research article staphylococcus aureus clinical isolates ...downloads.hindawi.com › journals ›...

Hindawi Publishing CorporationBioMed Research InternationalVolume 2013 Article ID 314654 11 pageshttpdxdoiorg1011552013314654

Research ArticleStaphylococcus aureus Clinical Isolates AntibioticSusceptibility Molecular Characteristics and Ability toForm Biofilm

N Indrawattana1 O Sungkhachat1 N Sookrung2

M Chongsa-nguan1 A Tungtrongchitr3 S P Voravuthikunchai4

T Kong-ngoen1 H Kurazono5 and W Chaicumpa3

1 Department of Microbiology and Immunology Faculty of Tropical Medicine Mahidol University Bangkok 10400 Thailand2Department of Research and Development Faculty of Medicine Siriraj Hospital Mahidol University Bangkok 10700 Thailand3Department of Parasitology Faculty of Medicine Siriraj Hospital Mahidol University Bangkok 10700 Thailand4Natural Products Research Center and Department of Microbiology Faculty of Science Prince of Songkla UniversitySongkhla 90112 Thailand

5Department of Applied Veterinary Medicine and Public Health Obihiro University of Agriculture and Veterinary MedicineInada-cho Obihiro Hokkaido 080 8555 Japan

Correspondence should be addressed to W Chaicumpa wanpenchamahidolacth

Received 30 May 2013 Accepted 24 July 2013

Academic Editor Sou-ichi Makino

Copyright copy 2013 N Indrawattana et alThis is an open access article distributed under theCreativeCommonsAttribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Periodic monitoring of Staphylococcus aureus characteristics in a locality is imperative as their drug-resistant variants causetreatment problem In this study antibiograms prevalence of toxin genes (sea-see seg-ser seu tsst-1 eta etb and etd) PFGE typesaccessory gene regulator (agr) groups and ability to form biofilm of 92 S aureusThailand clinical isolates were investigated Theywere classified into 10 drug groups groups 1ndash7 (56 isolates) weremethicillin resistant (MRSA) and 8ndash10 (36 isolates) weremethicillinsensitive (MSSA) One isolate did not have any toxin gene 4 isolates carried one toxin gene (seq) and 87 isolates had two or moretoxin genes No isolate had see etb or tsst-1 six isolates had eta or etd Combined seg-sei-sem-sen-seo of the highly prevalent egclocus was 261 The seb sec sel seu and eta associated significantly with MSSA sek was more in MRSA The sek-seq associationwas 5217while combined sed-sejwas not found Twenty-three PFGE types were revealed no association of toxin genes with PFGEtypes All four agr groups were present agr group 1 was predominant (5870) but agr group 2 strains carried more toxin genesand were more frequent toxin producers Biofilm formation was found in 7283 of the isolates but there was no association withantibiograms This study provides insight information on molecular and phenotypic markers of Thailand S aureus clinical isolateswhich should be useful for future active surveillance that aimed to control a spread of existing antimicrobial resistant bacteria andearly recognition of a newly emerged variant

1 Introduction

Staphylococcus aureus a gram positive coccal bacterium iseither commensal that colonizes healthy nasal mucosa [1] orpathogen of humans As a pathogen the bacteria cause a vari-ety of community and hospital acquired diseases includingskin abscess [2] food poisoning [3] pneumonitis [4] sepsis[5] and toxic shock syndrome [6] This bacterium producesseveral virulent factors including adhesins (colonization

factors) toxic proteinsenzymes (eg DNase for bacterialspread coagulase and catalase for host immunity evasion)and exotoxins including exfoliative toxins (ExTs) staphylo-coccal enterotoxins (SEs) and toxic shock syndrome toxin-1(TSST-1) Patients infected with the ExT producing S aureusmay develop scalded-skin syndrome [7]The SEs and TSST-1besides causing food poisoning are also superantigens (SAg)that can stimulate a relatively large fraction of peripheralblood T cells to release massive amounts of proinflammatory

2 BioMed Research International

cytokines and T-cell stimulating factors leading to toxicshock syndrome which may be fatal [8 9] The enterotoxicityand superantigenicity are distinct properties of the toxinmolecule [6] SEs are classified into two types based on theiremetic activity in the toxin fed modeled primate Toxins thatinduce vomiting in the primate are placed in the classicalSE type while those that lack the emetic activity or havenot been tested are allocated in the SE-like (SEls) type[10 11] Members of the classical SEs are SEA-SEE and themore recently recognized SEG SEH SEI SER SES andSET The SEls members include SElJ SElK SElL SElMSElN SElO SElP SElQ SElU SElU2 or SEW and SElV[11] The staphylococcal enterotoxin F (SEF) which lacksemetic activity but is associated with toxic shock syndrome ispresently called toxic shock syndrome toxin-1 (TSST-1) [12]The SEs and the TSST-1 as well as the bacterial resistanceto drugs are encoded by genes on the mobile genetic ele-ments including prophages plasmids pathogenicity islandsgenomic islands and antibiotic resistance cassette [13] thusthey are transmitted horizontally rather easily Expression ofS aureus virulence factors andmetabolismofmetabolic path-ways during growth are coordinatedregulated by a quorum-sensing operon named accessory gene regulator (agr) [14 15]Based on the amino acid sequence polymorphisms of theagr-encoding autoinducing peptides and their respondingreceptors S aureus strains can be divided into four major agrgroups (groups 1ndash4) [16]

During the last five decades S aureus clones thatresist methicillin (methicillin-resistant S aureus MRSA) dis-seminated and caused medical and public health problemworldwide [17 18] These strains are not only resistant tomethicillin but also resistant to all other 120573-lactams such ascephalosporin [18 19] In Thailand MRSA infections werereported from 23 hospitals from 1988 to 1998 [20 21] Theproportions of MRSA to MSSA in the northeast central andsouthern regions of the country during the studied periodincreased from 11 to 234 16 to 305 and 21 to 303respectively [22] Moreover methicillin-resistant S aureuswith reduced susceptibility to vancomycin was recognized[23] However data on genotypic characteristics and otherattributes of the S aureus isolates in Thailand are relativelyrare Therefore this study investigated the prevalence ofvirulence toxin genes coding for enterotoxins (sea-see seg-serand seu) toxic shock syndrome toxin-1 (tsst-1) and exfoliativetoxins (eta etb and etd) among S aureus Thailand clinicalisolates Molecular diversity of the isolates regarding theirendonuclease-restricted patterns of genomic DNA (PFGE)agr types and antimicrobial susceptibility as well as theirability to produce biofilm were also investigated

2 Materials and Methods

21 Bacterial Strains Ninety-two strains of S aureus isolatedfrom clinical specimens were obtained from three hospitalsThey were 43 strains (S1ndashS43) isolated in 2007 from patientsof Prince of Songkla University Teaching Hospital and keptat theDepartment ofMicrobiology Faculty of Science Princeof SongklaUniversity Songkhla province southernThailand36 strains (P1ndashP36) from the patients of Prasat Neurological

Institute Bangkok in 2010 and 13 strains (T1ndashT13) isolatedin 2010 from patients of the Hospital for Tropical DiseasesFaculty of Tropical Medicine Mahidol University BangkokThailand The bacteria were reconfirmed by Gram stainingbiochemical testing (catalase coagulase and DNase) andmannitol fermentationTheir ability to produce proteinAwasdetected by agglutination assay

