases are divided

into families 18, 19 and 20 based on amino acid sequence

similarities60 where the chitinases in family 18 are of

bacteria, fungal, viral, animal and plant origin (class III and

V), while family 19 contains chitinases of plant origin from

class I, II and IV50 and N-acetylglucosaminidases

(GlcNAcases) belong to 20 family43.

The family 18 chitinases are divided into the categories of

endochitinase, exochitinase and acetylhexosaminidase23

having vital importance in agriculture as biocontrol agents

and in recycling of chitin back into ecosystem12,42. Besides,

chitinases play important roles in plant defence

mechanisms5,36 and fungal growth21,24.

Previously, several endo- and exo-chitinases such as ech42,

ech46, chit36, ech30, ech33 have been isolated and

characterized from Trichoderma spp.22,41,52,53,57,59 These

chitinases were either isolated via the genomic DNA or the

cDNA approach through the use of PCR amplification with

specifically designed primers30,58,60.

In this study, we examine the variation in the chitinolytic

activity of various Trichoderma spp. The best chitinase

mailto:[email protected]


41

producer Trichoderma isolate was then used as a target for

endochitinase gene amplification, cloning and in silico

characterization to compare and contrast with other

Trichoderma spp. endochitinases.

The amino acid sequence of amplified products was

analysed for the presence of conserved motifs. Additionally,

for identification of the active domains, the protein was also

subjected to physicochemical, phylogenetic and structural

analysis. Furthermore, the expression profiling of the

endochitinase gene was examined in two representative

Trichoderma isolates viz., T. harzianum and T. nigricans in

order to check the expression level in these two different

isolates of Trichoderma spp.

Material and Methods Collection of Trichoderma spp. and their maintenance: A

total of thirty-one (31) Trichoderma isolates were obtained

from Department of Recombination Techniques, College of

Biotechnology, SVP University of Ag. and Tech., Meerut.

Out of the thirty one Trichoderma isolates, twelve isolates

(Table 1) were screened for chitinase activity studies based

on their antagonistic efficacy against plant pathogens

(Rhizoctonia solani, Fusarium spp. and Colletotrichum spp.)

via dual culture method, production of volatile and non-

volatile compounds as well as greenhouse studies9,49. These

isolates were maintained on PDA plates and slants at 4°C for

further use.

Preparation of colloidal chitin: Colloidal chitin was

prepared from commercial chitin (HiMedia) following the

method of Roberts and Selitrennikoff47 with slight

modification and supplemented in the chitinase assay as a

sole carbon source. For acid hydrolysis of chitin powder,

five grams of chitin powder were added into 60 ml of

concentrated HCl and left overnight at 4°C with vigorous

shaking. The mixture was added to 2 L of ice-cold ethanol

(95%) with rapid stirring and kept at 25°C for overnight. The

precipitant was collected by centrifugation at 5,000 rpm for

20 min at 4°C and washed with sterile distilled water until

the colloidal chitin became neutral (pH 7.0). Colloidal chitin

was collected and stored at 4°C until further use.

Preparation of chitin plates: Chitin plates were prepared

according to Kamil et al27. For 1 L media, 15.0 g Agar, 3.0

g colloidal chitin, 2.0 g (NH4)2SO4, 1.1 g Na2HPO4, 0.7 g

KH2PO4, 0.2 g MgSO4.7H20, 1.0 mg FeSO4 and 1.0 mg

MnSO4, were dissolved in 1 L of distilled water. Then the

media was autoclaved at 121°C for 15 minutes and cooled.

Twenty ml media was poured in each Petri-plate and

solidified.

Chitin plate assays: Trichoderma spores were harvested

from 7 days old culture plates in sterilized distilled water to

contain 1x108 spores/ml and 100 µl of spore suspension was

plated on chitin plates via spread plate method and incubated

at 28°C. After 4 days of incubation, the viable / germinating

spores per ml for each isolate were recorded.

Chitinolytic enzyme activity assay: Colloidal chitin

(derived from commercial chitin) supplemented broths were

inoculated with young actively growing mycelium plugs of

Trichoderma isolates and incubated at 28°C for 5 days at 150

rpm. After 5 days, post incubation cultural filtrates were

filtered through Whatmann(R) No. 1 filter paper and stored at

-20°C for further use. The culture filtrates were used as

enzyme solution for chitinase activity assay.

Total chitinolytic activity was analysed by measuring the

release of reducing saccharides from colloidal chitin through

spectrophotometric assay following the method of Agrawal

and Kotasthane1 with some modifications. Briefly, the

reaction mixture containing 1 ml of culture extract, 0.3 ml of

1 M sodium acetate buffer, pH 4.6 and 0.2 ml of colloidal

chitin was incubated at 37°C for 15 hrs and then centrifuged

at 12,000 rpm for 5 min at 4°C. Collect the supernatant. An

aliquot of 0.75 ml of the supernatant, 0.25 ml of 1% solution

of dinitro-salicylic acid in 0.7 M NaOH and 0.1 ml of 10 M

NaOH were mixed and heated to boil for 5 min. After

cooling at room temperature, absorbance of the reaction

mixture was measured at 582 nm39.

Calibration curve with N-acetyl-β-D-glucosamine (NAGA)

was used as a standard to determine reducing saccharide

concentration. Chitinolytic activity was calculated in terms

of the concentration (mg/ml) of NAGA released. The

average of three replicate readings for each isolate was

recorded.

Isolation of fungal genomic DNA: Fungal cultures were

grown in 50 ml of PDB at 28°C in a rotary shaker at 120 rpm

for 2 to 4 days. After incubation, mycelium was harvested

on Whatmann(R) No. 1 filter paper in a Buchner funnel and

washed with 0.9% NaCl followed by distilled water. The

mycelium was frozen in liquid nitrogen and lyophilized. The

extraction was based on the Cetyl Trimethyl Ammonium

Bromide (CTAB) extraction method described by Doyle and

Doyle13 with slight modification. All DNA samples were

treated with RNase A (10 mg/ml) to remove RNA

impurities. The quality and quantity of purified DNA were

analysed both spectrophotometrically and in 0.8% agarose

gel stained with ethidium bromide. The purified DNA was

stored at -20°C for further use.

Amplification and cloning of endochitinase gene: The

specific primer sets F: ACGCAAACGCC

GTCTACTTCACCAA and R: GCATCCCAGAACA

TGCTGCCTCCCA5 were used to amplify the endochitinase

gene from genomic DNA of Trichoderma isolates.

Amplification reaction was carried out in a total volume of

25 μl reaction mixture containing 100 ng/μl of genomic

DNA, 20 pmol of each primer, 2.0 mM of MgCl2, 0.25 mM

of each dNTP, 1 U Taq DNA polymerase (Genei) and 10X

PCR buffer. The thermal cycler conditions were: 95°C for 5

min followed by 35 cycles of 94°C for 1.3 min, 58°C for 1

min and 72°C for 2 min and a final extension at 72°C for 7

min. Aliquots (10 μl) of the amplified products were


42

analysed in 1.2% (w/v) agarose gel, stained with ethidium

bromide (1 μg/ml) and observed on a UV transilluminator

and photographed on gel documentation system.

