research article sequence variants of and association...

Research ArticleSequence Variants of ADIPOQ and Association with Type 2Diabetes Mellitus in Taiwan Chinese Han Population

Ming-Kai Tsai1 Hui-Min David Wang23 Jeng-Chuan Shiang1

I-Hung Chen1 Chih-Chiang Wang1 Ya-Fen Shiao4 Wen-Sheng Liu4 Tai-Jung Lin5

Tsung-Ming Chen67 and Ya-Huey Chen89

1 Division of Nephrology Department of Medicine Kaohsiung Armed Forces General Hospital Kaohsiung 80284 Taiwan2Department of Fragrance and Cosmetic Science Kaohsiung Medical University Kaohsiung 80708 Taiwan3Graduate Institute of Natural Products Kaohsiung Medical University Kaohsiung 80708 Taiwan4Asia-Pacific Biotech Developing Inc Kaohsiung 80681 Taiwan5Department of Pharmacy and Graduate Institute of Pharmaceutical Technology Tajen University Pingtung 90741 Taiwan6Department of Physiology College of Medicine National Cheng Kung University 1 University Road Tainan 70101 Taiwan7Department and Graduate Institute of Aquaculture National Kaohsiung Marine University Kaohsiung 81157 Taiwan8Center for Molecular Medicine China Medical University Hospital Taichung 40477 Taiwan9Graduate Institute of Cancer Biology China Medical University Cancer Center Building 8F No 6 Hsueh-Shih RoadTaichung 40477 Taiwan

Correspondence should be addressed to Tsung-Ming Chen tsungmingchengmailcomand Ya-Huey Chen elva1225chengmailcom

Received 18 March 2014 Revised 4 June 2014 Accepted 16 June 2014 Published 10 July 2014

Academic Editor George Panagiotis Chrousos

Copyright copy 2014 Ming-Kai Tsai et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Diabetes is a serious global health problem Large-scale genome-wide association studies identified loci for type 2 diabetes mellitus(T2DM) including adiponectin (ADIPOQ) gene and transcription factor 7-like 2 (TCF7L2) but few studies clarified the effectof genetic polymorphisms of ADIPOQ and TCF7L2 on risk of T2DM We attempted to elucidate association between T2DMand polymorphic variations of both in Taiwanrsquos Chinese Han population with our retrospective case-control study genotypingsingle nucleotide polymorphisms (SNPs) in ADIPOQ and TCF7L2 genes both in 149 T2DM patients and in 139 healthy controlsfrom Taiwan Statistical analysis gauged association of these polymorphisms with risk of T2DM to show ADIPOQ rs1501299polymorphism variations strongly correlated with T2DM risk (119875 = 0042) with rs2241766 polymorphism being not associatedwith T2DM (119875 = 0967) However both polymorphisms rs7903146 and rs12255372 of TCF7L2 were rarely detected in Taiwanesepeople This study avers that ADIPOQ rs1501299 polymorphism contributes to risk of T2DM in the Taiwanese population

1 Introduction

Global prevalence of type 2 diabetes mellitus (T2DM) is 6but is expected to rise due to aging population [1] 2012saw some 16 million patients (sim7 of total population) inTaiwan suffering from it with sim90 of these cases diagnosedas T2DM non-insulin-dependent diabetes characterized byimpaired insulin secretion in peripheral tissues It accountsfor up to 115 of healthcare costs in Taiwan annuallyFactors such as age weight diet lifestyle and family history

are linked therewith [1] higher concordance rate amongmonozygotic versus dizygotic twins and sibling risk mani-fested itself and prevalence differs among racial groups [2]suggesting genetic contribution to risk of T2DM

Genome-wide studies identify diabetes susceptibility locion chromosomes 3q27 and 10q253 where adiponectin genes(ADIPOQ or APM1) and TCF7L2 are located respectively[3] Human adiponectin encoded by ADIPOQ gene isan adipose-specific secretory protein involved in manymetabolic processes for example glucose modulation and

Hindawi Publishing Corporatione Scientific World JournalVolume 2014 Article ID 650393 7 pageshttpdxdoiorg1011552014650393

2 The Scientific World Journal

Table 1 Characteristics of participants

T2DM(n = 149)

Controls(n = 139)

Age (years) 6562 plusmn 1348 2708 plusmn 1458Sex malefemale 7772 9344Values represented mean plusmn SD (standard deviation)

