research article molecular characterization of human...

Research ArticleMolecular Characterization of Human Rotavirus from Childrenwith Diarrhoeal Disease in Sokoto State Nigeria

B R Alkali12 A I Daneji1 A A Magaji1 L S Bilbis3 and F Bande4

1Department of Veterinary Microbiology Faculty of Veterinary Medicine Usmanu Danfodiyo University PMB 2346 Sokoto Nigeria2Department of Veterinary Microbiology Usmanu Danfodiyo University PMB 2346 Sokoto Nigeria3Department of Biochemistry Faculty of Science Usmanu Danfodiyo University Sokoto Nigeria4Department of Veterinary ServicesMinistry of Animal Health and Fisheries Development Usman Faruk Secretariate Sokoto Nigeria

Correspondence should be addressed to B R Alkali balkaliyahoocouk

Received 7 October 2015 Revised 2 January 2016 Accepted 10 January 2016

Academic Editor R Holland Cheng

Copyright copy 2016 B R Alkali et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

This study was conducted to detect and characterize prevalent human group A rotavirus strains from 200 diarrheic children inSokoto Nigeria by ELISA monoclonal antibody (Mab) serotyping and Reverse Transcription-Polymerase Chain Reaction (RT-PCR) techniques Rotavirus was detected in 255 of the children The G-serotypes observed in circulation were G4 16 (593)G1 4 (148) G2 3 (111) G3 3 (111) and G12 1 (37) The monoclonal antibody (Mab) serotyping detected G1 and G3 butdid not detect G4 and G2 serotypes The Mab typing of the G1 and G3 serotypes was consistent with the result of the RT-PCRTheVP4 genotypes detected were P[6] 3 (13) P[8] 11 (478) and the rare human P genotype (P[9]) found in 9 patients (391) Ninestrains identified with the common G and P combinations were G4 P[8] 5 (56) G4 P[6] 1 (11) G1 P[8] 2 (22) and G3 P[8] 1(11) while seven strains with unusual combinations or rare G or P genotypes identified were G12 P[8] 1 (14) G2 P[8] 2 (29)and G4 P[9] 4 (57) To our knowledge this is the first molecular study of human rotavirus and report of rare human G and Pserotypes in Sokoto State

1 Introduction

Rotavirus is a nonenveloped segmented RNA virus classifiedunder the family Reoviridae Rotavirus constitutes a majorcause of severe gastroenteritis in young children worldwide[1ndash3] Studies have shown that by the age of two yearsalmost all children stand the risk of being infected withrotavirus with children living in the industrialized countriesexperiencing their first infection at comparatively older agecompared to those in developing countries [4 5]

In sub-Saharan Africa gastroenteritis remains a majorcause of childhoodmorbidity andmortality [6] and a leadingcause of childhood illness as a result of poor economyinfrastructure and political instability [7] In a review of 43studies from 15 countries including Nigeria Cunliffe et al[4] reported that of the 25 million children born each yearin sub-Saharan Africa 43 million (about 1 in 6) dies by theage of 5 years and about 15 of these deaths (850000) are

associated with diarrhoea Among all the identified causes ofinfantile diarrhoea rotavirus has been ranked as the singlemost important pathogen associated with diarrhoea in bothhospitalized and outpatient cases In Nigeria for examplea high incidence of childhood diarrhoea is estimated toaccount for over 160 000 of all deaths in children less than5 years of age annually and approximately 20 are associatedwith rotavirus infection [8]

Although it was speculated that an effective and properlyadministered rotavirus vaccine in Africa could potentiallyprevent 170000ndash210000 deaths (about 1 in 20) annuallybased on the assumptions that 20ndash25 of all childhooddiarrhoea deaths are due to rotavirus [4] there is a lack ofinformation on the epidemiology and genetic characteristicsof the circulating human retrovirus in most of the developingnations This will be crucial to guide control and preven-tion strategies so as to ensure that rotavirus infection isreduced Thus the objectives of this study are to determine

Hindawi Publishing CorporationMolecular Biology InternationalVolume 2016 Article ID 1876065 9 pageshttpdxdoiorg10115520161876065

2 Molecular Biology International

the occurrence and molecular characteristics of humanrotavirus among children in Sokoto State Nigeria

2 Material and Methods

21 Study Area Samples were collected frommajor hospitalsin Sokoto which lies between longitude 11∘ 301015840 to 13∘ 501015840 Eastand latitude 4∘ to 61015840 North The GNP per capita in the statewas put at 320 dollars [9]

22 Sampling Method A simple random sampling methodwas adopted in the study The formula of Campbell [10] wasused to estimate the minimum of 189 samples however inorder to increase the precision and chances for the detectionof infection the samples were increased to 200

23 Sample Collection Diarrhoea samples were collectedfrom diarrheic children less than 5 years of age presentedat the study hospitals The samples were obtained followingparental consent and ethical approval from the medicalresearch ethics committee of the hospitals Diarrhoea in thisstudy was defined as the passage of more than 3 looser thannormal stools within 24 hours The stool samples were col-lected aseptically in sterile commercial bijou bottles ade-quately labeled (patient ID and date of collection) and trans-ported on ice to the Veterinary Microbiology Laboratoryof Usmanu Danfodiyo University Sokoto where they werestored at minus20∘C until being transported on ice to the NoguchiMemorial Institute for Medical Research (NMIMR) AccraGhana where they were also stored at minus20∘C until tested

24 Preparation of 10 Stool Suspension The stored stoolspecimens were retrieved after freeze thawing and a 10 stoolsuspension was prepared by pipetting 15mL of supply speci-men preparation buffer (included in the kit)

25 Detection of Rotavirus Antigen by ELISA Rotavirus anti-gens in stool samples were detected by a commercially avail-able DAKO Rotavirus ELISA kit according to the manufac-turerrsquos instructions The result was read spectrophotometri-cally in 30 minutes after stopping the reaction on MultiskanELISA reader (Multiskan Plus LabsystemsHelsinki Finland)at the reference wavelength of 450 nm

26 Sodium Dodecyl Sulphate Polyacrylamide Gel Electro-phoresis (SDS-PAGE) All ELISA positive samples (119899 = 51)were subjected to SDS-PAGE according to the techniquedescribed by Herring et al [11]

27 Reverse Transcription-Polymerase Chain Reaction (RT-PCR) TheG-typing was conducted according to themethodof Gouvea et al [12] andDas et al [13] whilst the P-typing wasconducted as described by Gentsch et al [14] The protocolsfor viral RNA extraction from the stools and the RT-PCRtyping protocols for rotavirus gene 7 (G-serotyping) and gene4 (P-genotyping) were kindly provided by Dr Gentsch of theViral Gastroenteritis Section CDC Atlanta USA