After gel elution, the purified PCR product of ~1.2 kb (50

ng/μl) was ligated into pGEMT- Easy Vector System (3.0 kb

and 50 ng/μl). The ligated vector was transformed into E.

coli DH5α competent cells by heat-shock treatment at 42°C

for 2 min followed by immediate chilling for 5 min. Luria

broth (800 μl) was added and the mixture was incubated at

37°C at 200 rpm for 1 hr to allow bacteria to multiply and

express the antibiotic marker encoded by the plasmid. The

culture was centrifuged and the pellet was dissolved in 100

ul Luria broth and plated onto Luria Bertani agar plates

supplemented with ampicillin 100 μg, 5-Bromo-4-choloro-

3-indoyl-β-D-galactopyranoside (X-gal) 80 μg/ml and

isopropyl β-D-thiogalacto-pyranoside (IPTG) 0.5 mM.

The plates were incubated overnight at 37°C. The

recombinant clones were identified by blue/white

conformation assay. After incubation, white recombinant

colonies were picked and streaked on Luria Bertani agar

plates supplemented with Amp100, X-gal, IPTG and

incubated overnight at 37°C and checked for the presence of

construct through colony PCR and plasmid restriction

digestion with EcoR1.

Sequencing and in silico characterization of clones: The

recombinant clones were sequenced commercially using

M13 universal forward and reverse primers at Chromos

Biotech Pvt. Ltd., Bangalore, India by employing primer

walking technique. The vector sequence was removed

through VecScreen service at NCBI and the sequences were

analyzed in silico. Nucleotide sequences homology search

was conducted using BLAST search at

http://www.ncbi.nlm.nih.gov/BLAST3. To determine the

evolutionary relationship of putative endochitinase gene

with other reference sequences, a phylogenetic analysis was

performed using MEGA6.056. A total of 24 reference

endochitinases were retrieved and aligned using ClustalW.

Neighbour joining tree was constructed using bootstrap

value of 1000 replicates to investigate the distances among

these sequences.

The complete putative open reading frame (ORF) based on

nucleotide sequence was predicted using ExPASy server

(http://expasy.org/translate). Potential O-glycosylation sites

were determined using NetNGlyc 1.0 Server

(http://www.cbs.dtu.dk/services/NetNGlyc/). Molecular

weight, theoretical pI and amino acid composition were

analysed by ProtParam tool (http://us.expasy.org/

protparam/)15. Putative signal peptide sequence was

predicted by SignalP (Version 4.1) based on Neural Network

(NN) and Hidden Markov Models (HMM). InterProScan

modular architectural analysis programs

(http://www.ebi.ac.uk/interpro/search/sequence-search/)

were used to predict the domain architecture of the

proteins64.

Multiple sequence alignment and phylogenetic analysis:

Multiple alignment for homology search was performed

using Multialin (http://npsa-prabil.ibcp.fr/cgi-bin/npsa_

automat.pI?page=npsa_multalin.html). A phylo-genetic

analysis was performed using MEGA5.1

(http://www.megasoftware.net/)32 to investigate the

evolutionary relationship among the endochitinase proteins

available in the database and the isolated putative

endochitinase in this study. The search for complete protein

sequence was explored using the NCBI Blastp and a total of

43 reference endochitinases sequences from plant, fungi and

bacteria were downloaded and aligned using ClustalX. For

phylogenetic analysis, maximum parsimony tree was

constructed using bootstrap value of 1000 replicates to

examine the distance among these sequences.

Structure prediction of ChitTh: The structure prediction

of ChitTh was done by using automated modelling SWISS-

MODEL (http://swissmodel.expasy.org)7. Location and

number of helixes and sheets in a 2D representation

predicted by Psipred (http://bioinf.cs.ucl.ac.uk/psipred/)38

and a 3D model of the protein were built using I-TASSER

(http://zhanglab.ccmb.med.umich.edu/ITASSER/)48,63,65.

Gene expression analysis of endochitinase gene

Fungal total RNA extraction: Based on in vitro and in vivo

screening, two representatives of Trichoderma spp. viz. T. asperallum and T. harzianum were taken for the gene

expression analysis. Total RNA was extracted from the

frozen mycelium using Trizol (Invitrogen, USA) as

described by the manufacturer instructions. The RNA

samples were treated with DNase to make sure that no

genomic DNA was left in the samples. The integrity of RNA

was confirmed by running samples in 1.2% denaturating

agarose gel. First strand cDNA was synthesised from the

total RNA by reverse transcription reaction with oligo-(dT)

primers using Revert AidTM First Strand cDNA kit as

described by the manufacturer instructions.

Endochitinase gene expression analysis: Semi-

quantitative reverse transcription-polymerase chain reaction

(RT-PCR) was performed by using cDNA as template with

the primer set52 F: 5’ TCAGTGAATCATAGAATCTT 3’

and R: 5’ TAATGGATGCTAGACCTTTG 3’.

Amplifications were carried out in 25 µl reactions mixture

following the same PCR reaction conditions as in

conventional PCR for amplification of the endochitinase

gene. ITS 1 and ITS 461 were used to amplify the internal

transcribed sequence (ITS) region using cDNA as template

of the three Trichoderma isolates used as control for

comparing the expression. The endochitinase gene

expression levels of Trichoderma spp. were observed on

1.2% agarose gel stained with ethidium bromide with respect

to the control ITS amplification.

Results Screening of Trichoderma spp. based on chitinolytic

activity: Twelve (12) Trichoderma isolates of four

http://www.ncbi.nlm.nih.gov/BLAST

http://expasy.org/translate

http://www.cbs.dtu.dk/services/NetNGlyc/

http://us.expasy.org/%20protparam/

http://us.expasy.org/%20protparam/

http://www.ebi.ac.uk/interpro/search/sequence-search/

http://npsa-prabil.ibcp.fr/cgi-bin/npsa_%20automat.pI?page=npsa_multalin.html

http://npsa-prabil.ibcp.fr/cgi-bin/npsa_%20automat.pI?page=npsa_multalin.html

http://www.megasoftware.net/

http://swissmodel.expasy.org/

http://bioinf.cs.ucl.ac.uk/psipred/)38

http://zhanglab.ccmb.med.umich.edu/ITASSER/


43

representative species viz. Trichoderma harzianum, T. longibraciatum, T. nigricans and T. virens were shortlisted

for chitinolytic activity studies based on their antagonistic

efficacy. These isolates were cultured on chitin agar plates

to screen their chitinase activity. The results revealed that

among the twelve Trichoderma isolates, SVPRT-THLi03

and SVPRT-47 (Trichoderma harzianum) recorded

maximum viable/germinating spores ability (3x108 and

2x108 spores/ml respectively) (Table 1) that are correlated to

the better chitinase enzyme activity.

Trichoderma isolates showed detectable chitinolytic activity

expressed in terms of conc. of NAGA (mg/ml) released in

colloidal chitin supplemented media. Released NAGA conc.

ranged from 41.33 (isolate SVPRT-LB06) to 126.67 (isolate

SVPRT-THLi01) mg/ml (Fig.1).