22 Antimicrobial Susceptibility Testing Disc diffusionmethod was used for antimicrobial susceptibility testing ofthe S aureus isolates which was done according to CLSIguidelines [24] Antibiotic discs were cefoxitin ciprofloxacinclindamycin erythromycin gentamycin oxacillin penicillinG rifampin tetracycline sulfamethoxazole plus trimetho-prim and teicoplanin (Oxoid UK) Cefoxitin disc (30 120583g)and oxacillin disc (1120583g) were used for detecting methicillin-resistant isolates S aureus ATCC 25923 was used as controlReduction of vancomycin susceptibility of the isolates wasalso determined by observing the minimum inhibitoryconcentration (MIC) by agar dilution according to the CLSIguidelines [24]

23 Detection of Genes Coding for Staphylococcal EnterotoxinsTSST-1 and ExTs Genomic DNA was extracted from eachS aureus isolate by DNA extraction kit (Geneaid Taiwan)following the protocol for Gram-positive bacteria Qualityof each DNA preparation was assessed by determining theratio ofOD

260 nmOD280 nm Twenty-two virulence geneswereamplified including sea-see seg-ser and seu tsst-1 and etaetb and etd using specific oligonucleotide primer sequenceslisted in Table 1 [25 26] The PCR reaction mixture (25 120583L)is composed of 1mM of each primer 1x Taq buffer PCR02mM dNTP 2mM MgCl

2 1 unit of Taq DNA polymerase

(Fermentas Germany) and 100 ng of DNA template ThePCR reaction mixture was subjected to the thermal cyclesan initial denaturation of DNA at 95∘C for 10min prior to 35cycles of denaturation at 95∘C for 30 sec 55∘C for 30 sec and72∘C for 30 sec followed by a final extension of 10min at 72∘Cusing the Lifecycler (BioRad USA) The amplified productswere analyzed by 15 agarose gel electrophoresis and ethid-ium bromide staining The DNA bands were observed underanUV transilluminator (Syngene England) Control bacteriafor the PCR included strains ATCC 19095 (sea sec seh segsei sel sem sen seo seu and tst) ATCC 14458 (seb and sek)ATCC 23235 (sed sej) and ATCC 27664 (see seq and sea)For eta etb and etd the PCR ampliconswere verified byDNAsequencing and the nucleotide sequences were aligned withthe staphylococcal eta etb and etd sequences of the database(accession numbers L253721 M173481 and AB0574211resp)

24 Detection of SEs TSST-1 and ExTs The bacterial isolateswhich carried sea seb sec and sed eta and etb tsst-1 weretested for their ability to express the respective proteins by thereversed-passive latex agglutination (RPLA) using commer-cially available kits SET-RPLA TST-RPLA and EXT-RPLA(Denka Seiken Japan) respectively Other toxin detectionswere not done due to lack of available test kits

BioMed Research International 3

Table 1 The primer sequences for amplification of the S aureus enterotoxin genes

Target gene Primer sequence 51015840 rarr 31015840 Size of PCR product(bp) Reference

sea (F)(R)

GAAAAAAGTCTGAATTGCAGGGAACACAAATAAATCGTAATTAACCGAAGGTTC 560 [26]

seb (F)(R)

ATTCTATTAAGGACACTAAGTTAGGGAATCCCGTTTCATAAGGCGAGT 404 [26]

sec (F)(R)

CTTGTATGTATGGAGGAATAACAAAACATGCATATCATACCAAAAAGTATTGCCGT 275 [26]

sed (F)(R)

GAATTAAGTAGTACCGCGCTAAATAATATGGCTGTATTTTTCCTCCGAGAGT 492 [26]

see (F)(R)

CAAAGAAATGCTTTAAGCAATCTTAGGCCACCTTACCGCCAAAGCTG 482 [26]

seg (F)(R)

ACCTGAAAAGCTTCAAGGACGCCAACGTAATTCCAC 204 [26]

seh (F)(R)

CAATCACATCATATGCGAAAGCAGCATCTACCCAAACATTAGCACC 376 [26]

sei (F)(R)

CTYGAATTTTCAACMGGTACAGGCAGTCCATCTCCTG-3 461 [26]

sej (F)(R)

TCAGAACTGTTGTTCCGCTAGGAATTTTACCAYCAAAGGTAC 138 [26]

sek(F)(R1)(R2)

ATGCCAGCGCTCAAGGCAGATTCATTTGAAAATTGTAGTTGATTAGCT

TGCCAGCGCTCAAGGTG134 [26]

sel (F)(R)

GCGATGTAGGTCCAGGAAACCATATATAGTACGAGAGTTAGAACCATA 234 [26]

sem (F)(R)

CTATTAATCTTTGGGTTAATGGAGAACTTCAGTTTCGACAGTTTTGTTGTCAT 326 [26]

sen (F)(R)

CGTGGCAATTAGACGAGTCGATTGATYTTGATGATTATKAG 474 [26]

seo (F)(R)

AGTTTGTGTAAGAAGTCAAGTGTAGAATCTTTAAATTCAGCAGATATTCCATCTAAC 180 [26]

sep (F)(R)

GAATTGCAGGGAACTGCTGGCGGTGTCTTTTGAAC 182 [26]

seq (F)(R)


ser (F)(R)

AGCGGTAATAGCAGAAAATGTCTTGTACCGTAACCGTTTT 363 [26]

seu (F)(R)

AATGGCTCTAAAATTGATGGATTTGATTTCCATCATGCTC 215 [26]

tst (F)(R)

TTCACTATTTGTAAAAGTGTCAGACCCACTTACTAATGAATTTTTTTATCGTAAGCCCTT 180 [26]

eta (F)(R)

ACTGTAGGAGCTAGTGCATTTGTTGGATACTTTTGTCTATCTTTTTCATCAAC 190 [26]

etb (F)(R)

CAGATAAAGAGCTTTATACACACATTACAGTGAACTTATCTTTCTATTGAAAAACACTC 612 [25]

etd (F)(R)

CAAACTATCATGTATCAAGGATGGCCAGAATTTCCCGACTCAG 358 [26]

25 Pulsed-Field Gel Electrophoresis (PFGE) PFGE patternsof chromosomal DNA of all S aureus isolates were deter-mined by digesting each DNA preparation with SmaI Thedigested DNA preparations were subjected to electrophoreticseparation in a CHEF-DR II system (BioRad USA) asdescribed previously [27] DNA fragment patterns wereanalyzed in the GeneDirectory Application Version 20100Copyright 2000ndash2008 Synoptics Ltd Percent similarities

were identified on dendrogram derived from the unweightedpair group method with arithmetic averages (UPGMA) andbased on Dice coefficients Band position tolerance was setat 10 A coefficient similarity of 70 was selected to definecluster of the PFGE types

26TheAgrAlleles GenomicDNAof the 92 S aureus isolateswas used as templates for amplification of agr alleles using


the group specific primers [16] The common forward (pan)primer (51015840-ATGCACATGGTGCACATGC-31015840) and reversedprimers including agr1 (51015840-GTCACAAGTACTATAAGC-TGCGAT-31015840) agr2 (51015840-TATTACTAATTGAAAAGTGCC-ATAGC-31015840) agr3 (51015840-GTAATGTAATAGCTTGTATAA-TAATACCCAG-31015840) and agr4 (51015840-CGATAATGCCGTAAT-ACCCG-31015840) were used These primers allowed amplificationof 439- 572- 320- and 657-bp DNA fragments of the agrgroups 1ndash4 respectively