28 Monoclonal Antibody (Mab) Serotyping Mab serotypingwas carried outwithmonoclonal antibodies specific for group

A human rotavirus strains using the Mab serotyping kitaccording to Manufacturerrsquos instructions The Mab serotyp-ing kit was kindly provided by the National Institute ofHealth Atlanta Georgia USA The method employed theELISA protocol and the procedure was basically as describedby Taniguchi et al [15] with the monoclonal antibody asthe capture reagent but skim milk was used to reduce thebackground as described by Coulson et al [16]

29 VP7 and VP4 Genotyping Phenolchloroform methoddescribed by Steele and Alexander [17] was used to extractthe viral RNA from all PAGE positive specimens and thenpurified with the RNaidreg Kit (Bio 191 Carlsbad USA) Theextracted RNA was stored at minus20∘C until further use

The VP7 and VP4 genotyping was performed asdescribed by Gouvea et al [12] and Gentsch et al [14] Brieflyviral RNA was subjected to Reverse Transcription (RT) stepand Polymerase Chain Reaction (PCR) step was performedto amplify the transcribed gene Finally a seminested PCRwas performed using genotype specific primers as a mean todetermine the viral genotype (Table 1)

210 VP7 First Round Amplification The purified viral RNAwas reverse transcribed according to the method of Gouveaet al [12] Briefly 1 120583L each of the specific primer pair(sBeg9End9) was added to 8 120583L of previously extracteddsRNA and put in a 500 120583L PCR tube The solution washeated for 5 minutes at 94∘C to denature the dsRNA andchilled immediately in an ice bath for 2 minutes Thedenatured dsRNAs were then reverse transcribed by adding32 120583L of master mix (02 120583L of 10mM dATP 02 120583L of 10mMdCTP 02 120583Lof 10mMdGTP 02 120583Lof 10mMdTTP 04 120583Lofavianmyeloblastosis (AMV) reverse transcriptase and 20120583Lof 5x AMV buffer) and incubated for 20 minutes at 42∘Cin a water bath The cDNA was then amplified by PCR ina 40 120583L reaction mixture containing 1 120583L of 10mM dATP1 120583L of 10mM dCTP 1 120583L of 10mM dGTP 1 120583L of 10mMdTTP 4 120583L of 10x Taq buffer 24 120583L of 25mM MgC1

2 30 120583L

of double distilled water and 03 120583L Taq polymerase prior touse No template control (NTC) included negative controlThirty cycles of PCR (1 minute denaturing at 94∘C 2 minutesannealing at 42∘C and 3 minutes extension at 72∘C) and afinal extension cycle at 72∘C for 7 minutes was performed ona Gene AMP PCR Primus 25 System machine The amplifiedsamples were analysed onto 2 agarose (SEAKEMUSA) andvisualised on the GelDOC system

211 VP7 Second Round Amplification A second round Poly-merase Chain Reaction was carried out to determine thegenotype of the rotavirus strains Briefly 1 120583L of the firstround reaction products was added to 40 120583L PCR-MM con-taining 1 120583L of each of six serotype-specific primers (aBT-1 aCT-2 aET-3 aDT-4 aAT-8 and aFT-9) and the primerRVG9 1 120583L of 10mM dATP 1 120583L of 10mM dCTP 1 120583L of10mM dGTP 1120583L of 10mM dTTP 4 120583L of 10x Taq buffer24 120583L of 25mM MgCl

2 30 120583L of ddH

2O and 03 120583L of Taq

polymerase and PCR performed according to the conditionstated above The amplified products were analysed on 2agarose gel and the genotype determined based on the sizeof the resultant amplicon

Molecular Biology International 3

Table 1 List of VP7 primers used for VP7 (G) genotyping

Primer designation Sequences (51015840-31015840) Region amplified Amplicon sizeBeg9 GGCTTTAAAAGAGAGAATTTCCGTCTGG 1ndash29End9 GGTACACATCATACAATTCTAATCTAAG 1062ndash1036RVG9 GGTACATCATACAATTCT 1062ndash1044aAT8-69M (G8) GTCACACCATTTGTAAATTCG 178ndash198 885 bpaBT1-Wa (G1) CAAGTACTCAAATCAATGATGG 314ndash335 749 bpaCT2-DS-1 (G2) CAATGATATTAACACATTTTCTGTG 411ndash435 652 bpaDT4-ST-3 (G4) CGTTTCTGGTGAGGAGTTG 480ndash498 583 bpaET3-P (G3) CGTTTGAAGAAGTTGCAACAG 689ndash709 374 bpaFT9-W161 (G9) CTAGATGTAACTACAACTAC 757ndash776 306 bpG10-(G10) ATGTCAGACTACARATACTGG 666ndash687 397 bpG12-(G12) CCGATGGACGTAACGTTGTA 548ndash567 515 bpSource Noguchi Memorial Institute for Medical Research (NMIMR)

Table 2 Primers used for VP4 genotyping of human rotavirus

Primer designation Sequence (51015840-31015840) Nucleotide position GenotypeCon2 ATTTCGGACCATTTATAACC 868ndash887 mdashCon3 TGGCTTCGCTCATTTATAGACA 11ndash32 mdash1-TI-KU ACTTGGATAACGTGC 336ndash356 P[8]2T-1 CTATTGTTAGAGGTTAGAGTC 474ndash494 P[4]3T-1 TGTTGATTAGTTGGATTCAA 259ndash278 P[6]4T-1 TGAGACATGCAATTGGAC 385ndash402 P[9]5T-1 ATCATAGTTAGTAGTCGG 575ndash594 P[10]Source Noguchi Memorial Institute for Medical Research (NMIMR)

212 VP4 (VP8lowast) Genotyping

Step 1 RT-PCR of the VP4 gene used terminal primers Con2and Con3

Step 2 Genotyping of VP4 gene of human rotaviruses useda cocktail of Gentsch primers Con3 + [1T-1 2T-1 3T-1 4T-1 and 5T-1] to determine genotypes P[8] P[4] P[6] P[9]and P[10] respectively (Table 2) Amplification for both setsof primers was carried out by initial denaturation at 94∘Cfor 2mins denaturation at 94∘C for 1 minute annealing at42∘C for 2 minutes extension at 72∘C for 5 minutes and finalextension at 72∘C for 7 minutes 30 cycles of repetitions werecarried out

213 VP4 First Round Amplification The RT-PCR typingmethod used for P-typing was similar to that used for G-typingHowever different primer pairswere used instead ForP-typing the consensus primers usedwere Con2 andCon3 asdescribed byGentsch et al [14]ThePRCconditionswere alsoas described for G-typing