Cloning of gene encoding endochitinase and

confirmation of clones: An amplicon of 1223 bp was

obtained from genomic DNA of all T. harzianum isolates

with the specific primer set after PCR amplification where

other Trichoderma spp. were unable to amplify the expected

size PCR product except in two T. longibrachiatum isolates

where ~2 kb product was amplified (Fig. 2a). The PCR

products from two T. harzianum were excised and eluted

from gel and the eluted fragments were confirmed by 1.2%

agaroae gel electrophoresis. The eluted fragments were

ligated into pGEMT-Easy Vector and transformed to E. coli

DH5α separately. The recombinant E. coli DH5α was

maintained on Luria agar having Amp100 as a selection

pressure.

Recombinant cells were selected based on blue/white colony

confirmation assay (Supplementary Fig. 1). The

confirmation of positive clones was done by restriction

digestion and colony PCR amplification. The positive clones

gave ~1.2 kb amplicon using endochitinase gene specific

primer with colony PCR as described earlier for

amplification of endochitinase gene (Fig. 2b). Restriction

digestion analysis was done with EcoR1 which produced the

1.2 kb fragment insert from the pGEMT vector of ~3 kb (Fig.

3 a, b).

Sequencing and phylogenetic analysis of the clones: The

M13 primer was used to amplify the gene insert from the

pGEMT Easy Cloning Vector and the nucleotide sequence

of putative endochitinase (ChitTh) gene was obtained. The

complete ChitTh gene was obtained after processing the

sequences through GENE TOOL and VecScreen service.

The nucleotide sequences of ChitTh gene were subjected to

BLAST analysis for homology search; it showed 99%

homology with Hypocrea lixii isolate DLY1202

endochitinase 42 gene (accession #HQ286987.1),

Trichoderma harzianum chit-HAR2 endochitinase

(accession #AB041752.1) with 0.0 E-value. Based on 24

endochitinase nucleotide sequences belonging to different

organisms, ChitTh showed polyphyletic distribution

(Supplementary Fig. 1).

The endochitinase genes of various organisms were grouped

into three major clusters. Cluster I contained mainly

Trichoderma spp. endochitinase genes and was divided into

two sub-cluster. The first sub-cluster in clade I contained

ChitTh gene with other Trichoderma spp. endochitinase

gene. The clade II and III also showed a polyphyletic

distribution for selected reference endochitinase genes

belonging to bacteria and plants. The redundancy of the

chitinase gene distribution across different organisms or

even between Trichoderma species reflects their functional

difference between related proteins.

In silico analysis of ChitTh sequence: The ChitTh gene

sequence of 1223 bp was processed with ORF Finder which

revealed a single ORF (Open reading frame) with 379 amino

acid residues followed by a stop codon (Fig.4 A, B). Fig. 1B

shows the location of peptidase cleavage site and conserved

domains within the amino acids. Further, the protein was

subjected to BLASTp algorithm for homology analysis and

the sequence confirmed 65-99% identity to Trichoderma

endochitinases. Based on homology to available sequences

in the database, ChitTh appears to be an endochitinase with

an N-terminal signal peptide of 22 amino acids followed by

glycosyl hydrolase family 18 domains.

The SignalIP indicated the presence of a putative signal

sequence SSA/SP in the protein (Supplementary Fig. 2).

After processing of the 22 N-terminal amino acids, the

predicted molecular mass of ChitTh is 40.7 kDa with a

theoretical pI of 8.30 and the protein was deemed stable with

a net negative charge.

Chitin catalytic domain organization: The ChitTh amino

acid sequence was blasted against eleven reference amino

acid sequence of endochitinase genes from Trichoderma

spp., one Aspergillus spp. and one plant species (Elaeis

guineensis) available at NCBI database. The Multialin

analysis was performed for multiple alignments with default

parameters (Fig 5). Multiple alignment results revealed

several regions of homology as indicated by derived

consensus sequence in red. Comparison of ChitTh sequences

predicted that ChitTh shared a high degree of similarity

among fungal endochitinases and the regions of SIGGW and

FDGIDVDWE (Conserved domain are SxGG and

DxxDxDxE) which were highly conserved among chitinases

of the glycosyl hydrolase family 18.

Minimum variation was observed within the SxGG and

DxxDxDxE conserved domains of the amino acid sequences

whereas the variation was observed in the chitin binding

domain (SxGG) of Elaeis guineensis chitin-like protein and

the absence of the signature DxxDxDxE domain in the

putative endochitinase ECH30 (ech30) of T. atroviride.

Serine [Ser (S) 146] and glycine [Gly (G): 148,149] in the

conserved region (orange box) are hydrophilic and

hydrophobic in nature that are responsible for reacting with

the surface of chitin molecules during a hydrolysis reaction.


44

The blue box was dominated by glutamic acid (E) and

aspartic acid (D) residues responsible for the acidic and

negatively charged nature of the ChitTh protein. In addition,

the InterProScan analysis of ChitTh revealed its close

relation to family 18 (GH18) of glycosyl hydrolases with N-

terminal signal peptide followed by non-cytoplasmic

domain (IPR017853) and chitinase insertion domain

(IPR029070) of glycoside hydrolase superfamily

(Supplementary Fig. 4).

The complete annotation of ChitTh protein showed presence

of 22 amino acids long signal peptide at N-terminal of

premature protein, a typical signature of proteins with

secretory nature and Serine [S] at position 23 was the first

amino acid of the mature protein. No O-glycosylation site

was observed in the protein which confirmed the secretory

nature of protein.

Phylogenetic analysis of ChitTh protein: Based on 43

reference endochitinase protein sequences belonging to

different organisms (plants, fungi and bacteria), ChitTh from

T. harzianum (SVPRT- THLi03) showed polyphyletic

distribution (Fig. 6). Class I contains endochitinases of plant

origin further divided into three sub-clades. These subclades

were then further separated into group Ia (acidic plant

chitinase) and group Ib (basic endochitinase). Class III

constituted chitinases belonging to the family 18 glycosyl-

hydrolases and are further divided in sub-clades where group

IIIa and IIIb contain fungal and plant origin endochitinases

respectively. Class IV and V constituted single clades.

Maximum Parsimony phylogenetic tree places ChitTh in

group V together with other Trichoderma spp.

endochitinases. Moreover, maximum likelihood and

UPGMA methods clustered ChitTh alone between group III

and V when analysis was conducted on the same set of

sequences (Supplementary Fig. 3 a, b).

Structural modelling of ChitTh: The secondary structure

of ChitTh protein consisted of 9 stands of parallel β-barrel

sheets within the 9 external α helices (Supplementary Fig.

4). A 3D modelling analysed through I-TASSER which was

based on top 10 PDB hits, revealed that the β-barrel sheets

are located within the barrel structure of the protein (Fig. 7).

The proposed model of T. harzianum ChitTh endochitinase

was predicted using 3g6m.1. A template of Clonostachys rosea chitinase CrChi1 revealed query coverage of 0.86 and

identity of 66.06%. The ligand binding pocket for T.

harzianum endochitinase contained 12 amino acids

including Leu19, Gly80, Trp81, Thr82, Asp119, Glu121,

Met187, Tyr189, Asp190, Tyr243, Arg245 and Trp334. The

QMEAN score of predicted model is -1.12 and normalized

Z-score 3.25 within the prescribed limits describing the

expected similarity to the native structure.

