research article plasma mir-126 is a potential biomarker...

Hindawi Publishing CorporationBioMed Research InternationalVolume 2013 Article ID 761617 6 pageshttpdxdoiorg1011552013761617

Research ArticlePlasma miR-126 Is a Potential Biomarker for Early Prediction ofType 2 Diabetes Mellitus in Susceptible Individuals

Tao Zhang1 Chunfang Lv1 Liling Li1 Sihan Chen2 Shenglin Liu3

Changyi Wang2 and Bing Su34567

1 Department of Laboratory Medicine Shenzhen Nanshan Center for Chronic Disease Control Shenzhen Guangdong 518054 China2Department of Control and Prevention for Chronic Non-Communicable Diseases Shenzhen Nanshan Center for Chronic DiseaseControl Shenzhen Guangdong 518054 China

3 Biomedical Research Institute Shenzhen PKU-HKUST Medical Center Shenzhen Guangdong 518036 China4 Shenzhen Key Laboratory for Translational Medicine of Dermatology Shenzhen PKU-HKUST Medical Center ShenzhenGuangdong 518036 China

5 Shenzhen Key Discipline of Dermatology Peking University Shenzhen Hospital Shenzhen Guangdong 518036 China6Department of Social and Preventive Medicine School of Public Health and Health Professions The State University of New YorkBuffalo NY 14214 USA

7Department of Cancer Genetics Roswell Park Cancer Institute Buffalo NY 14263 USA

Correspondence should be addressed to Tao Zhang taozhang315126com and Bing Su bsu2buffaloedu

Received 14 September 2013 Accepted 14 December 2013

Academic Editor Thean Hock Tang

Copyright copy 2013 Tao Zhang et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Type 2 diabetes mellitus (T2DM) is a major public health problem in China Diagnostic markers are urgently needed to identifyindividuals at risk of developing T2DMand encourage them to adapt to a healthier life style CirculatingmiRNAs present importantsources of noninvasive biomarkers of various diseases Recently a novel plasma microRNA signature was identified in T2DMHere we evaluated the T2DM-related miRNA signature in plasma of three study groups normal (fasting glucose (FG) 48ndash52mmolL) T2DM-susceptible (FG 61ndash69mmolL) and T2DM individuals (FG ge70mmolL) and tested the feasibility of usingcirculating miRNAs to identify individuals at risk of developing T2DM Among the 5 miRNAs included in the signature miR-29band miR-28-3p are not detectable miR-15a and miR-223 have comparable expression levels among three groups Notably miR-126 is the only miRNA that showed significantly reduced expression in susceptible individuals and T2DM patients compared tonormal individuals suggesting that miR-126 in circulation may serve as a potential biomarker for early identification of susceptibleindividuals to T2DM

1 Introduction

Diabetes mellitus (DM) affects more than 350 million peoplecurrently and additional 552 million people within the nexttwo decades worldwide [1] In China the prevalence ofDM has increased markedly in recent years and is nowreaching epidemic proportions [2] The Journal of AmericanMedical Association (JAMA) reported that the number ofadult diabetic patients in China has reached 1139 millionaccounting for almost one third of DM patients worldwideindicating that DM has become a major public health issuein China [3 4] The majority of the cases are attributable to

T2DM in China most likely due to major diet and life stylechanges caused by rapid economic growth These changesinclude increased nutrition and reduced physical activitieswhich promote obesity Along these lines our recent surveyshowed that T2DM occurrence in Shenzhen Guangzhouprovince increases rapidly from 47 to 62 in the past 5years and reaches an alert level (unpublished data) OverallDM is becoming a major risk factor for morbidity andmortality worldwide [5] To date the causes of DM remainunclear and a definitive cure is still not available [6] Howeverthe onset and progression of DM will be drastically delayedif preventive interventions could be implemented for highly

2 BioMed Research International

susceptible T2DM individuals before and during the initialphase of the disease The development of biomarkers forearly detection of DM will help identify individuals at riskof developing DM and greatly improve the care for theseindividuals and reduce or delay the occurrence and severityof the disease Hence the discovery of new biomarkerswould enable clinicians to tailor preventive and therapeuticapproaches and minimize the expected negative impacts ofthe disease