fatty acid oxidation [4] Adiponectin level positively corre-lates with weight [5] T2DM [5] insulin resistance [6] andcardiovascular diseases [5 7] but negatively with insulin level[8] Polymorphisms of ADIPOQ are linked with metabolicsyndromes for example insulin resistance abdominal obe-sity impaired glucose tolerance dyslipidemia hypertensionincreased fasting glucose [9 10] and plasma adiponectinlevel [11 12] Also haplotype analysis of ADIPOQ showedsignificant association with obesity and insulin resistance[13 14] Two ADIPOQ SNPs rs2241766 and rs1501299showed significant association with risk of T2DM in theJapanese population [15 16] yet this phenomenon did notappear in the French population [17] Interestingly personswithout family history of diabetes revealed stark correlationof rs2241766 SNP obesity and insulin sensitivity amongGerman people [18] making the role of ADIPOQ gene inT2DM controversial Any relation between these SNPs andT2DM in the Taiwanese remains unclear Human transcrip-tion factor 7-like 2 (TCF7L2 aka TCF4) [19] is involvedin beta-catenin-dependent Wnt signaling pathway playingroles in pancreatic and intestinal endocrine cells [20 21]Polymorphism of TCF7L2 gene correlates with T2DM riskand progression in multiple ethnicities [22ndash26] Stronglyassociated variants rs12255372 and rs7903146 were citedas risk factors [27] while information about TCF7L2 andADIPOQ on T2DM risk is scant in Taiwanese populationswe researched both genes

2 Materials and Methods

21 Sample Collection We recruited 149 individuals withT2DM and 139 healthy controls as diagnosed by Dr Ming-Kai Tsai with basic characteristics of both groups summa-rized in Table 1 3mL blood samples with EDTA anticoagu-lants were collected from Kaohsiung Armed Forces GeneralHospital with informed consent Genomic DNA was isolatedfrom blood samples using the DNA isolation kit (QIAampDNA Blood Mini Kit Qiagen Valencia Germany)

22 Marker Selection and Genotyping of SNPs In ADIPOQand TCFL2 33 and 84 SNPs were reported respectively fromdbSNP database (httpwwwncbinlmnihgovSNP) SNPswere based on genetic information for the Chinese (CHB)and the Japanese (JPT) in HapMap (wwwhapmaporg)Allele-specific polymerase chain reaction (AS-PCR) analysiswas performed with allele-specific primer sets (Table 2)on genotype alleles of ADIPOQ (rs2241766 and rs1501299)and TCF7L2 (rs7903146 and rs12255372) In brief forward

primers specifically complementary to each SNP allele weredesigned and two PCR reactions were conducted in parallelto determine the allele PCR used MyCycle thermal cycler(USA) containing 125 U of Taq DNA polymerase (TaKaRa)1X PCR buffer 200 umolL dNTP 100 ng of each primer and10 ng of genomic DNA Amplification was through initialdenaturation at 94∘C for 5min 35 cycles of denaturation at94∘C for 30 s annealing at 45∘C for 30 s extension at 72∘Cfor 30 s and final extension at 72∘C for 5min PCR productswere analyzed by 2 agarose gelWe also confirmed accuracyof AS-PCR via Sanger DNA sequencing

23 Statistical Analysis Hardy-Weinberg equilibrium(HWE) was tested by online HWE program (httplinkager-ockefellereduottlinkutilhtm) [28] and allele and genotypefrequencies were examined by Fisherrsquos exact (two-tailed) testusing SPSS version 100 software (SPSS for Windows IncChicago IL) Odds ratios with 95 confidence intervals werederived for external variables with119875 valuelt005 constitutingstatistical significance Correction for multiple comparisonsused positive false discovery rate (FDR) statistics based onthe method of Benjamini and Hochberg [29] with FDRlt 005 for significant association adopted as true positiveresult Power was estimated by free power analysis programGlowastpower 31 [30]

3 Results

Two SNPs of ADIPOQ and two SNPs of TCF7L2 geneswere genotyped in T2DM patients and controls using allele-specific polymerase chain reaction analysis (Table 3) Dis-tributions of ADIPOQ and TCF7L2 genotypes are plottedin Table 4 and genotype frequencies were evaluated bychi-square test The method of Benjamini and Hochberg(threshold = 01) served to correct for multiple testing ofeach tested gene Results showed significant difference (119875 =0042) in ADIPOQ (rs1501299 (G276T)) polymorphism afterBenjamini and Hochberg correction (FDR lt 005) Yet nodifferences of genotype frequencies in ADIPOQ (rs2241766(T45G)) and TCF7L2 (rs7903146) polymorphisms weredetected Surprisingly genotypes of rs12255372 for TCF7L2were the only GG genotype appearing in both healthy andT2DM subjects that is rs12255372 is not informative amongthe Taiwanese population Genotype distributions of all SNPsdo not deviate from HWE in either T2DM patients orcontrols (data not shown)

Similar results were observed in allele frequency minorallele frequency of rs1501299 SNP in ADIPOQ being 285higher among T2DM patients compared to healthy controls(206119875 = 0028 FDRlt 005) (Table 5)Theodds ratio (OR)showed T allele of rs1501299 SNP as the risk factor for T2DMin our subjects (OR = 059 95 confidence interval (CI)001ndash024 119875 = 0032) with no difference apparent in otherpolymorphisms Collectively these results suggest geneticvariation ofADIPOQ in particular rs1501299 SNPmay have arole in prevalence of T2DMamong theTaiwanese populationWe likewise compared distribution of genotypes forADIPOQrs1501299 SNP among Taiwanese T2DM and control subjects