Semi-quantitative gene expression analysis: Based on the

antagonistic activity of Trichoderma spp. in vitro and in vivo

condition, two representatives of Trichoderma species viz. T.

harzianum and T. nigricans isolates were selected for the

gene expression analysis. Total RNA was extracted from

mycelium of all three Trichoderma isolates and cDNA was

used as a template in the RT-PCR. Expression analysis of

cDNA amplification of Trichoderma isolates showed higher

expression of endochitinase gene in T. harzianum (SVPRT-

THLi03 and SVPRT-47) and a marked lesser expression was

detected in T. nigricans (SVPPP-7) with respect to other two

isolates and internal transcribed spacer (ITS) sequence as

control (Fig. 8), as visualized under gel documentation

system.

Fig. 1: Chitinase activity of twelve Trichoderma isolates in colloidal chitin supplementary broth

0

5

10

15

20

25

Endochitinase activityUn

its/

ml

Trichoderma isolates


45

Fig. 2(a): PCR amplification of endochitinase from Trichoderma spp. visualized on 1.2% agarose gel stained with

ethidium bromide. Lanes M contain the 1 Kb molecular ladder; Lane 1- Hypocrea virens, 2 and 4- T. longibrachiatum,

3 and 5- T. nigrican, 6-12- T. harzianum

Fig. 2 (b): Colony PCR analysis of the white/ blue (control) colonies to confirm the presence of the insert.

Lane 1-10 - White colonies; 11-14- Blue colonies; 15- Negative control (no colony); M- 1 kb marker

M 1 2 3 4 M

0.5

1.03.0

5.0

10

kb

0.5

1.0

3.0

5.0

10

kb

1 2 3 4 5 6 7 8 9 10 11 12 M kb

0.1

0.5

1.5

3.0

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 kb

1.0

3.0

10.0

M 1 2

0.5

10

5.0

kb

3.0

Fig. 3 (a): Recombinant Cloned Plasmid

isolated from two isolates of Trichoderma

harzianum. Lanes M: 1 Kb ladder,

Lane 1: SVPRT-THLi03, Lane 2: SVPRT-47

Figure 3 (b): Restriction analysis of the

cloned endochitinase gene Lanes M: 1 Kb

molecular ladder, Lane 1: Amplified

endochitinase gene, Lane 2: Cloned plasmid,

Lane 3 and 4: Restriction digestion of cloned

endochitinase gene from SVPRT-THLi03 and

SVPRT-47 digested with EcoR1


46

(A)

(B)

Fig. 4: The putative endochitinase (ChitTh) gene. (A) The Nucleotide and Protein Sequences of ChitTh. (B) The

Amino Acid Sequence of ChitTh. The peptide cleavage site indicated in green bold underlined (SSA/SP) and

sequences that are highlighted are the conserved domains in different endochitinase genes.


47

Fig. 5: Output of Multiple sequence alignments of endochitinases processed with Multialin. The boxed regions

represent the location of two conserved domains in the putative gene. Legend: ChitTH, AEF28834.1| Hypocrea lixii

isolate SG3303 endochitinase 42, AEF28830.1| Hypocrea lixii isolate DLY1202 endochitinase 42, AEF28839.1|

Hypocrea lixii isolate ZQ2302 endochitinase 42, AEF28842.1| Hypocrea lixii isolate NC3206 endochitinase 42

and77069.1| Hypocrea lixii chitinase (chit42), AEF28840.1| Hypocrea lixii isolate HA1102 endochitinase 42,

XP_024767653.1| Trichoderma harzianum CBS 226.95 glycoside hydrolase family 18 protein, ACJ38679.1| Hypocrea

lixii chitinase (chit42), PYH70597.1| Aspergillus vadensis cbs 113365 genomic scaffold, AFV30206.1| Elaeis guineesis

chitinase-like protein (Chit5-1), AAP81811.1| Trichoderma atroviride putative endochitinase ECH30 (ech30). The blue

boxes represent the conserved domain for all sequences.


48

Fig. 6: Evolutionary relationship of ChitTh inferred based on amino acid sequence with other endochitinases with

Maximum Parsimony method. Analysis was conducted in MEGA5.1 and the percentage of replicate trees in which

the associated taxa clustered together in the bootstrap test (1000 replicates) are shown to the branches. The most

parsimonious tree with length = 670 is shown. The evolutionary distances were computed using the Substree-Pruning-

Regrafting (SPR) algorithm and are in the units of the number of amino acid substitutions per site.

The analysis involved 41 amino acids sequences retrieved from database. All positions containing gaps

and missing data were eliminated.

ChitTh

gi|38091825|emb|CAE53388.1| endochitinase Trichoderma lixii

gi|88191687|gb|ABD42924.1| endochitinase Trichoderma harzianum

gi|19073005|gb|AAL84699.1|AF395760 1 endochitinase class V precursor Trichoderma virens



gi|1435849967|gb|RDH17911.1| class V chitinase Aspergillus niger ATCC 13496

gi|1440845097|gb|RDK46183.1| class V chitinase Aspergillus phoenicis ATCC 13157

gi|477532312|gb|ENH83952.1| class III chitinase Colletotrichum orbiculare MAFF 240422

gi|32441473|gb|AAP81811.1| putative endochitinase ECH30 Trichoderma atroviride

gi|21264396|sp|P46876.2|CHI1 CANAX RecName: Full Chitinase 1 Flags: Precursor

gi|1399667060|gb|PYH78528.1| class III chitinase Aspergillus uvarum CBS 121591

gi|1168933|sp|P40954.2|CHI3 CANAL RecName: Full Chitinase 3 Flags: Precursor

gi|171334|gb|AAA34539.1| endochitinase Saccharomyces cerevisiae

gi|1198333454|ref|NP 001236631.2| class III acidic endochitinase precursor Glycine max

gi|23499326|gb|AAN37392.1|AF435029 1 class III chitinase Capsicum annuum

gi|670422815|ref|XP 008652267.1| acidic endochitinase Zea mays

gi|28848952|gb|AAO47731.1| acidic class III chitinase Rehmannia glutinosa

gi|118200080|emb|CAJ43737.1| class III chitinase Coffea arabica

gi|308212836|gb|ADO21646.1| class III chitinase partial Tamarindus indica

gi|432580|gb|AAB28479.1| acidic class III chitinase SE2 Beta vulgaris

gi|45934508|gb|AAS79333.1| endochitinase class III PR3 partial Malus domestica

gi|33413585|gb|AAM77132.1| endochitinase Trichoderma atroviride

gi|1399657756|gb|PYH69358.1| class III chitinase Aspergillus vadensis CBS 113365

gi|485925806|gb|EOD50296.1| class iii chitinase protein Neofusicoccum parvum UCRNP2

gi|953380201|ref|XP 014534369.1| Class III chitinase putative Penicillium digitatum Pd1

