research article investigating acid stress response in...

Research ArticleInvestigating Acid Stress Response in DifferentSaccharomyces Strains

Rogelio Lopes Brandatildeo1 Juacutelio Ceacutesar Cacircmara Rosa1

Jacques Robert Nicoli2 Marcos Vinicius Simi Almeida1 Ana Paula do Carmo1

Heloa Teixeira Queiros1 and Ieso Miranda Castro13

1 Nucleo de Pesquisas em Ciencias Biologicas Escola de Farmacia Universidade Federal de Ouro PretoCampus Morro do Cruzeiro 35400-000 Ouro Preto MG Brazil

2 Departamento de Microbiologia Instituto de Ciencias Biologicas Universidade Federal de Minas GeraisCampus Universitario 30171-970 Belo Horizonte MG Brazil

3 LBCM Instituto de Ciencias Exatas e Biologicas Campus Morro do Cruzeiro 35400-000 Ouro Preto MG Brazil

Correspondence should be addressed to Ieso Miranda Castro imcastronupebufopbr

Received 3 February 2014 Accepted 1 April 2014 Published 17 April 2014

Academic Editor Praveen Rao Juvvadi

Copyright copy 2014 Rogelio Lopes Brandao et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

Yeast cells need to respond to a variety of stresses found in such different conditions as gastrointestinal tract after probiotic ingestionor fermentation vat during ethanol production In the present study H+ neutralisation capacity membrane fatty acid compositionH+-ATPase activity and cytosolic Ca2+ concentration were evaluated in yeast cells used for probiotic (Saccharomyces boulardii)and laboratory (Saccharomyces cerevisiaeW303) purposes as well as in someW303 mutant strains for ENA1 gene and S cerevisiaeBY4741 Results show that the H+ internal concentration of yeast is regulated by several systems including the plasma membraneH+-ATPase and that Ena1p has an important but undefined role in the cellular response to acid Membrane fatty acid compositionof S cerevisiaeW303 strain was affected by exposure to acidic pH but the presence of 86mM NaCl prevented this effect whereasmembrane fatty acid composition of S boulardii was unaffected by acidic pH We also demonstrated that the acid stress responseis dependent on calcium metabolism and blocked by FK 506

1 Introduction

To survive and proliferate free-living organisms must adaptto changes in their environment Exposure of the Saccha-romyces cerevisiae to environmental stresses such as toxicions [1 2] ethanol [3] or changes in temperature [4] orpH [5] triggers biochemical and gene expression changes[6] Yeast rapid exposure to inorganic acids is of interestbecause such exposure occurs under environmental (egyeast probiotics passing through the gastrointestinal system)and industrial conditions (eg sulphuric acid to eliminatebacterial contamination in yeast cultures that are to be reusedfor fermentation [7])

Saccharomyces cerevisiae grows well over a wide rangeof pH but grows better in acidic than in alkaline pH [58] Studies have demonstrated changes in the expression of

hundred genes in S cerevisiae following alterations in pH[9ndash11] The responses of S cerevisiae to alkaline pH havebeen reviewed by Arino [5] and involve various signallingpathways In particular the role of calcineurin on alkalinestress was suggested early on and the involvement of calciumsignalling in this response was reported in subsequent works[5 10 12 13] Responses to alkaline pH have also beendescribed for Candida albicans [14] and Aspergillus nidulans[15 16]

Responses to acid stress have been studied in yeast cellsthat were artificially exposed to weak organic acids [9 17]food preservatives [17 18] and herbicides [19] In responseto exposure to weak acids yeast cells show decreased mem-brane permeability anion extrusion an increased ability tocatabolize preservatives [20] and altered gene expression [9]Results of genomewide analysis and functional screening of

Hindawi Publishing CorporationJournal of MycologyVolume 2014 Article ID 178274 9 pageshttpdxdoiorg1011552014178274

2 Journal of Mycology

Table 1 Saccharomyces cerevisiae strains used in this study

Strain Genotype SourceS boulardii Wild type FLORATIL Merck SA

W303 119872119886119905120572 leu2-3 112 ura3-1 trp1-1 his3-1115 ade2-1 can1-100 GAL mal SUC2 Johan MThevelein