27 Biofilm Formation Ability of the S aureus isolates toform biofilm was determined according to the protocoldescribed previously [28] with modification Individual bac-terial isolates were cultured in TSB (Oxoid) supplementedwith 025 glucose at 35∘C until the turbidity reachedMcFarland no 05 Approximately 100 cfu of each culturewere applied in triplicate into wells of 96-well flat-bottomedmicroplate containing 200120583L of the TSB and 025 glu-cose Wells added with cultured S epidermidis (ATCC12228)served as negative controls The plate was incubated for 24 hThe content of each well was then discarded and the wellswere washed five times with sterile 09 NaCl solution Eachwell surface was stained by adding 100 120583L of 03 (wv)crystal violet (Merck) in water and kept for 5min Afterfive washing with sterile distilled water and air dried Thebiofilm fixed on each well surface was extracted with 100 120583Lof 70 ethanol and measured the absorbance at OD

570 nmThe isolates with OD

570 nm values above the mean OD570 nm

values plus three standard deviations of the negative control(meanneg + 3 SDNeg) were considered positive for biofilmformation

28 Statistical Analyses SPSS Statistics 160 was used forstatistical analysis Chi-squared (1205942) test and 119905-test were usedto analyze the data sorted by MRSA and MSSA groupsand frequencies of virulence genes and biofilm formationrespectively A probability value (119875) lt 005 was considereddifferent significantly

3 Results

31 Antimicrobial Susceptibility All of the 92 bacterial iso-lates from culture stocks were verified as S aureus strainsaccording to their phenotypic characteristics determined bythe conventional microbiological method After testing withthe 30 120583g cefoxitin disc 5692 isolates (6087) were MRSA(37 isolates from the Prince of Songkla hospital and 19isolates from Prasat Neurological Institute) and 36 isolates(3913) were MSSA (5 isolates from the Prince of Songklahospital 17 isolates from the Prasat Neurological Instituteand 19 isolates from the Hospital for Tropical Diseases)The 92 S aureus Thailand isolates were arbitrarily classifiedinto 10 drug groups Groups 1ndash7 were MRSA and groups8ndash10 were MSSA Data on susceptible and intermediatesensitivity to the 11 antibiotics tested (cefoxitin ciprofloxacinclindamycin erythromycin gentamicin oxacillin peni-cillin rifampin trimethoprimsulfamethoxazole (TS) tetra-cycline and teicoplanin) were group 1 (16 isolates) suscep-tible (9 isolates) and intermediate (7 isolates) to rifampin

and susceptible to teicoplanin group 2 (2 isolates) sus-ceptible to gentamicin and teicoplanin intermediate torifampin group 3 (7 isolates) susceptible to gentamicin andteicoplanin group 4 (1 isolate) susceptible to tetracyclineand teicoplanin group 5 (7 isolates) susceptible to rifampintrimethoprimsulfametoxazole tetracycline and teicoplaninand susceptible to gentamicin (1 isolate) group 6 (10 isolates)susceptible to rifampin trimethoprimsulfametoxazole (10isolates) intermediate to trimethoprimsulfametoxazole (1isolate) and susceptible to teicoplanin group 7 (13 isolates)susceptible to teicoplanin group 8 (3 isolates) susceptibleto oxacillin (2 isolates) cefoxitin gentamicin gentamicinand teicoplanin group 9 (28 isolates) resistant to penicillinand tetracycline (13 isolates) intermediate to erythromycin(1 islates) group 10 (5 isolates) resistant to gentamicin (1isolate) ciprofloxacin (2 isolates) erythromycin (2 isolates)and clindamycin (2 isolates) All of the isolates were sensitiveto vancomycin according to the MIC testing The methicillinsusceptibility and drug groups of the 92 isolates are shown inTable 2

32 Prevalence of Toxin Genes in Individual S aureus IsolatesAmong the 92 isolates 1 isolate (108) did not have any toxingene (S38) 4 (435) isolates (S16 S33 S40 and P33) carriedone toxin gene (seq) and the remaining 87 isolates (9457)carried two or more toxin genes (Table 2) There were only692 isolates that carry the etx genes either eta or etd (P28 P31T3 T8 T9 andT13)The prevalence of toxin genes among theisolates is shown in Figure 1 The predominant enterotoxingene was seq which was presented in 9192 isolates (9891)followed by sea (6522) and sek (5435) There was noisolate with see tsst-1 (sef ) or etb The prevalence of seasec sed seg seh sei sej sem sen seo sep seq ser eta andetd among the MRSA and MSSA isolates were not differentHowever the prevalence of seb sel and seu among isolates ofthe two methicillin groups was different significantly

33 Determination of Toxin Production Thebacterial isolateswhich carried sea seb sec sed eta and etb tsst-1 were deter-mined for their ability to produce the respective toxins byusing SET-RPLA TST-RPLA and EXT-RPLA respectivelyand 35 isolates were toxin producers (Table 2) There were2160 sea strains (35) that produced SEA 913 seb isolates(6923) produced SEB 47 sec isolates (5714) producedSEC and 35 sed isolates (60) produced SED One of thethree eta positive strains (3333) could produce ETA Noneof the four isolates with etd-positive strains produced ETDAmong the MRSA 2456 isolates (4286) produced toxins(17 SEA and 7 SEB) whereas 1136 (3055) of the MSSAisolates produced toxins (SEA 4 isolates SEB 1 isolate SEC3 isolates SED 2 isolates and SEB and ETA 1 isolate) Therewere 3MSSA isolates that producedmore than one toxin S41produced SEB and SED P23 produced SEA and SEC and T3produced SEB and ETA

34 PFGE Types The 92 S aureus isolates could be classifiedaccording to the PFGE results into 23 genotypes genotypes1ndash23 (Figure 2) Information on the PFGE types of individual


Table 2 Characteristics of the 92 S aureusThailand isolates

Isolate no Methicillinsusceptibility

Drug group Enterotoxin gene(s) ExT gene RPLA toxin PFGE type Agr group Biofilm (OD)

S1 R 1 sek seq mdash ND 1 1 + (0831)S2 R 1 sea sek seo seq mdash ND 1 1 + (0828)S3 R 1 sek seq mdash ND 1 1 + (0039)S4 R 1 sek seq mdash ND 1 1 + (0181)S5 R 1 sea sek seq mdash mdash 1 1 + (0701)S6 R 1 sek seq mdash ND 2 1 + (1566)S7 R 1 sea sed sek seq mdash mdash 1 2 + (1841)S8 R 1 sea sek seq mdash SEA 6 1 + (1701)S9 R 1 sea sek seq mdash SEA 21 1 + (0996)S10 R 1 sea sek seq mdash SEA 21 1 + (1219)S11 R 1 sea sek seo seq mdash SEA 21 1 + (1749)S12 R 1 sea sek seq mdash SEA 21 1 + (1377)S13 R 1 sea sek seq mdash SEA 21 1 + (1687)S14 R 1 sea sek seq mdash SEA 21 1 + (0796)S15 R 2 sea sek seq mdash mdash 1 1 + (0097)S16 R 2 seq mdash ND 3 1 + (0132)S17 R 3 sea sek seq mdash mdash 1 1 + (0085)S18 R 3 sea sek seq mdash mdash 4 1 + (0230)S19 R 3 sea sek seq mdash mdash 4 1 + (0080)S20 R 3 sek seq mdash ND 6 1 + (0417)S21 R 3 sek seq mdash ND 6 1 + (1103)S22 R 3 sek seq mdash ND 6 1 + (1835)S23 R 3 sek seq mdash ND 21 1 + (0097)S24 R 4 sea sek seq mdash mdash 2 1 + (0552)S25 R 7 sea sek seq mdash mdash 1 1 + (0569)S26 R 7 sek seq mdash ND 1 1 + (1000)S27 R 7 sek seq mdash ND 1 1 + (1155)S28 R 7 sea sek seq mdash mdash 1 1 + (0715)S29 R 7 sek seq mdash ND 2 1 + (1061)S30 R 7 sek seq mdash ND 2 1 + (1131)S31 R 7 sek seq mdash ND 2 1 + (0774)S32 R 7 sea sec sek sel seq mdash mdash 9 1 + (1796)S33 R 7 seq mdash ND 21 1 + (2481)S34 R 7 sea sec sel seq mdash mdash 21 1 + (1000)S35 R 7 sea sek seq mdash mdash 21 1 + (1792)S36 R 7 sek seq mdash ND 21 1 + (1184)S37 R 7 sek seq mdash ND 21 1 + (2332)S38 S 8 mdash ND 4 1 minus (minus0052)S39 S 8 sej sek seq mdash ND 4 2 + (0367)S40 S 8 seq mdash ND 21 1 + (0508)S41 S 9 seb sed sej sek seq ser etd mdash SEB SED 21 3 + (0074)S42 S 9 seg sei sem sen seo seq seu mdash mdash 19 3 minus (minus0007)S43 S 9 seg sei sek sem sen seo seq mdash mdash 7 2 minus (minus0008)P1 R 1 sea seq mdash SEA 21 1 + (0317)P2 R 1 sea seg sei sek sen seo seq mdash SEA 9 2 + (0700)