Noncoding RNAs (ncRNAs) are divided into two maincategories based on transcript size small ncRNAs and longnoncoding RNAs (lncRNAs) [7 8] They are emerging asimportant new regulators in cancer and other diseases [7 8]Small ncRNAs include a broad range of known and newlydiscovered RNA species many of which associate with 51015840 or31015840 regions of genes microRNAs (miRNAs) belong to this cat-egory Altered expression of miRNAs has been documentedin human diseases [9 10] prompting an increasing interestin their use as biomarkers for diagnosis and prognosis as wellas potential therapeutic targets [11ndash13] To date miRNAs havebeen widely reported in blood as potential biomarkers for thedetection of cancers [10 14] cardiovascular diseases [12 15]and kidney diseases [16]

Aberrant expression ofmiRNAs inDMhas been reportedrecently [17 18] suggesting a potential for their use asbiomarkers for disease diagnosis In this study we evalu-ated the plasma expression patterns of five T2DM-relatedmiRNAs in three study groups normal individuals (fast glu-cose (FG) 48ndash52mmolL) T2DM susceptible individuals(FG 61ndash69mmolL) and diagnosed T2DM patients (FGge70mmolL) and tested the feasibility of clinical applicationof circulating miRNAs in early prediction of T2DM insusceptible individuals

2 Materials and Methods

21 Participants In this cohort 90 Han Chinese individ-uals aged 42ndash75 years receiving routine physical examswere recruited by the Outpatient Department of Labora-tory Medicine Chronic Disease Hospital of Nanshan Dis-trict in Shenzhen China They were recruited to 3 studygroups (30 subjectsgroup) normal individuals (fasting glu-cose (FG) 48ndash52mmolL) T2DM susceptible individuals(FG 61ndash69mmolL) and diagnosed T2DM patients (FGge70mmolL) Individuals in the normal and susceptiblegroups with the following conditions were excluded from thestudy common diabetic complications such as retinopathynephropathy and cardiovascular disorders which may poselatent effect on miRNA expression Individuals who hadpreviously been diagnosed with DM or had any historyof medication for 6 months prior to the study were alsoexcluded T2DMwas diagnosed based on the combination ofseveral parameters FG level higher than 70mmolL and 2 hplasma glucose (PG) higher than 111mmolL in oral glucosetolerance test (OGTT) or diagnosed by other hospitalsWritten consents were obtained from all subjects prior tothe recruitment and the study protocol was approved by theEthics Committee of Chronic Disease Hospital of Nanshan

Table 1 Clinical characteristics of the study subjects

Characteristics Normal Susceptible DM 119875 valueSex

Male 16 9 16Female 14 21 14 gt005

Ages (yr)Mean 61 plusmn 9 62 plusmn 8 63 plusmn 856

Range 42ndash75 47ndash72 42ndash73Median 62 64 655 gt005

FG 486 plusmn 036 645 plusmn 024 108 plusmn 29 lt001

District The clinical characteristics of the subjects are listedin Table 1

22 RNA Isolation and Real-Time Quantitative RT-PCR (qRT-PCR) Peripheral blood was collected via venipuncture intotubes containing sodium EDTA centrifuged at 1000 g for5min and the plasma was carefully transferred into RNase-free tubes and stored at minus80∘C until use Total RNA contain-ing miRNAs was isolated from plasma using isothiocyanate-phenolchloroform extraction procedures cDNA synthesiswas performed with RevertAid First Strand cDNA Synthesiskit according to the manufacturerrsquos instructions (Thermo)The SYBR Premix DimerEraser kit (TaKaRa Shiga Japan)was used in real-time PCR for relative quantification ofmiRNAs with miR-238 as an internal control qRT-PCR wasperformed on a Bio-Rad CFX-96 real-time PCR system (Bio-Rad Hercules CA) The sequences of the PCR primers usedwere listed in Table 2

23 Statistical Analysis and Algorithm of Figure GenerationThe differences in the expression of plasma miRNAs amongthe groups were analyzed with Studentrsquos test concerningclinical parameters as median age and sex All statisticalanalyses were done with STATA 100 (StataCorp LP CollegeStation TX) 119875 lt 005 was considered statistically signifi-cant miRNA expression heat-map in Figure 2(a) was gen-erated by matrix2png (httpchibiubccamatrix2pngbinmatrix2pngcgi)