LBCM 479 W303119872119886119905120572 ena1HIS3ena4 Jose RamosLBCM 690 LBCM479 [p417] This workLBCM 691 LBCM479 [p427] This workLBCM 692 LBCM479 [p417ENA1] This workLBCM 693 LBCM479 [p427ENA1] This workBY4741 MATa his3Δ1 leu2Δ0 lis2Δ0 ura3Δ0 EuroscarfYKL190W BY4741 cnb1KanMX4 EuroscarfYNL027W BY4741 crz1KanMX4 Euroscarf

genes involved in response to lactic acetic and hydrochloricacids suggest that acidic conditions affect cell wall architec-ture the expression of genes involved in metal metabolismvacuolar H+-ATPase (V-ATPase) and HOG MAPK proteinlevels [17]

Similar to the response to weak acids resistance toinorganic acid exposure involves changes in the membraneconductivity to H+ active extrusion of protons from thecell [21] and the modulation of gene expression [8 17]Previous studies have shown that the protein kinase C (PKC)pathway involved in cell integrity in S cerevisiae is activatedin response to acid stress and that this activation is dependenton the cell wall sensor Mid2p [22ndash24] Claret et al havesuggested the existence of two distinct pathways involvingMid2p (cell wall sensor) or Rgd1p (Hog pathway) that acttogether to induce cell integrity pathway and to increaseacidic tolerance [22]

In Saccharomyces cytosolic calciumplays an essential rolein the control of the cell cycle budding process and matingAdditionally cytosolic calcium is an important second mes-senger in eukaryotic cells Yeast cells growing under standardlaboratory conditions exhibit low cytosolic calcium levelsand minimal calcineurin activity [25] Exposure to variousenvironmental stresses such as salt oxidative alkali or heatstress causes immediate changes in the cytosolic calciumCalcium levels first increase and then decline rapidly whenyeast cells are exposed to these conditions [10 14 26ndash28] Crz1is the major effector of calcineurin-regulated gene expressionin S cerevisiae but unidentified targets for calcineurin withroles in stress adaptation also exist [5] The Cch1 and Mid1proteins components of membrane calcium channel andeffectors of Slt2p (PKC pathway) are involved in cell viabilityat low pH in Saccharomyces [22] However calcium-mediatedsignallingmechanisms have not been studied under the acid-shock response

In a previous work carried out in our laboratory weestablished that low concentrations of sodium ions conferredprotection to yeast cells exposed to acid stress [29] Ourobservations also suggested that the systems involved inmaintaining the plasma membrane potential (PMA1p H+-ATPase and secondary transporter systems) were linked tothe acid stress response In the present study we focused

experiments on plasma membrane H+-ATPase participationand on calcium signalling events observed in yeast cells inresponse to acid stress

2 Materials and Methods

21 Yeast Strains and Growth Conditions Table 1 lists theyeast strains used in this study Yeast strains were grown in anorbital shaker (200 rpm) at 30∘C in YPDmedium containing(wv) 1 yeast extract 2 peptone and 2 glucose Cellulargrowth was monitored by optical density (OD) at 600 nm

22 Acid Stress Condition and Viability Assays Yeast cellcultures (OD

600 nm sim 10) were harvested by centrifugationat 4750timesg for 5min and washed twice with YP mediaThen pellets were suspended at an OD600 nm of 10 in anaqueous solution previously adjusted to pH 20 with 1MHCl and supplementedwith 86mMNaClThis conditionwasapplied to every acid treatment performed in this study Yeastsamples were then incubated in an orbital shaker at 30∘Cfor 1 h Aliquots were collected after 0 (control cells beforeacid stress) 15 30 and 60min of incubation Cells wereimmediately washed twice with an equal volume of YP anddiluted 20000times Then 50120583L of cell suspension was seededon YPD agar Plates were incubated at 30∘C for 48 to 72 hThe results were expressed as the percentage () of colonyforming units (cfu) relative to the control sample (119905 = 0)

The growth of yeast cells in the presence of Na+ was testedon a series of YPD plates supplemented with increasing con-centrations of NaCl (200ndash500mM) Tenfold serial dilutionsof cell suspensions were prepared and 5 120583L aliquots of eachwere spotted onto YP plates Growth was monitored over 3days