gi|526117633|ref|NP 001268075.1| class IV chitinase precursor Vitis vinifera

gi|2306811|gb|AAB65776.1| class IV endochitinase Vitis vinifera

gi|442564141|gb|AET86623.2| class IV endochitinase Dactylis glomerata

gi|315258225|gb|ADT91691.1| endochitinase Nicotiana attenuata

gi|19847|emb|CAA45822.1| chitinase B class I partial Nicotiana tabacum

gi|625295692|gb|AHY24796.1| endochitinase Triticum aestivum

gi|108708844|gb|ABF96639.1| Basic endochitinase Oryza sativa Japonica Group

gi|1144307|gb|AAB08443.1| chitinase class II Solanum lycopersicum

gi|307159110|gb|ADN39439.1| class I chitinase isoform 2 partial Castanea sativa

gi|728844414|gb|KHG23857.1| Endochitinase 1 Gossypium arboreum

gi|6573210|gb|AAF17593.1|AF202731 1 chitinase class I Glycine max

gi|545912031|gb|AGW81842.1| class I chitinase Theobroma cacao

gi|298106229|gb|ADI56257.1| class I chitinase Gossypium hirsutum

gi|4205741|gb|AAD11255.1| class I chitinase partial Gossypium hirsutum86

99

83

100

75

52

99

98

44

87

100

63

62

46

85

31

88

50

98

71

96

27

20

20

37

42

56

68

33

35

41

40

49

77

99

34

36

V

IIIb

IIIa

IV

Ia

Ib


49

Fig. 7: The 3D Model of T. harzianum (SVPRT-THLi03) protein. 3D structure of ChitTh showing 9 β-sheets laid in

the middle surrounded by the helixes (as indicated by arrow). The 3D modelling of ChitTh used the following PDB

structures in prediction: 3g6mA, 3cheB, 1II6D, 1kfwA, 1itxA. The top 10 alignments (in order of their ranking) are

from the threading programs: 1: MUSTER, 2: FFAS-3D, 3: SPARKS-X, 4: HHSEARCH2, 5: HHSEARCH I, 6: Neff-

PPAS, 7: HHSEARCH, 8: pGenTHREADER, 9: wdPPAS and 10: PROSPECT2. The model presented was selected

based on the highest C-score of 1.23 (range -5 to 2). The C-score predicts the confidence score for estimating the

quality of models by I-TASSER. It is calculated based on the significance of threading template alignments and the

convergence parameters of the structure assembly simulation. In addition, the Z-score was also taken into

consideration where a normalized Z-score >1 means a good alignment.

Fig. 8: Semi-quantitative gene expression of endochitinase of Trichoderma isolates. Lane 1: Trichoderma harzianum

(SVPRT-THLi03); 2: T. harzianum (SVPRT-47); and 3: T. nigricans (SVPPP-7) in comparison to internal transcribed

spacer (ITS) sequence.

Table 1

Details of Trichoderma spp. used in this study and their germinating spore/ml ability on chitin plate

Isolate Isolate Code Source and Place of collection GenBank

Accession No.

Germinating

spore/ml

T. harzianum SVPPP-12 Soil & Rice field, Meerut KU215922 3x108

Hypocrea lixii SVPRT-47 Soil & Rice field, Meerut JX232597 2x109

Hypocrea lixii SVPRT-36 Soil & Rice field, Meerut KX139407 3x107

Hypocrea lixii SVPRT-THLi04 Soil & Sugarcane field, Muzaffarnagar JX232596 2x108

Hypocrea lixii SVPRT-THLi03 Soil & Sugarcane field, Muzaffarnagar JX232595 4x108

Hypocrea lixii SVPRT-THLi02 Soil & Sugarcane field, Meerut JX232594 3x106

Hypocrea lixii SVPRT-THLi01 Soil & Sugarcane field, Meerut JX232593 1x108

Hypocrea virens SVPRT-TVir01 Soil & Rice field, Meerut JX908730 2x105

T. longibrachiatum SVPRT-LB02 Soil & Rice field, Meerut JX908722 3x105

T. longibrachiatum SVPRT-LB06 Soil & Rice field, Meerut JX908726 2x105

T. nigricans SVPPP-7 Soil & Rice field, Meerut KU215926 1x105

T. nigricans SVPPP-19 Soil & Rice field, Meerut KU215927 2x104

1 2 3a

ENDOCHITINASE

ITS CONTROL

β- sheets laid

within the helixes


50

Supplementary Fig. 1: Phylogenetic relationship of endochitinase (ChitTh) gene of T. harzianum isolate

(SVPRT- THLi03) based on nucleotide sequence with other endochitinases using Neighbour Joining method.

Measure Position Value Cutoff Signal peptide?

max. C 23 0.250

max. Y 23 0.463

max. S 10 0.942

mean S 1-22 0.856

D 1-22 0.675 0.450 YES

Name=Sequence1 SP=’YES’ Cleavage site between pos. 22 and

23: SSA-SP D=0.675 D-cutoff=0.450 Networks=SignalIP-noTM

Supplementary Fig. 2: SignalIP results of putative chit42 protein


51

Discussion Trichoderma spp. are commercially applied as antagonistic

agents against fungal plant pathogens. The chitinolytic

enzymes secreted by Trichoderma spp. play a vital role in

controlling the plant diseases. Due to importance of

chitinases in agricultural, environmental and industrial

sectors, a number of genes encoding hydrolytic enzymes

have been cloned, characterized and explored to developing

resistance in transgenic plants against fungal

pathogens34,37,45,51. Since the biocontrol potential, chitinase

activity and chitinase encoding genes2,30 of different

Trichoderma spp. and isolates of same species showed vast

variation, it is important to isolate and characterize

Trichodrma spp. from different geographical areas.

Keeping in view the relevance of chitinase enzymes, a total

of twelve Trichoderma isolates of four representative

species viz., T. hazianum, T. longibrachiatum, T. virens and

T. nigricans were screened for their chitinolytic activity.

Differences were observed among different isolates with

respect to chitinolytic activity in colloidal chitin

supplemented broth medium. A correlation was established

on the chitin utilization ability and chitinase activity i.e. high

CFU (high colonization) was indicative of high enzyme

activity. Among the twelve isolates, Trichoderma

harzianum isolate SVPRT-THLi03 and SVPRT-47 showed

high CFU ability and better chitinase activity (17.21μg/ml

and 13.11μg/ml respectively).

Supplementary Fig. 3 (a): A Phylogenetics analysis ChitTh inferred based on amino acid sequence

with other endochitinases with Maximum Likelihood method. Analysis was conducted in MEGA5.1

and the percentage of replicate trees in which the associated taxa clustered together in the bootstrap test

(1000 replicates) are shown to the branches.



CAA45821.1 chitinase C class I Nicotiana tabacum



gi|108708844|gb|ABF96639.1| Basic endochitinase 2 precursor putative expressed Oryza sativa Japonica Group



gi|4205741|gb|AAD11255.1| class I chitinase partial Gossypium hirsutum









EMR90463.1 putative class iii protein Botrytis cinerea BcDW1

gi|485925806|gb|EOD50296.1| putative class iii chitinase protein Neofusicoccum parvum UCRNP2






ChitTh



















100

99

99

98

97

91

85

76

75

72

64

58

57

53

94

63

89

88

77

74

53

79

55

100

65

55

I

II

III

IV

V


52

Supplementary Fig. 3 (b): Phylogenetics analysis ChitTh inferred based on amino acid sequence with other

endochitinases with UPGMA method. Analysis was conducted in MEGA5.1 and the percentage of replicate trees in

which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown to the branches.