Table 2 Continued



P3 R 5 sea seg sei sem sen seo seq mdash SEA 9 2 + (0098)P4 R 5 sea seg sei sem sen seo seq mdash SEA 9 2 minus (minus0194)P5 R 5 sea sei sek sen seo seq mdash SEA 9 2 + (0543)P6 R 5 sea seg sei sem sen seo seq mdash SEA 9 2 minus (minus0144)

P7 R 5 sea seg sei sek sem sen seoseq

mdash SEA 9 2 minus (minus0095)

P8 R 5 sea seg sei sem sen seo seq mdash SEA 13 2 + (0451)

P9 R 5 sea sed seg sei sej sem senseo sep seq ser

mdash SED 16 2 minus (minus005)

P10 R 6 sea sek seq mdash SEA 21 1 + (0817)

P11 R 6 sea seb seg sei sem sen seoseq

mdash SEB 22 2 + (0141)

P12 R 6 seb seg sei sem sen seo seq mdash SEB 22 2 + (0179)P13 R 6 seb seg sei sem sen seq mdash SEB 22 2 minus (minus0176)


mdash mdash 22 2 + (0182)


mdash SEB 22 2 minus (minus0084)



P17 R 6 seb seg sei sem sen seo seq mdash SEB 22 2 minus (minus0051)P18 R 6 seb seg sei sem sen seo seq mdash SEB 22 2 minus (minus0137)


mdash mdash 22 2 minus (minus0117)

P20 S 9 sea sek sel seq mdash mdash 1 1 + (1311)P21 S 9 sea sec sel seq mdash mdash 2 1 minus (minus0173)P22 S 9 sea seo seq mdash mdash 8 1 + (0300)P23 S 9 sea sec sel seq mdash SEA SEC 9 1 minus (minus0204)P24 S 9 sea seq mdash mdash 9 1 + (2210)P25 S 9 sea sek seq mdash mdash 10 4 + (0484)P26 S 9 sea sek seo seq mdash mdash 17 1 + (1156)P27 S 9 sea seh sek seq mdash SEA 17 3 minus (minus0058)P28 S 9 sea sed sei seq etd SED 18 1 minus (minus0225)P29 S 9 sea seq mdash mdash 18 2 + (0098)

P30 S 9 sea sec seg sei sel sem senseo seq

mdash SEC 18 2 minus (minus0390)

P31 S 9 sea seb seg sei sem sen seoseq seu

eta mdash 18 2 minus (minus0147)

P32 S 9 sea sec seg sei sel sen seo seq mdash SEC 20 3 + (0128)P33 S 9 seq mdash ND 20 3 minus (minus0245)P34 S 9 seo seq mdash ND 22 1 minus (minus0326)P35 S 9 sea seo seq mdash mdash 23 1 + (0054)P36 S 9 sed sek seq mdash ND 23 1 + (1107)T1 S 9 sea sen seq mdash mdash 5 2 minus (minus0073)T2 S 9 sea seg sem sen seo seq mdash SEA 5 2 + (0046)

T3 S 9 seb seg sei sem sen seo seqseu

eta SEB ETA 8 4 + (3872)


Table 2 Continued

Isolate no Methicillinsusceptibility Drug group Enterotoxin gene(s) ExT gene RPLA toxin PFGE type Agr group Biofilm (OD)

T4 S 9 sea seg sen seq mdash mdash 9 2 + (0319)

T5 S 9 sea seg sei sek sem sen seoseq seu mdash mdash 9 4 minus (minus0081)

T6 S 9 seg sen seq mdash ND 11 1 + (0736)T7 S 9 sea seg sei sek sen seo mdash mdash 15 2 + (2818)T8 S 9 sea seg sei sem sen seo seq eta mdash 18 1 + (0156)T9 S 10 seq etd ND 12 1 minus (minus0114)T10 S 10 sea seg sei sem sen seo seq mdash SEA 14 2 + (0086)T11 S 10 sea seg sei sem sen seo seq mdash mdash 15 2 + (0808)T12 S 10 sec seh sel seq mdash SEC 15 3 minus (minus0198)T13 S 10 sea sek seq etd SEA 18 1 + (0235)minus not detectable + produced biofilmND not done

5812

75

030

229

349

8

1

24

03

04

0 10 20 30 40 50 60 70 80 90 100

seasebsecsedseesegsehseisejsekselsesenseosepseqserseutsstetaetbetd

Number of isolates

Viru

lenc

e gen

es

(0 MRSA 3 MSSA P = 0057)

(0 MRSA 4 MSSA P = 0021)(1 MRSA 1 MSSAP = 0632)

(1 MRSA 0 MSSAP = 0609)34 (18 MRSA 15 MSSAP = 0239)

90 (56 MRSA 34 MSSA P = 0151)

32(17 MRSA 15 MSSAP = 0187)

25 (17 MRSA 15 MSSAP = 0187)

(2 MRSA 6 MSSAP = 0038)

(39 MRSA 10 MSSA P lt 0001)

(1 MRSA 2 MSSAP = 0338)

(17 MRSA 12 MSSAP = 0536)

(0 MRSA 2 MSSA P = 0151)(17 MRSA 13 MSSA P = 0363)

(2 MRSA 3 MSSA P = 0298)


(35 MRSA 23 MSSA P = 0536)

(0 MRSA 4 MSSA lowastP = 0021)

sem

Figure 1 Prevalence of the enterotoxin and exfoliative toxin genes among the 92 S aureusThailand isolates lowast119875 value between prevalence ofMRSA compared to MSSA

isolates is given in Table 2 PFGE type 21 was predominant (16isolates) followed by types 1 9 and 22 (13 11 and 10 isolatesresp) types 2 and 18 had 6 isolates each types 4 and 6 had 4isolates each 3 isolates belonged to type 15 types 5 8 17 20and 23 had 2 isolates each and types 3 7 10 11 12 13 14 16and 19 had 1 isolate each

35 The Agr Groups The predominant agr group among the92 isolates was group 1 (5492 isolates 5870) followed bygroups 2 (29 isolates 3152) 3 (6 isolates 652) and 4 (3isolates 326)

36 Biofilm Formation There were 6792 isolates (7283)that produced biofilm 2136 (5833) were MSSA and 4656isolates (8214) were MRSA The prevalence of the biofilmformation of the MRSA and MSSA was not different (119875 gt005)

4 Discussion

Diseases caused by S aureus are health hazard to humanworldwide Since the first recognition of methicillin-resistantS aureus in 1961 [29] there has been an upsurge of infections