23 H+ Neutralisation Capacity of the Yeast Cells The capac-ity of cells to neutralise added H+ to a cell suspension wasdetermined by an acid-pulse technique with a pH meterBriefly the pH was measured after the addition of acid pulses[30] To estimate the extracellular capacity to neutraliseadded H+ the cells were grown as previously describedwashed and either exposed (stressed cells) or not (control

Journal of Mycology 3

cells) to acid stress Aliquots of 50mL were collected bycentrifugation washed twice with Milli-Q water and resus-pended in a 2mL volume to obtain a dense cell suspensionThe pH of cell suspension was previously adjusted in pH 68with NaOH and the first acid pulses were performed withsmall volumes of 10mM HCl because near the neutral pHrange even the addition of small amounts of protons resultsin large pH changes To estimate the total cell capacity toneutralise H+ (meaning the ability of cell surface-derivedchemical groups plus internal metabolites) the cells werepreviously disrupted with liquid nitrogen in Milli-Q waterand resuspended as described before

24 Determination of H+-ATPase Activity Measurements ofH+-ATPase activity were made with 375mg of cells (wetweight) grown in YPD (4 glucose) to an OD

600of 10ndash

12 (control) or cells grown in YPD washed exposed toacid stress as described above and harvested after 10 30and 60min After recover on glass fiber filters the cellswere removed from the filters immediately frozen in liquidnitrogen and stored until use Plasma membrane isolationand determination of ATPase activity in the presence ofinhibitors of mitochondrial ATPase and phosphatase wereperformed as previously described [31] Protein content wasdetermined by the Lowry method [32]

25 Intracellular Free Calcium Concentration The cytosolicfree calcium concentration was measured by the aequorin-based method [33] with some modifications The pVTU-AEQ plasmid was a gift from Marco Vanoni (Univer-sita di Milano-Bicocca Milan Italy) Briefly exponentiallygrowing cells transformed with the multicopy apoaequorin-expressing plasmid pVTU-AEQ were harvested by cen-trifugation at 4750timesg for 5min washed three times withMesTris 01M (pH 65) and resuspended at a density ofsim109 cellsmL To reconstitute functional aequorin 50120583Mcoelenterazine (Molecular Probes stock solution 1 120583g120583Ldissolved in methanol) was added to the cell suspensionand the cells were incubated for 30min at room temperaturein the dark Excess coelenterazine was removed by washingthe cells three times with Milli-Q water and centrifuging at3200timesg for 3min

For each acid pulse (pH 20 plus 86mMNaCl) 450120583L ofcell suspension (in water) was transferred to a luminometertube Light emission was monitored in a Berthold LumatLB 950116 luminometer at 2 s intervals starting 1min beforeand lasting until gt6min after HCl addition to the finalconcentration indicated in the figuresThe results summarisethree replicates and are expressed in relative luminescenceunits per second (RLUs)

26 Analysis of Membrane Fatty Acid Composition TheMicrobial Identification System (MIS Microbial ID IncNewark DE USA) was used to analyse the fatty acid com-position of cytoplasmic membranes [34] Methyl esters wereobtained according to the MIDI method (Microbial ID Inc)Methyl esters were identified and quantified by chromatogra-phy with the Sherlock software package (MIDI Inc version

45) Arcsine square root transformations were performedData were analysed by analysis of variance (ANOVA) withthe Scott Knott test at 5 significance Transformations andanalyses were performed with the Genes software packageversion 200700 which allows for the study of microbialgenetic diversity frommembrane fatty acid composition [35]Data were analysed by the standardized Euclidian distanceand the calculated matrix distance was used for clusteringanalysis by the UPGMA method (Unweighted Pair GroupMethod with Arithmetic Mean)

27 Molecular Biological Methods Preparation and manipu-lation of nucleic acids (eg phenol extraction ethanol pre-cipitation and electrophoresis) were performed as describedby Sambrook et al [36]