3 Results

31 Clinical Characteristics of Study Subjects Whenrecruited the average ages of normal individuals T2DMsusceptible individuals and diagnosed T2DM patients were61 plusmn 9 62 plusmn 8 and 63 plusmn 86 years respectively No significantdifference in age and sex distribution was found among threestudy groups (119875 gt 005) (Table 1)

32 Circulating miRNA Expression in Plasma Samples Firstwe validated the feasibility of miRNA detection in plasmasamples of three study groups Total RNA containing miR-NAs was isolated from plasma samples and quantified for thesubsequent qRT-PCR analysis No significant difference inRNA concentrations was discovered among the groups (datanot shown)

BioMed Research International 3

Table 2 Nucleotide sequences of primers for miRNA qPCR

miRNA Primer Sequence

miRNA15a RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGAC CACAAACF GGCTAGCAGCACATAATGG

miRNA29b RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGAC AACACTGF GGCTAGCACCATTTGAAATC

miRNA28-3p RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGAC TCCAGGF GCGCACTAGATTGTGAGCT

miRNA223 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGAC TGGGGTF GGCCTGTCAGTTTGTCAAA

miRNA126 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCGCATTF GCGTCGTACCGTGAGTAAT

miR238 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCTGAAF AGCCTTTGTACTCCGATGC

HasmirR R GTGCGTGTCGTGGAGTC

miR-15a

miR-28-3p

miR-223

miR-126

miR-238

Plasma 293 cells

miR-29b

Figure 1 Detection of miRNAs in plasma samples of normalT2DM-susceptible individuals and diagnosed T2DM patients aswell as 293 cells RNA was extracted from plasma samples of the 3groups and 293 cellsmiRNAswere assessed by qRT-PCR assaysThesamples with an average qRT-PCR result of Ct lt 40 were consideredas positive The qRT-PCR products were visualized by 2 agarosegel electrophoresis

Up to date only one study examined miRNA expressionin plasma samples of T2DM patients [17] From the miRNAsignature identified in the study we selected five DM-associatedmiRNAs (miR-29b miR-15a miR-28-3p miR-223and miR-126) [17] to evaluate their expression in plasmasamples of normal susceptible individuals and diabeticpatients miR-238 is used as an internal control The sampleswith a qRT-PCR result of Ct lt 40 were considered aspositive We found out that 3 out of 5 selected miRNAswere detectable in plasma from all three groups (Figure 1)However inconsistent with the reported finding [17] miR-29b andmiR-28-3pwere undetectable in any group (Figure 1)To validate the miRNA qRT-PCR assays we examined theexpression of these miRNAs in 293 cells All of the 5 miRNAs

were readily detected in 293 cells which demonstrated thereliability of the procedure and primers (Figure 1) Thereforethe failure to amplifying miR-29b and miR-28-3p couldsimply indicate their absence or very low expression levels inthe plasma samples collected

33 miR-126 Expression Was Significantly Downregulated inPlasma Samples of T2DM Susceptible Subjects and T2DMPatients Next we compared the expression of detectablemiRNAs in three groups No statistically significant differ-ence was found in the expression of miR-15a and miR-223 among the groups In contrast the expression level ofmiR-126 was significantly lower in plasma samples of thesusceptible and T2DM groups compared with the normalgroup (119875 lt 001) (Figures 2(a) and 2(b)) No significantdifference was found between miR-126 levels in plasmasamples of the susceptible and T2DM groups (Figures 2(a)and 2(b))

We further compared the expression of miR-126 in differ-ent sex and age groups No statistical difference in miR-126expression was found between male and female participants(119875 = 0517) Dividing the subjects into two age groups by themedian age (65) there was no statistical difference inmiR-126expression between these two age groups either (119875 = 0526)

34 The Association of Circulating miR-126 with FG Concen-tration To evaluate whether miR-126 expression associateswith blood glucose levels one way-ANOVA test was con-ducted The result indicated that different FG levels associatewith distinct miR-126 expression levels (119875 lt 00001)Further Bonferronirsquos multiple comparison test showed thatmiR-126 expression was significantly different between thesubjects with low and medium FG levels (48ndash52 versus 61ndash69mmolL) (119875 lt 005 95 CI of diff = 282ndash604) miR-126 expression also differed between the patients with lowand high FG levels (ge7mmolL) (119875 lt 005 95 CI of diff= 199ndash521) However no difference in miR-126 expressionwas found between patients with medium and high FG levels(119875 gt 005 95 CI of diff = minus244ndash0780) Together these