The Scientific World Journal 3

Table 2 Primers utilized in allele-specific PCR analysis

GeneSNP Primers 51015840-31015840 Productsize

ADIPOQrs2241766F GCAGCTCCTAGCCGTAGACTCTGCTGR GGAGGTCTGTGATGAAAGAGGCCFG TGCTATTAGCTCTGCCCGAGFT TGCTATTAGCTCTGCCCGAT

372 bp

226 bp

ADIPOQrs1501299F CCTGGTGAGAAGGGTGAGAAR AGATGCAGCAAAGCCAAAGTFG TGATATAAACTATATGAATGFT TGATATAAACTATATGAATT

241 bp

168 bp

TCF7L2rs7903146F GCCTCAAAACCTAGCACAGCR GTGAAGTGCCCAAGCTTCTCFC GCTAAGCACTTTTTAGATGCFT GCTAAGCACTTTTTAGATGT

220 bp

176 bp

TCF7L2rs12255372F CTTGAGGTGTACTGGAAACTAAGGCR CTGTCTATTTGGCATTCAAATGGAFG GGAATATCCAGGCAAGAACGFT GGAATATCCAGGCAAGAACT

251 bp

130 bp

SNP single nucleotide polymorphism F forward R reverse

Table 3 Polymorphisms genotyped in this study

Marker type dbSNP ID Position in genes AllelesDNA (majorminer) Amino acid

ADIPOQSNP rs2241766 Coding sequence TG NACSNP rs1501299 Intron 2 GT NAC

TCF7L2SNP rs7903146 Intron 3 CT NACSNP rs12255372 Intron 4 GT NAC

NAC no amino acid change

Table 4 Genotype frequencies () of SNPs T2DM and controls

dbSNP ID 119899Genotypes () P value Dominant Recessive

OR (95 CI) P value OR (95 CI) P valueADIPOQ TT TG GG TG + GGTT TT + TGGGrs2241766

T2DM 149 71 (477) 69 (463) 9 (6) 0967 091 (minus010sim014) 0684 149 (minus018sim007) 039Control 139 70 (504) 57 (41) 12 (86)

ADIPOQ GG GT TT GT + TTGG GG + GTTTrs1501299

T2DM 149 80 (537) 53 (356) 16 (107) 0042lowast 059 (001sim024) 0032lowast 066 (minus007sim02) 032Control 139 92 (662) 37 (266) 10 (72)

TCF7L2 CC CT TT CCCTrs7903146

T2DM 149 143 (96) 6 (4) 0 (0) 0246 185 (minus009sim022) 025Control 139 129 (928) 10 (72) 0 (0)

TCF7L2 GG GT GGrs12255372

T2DM 149 149 (100) 0 (0) 0 (0) NAControl 139 139 (100) 0 (0) 0 (0)

lowastP lt 005 NA nonavailable OR odds ratios CI confidence interval


Table 5 Allele frequencies () of SNPs ADIPOQ and TCF7L2 T2DM and controls

SNP types 119899 Allele () P value OR (95 CI)ADIPOQ T Grs2241766

T2DM 149 211 (708) 87 (292) 0968 1 (minus008sim008)Control 139 197 (707) 81 (293)

ADIPOQ G Trs1501299

T2DM 149 213 (715) 85 (285) 0028lowast 065 (001sim015)Control 139 221 (794) 57 (206)

TCF7L2 C Trs7903146


lowastP lt 005 OR odds ratios CI confidence interval

Table 6 ADIPOQ SNP rs1501299 genotype distribution in this study and HapMap

119899 Distribution of genotypes 119899 ()TT TG GG

TaiwaneseT2DM 149 16 (107) 53 (356) 80 (537)Control 139 10 (73) 36 (263) 91 (664)

TT TG GGHapMap populations

HapMap-CEUlowast 116 8 (69) 46 (397) 62 (534)HapMap-HCBlowast 90 8 (89) 42 (467) 40 (444)HapMap-YRIlowast 88 6 (68) 40 (455) 42 (477)

lowastCEU Europe HCB China YRI Nigeria

from the current study plus other ethnic control groups forexample the European (CEU) the Han Chinese (HCB) andthe Nigerian (YRI) groups from HapMap database (Table 6)While GG genotype in rs1501299 had prevalence in all controlethnic groups TT genotype is relatively higher in TaiwaneseT2DM patients such that T allele of rs1501299 in ADIPOQmight play an important role in T2DM

4 Discussion

Novel associated genetic diseases identified by genome-wideassociation studies are needed for further testing in differentpopulations Association study is the most important toolfor identifying genes conferring susceptibility to complexdisorders Genetic studies on many complex disorders likediabetes and psychiatric traits confirm many risk-associatedgenetic variants contributing to a subtle effect [2] Our case-control study analyzed association of T2DM with ADIPOQand TCF7L2 polymorphism in the Taiwanese Interestinglysignificant correlationwas noted betweenADIPOQ rs1501299polymorphism and T2DM subjects with T allele shown as arisk factor for prevalence of T2DM