10092857770625547403225

Similarity ()

1

2

16

15

9

8

7

6

5

4

3

14

13

12

11

10

20

19

18

17

22

21

23

Banding pattern

Figure 2 Dendrogram of PFGE patterns the 92 S aureusThailand isolates

caused by the S aureus variants that resist not only methi-cillin but also other 120573-lactams and vancomycin which aretherapeutic drugs of choice [30ndash32] leading to treatmentfailure and increased case fatality rate The methicillin and

vancomycin resistance of the S aureus are encoded bystaphylococcal cassette chromosome mec (SCCmec) andvanA respectively [30 31] Association of the presence of Saureus toxin genes with methicillin sensitivity and resistance


among S aureus has been reported previously [28 33ndash35]The association was found also in the present study theprevalence of the seb sec sel seu and eta was associatedsignificantly (119875 lt 005) with the MSSA while sek was foundmore in MRSA

The toxin genes carried by the 92Thailand isolates variedfrom none to as many as 11 genes (Table 2) Five of theS aureus enterotoxin genes that is seg sei sem sen andseo belonged to the highly prevalent egc locus [36 37] thustheir coexistencewas frequently reported Coexistence of seg-sei in the same strain either alone or in more combinationwith other toxin gene(s) (sea sec sed seh sej andor tst) wasfound in 55 of the 429 S aureus isolates fromGermany [38]In Japan the seg-sei alone or with seb sec or sed were 2427 68 and 20 respectively [39] The combined seg-sei-sem-sen-seo with seu was 151 among the Chinese isolates[26] In the present study the combined seg-sei-sem-sen-seowith other toxin genes including sea seb sed sej sek sel sepseq ser andor eta was found in 2492 isolates (261)Therewere 3 isolates that carried seg-sei-sen-seo with sea sec seksel andor seq and 1 isolate with seg-sei-sem-sen and seb Thepreviously reported fixed association of sed-sej [38] was notfound among the 92 Thailand isolates The combined sek-seqwith other toxin gene(s) that is sea andor seb was 455among the Chinese isolates [26] In the present study the sek-seq association was found in 48 of the 92 isolates (5217)either the two genes alone (163) or with the other toxingenes (3586)

The ability of the isolates to produce SEA SEB SECand SED and ETA ETB and TSST-1 was examined by usingSET-RPLA TST-RPLA and EXT-RPLA test kits respec-tively Not all isolates harboring the genes expressed therespective toxins The results were similar to the findingreported previously among S aureus isolates from milk andmilk products from Morocco [40] The unconformed resultsbetween genotypes (by PCR) to phenotypes (by RPLA) couldbe due to the fact that toxin production of the bacteria canbe affected by the growth conditions including temperaturepH and water activity The so-produced toxin levels mightbe lower than the detection limits of the immunoassay [4041] Alternatively the toxin gene may not be expressed dueto mutation either in the coding region or in a regulatoryregion for example agr [42 43] No annotated data areavailable in the literature on association of the ability of toxinproduction and antibiograms of the S aureus Neverthelessin this study the frequency of toxin production is higheramong the MRSA (4886) than the MSSA (3055) (119875 lt005)

Therewas no association between PFGE patterns with theMRSA and MSSA of the 92 Thai strains which conformedto the results reported elsewhere [44 45] However PFGEpatterns 21 and 22 ofMRSA strains predominated among iso-lates fromPrince of SongklaHospital andPrasatNeurologicalInstitute that is 325 and 278 respectively Among the 7isolates of PFGE pattern 21 of Songkla that could produceenterotoxins 6 strains (857) produced SEA All 7 isolates

of PFGE type 22 of Prasat Neurological Institute isolatesproduced SEB

The polymorphism in the agr locus was first describedby Ji et al in 1997 [46] To date S aureus isolates wereclassified into four different agr groups [25 46] In this studyall agr groups were found large proportion (586) of theisolates was agr group 1whichwas similar to the data reportedpreviously [16] Moreover majority (3854 isolates 70) ofthe agr group 1 were MRSA which conformed also to theprevious report [47] However it is noteworthy that isolatesof the agr group 2 in this study carried more number ofenterotoxins genes and most of the toxin producing strainsbelonged to this agr group The data were different fromelsewhere which showed that most toxin producing S aureusstrains were either agr groups 3 [46] or 4 [48]

Biofilm formation contributes to bacterial pathogenesisand resistance to antibiotics and harsh environment S aureusisolates did form biofilms [28 49] More strains of MSSAproduced biofilm compared to MRSA strains [28] In thisstudy 7283 of the S aureus isolates formed biofilm butthere was no association with their antibiotic patterns

In conclusion the results of this study provide insightinformation on molecular and phenotypic markers of Saureus clinical isolates in Thailand which should be usefulfor future active surveillance that aimed to control a spreadof existing antimicrobial resistant bacteria as well as earlyrecognition of a newly emerged variant

Conflict of Interests

The authors have declared that no conflict of interests exists

Acknowledgments

Thework was supported by DPG5380001 grant theThailandResearch Fund (TRF) and the National Research University(NRU) Project of the Office of Higher Education Commis-sion Ministry of Education Thailand Nitaya Indrawattanaand Nitat Sookrung are the TRF new scholars Thanks aredue to Assistant Professor Narisara Chantratita Depart-ment of Microbiology and Immunology Faculty of TropicalMedicine Mahidol University Bangkok for providing thePFGE facility

References

[1] R E Williams ldquoHealthy carriage of Staphylococcus aureus itsprevalence and importancerdquo Bacteriological reviews vol 27 pp56ndash71 1963

[2] D L Stulberg M A Penrod and R A Blatny ldquoCommon bac-terial skin infectionsrdquo The American Family Physician vol 66no 1 pp 119ndash124 2002

[3] I V Pinchuk E J Beswick and V E Reyes ldquoStaphylococcalenterotoxinsrdquo Toxins vol 2 no 8 pp 2177ndash2197 2010

[4] S D Haessler and R B Brown ldquoPneumonia caused by Staphy-lococcus aureusrdquo Current Respiratory Medicine Reviews vol 5no 1 pp 62ndash67 2009


[5] M Kowalik J Ellert-Zygadłowska T Smiatacz et al ldquoStaphy-lococcus aureus sepsis still life threatening diseaserdquo PolskiMerkuriusz Lekarski vol 11 no 64 pp 352ndash356 2001

[6] T Proft and J D Fraser ldquoBacterial superantigensrdquo Clinical andExperimental Immunology vol 133 no 3 pp 299ndash306 2003

[7] M M Dinges P M Orwin and P M Schlievert ldquoExotoxinsof Staphylococcus aureusrdquoClinical Microbiology Reviews vol 13no 1 pp 16ndash34 2000

[8] N Balaban and A Rasooly ldquoStaphylococcal enterotoxinsrdquoInternational Journal of Food Microbiology vol 61 no 1 pp 1ndash10 2000

[9] M Llewelyn and J Cohen ldquoSuperantigens microbial agentsthat corrupt immunityrdquo The Lancet Infectious Diseases vol 2no 3 pp 156ndash162 2002

[10] G Lina G A Bohach S P Nair K Hiramatsu E Jouvin-Marche and R Mariuzza ldquoStandard nomenclature for thesuperantigens expressed by Staphylococcusrdquo Journal of InfectiousDiseases vol 189 no 12 pp 2334ndash2336 2004

[11] M A Argudın M C Mendoza and M R Rodicio ldquoFoodpoisoning and Staphylococcus aureus enterotoxinsrdquo Toxins vol2 no 7 pp 1751ndash1773 2010