0

10

miR-15a

miR-223

miR-126

NormalT2DM Susceptible

(a)

Normal Susceptible T2DM0

500

1000

1500


500

1000

1500

2000


5

10

15

20

miR-15a miR-223 miR-126

lowast

lowast

2Δ

CT

2Δ

CT

2Δ

CT

(b)

Figure 2 Circulating levels of miR-15a miR-223 and miR-126 in plasma samples of normal T2DM-susceptible individuals and diagnosedT2DM patients qRT-PCR was performed with RNA extracted from plasma samples from 3 groups (a) The heat-map depicts the expressionof the 3 miRNAs in the 90 plasma samples (b) The graph showed that relative plasma miRNAs

results support an association between fasting glucose levelsand miR-126 expression in circulation

4 Discussion

DM affects more than 350 million people worldwide in 2011[1] The prevalence of DM in Asia has increased significantlyin recent years with a disproportionate burden in youngand middle-aged population [19] The situation is consideredespecially urgent in China because it is becoming a majorpublic health problem Despite the widely publicized reportof 97 prevalence for diabetes and 155 for prediabetes inthe 2007 survey [2] the latest epidemiologic study suggeststhat the estimated prevalence has increased to 116 fordiabetes and 501 for prediabetes [3] Unfortunately theepidemic of diabetes and prediabetes in China has shown nosign of abating [3]

Due to complex etiologywhich involves genetics diet lifestyle and environmental factorsDM is posing diagnostic andtherapeutic challenges The existing traditional biochemicalmarkers for DM including levels of glucose triacylglycerol

cholesterol lipoproteins and HbA1c may predict the devel-opment of DM a few years prior to disease manifestationHowever these biomarkers are not specific for DM andcannot be used to assess disease susceptibility in the generalpopulation Hence the discovery of new biomarkers thatcould be used to identify individuals at risk and therebyprovide early intervention to delay the development andprogression of DM is urgently needed

miRNAs belong to a class of small noncoding RNAsthat function as translational repressors by partially pairingto the 31015840 untranslated region of target mRNAs The ideaof using circulating miRNAs as biomarkers is fairly newand was first proposed for detecting various types of cancer[20] Circulating miRNAs are very stable and resistant toribonucleases freezingthawing cycles and other drasticexperimental conditions [21] Consequently serumor plasmasamples can be stored at minus20∘C or minus80∘C for several monthswithout notable degradation of miRNAs which supports theutility of miRNAs as ideal candidate biomarkers [22]

The miRNA expression profiles in serum samples of pre-diabetic Han Chinese individuals or T2DM patients haverecently been analyzed [23] The results showed increased


expression of 7 diabetes-related miRNAs (miR9 miR29amiR30d miR34a miR124a miR146a and miR375) in T2DMpatients compared with pre-diabetic or T2DM susceptibleindividuals [23] However no difference in miRNA expres-sion was observed between individuals with normal glucosetolerance and pre-diabetic individuals indicating that theseserum miRNAs cannot be used for the prediction of suscep-tibility to T2DM Zampetaki and colleagues systematicallyexamined the plasma miRNA expression profiles in patientswith T2DM by microarray screening and revealed a uniqueplasma miRNA signature for DM [17] This pioneer studydemonstrates the potential of plasma miRNAs as diagnosticand prognostic biomarkers for T2DM

In this study we focused on the expression patterns of 5diabetes-related signature miRNAs identified by Zampetakirsquosgroup and investigated the potential of using plasmamiRNAsas a noninvasive tool for blood based prediction of highlysusceptible individuals to develop T2DM We present novelfindings that plasma miR-126 level is significantly lower insusceptible individuals and established T2DM patients incomparison to normal individuals and the decreased miR-126 level is inversely associated with the development of DMInterestingly miR-126 expression is not associated with thesex and age of patients Together our results support miR-126 as a potential independent risk factor and diagnosticbiomarker of susceptible individuals to developing T2DMCompared to the existing traditional biochemical markersour proposed miR-126 is more specific to DM and maybe able to facilitate early identification of DM risk sinceits expression level is significantly lower even in the DMsusceptible individuals miRNAs are also more stable andless likely to be affected by diet and physical activities beforethe blood sample collection Even though DM is affectedby multiple complex factors such as genetics environmentdiet and life style undoubtedly genetic factor contributesthe most to its occurrence Hence the identification ofgenetic markers such as miRNAs will yield new and reliableapproaches to prevent DM through early identification ofindividuals at risk