Polymorphisms of TCF7L2 TCF7L2 is involved in beta-catenin-dependent Wnt signaling pathway which employs

its physiological functions in pancreatic and intestinalendocrine cells [20 21] Previous investigations correlatedTCF7L2 with risk of T2DM in extensive populations [31 32]though not including the Taiwanese We rated associationof TCF7L2 polymorphisms rs7903146 and rs12255372 withT2DM prevalence in Taiwan However minor allele frequen-cies of rs7903146 and rs12255372 are 0023 and unknowninconsistent with prior study of the Chinese population[33] Data hinted these SNPs are not polymorphic in ourpopulation and were removed from the final analysesAlthough polymorphisms of TCF7L2 were rare in Taiwanesepopulation it is noteworthy to observe linkage betweenrs7903146 in TCF7L2 and T2DM in ethnic groups [31 34ndash37] Genetic markers well represented in one populationbut showing significantly different allele frequencies evenalmost total absence in another allele across ethnicities arefrequently observed [38] These phenomena might resultfrom heterogeneity among ethnic groups their effects onsusceptibility to T2DMare unclear andmerit follow-up study

Polymorphism of ADIPOQ Adiponectin adipocytokineencoded by ADIPOQ is central to insulin sensitivity andresistance and other metabolic syndrome traits in diversepopulations [39 40] In addition plasma level of adiponectinwas proposed as a biomarker for T2DM hypertension and


obesity [41 42] ADIPOQ SNPs were linked with plasmaadiponectin level among the Caucasian population [11 12]and metabolic syndrome [9 10] ADIPOQ polymorphismsand T2DM or diabetic nephropathy had also been evaluatedfrom many populations for example the European-derived[17 18] the Asian [14 16 40] the non-European SouthAfrican [43] and the African American [44] populationsStill no difference appeared between these SNPs and T2DMin the Taiwanese population [45] Gao et al indicated Gallele frequency of ADIPOQ SNP (rs2241766) as prevalentin metabolic syndrome patients versus control groups in theChinese Han population [10] which demonstrably augmentsrisk of T2DM in the Chinese population [10] We analyzedgenetic association between ADIPOQ polymorphisms andT2DM in 149 patients and 139 normal controls in Taiwan(study power = 07) genotype frequency of SNP rs2241766showed no difference between T2DM and controls Sincers2241766 is a silent mutation for Gly15 this SNP may linkwith other functional SNPs

We focused on other SNPs of ADIPOQ rs1501299 to findrs1501299 SNP definitely associated with T2DM (119875 = 0045)High prevalence of T allele (119875 = 0028) and risk of T2DM inthe Taiwanese population was observed (119875 = 0032) findingsthat are consistent with studies performed in populationsof southern India [14] Japan [15 16] and Mainland China[46] Also Yang et al reported SNP rs1501299 linked withobesity metabolic syndrome and diabetes in the elderlyTaiwanese [47] which suggest that T allele of SNP rs1501299increases risk of diabetes among the Chinese populationconsistent with our data However these results conflictedwith other studies of Chinese people [48ndash51] suggestingthat SNP rs1501299 may not be a functional SNP but mostlikely be in linkage disequilibrium with other functionalvariants [47] Moreover it suggests genetic background ofthe Taiwanese may be unique compared to the MainlandChinese Prevalence of TT genotype in SNP rs1501299 notedamong Taiwanese was compared with controls from EuropeChina and Nigeria in HapMap database Results indicatemost groups (Taiwanese European Japanese and Nigerian)retain high levels of GG content albeit not Mainland China(Table 6) suggesting genetic background of Chinese peopleis heterogeneous [46] This portends a greater number ofsubjects from different populations to evaluate in the future

Study Limitation One limitation of this study was smallsample size due to cost considerations While genetic anal-ysis of SNP rs1501299 proved significant we could notentirely exclude a possibility of false positives because ofsampling limitations and other factors (confounders withother medical conditions subject assessment lacking supportby structured interviews) Yet we added statistics FDRlt 005as a true positive association to support our conclusions

5 Conclusions

Our case-control study linked T2DM with ADIPOQ andTCF7L2 polymorphism in Taiwanrsquos Han Chinese populationstrong correlation emerged between ADIPOQ rs1501299 andT2DM subjects in Taiwan Taken together this verifies

that ADIPOQ is associated with T2DM risk in Taiwanesepopulation which may prove useful clinically as a geneticmarker Results suggestADIPOQ as a key genetic contributorto T2DM that may serve as a clinical biomarker

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

This work was funded by the National Science CouncilTaiwan (NSC 102-2320-B-039-053) The authors thank allthe persons participating in this investigation and Kaohsi-ung Armed Forces General Hospital for their support Theauthors also appreciate Asia-Pacific BiotechDeveloping Incfor assistance in gene polymorphism analysis and CharlesWagamon for the critical reading and editing of the paper

References

[1] P Zimmet KGMMAlberti and J Shaw ldquoGlobal and societalimplications of the diabetes epidemicrdquo Nature vol 414 no6865 pp 782ndash787 2001