The plasmids p417-CYC (low copy) and p427-TEF (highcopy) purchased fromDualsystemsBiotechAG Switzerlandwere used to express ENA1 (YDR040C SaccharomycescerevisiaeGenome Database httpwwwyeastgenomeorg)The insert was prepared by using yeast genomic DNA fromthe W303 strain as a template The primers were forwardGACTAGTATGGGCGAAGGAACTACTAAG and reverseTCCCCCGGGTCATTGTTTAT ACCAATATTAAC Theforward PCR primer contained a Spe1 site and the reverseprimer had a Sma1 site The PCR product was cut withSpe1Sma1 and inserted into SpeSma1 p417-CYC or p427-TEF vectors to produce the recombinant plasmids

Competent Escherichia coli Top10Frsquo strain cells weretransformed with the recombinant plasmids for expres-sion of Ena1p or aequorin The presence of the appropri-ate insert was determined by DNA extraction followedby digestion and sequencing with the chain terminationmethod (MegaBace 1000 Sequencing Analysis System andDynamicTM ET dye terminator kit) Nucleic acid sequenceswere compared to sequences in the Saccharomyces GenomeDatabase

For H+-ATPase activity and bioluminescence assaysyeast cells were transformed by the lithium method [37]

28 Reproducibility of Results All experiments were per-formed in triplicate Means plusmn SD are indicated in each figureexcept for H+ neutralisation and calcium signal experiments

3 Results

31 H+ Neutralisation Capacity Previous results of our lab-oratory showed that S boulardii (a probiotic strain) is moreresistant to low pH than S cerevisiaeW303 (laboratory non-probiotic strain) Therefore we decided to test the behaviorof these strains facing an acid pulse (pH 20 plus 86mMNaCl or a simulated gastric environment without pepsin) Asdescribed before low NaCl concentration seems to protectyeast cells against inorganic acid stress preventing exacer-bated cell death due to extreme conditions Figure 1 shows theextracellular and total (extracellular plus intracellular) H+-neutralisation capacity of S boulardii and S cerevisiaeW303cells grown in YPD (control) and cells previously exposed toacid stress The extracellular capacities of S cerevisiae W303


1 2 3 4 5 6 7 8

1000

2000

3000

4000

pH

nmol

H+

mg

of ce

lls

(a)

1 2 3 4 5 6 7 8

1000

2000

3000

4000

pH

nmol

H+

mg

of ce

lls

(b)

Figure 1 H+ neutralisation capacity of yeast cells grown in YPD medium as determined by an acid pulse technique (a) Extracellular H+neutralisation capacity of S boulardii (e) S boulardii exposed to pH 20 + 86mM NaCl (o) S cerevisiaeW303 (◼) and S cerevisiaeW303exposed to pH 20 + 86mMNaCl (◻) (b) Total H+ neutralisation capacity of S boulardii (e) S boulardii exposed to pH 20 + 86mM NaCl(o) S cerevisiaeW303 (◼) and S cerevisiaeW303 exposed to pH 20 + 86mMNaCl (◻)

and S boulardii to neutralise added H+ were similar butS cerevisiae W303 was lightly more affected by acid pulsesthan S boulardii (Figure 1(a)) Results also demonstrated thatthe extracellular capacity to neutralise added H+ was smallerthan the total capacity for both yeast strains (Figures 1(a) and1(b)) This difference is particularly evident when we observethe resulting pH after the addition of a specific amount ofH+mg of cells Saccharomyces boulardii had a higher totalH+ neutralisation capacity and possibly a greater ability tomaintain pH homeostasis after acid stress than S cerevisiaeW303 (Figure 1(b)) suggesting that the two strains havedifferent compositions of intracellular buffering compoundsThe resulting pH after the addition of 1000 nmol H+mgof cells was 33 and 28 (in control cells or exposed to pH20 + 86mM NaCl resp) for S boulardii and pH 26 and22 for W303 (Figure 1(b)) This buffering mechanism isimportant for a rapid intracellular pH adjustment but cannotaccommodate extreme changes in extracellular pH In fact a05 pH unit difference in external medium in low pH rangerepresents a pronounced stress condition