214 VP4 Second Round Amplification A second roundPolymerase Chain Reaction to determine the P-types of therotavirus strains was similarly performed using 5 P genotype-specific primers (1-T1 2T-1 3T-1 4T-1 5T-1) and the primerCon3 The PCR amplification was then performed according

Table 3 Primers and expected band sizes for GP-types on gelprimers

Genotype(G-types)

Ampliconsize (bp) Gentsch Cocktail + Con3 [P-type] Size

(bp)G1 749 P[4] 483G2 625 P[6] 267G3 374 P[8] 345G4 583 P[9] 391G8 885 P[10] 594G9 306G10 397G12 512Beg9End9 1062Source Noguchi Memorial Institute for Medical Research (NMIMR)

to the conditions earlier stated for G-typing The amplifiedproducts were analysed on 2 agarose gel and the genotypedetermined from the size of the amplicons

215 Interpretation of RT-PCR Genotyping for HumanRotavirus Table 3 provides the expected band sizes ofdifferent G- and P-types used as a criteria for interpretationof human rotavirus G- and P-types results based on theprimer types used (Table 3)


Table 4 PAGE distribution of electropherotypes of humanrotavirus strains in Sokoto

Electropherotypes Total Percentage ()Long 29 763Short 9 237Total 38 100

Short

Long

Figure 1 Representative electrophoretic patterns of human stoolspecimens analysed by PAGE with their short and long electro-pherotypes

3 Result

31 Rate of Rotavirus Detection among Children in SokotoNigeria Out of the 200 human diarrhoea stools examinedby ELISA rotavirus was detected in 51 of the samples thusindicating a prevalence of 255

32 Polyacrylamide Gel Electrophoresis (PAGE) Of the 51human ELISA positive samples tested by PAGE 38 (745)yielded electrophoretic patterns typical of rotavirus 29 of therotavirus strains (763) had classical long rotavirus RNAelectrophoretic patterns and 9 (237) exhibited classicalshort RNA profile as shown in (Table 4) The representativeof human electrophoretic patterns of rotavirus strains fromrotavirus strains from the SDS-PAGE results is shown inFigure 1

33 Rotavirus VP7 Genotype Analysis

331 Rotavirus VP7 and VP4 Genotype Analysis Of the 38PAGE positive samples further subjected to PCR genotypingmethod first round RT-PCR revealed a total of twenty-nine (763) positives for VP7 genotype Following secondround amplification 27 (711) of the rotavirus isolates weresuccessfully assigned aVP7 (G-type) specificity (Figure 2(a))while 11 (289) of the isolates were nontypeable SimilarlyVP4 genotyping of the 38 PAGE positive samples afterfirst round amplification showed 27 (711) positives forVP4 genotype However only 23 (605) samples producedsecond round PCR products that could be assigned a VP4genotype (Figure 2(b))

(a)

(b)

Figure 2 Illustration of VP7 andVP4 genotype on agarose gel Lane1 (from left to right) shows 1 kb Plus DNA Marker The Gel Picturewas divided into two (a) was for VP7 samples and (b) was for VP4samples (PCR) Lane l labeled ldquoMrdquo is for the molecular marker orLadder The last lane labeled ldquoNCrdquo contained the negative control

G12

G4

G3

G2

G1

4

59

15

11

11

Figure 3 Predominant G genotypes circulating in Sokotometropo-lis

34 Predominant V7-Genotypes Circulating in Sokoto Fivedifferent rotavirus VP7 genotypes including the rare humanrotavirus G genotype (G12) were detected The five predom-inant genotypes observed in circulation were sixteen G4(593) four G1 (148) three G2 (111) three G3 (111)and one G12 (37) (Figure 3) G1 G2 and G3 are bothcommon human G-types while the G12 is a rare humanG-type The rare G-serotype could be animal rotavirusstrains that accidently infected human or reassortant virusesbetween animal and human rotavirus generated in nature

35 Analysis of Electrophoretic Profiles of VP7 Genotypes Thedistribution of VP7 serotypes according to electrophoreticprofile of the isolates is summarized in Table 5 Twenty-nine samples exhibited classical long RNA electrophoreticprofile on PAGE and 22 (759) were typed and assigned toparticular G-types while 7 (241) could not be assigned anyVP7 genotype Thirteen (591) of these were typed as G4three (136) as G1 three (136) as G2 two (91) as G3


Table 5 Distribution of VP7 serotypes according to electrophoretic profile

VP7serotype

Number ofVP7

serotypesLong electropherotype Short electropherotype Long electropherotype Short electropherotype

G1 4 3 1 136 20

G2 3 3 0 136 0

G3 3 2 1 91 20

G4 16 13 3 591 60

G12 1 1 0 45 0

Total 27 22 5 999 100

and one (45) as G12 Nine samples exhibited classical shortRNA electrophoretic profile on PAGE and 5 (556) weretyped and assigned to particular G-types while 4 (444)could not be assigned any VP7 genotype Of the 5 that weretyped three (60) were typed as G4 one as G3 (20) andone (20) as G1

36 Monoclonal Antibody Serotyping The monoclonal anti-body serotyping detected G1 and G3 with consistency bothon visual examination and spectrophotometrically The ODvalues of the assigned serotypes were twice greater than thevalues obtained from the samples with the same Mab TheMab typing of the G1 and G3 serotypes was consistent withthe result of the RT-PCR serotyping of these types

37 VP4 Genotype Analysis The VP4 genotypes detectedduring the study included two of the recognized humanrotavirus VP4 gene alleles P[6] and P[8] and a rare humanP[9]Themost predominant P4 genotype was P[8] 11 (478)followed by P[9] 9 (391) and P[6] 3 (13) and none of thestrains was carrying a P[4] VP4 gene (Figure 4) The datashowed a high percentage of rare P genotype P[9] whichis considered as an indication of either animal rotavirusstrains that accidently infected human or reassortant virusesbetween animal and human rotavirus generated in nature

38 Occurrence of G and P Genotypes Combinations amongChildren in Sokoto Four distinct strains were identified withthe common G and P combinations being strains bearing thegenotype G4 P[8] (56) G4 P[6] (11) G1 P[8] (22) andG3 P[8] (11) (Figure 5)

Similarly three distinct strains with unusual combina-tions or rare G or P genotypes were observed these includedG12 P[8] (14) G2 P[8] (29) and G4 P[9] (57) assummarized in Figure 6

4 Discussions

Rotavirus has been identified to be the single most importantpathogen associated with diarrhoea cases in both hospitalpatients and outpatients [4 18] In this study 51 (255)out of the 200 diarrhoeic children tested were found to bepositive for rotavirus while 149200 (745) tested negative

11

3

9

39

13

48P[8]

P[6]

P[9]