In conclusionwe have shown thatmiR-126 is significantlyreduced in plasma samples of T2DM susceptible individualsand T2DM patients These findings suggest that detectionof circulating miR-126 can be developed into a noninvasiveand rapid diagnostic tool for the prediction of susceptibleindividuals to developing T2DM Furthermore screening alarge cohort of plasma samples of susceptible subjects willfurther determine the usefulness of miR-126 expression as apotential pre-DM biomarker

Conflict of Interests

The authors declare that they have no conflict of interests

Acknowledgment

The study was supported by the Research Grants of ShenzhenScience and Technology Project (no 201203231)

References

[1] D R Whiting L Guariguata C Weil and J Shaw ldquoIDFDiabetes Atlas global estimates of the prevalence of diabetes for2011 and 2030rdquo Diabetes Research and Clinical Practice vol 94no 3 pp 311ndash321 2011

[2] W Yang J Lu JWeng et al ldquoPrevalence of diabetes amongmenand women in Chinardquo The New England Journal of Medicinevol 362 no 12 pp 1090ndash1101 2010

[3] Y Xu L Wang J He et al ldquoChina noncommunicable diseasesurveillance prevalence and control of diabetes in Chineseadultsrdquo Journal of the American Medical Association vol 310pp 948ndash959 2013

[4] R C Ma and J C Chan ldquoType 2 diabetes in East Asianssimilarities and differences with populations in Europe and theUnited Statesrdquo Annals of the New York Academy of Sciences vol1281 pp 64ndash91 2013

[5] G Roglic and N Unwin ldquoMortality attributable to diabetesestimates for the year 2010rdquo Diabetes Research and ClinicalPractice vol 87 no 1 pp 15ndash19 2010

[6] A American Diabetes ldquoDiagnosis and classification of diabetesmellitusrdquo Diabetes Care vol 33 supplement 1 pp 62ndash69 2010

[7] C A Brosnan and O Voinnet ldquoThe long and the short ofnoncoding RNAsrdquo Current Opinion in Cell Biology vol 21 no3 pp 416ndash425 2009

[8] J S Mattick ldquoNon-coding RNAs the architects of eukaryoticcomplexityrdquo EMBO Reports vol 2 no 11 pp 986ndash991 2001

[9] J R Prensner and A M Chinnaiyan ldquoThe emergence oflncRNAs in cancer biologyrdquo Cancer Discovery vol 1 pp 391ndash407 2011

[10] M Redova J Sana and O Slaby ldquoCirculating miRNAs as newblood-based biomarkers for solid cancersrdquo Future Oncologyvol 9 pp 387ndash402 2013

[11] YM Pers andC Jorgensen ldquoMicroRNA in 2012 biotherapeuticpotential of microRNAs in rheumatic diseases Nature reviewsrdquoRheumatology vol 9 pp 76ndash78 2013

[12] D Quiat and E N Olson ldquoMicroRNAs in cardiovascular dis-ease from pathogenesis to prevention and treatmentrdquo Journalof Clinical Investigation vol 123 pp 11ndash18 2013

[13] C Guay and R Regazzi ldquoCirculating microRNAs as novelbiomarkers for diabetes mellitus Nature reviewsrdquo Endocrinol-ogy vol 9 pp 513ndash521 2013

[14] A Allegra A Alonci S Campo et al ldquoCirculating microRNAsnew biomarkers in diagnosis prognosis and treatment of cancer(review)rdquo International Journal of Oncology vol 41 pp 1897ndash1912 2012

[15] E E Creemers A J Tijsen and Y M Pinto ldquoCirculatingMicroRNAs novel biomarkers and extracellular communica-tors in cardiovascular diseaserdquo Circulation Research vol 110no 3 pp 483ndash495 2012

[16] S Saal and S J Harvey ldquoMicroRNAs and the kidney coming ofagerdquo Current Opinion in Nephrology and Hypertension vol 18no 4 pp 317ndash323 2009