Similar differences for chitinolytic activity among the Trichoderma isolates have been reported by other

workers1,31,41,52. Medium nutrient content is one of the

determinants of the levels of chitonylic enzymes production

and the presence of cell wall material has a significant

influence on the production of chitinase by many

Trichoderma isolates4,55.

Further, the amplicon of 1.2 kb has been amplified form

genomic DNA of different Trichodrma isolates by using a

pair of specific primers designed for Trichoderma spp.

endochitinase gene5. The amplicon of best chitinase

producing Trichoderma isolates was separately cloned into

pGEMT Easy Vector and sequenced commercially. The

resulting 1232 bp nucleotide sequence of ChitTh gene was

verified as an endochitinase gene through homologous

analysis via BLAST analysis which showed 99% homology

with Hypocrea lixii isolate DLY1202 endochitinase 42 gene

(accession #HQ286987.1). Phylogenetic analysis showed

that putative ChitTh endochitinase gene was clustered in

clade I with other Trichoderma spp. endochitinase gene.

A single ORF (open reading frame) with 379 amino acids

sequence was blasted against all protein sequences in the

NCBI database and returned 65-99% identity to

Trichoderma endochitinases. Comparison of the ChitTh

amino acid sequence showed conserved domain of the GH18

(glycosyl hydrolase, family 18) type II chitinases

hydrolyzing chitin. The glycosyl hydrolases GH18 includes

endochitinases that cleave the chitin into oligomers53.



















gi|485925806|gb|EOD50296.1| putative class iii chitinase protein Neofusicoccum parvum UCRNP2








ChitTh







gi|4205741|gb|AAD11255.1| class I chitinase partial Gossypium hirsutum






CAA45821.1 chitinase C class I Nicotiana tabacum



gi|108708844|gb|ABF96639.1| Basic endochitinase 2 precursor putative expressed Oryza sativa Japonica Group

100

100

100

100

100

100

97

94

100

94

100

94

92

88

100

83

75

100

71

97

100

51

68

51

49

46

41

40

31

100

100

100

89

88

26

47

0.00.20.40.60.81.01.2

I

II

III

V


53

In phylogenetic analysis, the ChitTh endochitinase of T. harzianum isolate SVPRT-THLi03 was clustered in group V

along with other Trichoderma spp. endochitinases.

According to Henrissat and Bairoch23, endochitinase have

been divided into two families, 18 and 19 glycosyl

hydrolases. Family 18 chitinases contains plants, bacteria,

fungi (Classes III and V), mammals and viruses as

members46.

Supplementary Fig. 4: Secondary structure analysis of ChitTh protein by Psipred. Location and number of helixes

and sheets are shown.


54

Chitinases from two different families do not share amino

acid sequence similarities and have completely different 3-

dimension structures and molecular mechanisms41. The

predicted size of the endochititnase is 40.7 kDa with N-

terminal signal peptide based on amino acid sequence. A

signal peptide of 31 amino acids for ech42 of T. virens2, 19

amino acids for ech30 and chiII of T. atroviridae and

Glaciozyma antartica30,44, 22 amino acids for ech42 of T. harzianum53 and 22 amino acids long in the present study for

T. harzianum ChitTh endochitinase revealed vast variation

in their size. The signal peptides between 16 and 30 amino

acids residues are usually nascent N-terminal extensions

composed of a hydrophilic, positively charged N-region,

followed by hydrophobic central H-region of 5-15 residues

and cleavage site for signal peptidase at C-region53.

The variation in size of signal peptide of endochitinases has

been reported for various species of Trichoderma6,26. The

signal peptides mediate targeting of protein within secretory

and membrane polypeptide chains28. The presence of N-

terminal signal peptides in chitinase suggested their

extracellular secretion.

The secondary and tertiary structure model of ChitTh

showed that β sheets are buried within the barrel structure of

the protein. This is as previously reported by other

researchers17,41. The active glutamic acid (Glu195) residue

and the negatively charged amino acids Asp188, Asp191 and

Asp193 (DxxDxDx) of class V, family 18 chitinases were

found within the catalytic domain in the barrel of the ChitTh.

The glutamic acid residues have been implicated in catalytic

activity by other researchers25,29. In addition to the highly

conserved amino acid Glu195, Asp188, Asp191, Asp193,

which have important roles in the enzyme function41, the I-

TASSER program also predicted active residues in Tyr189

and Try243. Both these residues are highly conserved in all

proteins analyzed for Trichoderma harzianum endochitinase

(ech42). This is expected as our BLAST analysis of ChitTh

returned highest homology to ech42 gene.

A semi-quantitative expression profiling of endochitinase

gene of three Trichoderma isolates viz. SVPRT-THLi03 and

SVPRT-47 (T. harzianum) and SVPPP-7 (T. nigricans) was

analysed which showed variable expression levels of the

gene. Expression level was found to be high in T. harzianum

isolates in comparison to T. nigricans. Similar

overexpression of novel chitinase gene from T. harzianum

was also observed by other researchers8,52.

Conclusion In conclusion, the overall in silico characterization of ChitTh

revealed that it belongs to the family 18 hydrolases and

contains conserved repeats of amino acids (Glu, Asp and

Tyr) known to be conserved in family 18 endochitinases.

Comparative study of ChitTh revealed high similarity with

strongly conserved 42 kDa endochitinase of Trichoderma

spp.35 Evolutionary classification indicated that ChitTh is

likely a Class V fungal endochitinase.

However, ChitTh endochitinase gene of T. harzianum

SVPRT-THLi03 differs in its domain structure, protein

molecular weight and signal peptide length from other

endochitinases of Trichoderma spp., bacteria and plants

indicating variation in amino acid sequence.

References 1. Agrawal T. and Kotasthane A.S., Chitinolytic assay of

indigenous Trichoderma isolates collected from different

geographical location of Chhattisgarh in Central India, Springer

Plus, 1, 73 (2012)

2. Alias N., Mahadi N.M., Myrad A.M.A., Bakar F.D.A.,

Mahmood N.A.N. and Illias R.M., Expression and characterization

of Trichoderma virens UKM-1 endochitinase in Escherichia coli,

World J. Microbiol. Biotechnol., 25(4), 561-572 (2009)

3. Altschul S.F., Madden T.L., Schaffer A.A., Zhang J., Zhang Z.,

Miller W. and Lipman D.J., Gapped BLAST and PSI-BLAST: a

new generation of protein database search programs, Nucleic Acids

Res., 25, 3389-3402 (1997)

4. Andre S. and Monika S., Biology and biotechnology of

Trichoderma, Appl. Microbiol. Biotechnol., 87, 787-799 (2010)

5. Baek J.M., Howell C.R. and Kenerley C.M., The role of an

extracellular chitinase from Trichoderma virens GV29-8 in the

biocontrol of Rhizoctonia solani, Curr. Genet., 35, 41-50 (1999)

6. Baratto C.M., Dutra V., Boldo J.T., Leiria L.B., Vainstein M.H.

and Schrank A., Isolation, characterization and Transcriptional

Analysis of the Chitinase chi2 Gene (DQ011663) from the

Biocontrol Fungus Metarhizium anisopliae var. anisopliae, Curr.