Figure 4 Predominant P genotypes circulating in Sokoto Nigeria

G4 P[8]

G4 P[8] 5 56

G4 P[6]G1 P[8]G3 P[8]

G4 P[6] 1 11

G1 P[8] 2 22

G3 P[8] 1 11

Figure 5 Four common GP-types combinations circulating inSokoto metropolis


14

29

57

G2 P[8]

G12 P[8]

G2 P[8]G4 P[9]G12 P[8]

G4 P[9]

Figure 6 Three uncommon GP-types combinations circulating inSokoto metropolis

for rotavirus Thus the prevalence of rotavirus diarrheaaccounted for 255 of diarrhea cases among childrenyounger than five years presented to hospitals in Sokotometropolis The result of this study is consistent with thesentinel based rotavirus surveillance system and hospitalbased study results within the African region [19]

Interestingly earlier studies carried out in different partsof the northern Nigeria reported low prevalence The reportof Pennap and Umoh [20] showed rotavirus infection preva-lence of 156 among children 0ndash60 months old that werepresented with diarrhea in northeastern Nigeria Aminu etal [21] similarly reported rotavirus prevalence of 18 amongdiarrheic children and 72 among nondiarrheic children ina hospital setting in northernNigeria and prevalence of 9 inchildren under five years of age in a community based studyin the same region Similarly other investigators reportedlower prevalence of the infection in the northern region[22] The low prevalence reported in the community basedstudy is expected as higher prevalence of rotavirus infectionmore likely to be encountered in hospital based studies sincerotavirus positive cases are often severe and likely representedin hospitals [23] However generally studies from southernNigeria had shown higher rotavirus prevalence values thanthose from northern Nigeria [24ndash27] The differences inthe prevalence recorded by different investigators had beenattributed to differences in time of sample collection methodof screening samples geographical location of the study orchanging trends of the burden of the rotavirus disease overthe years [28]

The possibility of direct transmission of animal rotavirusto human host and the uncommon serotypes detected in thisstudy may explain the high prevalence of the disease amongchildren with often contact with animals

The analysis of electropherotypes of rotavirus isolatesprovides information on genetic diversity of the virus andheterogeneity of circulating strains and can be useful intracing spread through a population Indeed viruses of thesame serotype could exhibit different electropherotypes andthose of the same electropherotypes different serotypes [29]In this study analyses using PAGE showed that of the 51human ELISA positive samples tested by PAGE 38 (745)yielded electrophoretic patterns typical of rotavirus while 13showed no profile Of the 38 rotavirus strains that yieldedRNA profile 29 (763) had classical long rotavirus RNAelectrophoretic patterns and 9 (237) exhibited classicalshort RNA profile The inconsistency between ELISA resultsand PAGE results might be as a result of RNA degradationin which case strains will not yield RNA profile on PAGEThe absence of RNA bands had also been attributed to toolittle RNA or its degradation during the phenolchloroformextraction stage [30] Strains with long RNA profiles were themost prevalent strains in circulation in the study area This isin consonant with the study of Aminu et al [21] Interestinglyhowever there were no unusual electropherotypes even inthe samples containing the G12 strains This observation wassimilar to that of Adah et al [22]

The RT-PCRVP7 serotyping results revealed that twenty-seven (711) of the rotavirus isolates were successfullyassigned a VP7 (G-type) specificity While 11 (289) of theisolates were nontypeable It was likely that the nontypeablestrains did not contain enough RNA to permit typing similarto the observation of Adah et al [22] It may also be asa result of the existence of serotypes which the serotype-specific primers used in the study could not detect

The monoclonal antibody serotyping detected G1 andG3 with consistency both on visual examination and spec-trophotometrically But no other G-serotype was typed usingMab apart from the two serotypes (G1 and G3) The ODvalue recorded against each of these two serotypes with thespecific Mab was consistently more than twice than what wasrecorded in the reaction of other samples with the sameMabThe Mab typing of the G1 and G3 serotypes was consistentwith the result of the RT-PCR serotyping of these types

Previous studies had shown that themost common globalhuman G-serotypes were G1 G2 G3 G4 and G9 with G1being most prevalent and G9 the fastest emerging genotypeworldwide [31ndash33] In this study five different rotavirus VP7serotypes including the rare human rotavirus G-serotype(G12) were detected The predominant serotypes observedin circulation in this study were sixteen G4 (593) fourG1 (148) three G2 (111) three G3 (111) and one G12(37) In earlier studies reported by Adah et al [22] andPennap et al [30] no G2 or G4 serotypes were detectedhowever Aminu et al [21] had recently reported the detectionof G2 serotypes in northern Nigeria The absence of G9serotype in this study could be a result of genetic shift sinceG9 serotype was previously reported in Northern region ofthe country [21 22]


Interestingly we detected a rare G12 serotype detectedin a single infection This is consistent with the studiesreported in Thailand [34] and India [35] Although G12rotaviruses were first identified in the Philippines in 1987 itemerged over the past few years in numerous countries [36]with the first incidence in Africa reported in JohannesburgSouth Africa [37] Indeed the detection of G12 serotypemay suggest either accidental human infection by animalrotavirus strains or reassortant viruses between animal andhuman rotavirus generated in nature Already rotavirus genereassortment between human and bovine strains has beenreported previously [22]

The results of VP4 genotyping revealed that theVP4 genotypes detected during the study included twoof the recognized human rotavirus VP4 gene alleles P[6]and P[8] and a rare human P genotype (P[9]) The mostpredominant P-type detected in this study was P[8] 11(478) followed by P[9] 9 (391) and P[6] 3 (13) Thepredominance of P[8] strains in this study agreed with theworldwide distribution of this genotype as epidemiologicalstudies had shown P[8] strains to be the most commonlyidentified worldwide [38 39] It is noted that similar tothe result of the study conducted in Nigeria by of Adah etal [22] none of the strains carrying P[4] VP4 gene wasfound However in disagreement with the work of Adahet al [22] in which P[6] was reported as the predominanttype and P[8] as the second most common type P[6] strainswere the least detected in this study and P[8] was the mostpredominant In fact P[6] genotype was previously thoughtto be associated with neonatal rotavirus strains and hencethought to be associated with asymptomatic infection [40]But in this study it was associated with symptomatic diarrheasimilar to what was observed in earlier studies conductedin Cameroon [41] Nigeria [21 22] and Ghana [42] Thisimplies that this genotype is now becoming more associatedwith symptomatic diarrhea In fact rotavirus with VP4P[6] genotype was the only genotype detected in the studyconducted by Aminu et al [21]