[17] A Zampetaki S Kiechl I Drozdov et al ldquoPlasma MicroRNAprofiling reveals loss of endothelial MiR-126 and other MicroR-NAs in type 2 diabetesrdquo Circulation Research vol 107 no 6 pp810ndash817 2010

[18] C Zhao J Dong T Jiang et al ldquoEarly second-trimester serummiRNA profiling predicts gestational diabetes mellitusrdquo PLoSONE vol 6 no 8 Article ID e23925 2011


[19] J C N Chan V Malik W Jia et al ldquoDiabetes in Asiaepidemiology risk factors and pathophysiologyrdquo Journal of theAmerican Medical Association vol 301 no 20 pp 2129ndash21402009

[20] N Kosaka H Iguchi and T Ochiya ldquoCirculating microRNA inbody fluid a new potential biomarker for cancer diagnosis andprognosisrdquo Cancer Science vol 101 no 10 pp 2087ndash2092 2010

[21] E M Kroh R K Parkin P S Mitchell and M TewarildquoAnalysis of circulating microRNA biomarkers in plasma andserum using quantitative reverse transcription-PCR (qRT-PCR)rdquoMethods vol 50 no 4 pp 298ndash301 2010

[22] MMraz KMalinova J Mayer and S Pospisilova ldquoMicroRNAisolation and stability in stored RNA samplesrdquo Biochemical andBiophysical Research Communications vol 390 no 1 pp 1ndash42009

[23] L Kong J Zhu W Han et al ldquoSignificance of serum microR-NAs in pre-diabetes and newly diagnosed type 2 diabetes aclinical studyrdquo Acta Diabetologica vol 48 no 1 pp 61ndash69 2011

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014


MEDIATORSINFLAMMATION

of


Behavioural Neurology

EndocrinologyInternational Journal of



Disease Markers


BioMed Research International

OncologyJournal of



Oxidative Medicine and Cellular Longevity


PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of



Computational and Mathematical Methods in Medicine

OphthalmologyJournal of


Diabetes ResearchJournal of



Research and TreatmentAIDS


Gastroenterology Research and Practice


Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom


susceptible T2DM individuals before and during the initialphase of the disease The development of biomarkers forearly detection of DM will help identify individuals at riskof developing DM and greatly improve the care for theseindividuals and reduce or delay the occurrence and severityof the disease Hence the discovery of new biomarkerswould enable clinicians to tailor preventive and therapeuticapproaches and minimize the expected negative impacts ofthe disease

Noncoding RNAs (ncRNAs) are divided into two maincategories based on transcript size small ncRNAs and longnoncoding RNAs (lncRNAs) [7 8] They are emerging asimportant new regulators in cancer and other diseases [7 8]Small ncRNAs include a broad range of known and newlydiscovered RNA species many of which associate with 51015840 or31015840 regions of genes microRNAs (miRNAs) belong to this cat-egory Altered expression of miRNAs has been documentedin human diseases [9 10] prompting an increasing interestin their use as biomarkers for diagnosis and prognosis as wellas potential therapeutic targets [11ndash13] To date miRNAs havebeen widely reported in blood as potential biomarkers for thedetection of cancers [10 14] cardiovascular diseases [12 15]and kidney diseases [16]

Aberrant expression ofmiRNAs inDMhas been reportedrecently [17 18] suggesting a potential for their use asbiomarkers for disease diagnosis In this study we evalu-ated the plasma expression patterns of five T2DM-relatedmiRNAs in three study groups normal individuals (fast glu-cose (FG) 48ndash52mmolL) T2DM susceptible individuals(FG 61ndash69mmolL) and diagnosed T2DM patients (FGge70mmolL) and tested the feasibility of clinical applicationof circulating miRNAs in early prediction of T2DM insusceptible individuals