[2] S S Rich ldquoMapping genes in diabetes Genetic epidemiologicalperspectiverdquo Diabetes vol 39 no 11 pp 1315ndash1319 1990

[3] S M Ruchat C E Elks R J Loos et al ldquoAssociation betweeninsulin secretion insulin sensitivity and type 2 diabetes suscep-tibility variants identified in genome-wide association studiesrdquoActa Diabetologica vol 46 no 3 pp 217ndash226 2009

[4] J J Dıez and P Iglesias ldquoThe role of the novel adipocyte-derivedhormone adiponectin in human diseaserdquo European Journal ofEndocrinology vol 148 no 3 pp 293ndash300 2003

[5] K Hotta T Funahashi Y Arita et al ldquoPlasma concentrations ofa novel adipose-specific protein adiponectin in type 2 diabeticpatientsrdquoArteriosclerosisThrombosis andVascular Biology vol20 no 6 pp 1595ndash1599 2000

[6] C Weyer T Funahashi S Tanaka et al ldquoHypoadiponectine-mia in obesity and type 2 diabetes close association withinsulin resistance and hyperinsulinemiardquo Journal of ClinicalEndocrinology and Metabolism vol 86 no 5 pp 1930ndash19352001

[7] M Kumada S Kihara S Sumitsuji et al ldquoAssociation ofhypoadiponectinemia with coronary artery disease in menrdquoArteriosclerosis Thrombosis and Vascular Biology vol 23 no1 pp 85ndash89 2003

[8] J G Yu S Javorschi A L Hevener et al ldquoThe effect ofthiazolidinediones on plasma adiponectin levels in normalobese and type 2 diabetic subjectsrdquo Diabetes vol 51 no 10 pp2968ndash2974 2002

[9] R H Eckel S M Grundy and P Z Zimmet ldquoThe metabolicsyndromerdquoThe Lancet vol 365 no 9468 pp 1415ndash1428 2005

[10] M Gao D Ding J Huang Y Qu Y Wang and Q HuangldquoAssociation of genetic variants in the adiponectin gene withmetabolic syndrome a case-control study and a systematicmeta-analysis in the Chinese populationrdquo PLoS ONE vol 8 no4 Article ID e58412 2013

[11] M Hivert A K Manning J B McAteer et al ldquoCommonvariants in the adiponectin gene (ADIPOQ) associated with


plasma adiponectin levels type 2 diabetes and diabetes-relatedquantitative traits The framingham offspring studyrdquo Diabetesvol 57 no 12 pp 3353ndash3359 2008

[12] I M Heid S AWagner H Gohlke et al ldquoGenetic architectureof theAPM1 gene and its influence on adiponectin plasma levelsand parameters of the metabolic syndrome in 1727 healthyCaucasiansrdquo Diabetes vol 55 no 2 pp 375ndash384 2006

[13] C Menzaghi T Ercolino R D Paola et al ldquoA haplotype at theadiponectin locus is associated with obesity and other featuresof the insulin resistance syndromerdquo Diabetes vol 51 no 7 pp2306ndash2312 2002

[14] K Ramya K A Ayyappa S Ghosh V Mohan and V RadhaldquoGenetic association of ADIPOQ gene variants with type 2diabetes obesity and serum adiponectin levels in south Indianpopulationrdquo Gene vol 532 no 2 pp 253ndash262 2013

[15] K Hara P Boutin Y Mori et al ldquoGenetic variation in the geneencoding adiponectin is associated with an increased risk oftype 2 diabetes in the Japanese populationrdquoDiabetes vol 51 no2 pp 536ndash540 2002

[16] S Yamaguchi Y Yamada H Matsuo et al ldquoGender differencesin the association of gene polymorphisms with type 2 diabetesmellitusrdquo International Journal of Molecular Medicine vol 19no 4 pp 631ndash637 2007

[17] F Vasseur N Helbecque C Dina et al ldquoSingle-nucleotidepolymorphism haplotypes in the both proximal promoterand exon 3 of the APM1 gene modulate adipocyte-secretedadiponectin hormone levels and contribute to the genetic riskfor type 2 diabetes in French Caucasiansrdquo Human MolecularGenetics vol 11 no 21 pp 2607ndash2614 2002

[18] M Stumvoll O Tschritter A Fritsche et al ldquoAssociation ofthe T-G polymorphism in adiponectin (Exon 2) with obesityand insulin sensitivity interaction with family history of type 2diabetesrdquo Diabetes vol 51 no 1 pp 37ndash41 2002

[19] A Duval M Busson-Leconiat R Berger and R HamelinldquoAssignment of the TCF-4 gene (TCF7L2) to human chromo-some band 10q253rdquo Cytogenetics and Cell Genetics vol 88 no3-4 pp 264ndash265 2000

[20] L Shu N S Sauter F T Schulthess A V Matveyenko JOberholzer and K Maedler ldquoTranscription factor 7-like 2regulates 120573-cell survival and function in human pancreaticisletsrdquo Diabetes vol 57 no 3 pp 645ndash653 2008