[12] M S Bergdoll B A Crass R F Reiser R N Robbins andJ P Davis ldquoA new staphylococcal enterotoxin enterotoxin Fassociated with toxic-shock-syndrome Staphylococcus aureusisolatesrdquoThe Lancet vol 1 no 8228 pp 1017ndash1021 1981

[13] S Holtfreter D Grumann M Schmudde et al ldquoClonal distri-bution of superantigen genes in clinical Staphylococcus aureusisolatesrdquo Journal of Clinical Microbiology vol 45 no 8 pp2669ndash2680 2007

[14] R P Novick H F Ross S J Projan J Kornblum B Kreiswirthand SMoghazeh ldquoSynthesis of staphylococcal virulence factorsis controlled by a regulatory RNA moleculerdquo EMBO Journalvol 12 no 10 pp 3967ndash3975 1993

[15] N Balaban and R P Novick ldquoTranslation of RNAIII theStaphylococcus aureus agr regulatory RNA molecule can beactivated by a 31015840-end deletionrdquo FEMS Microbiology Letters vol133 no 1-2 pp 155ndash161 1995

[16] P Gilot G Lina T Cochard and B Poutrel ldquoAnalysis of thegenetic variability of genes encoding the RNA III-activatingcomponents Agr and TRAP in a population of Staphylococcusaureus strains isolated from cows with mastitisrdquo Journal ofClinical Microbiology vol 40 no 11 pp 4060ndash4067 2002

[17] F D Lowy ldquoMedical progress Staphylococcus aureus infec-tionsrdquoThe New England Journal of Medicine vol 339 no 8 pp520ndash532 1998

[18] F D Lowy ldquoAntimicrobial resistance the example of Staphylo-coccus aureusrdquo Journal of Clinical Investigation vol 111 no 9 pp1265ndash1273 2003

[19] Y Katayama T Ito and K Hiramatsu ldquoA new class of geneticelement staphylococcus cassette chromosome mec encodesmethicillin resistance in Staphylococcus aureusrdquo AntimicrobialAgents and Chemotherapy vol 44 no 6 pp 1549ndash1555 2000

[20] The committee on Using Computer in Clinical MicrobiologyldquoBacterial antimicrobial susceptibility pattern 1998rdquo Journal ofInfectious Diseases and Antimicrobial Agents vol 8 pp 25ndash391991

[21] ldquoDrug resistance surveillance 1998 pilot phase reportrdquo NationalAntimicrobial Resistance Surveillance Center Ministry of Pub-lic Health Thailand 1999

[22] SWongwanich P Tishyadhigama S Paisomboon T Ohta andH Hayashi ldquoEpidemiological analysis of methicillin resistant

Staphylococcus aureus in Thailandrdquo Southeast Asian Journal ofTropical Medicine and Public Health vol 31 no 1 pp 72ndash762000

[23] S Trakulsomboon S Danchaivijitr Y Rongrungruang et alldquoFirst report of methicillin-resistant Staphylococcus aureuswithreduced susceptibility to vancomycin in Thailandrdquo Journal ofClinical Microbiology vol 39 no 2 pp 591ndash595 2001

[24] CLSI ldquoPerformance standards for antimicrobial susceptibil-ity testing 20th informational supplementrdquo CLSI DocumentM100-S20 CLSI Wayne Pa USA 2010

[25] S Jarraud G J Lyon A M S Figueiredo et al ldquoExfoliatin-producing strains define a fourth agr specificity group inStaphylococcus aureusrdquo Journal of Bacteriology vol 182 no 22pp 6517ndash6522 2000

[26] D Wu X Li Y Yang et al ldquoSuperantigen gene profiles andpresence of exfoliative toxin genes in community-acquiredmeticillin-resistant Staphylococcus aureus isolated from Chi-nese childrenrdquo Journal of Medical Microbiology vol 60 no 1pp 35ndash45 2011

[27] S J Peacock G D I de Silva A Justice et al ldquoComparison ofmultilocus sequence typing and pulsed-field gel electrophoresisas tools for typing Staphylococcus aureus isolates in a microepi-demiological settingrdquo Journal of Clinical Microbiology vol 40no 10 pp 3764ndash3770 2002

[28] LWang F Yu L Yang et al ldquoPrevalence of virulence genes andbiofilm formation among Staphylococcus aureus clinical isolatesassociated with lower respiratory infectionrdquo African Journal ofMicrobiology Research vol 4 no 23 pp 2566ndash2569 2010

[29] M P Jevons ldquoCelbenin-resistant staphylococcirdquo BritishMedicalJournal vol 1 pp 24ndash25 1961

[30] J B Kaper and J Hacker Pathogenicity Islands andOtherMobileVirulence Elements The American Society for MicrobiologyPress Washington DC USA 1999

[31] S Chang D M Sievert J C Hageman et al ldquoInfectionwith vancomycin-resistant Staphylococcus aureus containingthe vanA resistance generdquoTheNewEngland Journal ofMedicinevol 348 no 14 pp 1342ndash1347 2003

[32] S Christopher R M Verghis B Antonisamy et al ldquoTransmis-sion dynamics of methicillin-resistant Staphylococcus aureus ina medical intensive care unit in Indiardquo PLoS ONE vol 6 no 7Article ID e20604 2011

[33] J Sila P Sauer and M Kolar ldquoComparison of the preva-lence of genes coding for enterotoxins exfoliatins Panton-Valentine leukocidin and TSST-1 between methicillin-resistantand methicillin-susceptible isolates of Staphylococcus aureus atthe University Hospital in Olomoucrdquo Biomedical Papers vol153 no 3 pp 215ndash218 2009

[34] K T Lim Y A Hanifah M Y Mohd Yusof and KL Thong ldquoInvestigation of toxin genes among methicillin-resistant Staphylococcus aureus strains isolated from a tertiaryhospital in Malaysiardquo Tropical Biomedicine vol 29 pp 212ndash2192012

[35] J N Jimenez A M Ocampo J M Vanegas et al ldquoCharacteri-sation of virulence genes inmethicillin susceptible and resistantStaphylococcus aureus isolates from a paediatric populationin a university hospital of Medellın Colombiardquo Memorias doInstituto Oswaldo Cruz vol 106 pp 980ndash985 2011

[36] S Jarraud M A Peyrat A Lim et al ldquoegc a highly prevalentoperon of enterotoxin gene forms a putative nursery of super-antigens in Staphylococcus aureusrdquo Journal of Immunology vol166 no 1 pp 669ndash677 2001


[37] M Mempel G Lina M Hojka et al ldquoHigh prevalence ofsuperantigens associated with the egc locus in Staphylococcusaureus isolates from patients with atopic eczemardquo EuropeanJournal of Clinical Microbiology and Infectious Diseases vol 22no 5 pp 306ndash309 2003

[38] K Becker A W Friedrich G Lubritz M Weilert G Petersand C von Eiff ldquoPrevalence of genes encoding pyrogenic toxinsuperantigens and exfoliative toxins among strains of Staphylo-coccus aureus isolated from blood and nasal specimensrdquo Journalof Clinical Microbiology vol 41 no 4 pp 1434ndash1439 2003

[39] K Omoe D-L Hu H Takahashi-Omoe A Nakane and KShinagawa ldquoComprehensive analysis of classical and newlydescribed staphylococcal superantigenic toxin genes in Staphy-lococcus aureus isolatesrdquo FEMS Microbiology Letters vol 246no 2 pp 191ndash198 2005

[40] A Bendahou M Abid N Bouteldoun D Catelejine and MLebbadi ldquoEnterotoxigenic coagulase positive Staphylococcus inmilk and milk products Lben and Jben in northern MoroccordquoJournal of Infection inDevelopingCountries vol 3 no 3 pp 169ndash176 2009