2 Materials and Methods

21 Participants In this cohort 90 Han Chinese individ-uals aged 42ndash75 years receiving routine physical examswere recruited by the Outpatient Department of Labora-tory Medicine Chronic Disease Hospital of Nanshan Dis-trict in Shenzhen China They were recruited to 3 studygroups (30 subjectsgroup) normal individuals (fasting glu-cose (FG) 48ndash52mmolL) T2DM susceptible individuals(FG 61ndash69mmolL) and diagnosed T2DM patients (FGge70mmolL) Individuals in the normal and susceptiblegroups with the following conditions were excluded from thestudy common diabetic complications such as retinopathynephropathy and cardiovascular disorders which may poselatent effect on miRNA expression Individuals who hadpreviously been diagnosed with DM or had any historyof medication for 6 months prior to the study were alsoexcluded T2DMwas diagnosed based on the combination ofseveral parameters FG level higher than 70mmolL and 2 hplasma glucose (PG) higher than 111mmolL in oral glucosetolerance test (OGTT) or diagnosed by other hospitalsWritten consents were obtained from all subjects prior tothe recruitment and the study protocol was approved by theEthics Committee of Chronic Disease Hospital of Nanshan

Table 1 Clinical characteristics of the study subjects

Characteristics Normal Susceptible DM 119875 valueSex

Male 16 9 16Female 14 21 14 gt005

Ages (yr)Mean 61 plusmn 9 62 plusmn 8 63 plusmn 856

Range 42ndash75 47ndash72 42ndash73Median 62 64 655 gt005

FG 486 plusmn 036 645 plusmn 024 108 plusmn 29 lt001

District The clinical characteristics of the subjects are listedin Table 1

22 RNA Isolation and Real-Time Quantitative RT-PCR (qRT-PCR) Peripheral blood was collected via venipuncture intotubes containing sodium EDTA centrifuged at 1000 g for5min and the plasma was carefully transferred into RNase-free tubes and stored at minus80∘C until use Total RNA contain-ing miRNAs was isolated from plasma using isothiocyanate-phenolchloroform extraction procedures cDNA synthesiswas performed with RevertAid First Strand cDNA Synthesiskit according to the manufacturerrsquos instructions (Thermo)The SYBR Premix DimerEraser kit (TaKaRa Shiga Japan)was used in real-time PCR for relative quantification ofmiRNAs with miR-238 as an internal control qRT-PCR wasperformed on a Bio-Rad CFX-96 real-time PCR system (Bio-Rad Hercules CA) The sequences of the PCR primers usedwere listed in Table 2

23 Statistical Analysis and Algorithm of Figure GenerationThe differences in the expression of plasma miRNAs amongthe groups were analyzed with Studentrsquos test concerningclinical parameters as median age and sex All statisticalanalyses were done with STATA 100 (StataCorp LP CollegeStation TX) 119875 lt 005 was considered statistically signifi-cant miRNA expression heat-map in Figure 2(a) was gen-erated by matrix2png (httpchibiubccamatrix2pngbinmatrix2pngcgi)

3 Results

31 Clinical Characteristics of Study Subjects Whenrecruited the average ages of normal individuals T2DMsusceptible individuals and diagnosed T2DM patients were61 plusmn 9 62 plusmn 8 and 63 plusmn 86 years respectively No significantdifference in age and sex distribution was found among threestudy groups (119875 gt 005) (Table 1)

32 Circulating miRNA Expression in Plasma Samples Firstwe validated the feasibility of miRNA detection in plasmasamples of three study groups Total RNA containing miR-NAs was isolated from plasma samples and quantified for thesubsequent qRT-PCR analysis No significant difference inRNA concentrations was discovered among the groups (datanot shown)











miR-15a

miR-28-3p

miR-223

miR-126

miR-238

Plasma 293 cells

miR-29b








0

10

miR-15a

miR-223

miR-126


(a)


500

1000

1500


500

1000

1500

2000


5

10

15

20


lowast

lowast

2Δ

CT

2Δ

CT

2Δ

CT

(b)



4 Discussion












Acknowledgment


References






























of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of


























miR-15a

miR-28-3p

miR-223

miR-126

miR-238

Plasma 293 cells

miR-29b








0

10

miR-15a

miR-223

miR-126


(a)


500

1000

1500


500

1000

1500

2000


5

10

15

20


lowast

lowast

2Δ

CT

2Δ

CT

2Δ

CT

(b)



4 Discussion












Acknowledgment


References






























of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of

















0

10

miR-15a

miR-223

miR-126


(a)


500

1000

1500


500

1000

1500

2000


5

10

15

20


lowast

lowast

2Δ

CT

2Δ

CT

2Δ

CT

(b)



4 Discussion












Acknowledgment


References






























of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of






















Acknowledgment


References






























of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of



























of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















research article plasma mir-126 is a potential biomarker...

Documents