The prevalence of human rotaviruses with P[9] had beenshown to be low For example in the surveys which detectedP[9] strains only 02 of 1316 rotaviruses between 1996 and1999 in the United States [43] and 38 of 282 rotavirusesbetween 1991 and 1994 in Israel were of this P[9] specificityFurthermore all the strains with P[9] specificity had beenassociated with G3 or G1 specificity [44 45] Thereforethe high percentage of this genotype (P[9]) detected inthis study is considered as an indication of either animalrotavirus strains that accidently infected human or reassor-tant viruses between animal and human rotavirus generatedin nature

Studies in many countries have shown that G1 P[8] G2P[4] G3 P[8] and G2 P[6] are the G-P combinations mostcommonly found worldwide [38 39 46] In this study ninedistinct strains were identified with the common G and Pcombinations bearing the combination G4 P[8] (56) G4P[6] (11) G1 P[8] (22) and G3 P[8] (11) Similarly sevendistinct strains with unusual combinations or rare G or Pgenotypes were observedThesewereG12 P[8] (14) G2 P[8](29) and G4 P[9] (57)

Numerous studies had reported an unexpectedly highdiversity of rotavirus strains in most developing and devel-oped countries including Nigeria [34 39 42 47ndash54]

This had been attributed to natural reassortment whichappears to be detected more frequently in developing coun-tries than in developed world owing to low levels of hygieneand poor immunological defence in infants which facilitatemixed infections and hence more reassortment In additionmore close contact among humans livestock and otheranimals in developing countries makes the possibility ofemergence of virulent rotavirus strains very high as a resultof gene reassortment [55] Apart from gene reassortmentinterspecies transmissions of rotaviruses involving a wholegenome constellation evidenced by molecular characteriza-tion of rotaviruses isolated from different species have beensuggested [3]

Indeed studies had indicated that uncommon humanrotavirus strains are emerging as global strains which hasimportant implications for effective vaccine development[4 56] The detection of unusual GP combinations in thepresent study adds to this pool of information and furtherconfirms the emergence of these unusual strains

5 Conclusions

The study reported a high prevalence of rotavirus infectionamong diarrheic children attending health care in SokotoState Nigeria Both common uncommon and combinationsof various genotypes were identified as revealed by theirelectrophoresis pattern based on the VP4 and VP7 geneOverall this study contributed to the global understanding ofthe molecular epidemiology of human rotavirus which willbe useful in guiding the choice and application of rotavirusvaccines for effective control and preventions

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors would like to acknowledge all the participatinghospitals the Ministry of Health Sokoto Nigeria and theNoguchi Memorial Institute for Medical Research (NMIMR)Accra Ghana

References

[1] A Z Kapikian and R M Chanock ldquoRotavirusesrdquo in FieldsVirology B N Fields DM Knipe PM Howley et al Eds vol2 pp 1657ndash1708 Lippincostt-Raven Philadelphia Pa USA 3rdedition 1996

[2] V Martella N Decaro A Pratelli M Tempesta and CBuonavoglia ldquoVariation of rotavirus antigenic specificity ina dairy herd over a long-term surveyrdquo in Genomic Diversityand Molecular Epidemiology of Rotaviruses N Kobayashi EdResearch Signpost Trivandrum India 2003


[3] E A Palombo ldquoGenomic diversity and interspecies transmis-sion of rotavirusesrdquo in Genomic Diversity and Molecular Epi-demiology of Rotaviruses N Kobayashi Ed Research SignpostTrivandrum India 2003

[4] N A Cunliffe P E Kilgore J S Bresee et al ldquoEpidemiologyof rotavirus diarrhoea in Africa a review to assess the needfor rotavirus immunizationrdquo Bulletin of the World HealthOrganization vol 76 no 5 pp 525ndash537 1998

[5] J S Bresee R I Glass B Ivanoff and J R Gentsch ldquoCurrentstatus and future priorities for rotavirus vaccine developmentevaluation and implementation in developing countriesrdquo Vac-cine vol 17 no 18 pp 2207ndash2222 1999

[6] C Bern JMartines I de Zoysa andR I Glass ldquoThemagnitudeof the global problem of diarrhoeal disease a ten-year updaterdquoBulletin of theWorldHealthOrganization vol 70 no 6 pp 705ndash714 1992

[7] H Davidson S Jonathon T Donald and G T Keusch ldquoChild-hood Diarrhoea in sub-Saharan Africa child health researchproject Special projectrdquo in The Global Burden of Disease 1996C J C Murray and A D Lopez Eds vol 2 no1 WHO 1998

[8] U D Parashar E G Hummelmar J S Bresee M A Millerand R I Glass ldquoGlobal illness and deaths caused by rotavirusdisease in childrenrdquo Emerging Infectious Diseases vol 9 no 5pp 565ndash572 2003

[9] World Bank ldquoNigeria at a glance World Health Organization(2008) global networks for surveillance of rotavirus gastroen-teritis 2001ndash2008rdquo Weekly Epidemiological Report vol 83 no47 pp 421ndash425 2003

[10] M J Campbell Statistics at Square One Edited by T D VSwinscow University of Southampton BMJ Publishing Group9th edition 1997

[11] A J Herring N F Inglis C K Ojeh D R Snodgrass and JD Menzies ldquoRapid diagnosis of rotavirus infection by directdetection of viral nucleic acid in silver-stained polyacrylamidegelsrdquo Journal of Clinical Microbiology vol 16 no 3 pp 473ndash4771982

[12] V Gouvea R I Glass P Woods et al ldquoPolymerase chainreaction amplification and typing of rotavirus nucleic acid fromstool specimensrdquo Journal of Clinical Microbiology vol 28 pp270ndash282 1990

[13] B K Das J R Gentsch H G Cicirello et al ldquoCharacterizationof rotavirus strains fromnewborns inNewDelhi Indiardquo Journalof Clinical Microbiology vol 32 no 7 pp 1820ndash1822 1994

[14] J R Gentsch R I Glass PWoods et al ldquoIdentification of groupA rotavirus gene 4 types by polymerase chain reactionrdquo Journalof Clinical Microbiology vol 30 no 6 pp 1365ndash1373 1992

[15] K Taniguchi T Urasawa Y Morita H B Greenberg and SUrasawa ldquoDirect serotyping of human rotavirus in stools byan enzyme-linked immunosorbent assay using serotype 1- 2- 3- and 4-specific monoclonal antibodies to VP7rdquo Journal ofInfectious Diseases vol 155 no 6 pp 1159ndash1166 1987

[16] B S Coulson L E Unicomb G A Pitson and R F BishopldquoSimple and specific enzyme immunoassay using monoclonalantibodies for serotyping human rotavirusesrdquo Journal of ClinicalMicrobiology vol 25 no 3 pp 509ndash515 1987