Microbiol., 53, 217-221 (2006)

7. Biasini M., Bienert S., Waterhouse A., Anold K., Studer G.,

Schmidt T., Kiefer F., Gallo Cassarino T., Bertoni M., Bordoli L.

and Schwede T., SWISS-MODEL: modelling protein tertiary and

quaternary structure using evolutionary information, Nucleic Acid

Res., 42(W1), W252-W258 (2014)

8. Bolar J.P., Noreli J.L., Wong K.W., Hayes C.K., Harman G.E.

and Aldwinckle H.S., Expression of endochitinase from

Trichoderma harzianum in transgenic apple increases resistance to

apple scab and reduces vigour, Phytopathol., 90, 72-77 (2000)

9. Chaudhary S., Isolation and molecular characterization of

Rhizoctonia solani races causing sheath blight disease in Rice and

functional analysis of its biocontrol by Trichoderma spp., Ph.D.

Thesis, Sardar Vallabhbhai Patel University of Ag. and Tech.,

Meerut (2017)

10. Chet I. and Baker R., Isolation and biocontrol potential of

Trichoderma hamatum from soil naturally suppressive of

Rhizoctonia solan, Phytopathol., 71, 286-290 (1981)

11. Collinge D.B., Kragh K.M., Mikkelsen J.D., Nielsen K.K.,

Rasmussen U. and Vad K., Plant chitinases, Plant J., 3, 31-40

(1993)

12. Dahiya N., Tewari R. and Hoondal G.S., Biotechnological

aspects of chitinolytic enzymes: a review, Appl. Microbiol.

Biotechnol., 71, 773-782 (2006)


55

13. Dolye J.J. and Doyle J.L., A rapid DNA isolation procedure for

small quantities of fresh leaf tissue, Phytochem. Bull., 19, 11-15

(1987)

14. Flach J., Pilet P.E. and Jolles P., What’s new in chitinase

research?, Experimenta, 48, 701-716 (1992)

15. Gasteiger E., Hoogland C., Gattiker A., Duvaud S., Wilkins

M.R., Appel R.D. and Bairoch A., Protein Identification and

Analysis Tools on the ExPASy Server, In The Proteomics

Protocols Handbook, Eds., Walker J.M., Humana Press, 571-607

(2005)

16. Geremia R.A., Goldman G.H., Jcobs D., Ardiles W., Vila S.B.,

Van Montagu M. and Herrera-Estrella A., Prb1, a gene specifically

expressed during simulated mycoparasitism by Trichoderma

harzianum, Mol. Microbiol., 8, 603-613 (1993)

17. Goody G.W., Aggressive and defensive roles for chitinases,

EXS., 87, 157-169 (1999)

18. Hadar Y., Chet I. and Henis Y., Biological control of

Rhizoctonia solani Damping-off with Wheat Bran Culture of

Trichoderma harzianum, Phytopathol., 69, 64-68 (1979)

19. Hamid R., Khan M.A., Ahmad M., Ahmad M.M., Abdin M.Z.,

Musarrat J. and Javed S., Chitinases: An update, J. Pharm. Bioall.

Sci., 5, 21-29 (2013)

20. Haran S., Schickler H., Oppenheim A. and Chet I., New

components of the chitinolytic system of Trichoderma harzianum,

Mycol. Res., 99, 441-446 (1995)

21. Harman G.E., Overview of mechanisms and uses of

Trichoderma spp., Phytopathol., 96, 190-194 (2006)

22. Harman G.E., Hayes C.K., Lorito M., Broadway R.M.,

DiPietro A., Peterbauer C. and Tronsmo A., Chitinolytic enzymes

of Trichoderma harzianum: purification of chitobiosidase and

endochitinase, Phytopathol., 83, 313-318 (1993)

23. Henrissat B. and Bairoch A., Updating the sequence-based

classification of glycosyl hydrolases, Biochem. J., 316, 695-696

(1996)

24. Hermosa M.R., Grondona I., Iturriaga E.A., Diaz-Minguez

J.M., Castro C., Monte E. and Garcia-Acha I., Molecular

characterization and identification of biocontrol isolates of

Trichoderma spp., Appl. Environ. Microbiol., 66, 1890-1898

(2006)

25. Hollis T., Monzingo A.F., Bortone K., Ernst S., Cox R. and

Robertus J.D., The X-ray structure of a chitinase from the

pathogenic fungus Coccidiodes immitis, Prot. Sci., 9, 544-551

(2000)

26. Ihrmark K., Asmali N., Ubhayasekera W., Melin P., Stenlid J.

and Karlsson M., Comparative Molecular Evolution of

Trichoderma Chitinases in Response to Mycoparasitic Interaction,

Evol. Bioinform., 6, 1-26 (2010)

27. Kamil Z., Rizk M., Saleh M. and Moustafa S., Isolation and

identification of Rhizosphere soil chitinolytic bacteria and their

potential in antifungal biocontrol, Global J. Mol. Sci., 2, 57-66

(2007)

28. Kapp K., Schrempf S. and Lemberg M.K., Post-targeting

functions of signal peptides, In Madame Curie Bioscience

Database, Austin (TX), Landes Biscience (2013)

29. Kim D.J., Jong M.B., Pedro U., Charles M., Kenerl Y., Douglas

R. and Crook, Cloning and characterization of multiple glycosyl

hydrolase gene from Trichoderma virens, Curr. Genet., 40, 374-

384 (2002)

30. Klemsdal S.S., Clarke J.L., Hoell, I.A., Eijsink V.G. and

Brurberg M.B., Molecular cloning, characterization and expression

studies of a novel chitinase gene (ech30) from the mycoparasite

Trichoderma atroviride strain P1, FEMS Microbiol. Lett., 256,

282-289 (2006)

31. Kovacs K., Szaleacs G., Pusztahelyi T. and Pandey A.,

Production of chitinolytic enzymes with Trichoderma

longibrachiatum IMI 92027 in solid substrate fermentation, Appl.

Biochem. Biotechnol., 118, 189-204 (2004)

32. Kumar S., Koichiro T. and Masatoshi N., MEGA3: Integrated

software for evolutionary genetics analysis and sequence

alignment, Brief Bioinform., 5, 150-163 (2004)

33. Liu M., Sun J., Zhu J., Xu T., Harman G.E. and Lorito M.,

Enhancing rice resistance to fungal pathogens by transformation

with cell wall degrading enzyme genes from Trichoderma

atroviride, J. Zhejiang Uni. Sci., 5, 133-136 (2004)

34. Liu Z.H., Yang Q., Hu S., Zhang J.D. and Ma J., Cloning and

characterization of a novel chitinase gene (chi46) from

Chaetomium globosum and identification of its biocontrol activity,

Appl. Microbiol. Biotechnol., 80, 241-252 (2008)

35. Loc N.H., Quang H.T., Hung N.B., Huy N.D., Phuong T.T.B.

and Ha T.T.T., Trichoderma asperellum Chi42 genes encode

chitinase, Mycobiol., 39, 182-186 (2011)

36. Lorito M., Hayes C.K., Di Pietro A., Woo S.L. and Harman

G.E., Purification, characterization and synergistic activity of a

glucan 1,3,-β-glucosidase and an N-acetyl-β-glucosaminidase

from Trichoderma harzianum, Phytopathol., 84, 398-405 (1994)