32Membrane Fatty AcidComposition Thecomposition andlevels of fatty acids in the cell membrane were modulated inresponse to acid stress as shown by a dendrogram shown inFigure 2 A passive increase in intracellular proton concen-tration may partially explain this cellular response to acidThis effect was particularly pronounced in theW303 strain inwhich changes in fatty acid profile were observed after 30minof acid exposure (pH 20) Small increases were observedfor oleic acid and arachidic acid whereas the percentage ofgadoleic acid a cis-icos-9-enoic acid related to oleic acid buthas 20 carbon atoms presented a large decrease Figure 2 alsoshows that the addition of 86mM NaCl prevented this effectin theW303 strain and thatmembrane fatty acid compositionof S boulardii was unaffected by acidic pH It has been

known that unsaturation of fatty acid chains has a profoundeffect on membrane fluidity but further work will be neededto investigate if the changes in saturation and unsaturationdegrees influence the acid tolerance

33 H+-ATPase Activity in Ena Mutants To confirm theinvolvement of systems involved with maintaining theplasma membrane potential (PMA1H+-ATPase and sec-ondary transport systems) during the acid stress response weconstructed yeast strains expressing different levels of Ena1pWhile Pma1p is involved in protons active extrusion ENAproteins act in the responses to saline or alkaline stress [38]andhelp to regulate the plasmamembrane potential [29] Sac-charomyces cerevisiae contains several genes encoding ENAproteins but the ENA1 gene is the most functionally relevantcomponent of the gene cluster [38] Figure 3 shows the invivo activation of the plasma membrane H+-ATPase by pulseacid (pH 20 + 86mM NaCl) in yeast strains with differentlevels of Ena1p The deletion strain (W303 ena1HIS3ena4)theW303 ena1HIS3ena4 strain transformedwith the emptyvectors and the strain expressing single copy of ENA1 (W303ena1HIS3ena4 + p417ENA1) showed acid-induced H+-ATPase activation In contrast no activation was observedin Saccharomyces strains expressing high levels of Ena1p(W303 and W303 ena1HIS3ena4 + p427ENA1) Table 2shows that ena1Δ mutant presented higher tolerance toacid stress when viability of strains with different Ena1plevels was compared to wild-type S cerevisiae W303 (highENA expression) over time These results were confirmedby spot tests when tenfold serial dilutions of control andacid stressed cells were spotted onto YPD plates (resultsnot shown) The more negative membrane potentials understandard growth conditions of enanullmutants and cells withlow Ena1p expression could explain the correlation between


0 25 5 75 10 125 15Euclidian distance

Control

Control

30998400

60998400

+ NaCl 30998400

+ NaCl 60998400

30998400

60998400

+ NaCl 30998400

+ NaCl 60998400

S cerevisiae

S boulardii

pH 2

pH 2

pH 2

pH 2

pH 2

pH 2

pH 2

pH 2

Figure 2 Dendrogram of the fatty acid composition of yeast cytoplasmic membranes Data were analysed by the standardized Euclidiandistance and the calculated matrix distance was used for clustering analysis by the UPGMA method The composition and levels of fattyacids in the cell membrane were modulated in response to acid stress particularly in the W303 strain and this effect was prevented byaddition of 86mM of NaCl as shown by the dendrogram

0 10 20 30 40 50 6000

02

04

06

08

Time (min)

H+

-ATP

ase a

ctiv

ity(120583

mol

Pimiddotminminus1middotm

g pr

otei

nminus1)

Figure 3 H+-ATPase activity Plasma membrane H+-ATPase acti-vation in wild S cerevisiaeW303 (e) the ena1-4mutant (◼) ena1-4mutant + p417ENA1 (⧫) ena1-4 mutant + p427ENA1 (998771) ena1-4mutant + p417 (loz) and ena1-4mutant + p427 (Δ) S cerevisiaeW303mutants subjected to pH 20 (HCl) + 86mMNaCl for 60min

the ENA1 levels the acid-induced plasma membrane H+-ATPase activation and the acid tolerance as demonstratedin a previous study [29] In contrast strains overexpressingEna1p have more positive membrane potentials and arenot susceptible to acid-induced H+-ATPase activation Thestrain expressing single copy (or maximum two copies ofENA1) showed lower viability compared to S boulardii(low ENA1 expression and acid resistance previous work[29]) possibly because W303 ena1HIS3ena4 + p417ENA1shows a different expression profile compared to S boulardii(ectopic x eutopic expression) Subsequent experiments tounderstand the relationships between Ena1p expression andacid induced H+-ATPase activation are necessary to confirm