[17] A D Steele and J J Alexander ldquoMolecular epidemiology ofrotavirus in black infants in South Africardquo Journal of ClinicalMicrobiology vol 25 no 12 pp 2384ndash2387 1987

[18] B R Alkali A I Daneji A A Magaji and L S Bilbis ldquoClinicalsymptoms of human rotavirus infection observed in childrenin Sokoto Nigeriardquo Advances in Virology vol 2015 Article ID890957 6 pages 2015

[19] WHO ldquoGlobal networks for surveillance of rotavirus gastroen-teritis 2001ndash2008rdquoWeekly Epidemiological Report vol 83 no 47pp 421ndash425 2008

[20] G Pennap and J Umoh ldquoThe prevalence of group A rotavirusinfection and some risk factors in pediatric diarrhea inZaria North central Nigeriardquo African Journal of MicrobiologyResearch vol 4 no 14 pp 1532ndash1536 2010

[21] M Aminu A A Ahmad J U Umoh J Dewar M D EsonaandA D Steele ldquoEpidemiology of rotavirus infection inNorth-westernNigeriardquo Journal of Tropical Pediatrics vol 54 no 5 pp340ndash342 2008

[22] M I Adah A Rohwedder O D Olaleye O A Durojaiyeand H Werchau ldquoFurther characterization of field strainsof rotavirus from Nigeria VP4 genotype P6 most frequentlyidentified among symptomatically infected childrenrdquo Journal ofTropical Pediatrics vol 43 no 5 pp 267ndash274 1997

[23] I Banerjee S Ramani B Primrose et al ldquoComparative study ofthe epidemiology of rotavirus in children from a community-based birth cohort and a hospital in South Indiardquo Journal ofClinical Microbiology vol 44 no 7 pp 2468ndash2474 2006

[24] P O Abiodun and A Omoigberale ldquoPrevalence of nosocomialrotavirus infection in hospitalized children in Benin CityNigeriardquo Annals of Tropical Paediatrics vol 14 no 1 pp 85ndash881994

[25] O O Omotade O D Olayele C O Oyejide R M Avery APawley and A P Shelton ldquoRotavirus serotypes and subgroupsin gastroenteritisrdquoNigeria Journal of Pediatrics vol 22 pp 11ndash171995

[26] R Audu S A Omilabu I Peenze and D Steele ldquoViral diar-rhoea in young children in two districts in Nigeriardquo CentralAfrican Journal of Medicine vol 48 no 5-6 pp 59ndash63 2002

[27] M S Odimayo W I Olanrewaju S A Omilabu and BAdegboro ldquoPrevalence of rotavirus-induced diarrhea amongchildren under 5 years in Ilorin Nigeriardquo Journal of TropicalPediatrics vol 54 no 5 pp 343ndash346 2008

[28] CDC ldquoRotavirus surveillancemdashworldwide 2001ndash2008rdquo Mor-bidity and Mortality Weekly Report vol 57 pp 1255ndash1257 2008

[29] A Z Kapikian Y Hoshino and R M Chanock ldquoRotavirusesrdquoin Virology B N Fields D M Knippe and P M HowleyEds vol 2 pp 1787ndash1833 Lippincott Williams amp WilkinsPhiladelphia Pa USA 4th edition 2001

[30] G Pennap I Peenze M de Beer et al ldquoVP6 subgroup andVP7 serotype of human rotavirus in Zaria Northern NigeriardquoJournal of Tropical Pediatrics vol 46 no 6 pp 344ndash347 2000

[31] C Kirkwood N Bogdanovic-Sakran E Palombo et alldquoGenetic and antigenic characterization of rotavirus serotypeG9 strains isolated in Australia between 1997 and 2001rdquo Journalof Clinical Microbiology vol 41 no 8 pp 3649ndash3654 2003

[32] A R Laird J R Gentsch T Nakagomi O Nakagomi andR I Glass ldquoCharacterization of serotype G9 rotavirus strainsisolated in the United States and India from 1993 to 2001rdquoJournal of Clinical Microbiology vol 41 no 7 pp 3100ndash31112003

[33] Y Zhou L Li S Okitsu N Maneekarn and H Ushijima ldquoDis-tribution of human rotaviruses especially G9 strains in Japanfrom 1996 to 2000rdquo Microbiology and Immunology vol 47 no8 pp 591ndash599 2003

[34] Y Pongsuwanna R Guntapong M Chiwakul et al ldquoDetectionof a human rotavirus with G12 and P[9] specificity inThailandrdquoJournal of Clinical Microbiology vol 40 no 4 pp 1390ndash13942002


[35] S Das V Varghese S Chaudhury et al ldquoEmergence of novelhuman group A rotavirus G12 strains in Indiardquo Journal of Clin-ical Microbiology vol 41 no 6 pp 2760ndash2762 2003

[36] M Rahman J Matthijnssens X Yang et al ldquoEvolutionary his-tory and global spread of the emerging G12 human rotavirusesrdquoJournal of Virology vol 81 no 5 pp 2382ndash2390 2007

[37] M De Beer N Page J Dewar and D Steele ldquoMolecularanalysis of rotavirus strains from the Johannesburg area in 2004emergence of serotype G12 rotavirus strainsrdquo in Proceedingsof the 9th International Symposium on Double Stranded RNAViruses (PW67) Cape Town South Africa October 2006

[38] M H Arguelles G A Villegas A Castello et al ldquoVP7 andVP4 genotyping of human group A rotavirus in Buenos AiresArgentinardquo Journal of Clinical Microbiology vol 38 no 1 pp252ndash259 2000

[39] F Bon C Fromantin S Aho et al ldquoG and P genotyping ofrotavirus strains circulating in France over a three-year perioddetection of G9 and P[6] strains at low frequenciesrdquo Journal ofClinical Microbiology vol 38 no 4 pp 1681ndash1683 2000

[40] A D Steele M C van Niekerk A Geyer P Bos and JJ Alexander ldquoFurther characterisation of human rotavirusesisolated from asymptomatically infected neonates in SouthAfricardquo Journal of Medical Virology vol 38 no 1 pp 22ndash261992

[41] M D Esona G E Armah and A D Steele ldquoMolecular epi-demiology of rotavirus infection in Western Cameroonrdquo Jour-nal of Tropical Pediatrics vol 49 no 3 pp 160ndash163 2003

[42] G E Armah C T Pager R H Asmah et al ldquoPrevalence ofunusual human rotavirus strains in Ghanaian childrenrdquo Journalof Medical Virology vol 63 no 1 pp 67ndash71 2001

[43] DDGriffinCDKirkwoodUD Parashar et al ldquoSurveillanceof rotavirus strains in the United States identification ofunusual strainsrdquo Journal of Clinical Microbiology vol 38 no 7pp 2784ndash2787 2000