[21] Z Liu and J F Habener ldquoGlucagon-like peptide-1 activation ofTCF7L2-dependentWnt signaling enhances pancreatic beta cellproliferationrdquo The Journal of Biological Chemistry vol 283 no13 pp 8723ndash8735 2008

[22] T Jin and L Liu ldquoThe Wnt signaling pathway effector TCF7L2and type 2 diabetes mellitusrdquoMolecular Endocrinology vol 22no 11 pp 2383ndash2392 2008

[23] T Hayashi Y Iwamoto K Kaku H Hirose and S MaedaldquoReplication study for the association of TCF7L2 with suscepti-bility to type 2 diabetes in a Japanese populationrdquoDiabetologiavol 50 no 5 pp 980ndash984 2007

[24] M Horikoshi K Hara C Ito R Nagai P Froguel and TKadowaki ldquoA genetic variation of the transcription factor 7-like2 gene is associated with risk of type 2 diabetes in the Japanesepopulationrdquo Diabetologia vol 50 no 4 pp 747ndash751 2007

[25] D M Lehman K J Hunt R J Leach et al ldquoHaplotypes oftranscription factor 7-like 2 (TCF7L2) gene and its upstreamregion are associated with type 2 diabetes and age of onset inMexican AmericansrdquoDiabetes vol 56 no 2 pp 389ndash393 2007

[26] A Helgason S Palsson G Thorleifsson et al ldquoRefining theimpact of TCF7L2 gene variants on type 2 diabetes and adaptiveevolutionrdquo Nature Genetics vol 39 no 2 pp 218ndash225 2007

[27] J C Florez K A Jablonski N Bayley et al ldquoTCF7L2 polymor-phisms and progression to diabetes in the Diabetes PreventionProgramrdquoThe New England Journal of Medicine vol 355 no 3pp 241ndash250 2006

[28] J Ott Analysis of Human Genetic Linkage Johns HopkinsUniversity Press Baltimore Md USA 1999

[29] Y Benjamini and Y Hochberg ldquoControlling the false discoveryrate a practical and powerful approach to multiple testingrdquoJournal of the Royal Statistical Society B Methodological vol 57no 1 pp 289ndash300 1995

[30] F Faul E Erdfelder A Buchner and A-G Lang ldquoStatisticalpower analyses using GlowastPower 31 tests for correlation andregression analysesrdquo Behavior Research Methods vol 41 no 4pp 1149ndash1160 2009

[31] S F Grant G Thorleifsson I Reynisdottir et al ldquoVariant oftranscription factor 7-like 2 (TCF7L2) gene confers risk of type2 diabetesrdquo Nature Genetics vol 38 no 3 pp 320ndash323 2006

[32] Y Luo HWang X Han et al ldquoMeta-analysis of the associationbetween SNPs in TCF7L2 and type 2 diabetes in East AsianpopulationrdquoDiabetes Research and Clinical Practice vol 85 no2 pp 139ndash146 2009

[33] Y Chang T Chang Y Jiang et al ldquoAssociation study of thegenetic polymorphisms of the transcription factor 7-like 2(TCF7L2) gene and type 2 diabetes in the Chinese populationrdquoDiabetes vol 56 no 10 pp 2631ndash2637 2007

[34] S Cauchi D Meyre C Dina et al ldquoTranscription factorTCF7L2 genetic study in the French population expression inhuman 120573-cells and adipose tissue and strong association withtype 2 diabetesrdquo Diabetes vol 55 no 10 pp 2903ndash2908 2006

[35] E J Parra L Cameron L Simmonds et al ldquoAssociation ofTCF7L2 polymorphisms with type 2 diabetes in Mexico CityrdquoClinical Genetics vol 71 no 4 pp 359ndash366 2007

[36] C Zhang L Qi D J Hunter et al ldquoVariant of transcriptionfactor 7-like 2 (TCF7L2) gene and the risk of type 2 diabetes inlarge cohorts of US women and menrdquo Diabetes vol 55 no 9pp 2645ndash2648 2006

[37] H Saadi N Nagelkerke S G Carruthers et al ldquoAssociationof TCF7L2 polymorphism with diabetes mellitus metabolicsyndrome and markers of beta cell function and insulinresistance in a population-based sample of Emirati subjectsrdquoDiabetes Research and Clinical Practice vol 80 no 3 pp 392ndash398 2008

[38] R Chakraborty and K K Kidd ldquoThe utility of DNA typing inforensic workrdquo Science vol 254 no 5039 pp 1735ndash1739 1991

[39] W S Yang W S Lee T Funahashi et al ldquoPlasma adiponectinlevels in overweight and obese AsiansrdquoObesity Research vol 10no 11 pp 1104ndash1110 2002

[40] F Zadjali S AL-Yahyaee M O Hassan S Albarwani andR A Bayoumi ldquoAssociation of adiponectin promoter variantswith traits and clusters of metabolic syndrome in Arabs family-based studyrdquo Gene vol 527 no 2 pp 663ndash669 2013