this hypothesis In addition other factors are involved in acidstress response

34 Acid Induced Cytosolic Ca2+ Transient Increase Thecalcium signal induced by glucose was well known andused as a positive control in the present experiment [39]However information on calcium transient signal in responseto acid exposure is not available in the literature As expectedyeast cells resuspended in MesTris (01M pH 65) andsubmitted to glucose pulses showed clear glucose-inducedcalcium signal (Figure 4(a)) On the other hand acid pulsesproduced very low cytosolic calcium signal which were pHdependent (Figure 4(b)) The effect of identical acid pulseswas also measured in suspensions with lower cell density Weobserved a higher calcium signal in these suspensions likelybecause the denser cell suspensions had a higher bufferingcapacity (results not shown) However the luminescenceassay is pH sensitive and other studies have demonstrated arelationship between pH and luminescence of coelenterazine[40] To evaluate whether the transient acid-induced calciumsignals were the result of pH changes we performed asimilar experiment using a 15mM KCl pulse as a negativecontrolThe KCl pulse did not induce pH change or stimulateluminescence (Figure 4(b))

Figure 5 shows that calcineurin and CrZ1 were requiredto induce the acid stress response This suggests that cal-cineurin a protein phosphatase is activated by exposureto acid and acts by modulating gene expression throughdephosphorylation of the CrZ1pTcn1p transcription factorand its translocation to the nucleus [25] This pathway wasblocked by addition of 1 120583gmLFK506 (calcineurin inhibitor)to yeast cells culture at 05ODThe acid stress condition wasonly applied when the cell concentration reached 10OD


Table 2 Effect of acid stress on strain viability ( cfu)

StrainsConditions

Control (nonstressful) pH 20 + 86mMNaCl10min 30min 60min

W303 100 822 plusmn 31 701 plusmn 50 329 plusmn 41

LBCM479 (ena1-4Δ) 100 966 plusmn 42lowast

844 plusmn 43lowast

673 plusmn 31lowast

LBCM479 [p417 ENA1] 100 926 plusmn 26lowast

777 plusmn 06 370 plusmn 14

LBCM479 [p427 ENA1] 100 880 plusmn 16 732 plusmn 09 389 plusmn 35

Yeast cells were harvested during the exponential growth phase and subjected to 1 h of acidic stress (pH 20 + 86mMNaCl) Data are expressed as the mean plusmnstandard deviations of three separate experiments lowast(119875 values lt 005 compared to W303 strain)

0

500

1000

1500

2000

Time (s)

RLU

s

40 140 240 340 440 540minus60

(a)

0

50

100

150

200

40 140 240 340 440minus60

RLU

s

Time (s)

(b)

Figure 4 Calcium signalling in S cerevisiae BY4741 (a) Glucose-induced calcium signalling at pH 65 (◼) pH 37 (998771) pH 30 (Δ) and pH20 (◻) (b) acid-induced calcium signalling at pH 51 (◼) pH 42 (998771) pH 30 (Δ) pH 20 (◻) and 15mM KCl (⧫)

These cells (incubated with FK506) were less resistant whencompared to control cells (Figure 5) It is known that Scerevisiae generates cytosolic calcium signals in responseto diverse stimuli These calcium transient signals mediatevarious responses in eukaryotic cells For example alkalinestress triggers calcium fluctuation in S cerevisiae [5] and Calbicans [14] Claret et al [22] proposed the involvement ofthe cell calcium channel components Cch1 and Mid1 in cellviability at low pH

4 Discussion

Changes in extracellular pHhave a negative effect on the yeastlife cycle and the maintenance of internal pH homeostasisis important for cell viability Yeast cells can maintain anappropriate internal pH by utilizing cell buffer systems andconsuming H+ through metabolic pathways [41] increasingproton extrusion by the plasma membrane H+-ATPase [4243] transporting acid between the cytosol and organelles[44 45] Our results confirm that the cell buffer powermight be part of the pH homeostatic mechanism involvedin the acid stress response The composition and levels offatty acids in the cell membrane were also modulated inresponse to acid stress Here we propose that modulationof composition and level of membrane fatty acids interfereswith H+ conductivity into the cells Genes involved in thebiosynthesis of plasma membrane lipids which are essential