[44] E Kaga M Iizuka T Nakagomi and O Nakagomi ldquoThedistribution of G (VP7) and P (VP4) serotypes among humanrotaviruses recovered from Japanese children with diarrheardquoMicrobiology and Immunology vol 38 no 4 pp 317ndash320 1994

[45] I Silberstein L M Shulman E Mendelson and I Shif ldquoDis-tribution of both rotavirus VP4 genotypes and VP7 serotypesamong hospitalized and nonhospitalized Israeli childrenrdquo Jour-nal of Clinical Microbiology vol 33 no 5 pp 1421ndash1422 1995

[46] R F Bishop P J Masendycz H C Bugg J B Carlin andG L Barnes ldquoEpidemiological patterns of rotaviruses causingsevere gastroenteritis in young children throughout Australiafrom 1993 to 1996rdquo Journal of Clinical Microbiology vol 39 no3 pp 1085ndash1091 2001

[47] V Gouvea L de Castro M C Timenetsky H Greenberg andN Santos ldquoRotavirus serotype G5 associated with diarrhea inBrazilian childrenrdquo Journal of Clinical Microbiology vol 32 no5 pp 1408ndash1409 1994

[48] M Koopmans and D Brown ldquoSeasonality and diversity ofGroup A rotaviruses in Europerdquo Acta Paediatrica vol 88supplement 426 pp 14ndash19 1999

[49] A D Steele S P Parker I Peenze C T Pager M B Taylor andWD Cubitt ldquoComparative studies of human rotavirus serotypeG8 strains recovered in South Africa and the United KingdomrdquoJournal of General Virology vol 80 no 11 pp 3029ndash3034 1999

[50] L E Unicomb G Podder J R Gentch et al ldquoEvidence of high-frequency genomics reassortment of group A rotavirus strainsin Bangladesh emergence of type 09 in 1995rdquo Journal of ClinicalMicrobiology vol 37 pp 1885ndash1891 1999

[51] T K Fischer P Valentiner-Branth H Steinsland et al ldquoProtec-tive immunity after natural rotavirus infection a communitycohort study of newborn children in Guinea-Bissau WestAfricardquo Journal of Infectious Diseases vol 186 no 5 pp 593ndash597 2002

[52] M Iturriza-Gomara B Isherwood U Desselberger and J GrayldquoReassortment in vivo driving force for diversity of humanrotavirus strains isolated in the United Kingdom between 1995and 1999rdquo Journal of Virology vol 75 no 8 pp 3696ndash3705 2001

[53] M I Adah A Wade and K Taniguchi ldquoMolecular epidemiol-ogy of rotaviruses in Nigeria detection of unusual strains withG2P[6] and G8P[1] specificitiesrdquo Journal of Clinical Microbiol-ogy vol 39 no 11 pp 3969ndash3975 2001

[54] N A Cunliffe W Dove J E G Bunn et al ldquoExpanding globaldistribution of rotavirus serotypeG9 detection in Libya Kenyaand Cubardquo Emerging Infectious Diseases vol 7 no 5 pp 890ndash892 2001

[55] K Nobumichi M A Mohammed K Kazunobu M Keiji IMasaho and S Ayako ldquoGenetic diversity and evolution ofrotaviruses an overviewrdquo in Genomic Diversity and MolecularEpidemiology of Rotaviruses N Kobayashi Ed pp 75ndash89Research Signpost Thiruvananthapuram India 2003

[56] E A Palombo P J Masendycz H C Bugg N Bogdanovic-Sakran G L Barnes and R F Bishop ldquoEmergence of serotypeG9 human rotaviruses in Australiardquo Journal of Clinical Microbi-ology vol 38 no 3 pp 1305ndash1306 2000

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


the occurrence and molecular characteristics of humanrotavirus among children in Sokoto State Nigeria

2 Material and Methods

21 Study Area Samples were collected frommajor hospitalsin Sokoto which lies between longitude 11∘ 301015840 to 13∘ 501015840 Eastand latitude 4∘ to 61015840 North The GNP per capita in the statewas put at 320 dollars [9]

22 Sampling Method A simple random sampling methodwas adopted in the study The formula of Campbell [10] wasused to estimate the minimum of 189 samples however inorder to increase the precision and chances for the detectionof infection the samples were increased to 200

23 Sample Collection Diarrhoea samples were collectedfrom diarrheic children less than 5 years of age presentedat the study hospitals The samples were obtained followingparental consent and ethical approval from the medicalresearch ethics committee of the hospitals Diarrhoea in thisstudy was defined as the passage of more than 3 looser thannormal stools within 24 hours The stool samples were col-lected aseptically in sterile commercial bijou bottles ade-quately labeled (patient ID and date of collection) and trans-ported on ice to the Veterinary Microbiology Laboratoryof Usmanu Danfodiyo University Sokoto where they werestored at minus20∘C until being transported on ice to the NoguchiMemorial Institute for Medical Research (NMIMR) AccraGhana where they were also stored at minus20∘C until tested

24 Preparation of 10 Stool Suspension The stored stoolspecimens were retrieved after freeze thawing and a 10 stoolsuspension was prepared by pipetting 15mL of supply speci-men preparation buffer (included in the kit)

25 Detection of Rotavirus Antigen by ELISA Rotavirus anti-gens in stool samples were detected by a commercially avail-able DAKO Rotavirus ELISA kit according to the manufac-turerrsquos instructions The result was read spectrophotometri-cally in 30 minutes after stopping the reaction on MultiskanELISA reader (Multiskan Plus LabsystemsHelsinki Finland)at the reference wavelength of 450 nm

26 Sodium Dodecyl Sulphate Polyacrylamide Gel Electro-phoresis (SDS-PAGE) All ELISA positive samples (119899 = 51)were subjected to SDS-PAGE according to the techniquedescribed by Herring et al [11]

27 Reverse Transcription-Polymerase Chain Reaction (RT-PCR) TheG-typing was conducted according to themethodof Gouvea et al [12] andDas et al [13] whilst the P-typing wasconducted as described by Gentsch et al [14] The protocolsfor viral RNA extraction from the stools and the RT-PCRtyping protocols for rotavirus gene 7 (G-serotyping) and gene4 (P-genotyping) were kindly provided by Dr Gentsch of theViral Gastroenteritis Section CDC Atlanta USA

28 Monoclonal Antibody (Mab) Serotyping Mab serotypingwas carried outwithmonoclonal antibodies specific for group

A human rotavirus strains using the Mab serotyping kitaccording to Manufacturerrsquos instructions The Mab serotyp-ing kit was kindly provided by the National Institute ofHealth Atlanta Georgia USA The method employed theELISA protocol and the procedure was basically as describedby Taniguchi et al [15] with the monoclonal antibody asthe capture reagent but skim milk was used to reduce thebackground as described by Coulson et al [16]