37. Lorito M., Woo S.L., Garcia I., Fernandez I.G., Colucci G.,

Harman G.E., PintorToro J.A., Fillippone E., Muccifora S.,

Lawrence C.B., Zoina A., Tuzun S. and Scala F., Genes from

mycoparasitic fungi as a source for improving plant resistance to

fungal pathogens, Proc. Natl. Acad. Sci., 95, 7860-7865 (1998)

38. McGuffin L.J., Bryson K. and Jones D.T., The PSIPRED

protein structure prediction server, Bioinform., 16, 404-405 (2000)

39. Miller G.L., Use of dinitrosalicylic acid reagent for

determination of reducing sugar, Anal. Chem., 31, 426-429 (1959)

40. Mukherjee M., Mukherjee P.K., Horwitz B.A., Zachow C.,

Berg G. and Zeilinger S., Trichoderm-Plant-Pathogen Interaction:

Advances in Genetics of Biological Control, Indian J. Microbiol.,

52, 522-529 (2012)

41. Nadarajah K., Ali H.Z. and Omar N.S., The isolation and

characterization of an endochitinase gene from a Malaysian isolate

of Trichoderma sp., Aust. J. Crop. Sci., 8, 711-721 (2014)


56

42. Park J.K., Morita K., Fukumoto I., Yamasaki Y., Nakagawa T.,

Kawamukai M. and Matsuda H., Purification and characterization

of the Chitinase (chiA) from Enterobacter sp. G-1, Biosci.

Biotechnol. Biochem., 61, 684-689 (1997)

43. Perrakis A., Wilson K.S., Chet I., Oppenheim A.B. and Vorgias

C.E., Phylogenetic relationships of chitinases, In Chitin

Enzymology, Eds., Muzzarelli R.A.A., Atec, Italy, 217-232 (1993)

44. Ramli A.N., Mahadi N.M., Rabu A., Murad A.M., Bakar F.D.

and Illias M.R., Molecular cloning, expression and biochemical

characterization of a cold-adapted novel recombinant chitinase

from Glaciozyma antarctica PI12, Microb. Cell Fact., 10, 94

(2011)

45. Rana I.A., Loerz H., Schaefer W. and Becker D.,

Overexpression of chitinase and chitosanase genes from

Trichoderma harzianum under constitutive and inducible

promoters in order to increase disease resistance in wheat (Triticum

aestivum L.), Mol. Plant Breed, 3, 3659-3670 (2012)

46. Rifat H., Minhaj A.K., Mahboob A., Malik M.A., Malik Z.A.,

Javed M. and Saleem J., Chitinases: An update, J. Pharm. Bioall.

Sci., 5, 21-29 (2013)

47. Roberts W.K. and Selitrennikoff C.P., Plant and bacterial

chitinases differ in antifungal activity, J. Gen. Microbiol., 134,

169-176 (1988)

48. Roy A., Alper K. and Zhang Y., I-TASSER: A unified platform

for automated protein structure and function prediction, Nat.

Protoc., 5, 725-738 (2010)

49. Sagar S., Isolation and Molecular Characterization of

Colletotrichum falcatum races infecting Sugarcane varieties and its

in-vitro Management with Trichoderma spp., Ph.D. Thesis, Sardar

Vallabhbhai Patel University of Ag. and Tech., Meerut (2016)

50. Saito A., Fujii T., Yoneyama T., Redenbach M., Ohno T.,

Watanable T. and Miyashita K., High multiplicity of chitinase

genes in Streptomyces coelicolor A3(2), Biosci. Biotechnol.

Biochem., 63, 710-718 (1999)

51. Shah M.R., Mukherjee P.K. and Eapen S., Expression of a

fungal endocitinase gene in transgenic tomato and tobacco results

in enhanced tolerance to fungal pathogens, Physiol. Mol. Biol.

Plants, 16, 39-51 (2010)

52. Sharma P., Ramesh S.K., Kumar V., Singh D., Sharma M.,

Henry M.S. and Deep S., Cloning and semi-quantitative expression

of endochitinase (ech42) gene from Trichoderma spp., Afr. J.

Biotechnol., 11, 12930-12938 (2012)

53. Sharma V., Salwan R., Sharma P.N. and Kanwar S.S.,

Molecular cloning and characterization of ech46 endochitinase

from Trichoderma harzianum, Int. J. Biol. Macromol., 92, 615-624

(2016)

54. Shoresh M., Harman G.E. and Mastouri F., Induced systemic

resistance and plant responses to fungal biocontrol agents, Annu.

Rev. Phytopathol., 48, 21-43 (2010)

55. Sivan A. and Chet I., Degradation of fungal cell wall by lytic

enzymes of Trichoderma harzianum, J. Gen. Microbiol., 135, 675-

682 (1989)

56. Tamura K., Stecher G., Peterson D., Filipski A. and Kumar S.,

MEGA6.0: Molecular Evolutionary Genetics Analysis Version

6.0, Mol. Biol. Evol., 30, 2725-2729 (2013)

57. Ulhoa C.J. and Peberdy J.F., Purification and characterization

of an extracellular chitobiase from Trichoderma harzianum, Curr.

Microbiol., 23, 285-289 (1991)

58. Verena S., Bright H., Bernhard S. and Christain P.K., A

complete survey of Trichoderma chitinase reveals three distinct

subgroups of Family 18 chitinase, FEBS J., 272, 5923-5939 (2005)

59. Viterbo A., Haran S., Friesem D., Ramot O. and Chet I.,

Antifungal activity of a noval endochitinase gene (chit36) from

Trichoderma harzianum Rifai TM, FEMS Microbiol. Lett., 200,

169-174 (2001)

60. Viterbo A., Manuel A.M., Ramot O., Dana F., Enrique M.,

Antonio L. and Chet I., Expression regulation of the endochitinase

Chit36 from Trichoderma asperellum (T. harzianum T-203), Curr.

Genet., 42, 114-122 (2002)

61. White T.J., Bruns T., Lee S. and Taylor J., Amplification and

direct sequencing of fungal ribosomal RNA genes for

phylogenetics, In PCR Protocols: a guide to methods and

applications, Eds., Innis M.A., Gelfand D.H., Sninsky J.J. and

White T.J., Academic Press, San Diego, CA, 315-322 (1990)

62. Woo S.L., Ruocco M., Vinale F., Nigro M., Marra R.,

Lombardi N., Pascale A., Lanzuise S., Manganiello G. and Lorito

M., Trichoderma-based Products and their Widespread Use in

Agriculture, Open Mycol. J., 8, 71-126 (2014)

63. Yang J., Yan R., Roy A., Xu D., Poisson J. and Zhang Y., The

I-TASSER Suite: Protein structure and function prediction, Nature

Met., 12, 7-8 (2015)

64. Zdobnov E.M. and Apweiler R., InterProScan- an integration

platform for the signature-recognition methods in InterPro,

Bioinform., 17, 847-8 (2001)

65. Zhang Y., I-TASSER server for protein 3D structure

prediction, BMC Bioinform., 9, 40 (2008).

(Received 29th March 2019, accepted 18th June 2019)

research journal of biotechnology vol. res. j. biotech ...kumari rima*, kumar pankaj, sharma v.k....

Documents