[41] C A Genigeorgis ldquoPresent state of knowledge on staphylococ-cal intoxicationrdquo International Journal of FoodMicrobiology vol9 no 4 pp 327ndash360 1989

[42] L Chapaval D H Moon J E Gomes F R Duarte and S MTsai ldquoUse of PCR to detect classical enterotoxin genes (ent)and toxic shock syndrome toxin-1 gene (tst) in Staphylocooccusaureus isolated from crude milk and determination of toxinproductivities of S aureus isolates harboring these generdquoArquivos Do Instituto Biologico vol 73 pp 165ndash169 2006

[43] NK SharmaC ED Rees andC E RDodd ldquoDevelopment ofa single-reactionmultiplex PCR toxin typing assay for Staphylo-coccus aureus strainsrdquoApplied and Environmental Microbiologyvol 66 no 4 pp 1347ndash1353 2000

[44] Y Xie Y He A Gehring et al ldquoGenotypes and toxin geneprofiles of Staphylococcus aureus clinical isolates from ChinardquoPLoS ONE vol 6 no 12 Article ID e28276 2011

[45] Y Shimamura and M Murata ldquoPulsed-field gel electrophoreticanalysis and some characteristics of Staphylococcus aureus iso-lated from retail foods and human handsrdquo Bioscience Biotech-nology and Biochemistry vol 75 no 6 pp 1177ndash1180 2011

[46] G Ji R Beavis and R P Novick ldquoBacterial interference causedby autoinducing peptide variantsrdquo Science vol 276 no 5321 pp2027ndash2030 1997

[47] W van Leeuwen W van Nieuwenhuizen C Gijzen H Ver-brugh and A van Belkum ldquoPopulation studies of methicillin-resistant and -sensitive Staphylococcus aureus strains reveal alack of variability in the agrD gene encoding a staphylococcalautoinducer peptiderdquo Journal of Bacteriology vol 182 no 20pp 5721ndash5729 2000

[48] S Jarraud C Mougel J Thioulouse et al ldquoRelationshipsbetween Staphylococcus aureus genetic background virulencefactors agr groups (alleles) and human diseaserdquo Infection andImmunity vol 70 no 2 pp 631ndash641 2002

[49] G F M Gad M A El-Feky M S El-Rehewy M A Hassan HAbolella and R M A El-Baky ldquoDetection of icaA icaD genesand biofilm production by Staphylococcus aureus and Staphy-lococcus epidermidis isolated from urinary tract catheterizedpatientsrdquo Journal of Infection in Developing Countries vol 3 no5 pp 342ndash351 2009

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


cytokines and T-cell stimulating factors leading to toxicshock syndrome which may be fatal [8 9] The enterotoxicityand superantigenicity are distinct properties of the toxinmolecule [6] SEs are classified into two types based on theiremetic activity in the toxin fed modeled primate Toxins thatinduce vomiting in the primate are placed in the classicalSE type while those that lack the emetic activity or havenot been tested are allocated in the SE-like (SEls) type[10 11] Members of the classical SEs are SEA-SEE and themore recently recognized SEG SEH SEI SER SES andSET The SEls members include SElJ SElK SElL SElMSElN SElO SElP SElQ SElU SElU2 or SEW and SElV[11] The staphylococcal enterotoxin F (SEF) which lacksemetic activity but is associated with toxic shock syndrome ispresently called toxic shock syndrome toxin-1 (TSST-1) [12]The SEs and the TSST-1 as well as the bacterial resistanceto drugs are encoded by genes on the mobile genetic ele-ments including prophages plasmids pathogenicity islandsgenomic islands and antibiotic resistance cassette [13] thusthey are transmitted horizontally rather easily Expression ofS aureus virulence factors andmetabolismofmetabolic path-ways during growth are coordinatedregulated by a quorum-sensing operon named accessory gene regulator (agr) [14 15]Based on the amino acid sequence polymorphisms of theagr-encoding autoinducing peptides and their respondingreceptors S aureus strains can be divided into four major agrgroups (groups 1ndash4) [16]

During the last five decades S aureus clones thatresist methicillin (methicillin-resistant S aureus MRSA) dis-seminated and caused medical and public health problemworldwide [17 18] These strains are not only resistant tomethicillin but also resistant to all other 120573-lactams such ascephalosporin [18 19] In Thailand MRSA infections werereported from 23 hospitals from 1988 to 1998 [20 21] Theproportions of MRSA to MSSA in the northeast central andsouthern regions of the country during the studied periodincreased from 11 to 234 16 to 305 and 21 to 303respectively [22] Moreover methicillin-resistant S aureuswith reduced susceptibility to vancomycin was recognized[23] However data on genotypic characteristics and otherattributes of the S aureus isolates in Thailand are relativelyrare Therefore this study investigated the prevalence ofvirulence toxin genes coding for enterotoxins (sea-see seg-serand seu) toxic shock syndrome toxin-1 (tsst-1) and exfoliativetoxins (eta etb and etd) among S aureus Thailand clinicalisolates Molecular diversity of the isolates regarding theirendonuclease-restricted patterns of genomic DNA (PFGE)agr types and antimicrobial susceptibility as well as theirability to produce biofilm were also investigated

2 Materials and Methods

21 Bacterial Strains Ninety-two strains of S aureus isolatedfrom clinical specimens were obtained from three hospitalsThey were 43 strains (S1ndashS43) isolated in 2007 from patientsof Prince of Songkla University Teaching Hospital and keptat theDepartment ofMicrobiology Faculty of Science Princeof SongklaUniversity Songkhla province southernThailand36 strains (P1ndashP36) from the patients of Prasat Neurological

Institute Bangkok in 2010 and 13 strains (T1ndashT13) isolatedin 2010 from patients of the Hospital for Tropical DiseasesFaculty of Tropical Medicine Mahidol University BangkokThailand The bacteria were reconfirmed by Gram stainingbiochemical testing (catalase coagulase and DNase) andmannitol fermentationTheir ability to produce proteinAwasdetected by agglutination assay

22 Antimicrobial Susceptibility Testing Disc diffusionmethod was used for antimicrobial susceptibility testing ofthe S aureus isolates which was done according to CLSIguidelines [24] Antibiotic discs were cefoxitin ciprofloxacinclindamycin erythromycin gentamycin oxacillin penicillinG rifampin tetracycline sulfamethoxazole plus trimetho-prim and teicoplanin (Oxoid UK) Cefoxitin disc (30 120583g)and oxacillin disc (1120583g) were used for detecting methicillin-resistant isolates S aureus ATCC 25923 was used as controlReduction of vancomycin susceptibility of the isolates wasalso determined by observing the minimum inhibitoryconcentration (MIC) by agar dilution according to the CLSIguidelines [24]

23 Detection of Genes Coding for Staphylococcal EnterotoxinsTSST-1 and ExTs Genomic DNA was extracted from eachS aureus isolate by DNA extraction kit (Geneaid Taiwan)following the protocol for Gram-positive bacteria Qualityof each DNA preparation was assessed by determining theratio ofOD

260 nmOD280 nm Twenty-two virulence geneswereamplified including sea-see seg-ser and seu tsst-1 and etaetb and etd using specific oligonucleotide primer sequenceslisted in Table 1 [25 26] The PCR reaction mixture (25 120583L)is composed of 1mM of each primer 1x Taq buffer PCR02mM dNTP 2mM MgCl