[41] W-S Chow B M Y Cheung A W K Tso et al ldquoHypoad-iponectinemia as a predictor for the development of hyperten-sion a 5-year prospective studyrdquoHypertension vol 49 no 6 pp1455ndash1461 2007

[42] M Daimon T Oizumi T Saitoh et al ldquoDecreased serumlevels of adiponectin are a risk factor for the progression totype 2 diabetes in the Japanese population the Funagata studyrdquoDiabetes Care vol 26 no 7 pp 2015ndash2020 2003


[43] A Olckers G W Towers A van der Merwe P E H SchwarzP Rheeder and A E Schutte ldquoProtective effect against type2 diabetes mellitus identified within the ACDC gene in ablack South African diabetic cohortrdquo Metabolism Clinical andExperimental vol 56 no 5 pp 587ndash592 2007

[44] O Ukkola M Santaniemi T Rankinen et al ldquoAdiponectinpolymorphisms adiposity and insulinmetabolismHERITAGEfamily study and Oulu diabetic studyrdquo Annals of Medicine vol37 no 2 pp 141ndash150 2005

[45] W-L Liao C-C Chen C-T Chang et al ldquoGene polymor-phisms of adiponectin and leptin receptor are associated withearly onset of type 2 diabetes mellitus in the Taiwanese popu-lationrdquo International Journal of Obesity vol 36 no 6 pp 790ndash796 2012

[46] Y Li Y Yang L Shi X Li Y Zhang andY Yao ldquoThe associationstudies of ADIPOQ with type 2 diabetes mellitus in Chinesepopulationsrdquo DiabetesMetabolism Research and Reviews vol28 no 7 pp 551ndash559 2012

[47] W Yang Y Yang C Chen et al ldquoAdiponectin SNP276 isassociated with obesity the metabolic syndrome and diabetesin the elderlyrdquo American Journal of Clinical Nutrition vol 86no 2 pp 509ndash513 2007

[48] N X Wang D M Liu and M De ldquoThe association ofadiponectin gene polymorphism with insulin resistance andtype 2 diabetes mellitusrdquo Journal of Tianjin Medical Universityvol 15 pp 190ndash193 2009

[49] J M Hao Z H Dian and J X Liu ldquoCorrelation betweensingle nucleotide polymorphism of adiponectin gene and type 2diabete in Han population of HainanrdquoHainan Medical Journalvol 20 pp 1ndash3 2009

[50] Y Wang D Zhang Y Liu et al ldquoAssociation study of thesingle nucleotide polymorphisms in adiponectin-associatedgenes with type 2 diabetes in Han Chineserdquo Journal of Geneticsand Genomics vol 36 no 7 pp 417ndash423 2009

[51] W Yang and L Chuang ldquoHuman genetics of adiponectin in themetabolic syndromerdquo Journal ofMolecularMedicine vol 84 no2 pp 112ndash121 2006

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014


MEDIATORSINFLAMMATION

of


Behavioural Neurology

EndocrinologyInternational Journal of



Disease Markers


BioMed Research International

OncologyJournal of



Oxidative Medicine and Cellular Longevity


PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of



Computational and Mathematical Methods in Medicine

OphthalmologyJournal of


Diabetes ResearchJournal of



Research and TreatmentAIDS


Gastroenterology Research and Practice


Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom


Table 1 Characteristics of participants

T2DM(n = 149)

Controls(n = 139)

Age (years) 6562 plusmn 1348 2708 plusmn 1458Sex malefemale 7772 9344Values represented mean plusmn SD (standard deviation)

fatty acid oxidation [4] Adiponectin level positively corre-lates with weight [5] T2DM [5] insulin resistance [6] andcardiovascular diseases [5 7] but negatively with insulin level[8] Polymorphisms of ADIPOQ are linked with metabolicsyndromes for example insulin resistance abdominal obe-sity impaired glucose tolerance dyslipidemia hypertensionincreased fasting glucose [9 10] and plasma adiponectinlevel [11 12] Also haplotype analysis of ADIPOQ showedsignificant association with obesity and insulin resistance[13 14] Two ADIPOQ SNPs rs2241766 and rs1501299showed significant association with risk of T2DM in theJapanese population [15 16] yet this phenomenon did notappear in the French population [17] Interestingly personswithout family history of diabetes revealed stark correlationof rs2241766 SNP obesity and insulin sensitivity amongGerman people [18] making the role of ADIPOQ gene inT2DM controversial Any relation between these SNPs andT2DM in the Taiwanese remains unclear Human transcrip-tion factor 7-like 2 (TCF7L2 aka TCF4) [19] is involvedin beta-catenin-dependent Wnt signaling pathway playingroles in pancreatic and intestinal endocrine cells [20 21]Polymorphism of TCF7L2 gene correlates with T2DM riskand progression in multiple ethnicities [22ndash26] Stronglyassociated variants rs12255372 and rs7903146 were citedas risk factors [27] while information about TCF7L2 andADIPOQ on T2DM risk is scant in Taiwanese populationswe researched both genes