29 VP7 and VP4 Genotyping Phenolchloroform methoddescribed by Steele and Alexander [17] was used to extractthe viral RNA from all PAGE positive specimens and thenpurified with the RNaidreg Kit (Bio 191 Carlsbad USA) Theextracted RNA was stored at minus20∘C until further use

The VP7 and VP4 genotyping was performed asdescribed by Gouvea et al [12] and Gentsch et al [14] Brieflyviral RNA was subjected to Reverse Transcription (RT) stepand Polymerase Chain Reaction (PCR) step was performedto amplify the transcribed gene Finally a seminested PCRwas performed using genotype specific primers as a mean todetermine the viral genotype (Table 1)

210 VP7 First Round Amplification The purified viral RNAwas reverse transcribed according to the method of Gouveaet al [12] Briefly 1 120583L each of the specific primer pair(sBeg9End9) was added to 8 120583L of previously extracteddsRNA and put in a 500 120583L PCR tube The solution washeated for 5 minutes at 94∘C to denature the dsRNA andchilled immediately in an ice bath for 2 minutes Thedenatured dsRNAs were then reverse transcribed by adding32 120583L of master mix (02 120583L of 10mM dATP 02 120583L of 10mMdCTP 02 120583Lof 10mMdGTP 02 120583Lof 10mMdTTP 04 120583Lofavianmyeloblastosis (AMV) reverse transcriptase and 20120583Lof 5x AMV buffer) and incubated for 20 minutes at 42∘Cin a water bath The cDNA was then amplified by PCR ina 40 120583L reaction mixture containing 1 120583L of 10mM dATP1 120583L of 10mM dCTP 1 120583L of 10mM dGTP 1 120583L of 10mMdTTP 4 120583L of 10x Taq buffer 24 120583L of 25mM MgC1

2 30 120583L

of double distilled water and 03 120583L Taq polymerase prior touse No template control (NTC) included negative controlThirty cycles of PCR (1 minute denaturing at 94∘C 2 minutesannealing at 42∘C and 3 minutes extension at 72∘C) and afinal extension cycle at 72∘C for 7 minutes was performed ona Gene AMP PCR Primus 25 System machine The amplifiedsamples were analysed onto 2 agarose (SEAKEMUSA) andvisualised on the GelDOC system

211 VP7 Second Round Amplification A second round Poly-merase Chain Reaction was carried out to determine thegenotype of the rotavirus strains Briefly 1 120583L of the firstround reaction products was added to 40 120583L PCR-MM con-taining 1 120583L of each of six serotype-specific primers (aBT-1 aCT-2 aET-3 aDT-4 aAT-8 and aFT-9) and the primerRVG9 1 120583L of 10mM dATP 1 120583L of 10mM dCTP 1 120583L of10mM dGTP 1120583L of 10mM dTTP 4 120583L of 10x Taq buffer24 120583L of 25mM MgCl

2 30 120583L of ddH

2O and 03 120583L of Taq

polymerase and PCR performed according to the conditionstated above The amplified products were analysed on 2agarose gel and the genotype determined based on the sizeof the resultant amplicon












Genotype(G-types)








Short

Long


3 Result





(a)

(b)


G12

G4

G3

G2

G1

4

59

15

11

11






VP7serotype

Number ofVP7


G1 4 3 1 136 20

G2 3 3 0 136 0

G3 3 2 1 91 20

G4 16 13 3 591 60

G12 1 1 0 45 0

Total 27 22 5 999 100






4 Discussions


11

3

9

39

13

48P[8]

P[6]

P[9]


G4 P[8]

G4 P[8] 5 56

G4 P[6]G1 P[8]G3 P[8]

G4 P[6] 1 11

G1 P[8] 2 22

G3 P[8] 1 11



14

29

57

G2 P[8]

G12 P[8]

G2 P[8]G4 P[9]G12 P[8]

G4 P[9]

















5 Conclusions




Acknowledgments


References


































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology












Genotype(G-types)








Short

Long


3 Result





(a)

(b)


G12

G4

G3

G2

G1

4

59

15

11

11






VP7serotype

Number ofVP7


G1 4 3 1 136 20

G2 3 3 0 136 0

G3 3 2 1 91 20

G4 16 13 3 591 60

G12 1 1 0 45 0

Total 27 22 5 999 100






4 Discussions


11

3

9

39

13

48P[8]

P[6]

P[9]


G4 P[8]

G4 P[8] 5 56

G4 P[6]G1 P[8]G3 P[8]

G4 P[6] 1 11

G1 P[8] 2 22

G3 P[8] 1 11



14

29

57

G2 P[8]

G12 P[8]

G2 P[8]G4 P[9]G12 P[8]

G4 P[9]

















5 Conclusions




Acknowledgments


References


































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology




Short

Long


3 Result





(a)

(b)


G12

G4

G3

G2

G1

4

59

15

11

11






VP7serotype

Number ofVP7


G1 4 3 1 136 20

G2 3 3 0 136 0

G3 3 2 1 91 20

G4 16 13 3 591 60

G12 1 1 0 45 0

Total 27 22 5 999 100






4 Discussions


11

3

9

39

13

48P[8]

P[6]

P[9]


G4 P[8]

G4 P[8] 5 56

G4 P[6]G1 P[8]G3 P[8]

G4 P[6] 1 11

G1 P[8] 2 22

G3 P[8] 1 11



14

29

57

G2 P[8]

G12 P[8]

G2 P[8]G4 P[9]G12 P[8]

G4 P[9]

















5 Conclusions




Acknowledgments


References


































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology



VP7serotype

Number ofVP7


G1 4 3 1 136 20

G2 3 3 0 136 0

G3 3 2 1 91 20

G4 16 13 3 591 60

G12 1 1 0 45 0

Total 27 22 5 999 100






4 Discussions


11

3

9

39

13

48P[8]

P[6]

P[9]


G4 P[8]

G4 P[8] 5 56

G4 P[6]G1 P[8]G3 P[8]

G4 P[6] 1 11

G1 P[8] 2 22

G3 P[8] 1 11



14

29

57

G2 P[8]

G12 P[8]

G2 P[8]G4 P[9]G12 P[8]

G4 P[9]

















5 Conclusions




Acknowledgments


References


































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


14

29

57

G2 P[8]

G12 P[8]

G2 P[8]G4 P[9]G12 P[8]

G4 P[9]

















5 Conclusions




Acknowledgments


References


































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology









5 Conclusions




Acknowledgments


References


































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology
































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

research article molecular characterization of human...

Documents