2 1 unit of Taq DNA polymerase

(Fermentas Germany) and 100 ng of DNA template ThePCR reaction mixture was subjected to the thermal cyclesan initial denaturation of DNA at 95∘C for 10min prior to 35cycles of denaturation at 95∘C for 30 sec 55∘C for 30 sec and72∘C for 30 sec followed by a final extension of 10min at 72∘Cusing the Lifecycler (BioRad USA) The amplified productswere analyzed by 15 agarose gel electrophoresis and ethid-ium bromide staining The DNA bands were observed underanUV transilluminator (Syngene England) Control bacteriafor the PCR included strains ATCC 19095 (sea sec seh segsei sel sem sen seo seu and tst) ATCC 14458 (seb and sek)ATCC 23235 (sed sej) and ATCC 27664 (see seq and sea)For eta etb and etd the PCR ampliconswere verified byDNAsequencing and the nucleotide sequences were aligned withthe staphylococcal eta etb and etd sequences of the database(accession numbers L253721 M173481 and AB0574211resp)

24 Detection of SEs TSST-1 and ExTs The bacterial isolateswhich carried sea seb sec and sed eta and etb tsst-1 weretested for their ability to express the respective proteins by thereversed-passive latex agglutination (RPLA) using commer-cially available kits SET-RPLA TST-RPLA and EXT-RPLA(Denka Seiken Japan) respectively Other toxin detectionswere not done due to lack of available test kits




sea (F)(R)


seb (F)(R)


sec (F)(R)


sed (F)(R)


see (F)(R)


seg (F)(R)


seh (F)(R)


sei (F)(R)


sej (F)(R)


sek(F)(R1)(R2)



sel (F)(R)


sem (F)(R)


sen (F)(R)


seo (F)(R)


sep (F)(R)


seq (F)(R)


ser (F)(R)


seu (F)(R)


tst (F)(R)


eta (F)(R)


etb (F)(R)


etd (F)(R)












3 Results












Table 2 Continued











mdash SEB 22 2 + (0141)


















eta SEB ETA 8 4 + (3872)


Table 2 Continued





5812

75

030

229

349

8

1

24

03

04

0 10 20 30 40 50 60 70 80 90 100


Number of isolates

Viru

lenc

e gen

es

(0 MRSA 3 MSSA P = 0057)



90 (56 MRSA 34 MSSA P = 0151)

32(17 MRSA 15 MSSAP = 0187)

25 (17 MRSA 15 MSSAP = 0187)

(2 MRSA 6 MSSAP = 0038)


(1 MRSA 2 MSSAP = 0338)

(17 MRSA 12 MSSAP = 0536)


(2 MRSA 3 MSSA P = 0298)


(35 MRSA 23 MSSA P = 0536)


sem





4 Discussion



10092857770625547403225

Similarity ()

1

2

16

15

9

8

7

6

5

4

3

14

13

12

11

10

20

19

18

17

22

21

23

Banding pattern















Acknowledgments


References




























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology




sea (F)(R)


seb (F)(R)


sec (F)(R)


sed (F)(R)


see (F)(R)


seg (F)(R)


seh (F)(R)


sei (F)(R)


sej (F)(R)


sek(F)(R1)(R2)



sel (F)(R)


sem (F)(R)


sen (F)(R)


seo (F)(R)


sep (F)(R)


seq (F)(R)


ser (F)(R)


seu (F)(R)


tst (F)(R)


eta (F)(R)


etb (F)(R)


etd (F)(R)












3 Results












Table 2 Continued











mdash SEB 22 2 + (0141)


















eta SEB ETA 8 4 + (3872)


Table 2 Continued





5812

75

030

229

349

8

1

24

03

04

0 10 20 30 40 50 60 70 80 90 100


Number of isolates

Viru

lenc

e gen

es

(0 MRSA 3 MSSA P = 0057)



90 (56 MRSA 34 MSSA P = 0151)

32(17 MRSA 15 MSSAP = 0187)

25 (17 MRSA 15 MSSAP = 0187)

(2 MRSA 6 MSSAP = 0038)


(1 MRSA 2 MSSAP = 0338)

(17 MRSA 12 MSSAP = 0536)


(2 MRSA 3 MSSA P = 0298)


(35 MRSA 23 MSSA P = 0536)


sem





4 Discussion



10092857770625547403225

Similarity ()

1

2

16

15

9

8

7

6

5

4

3

14

13

12

11

10

20

19

18

17

22

21

23

Banding pattern















Acknowledgments


References




























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology








3 Results












Table 2 Continued











mdash SEB 22 2 + (0141)


















eta SEB ETA 8 4 + (3872)


Table 2 Continued





5812

75

030

229

349

8

1

24

03

04

0 10 20 30 40 50 60 70 80 90 100


Number of isolates

Viru

lenc

e gen

es

(0 MRSA 3 MSSA P = 0057)



90 (56 MRSA 34 MSSA P = 0151)

32(17 MRSA 15 MSSAP = 0187)

25 (17 MRSA 15 MSSAP = 0187)

(2 MRSA 6 MSSAP = 0038)


(1 MRSA 2 MSSAP = 0338)

(17 MRSA 12 MSSAP = 0536)


(2 MRSA 3 MSSA P = 0298)


(35 MRSA 23 MSSA P = 0536)


sem





4 Discussion



10092857770625547403225

Similarity ()

1

2

16

15

9

8

7

6

5

4

3

14

13

12

11

10

20

19

18

17

22

21

23

Banding pattern















Acknowledgments


References




























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology







Table 2 Continued











mdash SEB 22 2 + (0141)


















eta SEB ETA 8 4 + (3872)


Table 2 Continued





5812

75

030

229

349

8

1

24

03

04

0 10 20 30 40 50 60 70 80 90 100


Number of isolates

Viru

lenc

e gen

es

(0 MRSA 3 MSSA P = 0057)



90 (56 MRSA 34 MSSA P = 0151)

32(17 MRSA 15 MSSAP = 0187)

25 (17 MRSA 15 MSSAP = 0187)

(2 MRSA 6 MSSAP = 0038)


(1 MRSA 2 MSSAP = 0338)

(17 MRSA 12 MSSAP = 0536)


(2 MRSA 3 MSSA P = 0298)


(35 MRSA 23 MSSA P = 0536)


sem





4 Discussion



10092857770625547403225

Similarity ()

1

2

16

15

9

8

7

6

5

4

3

14

13

12

11

10

20

19

18

17

22

21

23

Banding pattern















Acknowledgments


References




























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


Table 2 Continued





5812

75

030

229

349

8

1

24

03

04

0 10 20 30 40 50 60 70 80 90 100


Number of isolates

Viru

lenc

e gen

es

(0 MRSA 3 MSSA P = 0057)



90 (56 MRSA 34 MSSA P = 0151)

32(17 MRSA 15 MSSAP = 0187)

25 (17 MRSA 15 MSSAP = 0187)

(2 MRSA 6 MSSAP = 0038)


(1 MRSA 2 MSSAP = 0338)

(17 MRSA 12 MSSAP = 0536)


(2 MRSA 3 MSSA P = 0298)


(35 MRSA 23 MSSA P = 0536)


sem





4 Discussion



10092857770625547403225

Similarity ()

1

2

16

15

9

8

7

6

5

4

3

14

13

12

11

10

20

19

18

17

22

21

23

Banding pattern















Acknowledgments


References




























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


10092857770625547403225

Similarity ()

1

2

16

15

9

8

7

6

5

4

3

14

13

12

11

10

20

19

18

17

22

21

23

Banding pattern















Acknowledgments


References




























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology












Acknowledgments


References




























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology
























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

research article staphylococcus aureus clinical isolates ...downloads.hindawi.com › journals ›...

Documents