2 Materials and Methods

21 Sample Collection We recruited 149 individuals withT2DM and 139 healthy controls as diagnosed by Dr Ming-Kai Tsai with basic characteristics of both groups summa-rized in Table 1 3mL blood samples with EDTA anticoagu-lants were collected from Kaohsiung Armed Forces GeneralHospital with informed consent Genomic DNA was isolatedfrom blood samples using the DNA isolation kit (QIAampDNA Blood Mini Kit Qiagen Valencia Germany)

22 Marker Selection and Genotyping of SNPs In ADIPOQand TCFL2 33 and 84 SNPs were reported respectively fromdbSNP database (httpwwwncbinlmnihgovSNP) SNPswere based on genetic information for the Chinese (CHB)and the Japanese (JPT) in HapMap (wwwhapmaporg)Allele-specific polymerase chain reaction (AS-PCR) analysiswas performed with allele-specific primer sets (Table 2)on genotype alleles of ADIPOQ (rs2241766 and rs1501299)and TCF7L2 (rs7903146 and rs12255372) In brief forward

primers specifically complementary to each SNP allele weredesigned and two PCR reactions were conducted in parallelto determine the allele PCR used MyCycle thermal cycler(USA) containing 125 U of Taq DNA polymerase (TaKaRa)1X PCR buffer 200 umolL dNTP 100 ng of each primer and10 ng of genomic DNA Amplification was through initialdenaturation at 94∘C for 5min 35 cycles of denaturation at94∘C for 30 s annealing at 45∘C for 30 s extension at 72∘Cfor 30 s and final extension at 72∘C for 5min PCR productswere analyzed by 2 agarose gelWe also confirmed accuracyof AS-PCR via Sanger DNA sequencing

23 Statistical Analysis Hardy-Weinberg equilibrium(HWE) was tested by online HWE program (httplinkager-ockefellereduottlinkutilhtm) [28] and allele and genotypefrequencies were examined by Fisherrsquos exact (two-tailed) testusing SPSS version 100 software (SPSS for Windows IncChicago IL) Odds ratios with 95 confidence intervals werederived for external variables with119875 valuelt005 constitutingstatistical significance Correction for multiple comparisonsused positive false discovery rate (FDR) statistics based onthe method of Benjamini and Hochberg [29] with FDRlt 005 for significant association adopted as true positiveresult Power was estimated by free power analysis programGlowastpower 31 [30]

3 Results

Two SNPs of ADIPOQ and two SNPs of TCF7L2 geneswere genotyped in T2DM patients and controls using allele-specific polymerase chain reaction analysis (Table 3) Dis-tributions of ADIPOQ and TCF7L2 genotypes are plottedin Table 4 and genotype frequencies were evaluated bychi-square test The method of Benjamini and Hochberg(threshold = 01) served to correct for multiple testing ofeach tested gene Results showed significant difference (119875 =0042) in ADIPOQ (rs1501299 (G276T)) polymorphism afterBenjamini and Hochberg correction (FDR lt 005) Yet nodifferences of genotype frequencies in ADIPOQ (rs2241766(T45G)) and TCF7L2 (rs7903146) polymorphisms weredetected Surprisingly genotypes of rs12255372 for TCF7L2were the only GG genotype appearing in both healthy andT2DM subjects that is rs12255372 is not informative amongthe Taiwanese population Genotype distributions of all SNPsdo not deviate from HWE in either T2DM patients orcontrols (data not shown)

Similar results were observed in allele frequency minorallele frequency of rs1501299 SNP in ADIPOQ being 285higher among T2DM patients compared to healthy controls(206119875 = 0028 FDRlt 005) (Table 5)Theodds ratio (OR)showed T allele of rs1501299 SNP as the risk factor for T2DMin our subjects (OR = 059 95 confidence interval (CI)001ndash024 119875 = 0032) with no difference apparent in otherpolymorphisms Collectively these results suggest geneticvariation ofADIPOQ in particular rs1501299 SNPmay have arole in prevalence of T2DMamong theTaiwanese populationWe likewise compared distribution of genotypes forADIPOQrs1501299 SNP among Taiwanese T2DM and control subjects





372 bp

226 bp


241 bp

168 bp


220 bp

176 bp


251 bp

130 bp
















T2DM 149 149 (100) 0 (0) 0 (0) NAControl 139 139 (100) 0 (0) 0 (0)






ADIPOQ G Trs1501299


TCF7L2 C Trs7903146










4 Discussion









5 Conclusions





Acknowledgments


References




























































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of




















372 bp

226 bp


241 bp

168 bp


220 bp

176 bp


251 bp

130 bp
















T2DM 149 149 (100) 0 (0) 0 (0) NAControl 139 139 (100) 0 (0) 0 (0)






ADIPOQ G Trs1501299


TCF7L2 C Trs7903146










4 Discussion









5 Conclusions





Acknowledgments


References




























































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of




















ADIPOQ G Trs1501299


TCF7L2 C Trs7903146










4 Discussion









5 Conclusions





Acknowledgments


References




























































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of




















5 Conclusions





Acknowledgments


References




























































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
































































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















research article sequence variants of and association...

Documents