0

50

100

BY4741

Time (min)

Viab

ility

()

0 10 30 60

BY4741 + FK506cnb1Δcrz1Δ

Figure 5 Effect of pH 20 (HCl) + 86mMNaCl on calcineurincrz1mutants The results show that the acid stress response is dependenton calcium metabolism and is blocked by FK 506

structural membrane components have their expressionmodulated under stress [46 47] Plasmamembrane structureis likely to affect yeast tolerance to low pH and other stresses[47] We also showed an effect of sodium on the modulationof the fatty acid composition after acid stress (Figure 2) Ourfinding is in agreement with observations by Dos Santos


SantrsquoAna et al [29] who reported that the addition of sodiumconferred protection to yeast cells against acid stress Infact addition of sodium slowed depolarization promotedby proton influx The authors suggested that alternativelythe sodium effect could be related to unknown signallingevents in response to acid stress For instance Bollo et al[48] reported an effect of 120mM extracellular NaCl on Ca2+mobilization from intracellular stores in Trypanosoma cruziThe present work showed that sodium through an indirecteffect is able to affect themodulation ofmembrane fatty acidsin acid stress condition

It is well known that cells of most organisms maintainhigh concentration ratios of extracellular to intracellular H+across the plasmamembrane and that stress factors leading todissipation of the H+ gradient across the plasma membraneand to intracellular acidification induce the stimulation ofplasma membrane H+-ATPase activity In this work wecompared the activity of plasma membrane H+-ATPasein different yeast strains exposed to low pH The resultsindicate a H+-ATPase activation following the acid exposureHowever the level of activation as previously suggested andthe great tolerance to acid were dependent on expressionof secondary transport systems involved in maintaining theplasma membrane potential This relationship between acidH+-ATPase activation and secondary systems needs to beclarified by studies of internal pH of membrane potentialand H+-ATPase activity in strains expressing different levelsof a gene family especially those encoding the most impor-tant ionic transporters

In the yeast S cerevisiae calcineurin a heterodimericenzyme consisting of a catalytic (a) subunit and an associatedcalcium binding regulatory (b) subunit is activated underspecific environmental conditions and plays an importantrole in coupling Ca2+ signals to cellular responses Thesensitivity and response of the cells to various stresses aredependent on its ability to sequester and use Ca2+ fromexternal and internal stores Our results show that calciumsignalling participates in acid stress response and that thestress response is calcineurin dependent Crz1 a substratephosphoprotein for calcineurin functions downstream ofcalcineurin to effect calcineurin-dependent responses Via-bility test results show similar phenotypes for cnb1Δ and crz1Δmutants

The response of the yeast S cerevisiae to environmentalstress results in remodelling of gene expression In previousstudies the genome response to acid stress has been evaluatedby DNA microarray analysis and a functional screeningperformed using a gene deletion collection [9 17] Theexpression analysis showed that genes involved in stressresponses such asYGP1TPS1 andHSP150 were upregulatedafter acid shock and that genes involved in metal metabolismor regulated by Aft1p were induced under the acid adaptation[17] The last study also indicated that loss of V-ATPase andHog-MAPK proteins caused acid sensitivity Mildly stressingacidic conditions (eg shift from pH 6 to pH 3) do not affectS cerevisiae growth but instead may be slightly beneficial [8]However proteins in the cell wall have been shown to beupregulated in response to low pH [8 17 49]

Some studies on the effect of acidic pH on yeast showthat PKC cell wall integrity pathway is activated in responseto low pH and that RGD1p (Hog pathway) plays a role inresponse to acidic pH [22ndash24] In more recent work usingscreening deletion mutants and gene expression profile deLucena et al [50] showed that the cell wall integrity pathway isthe main mechanism for cell tolerance to sulphuric acid pH25 and that Ca2+-calmodulin pathway is also responsive tothis type of stress Here we have shown that cytosolic freecalcium levels increase under acid shock and that calcineurinis an important transducer of calcium signals in acid stressresponses

In conclusion the results of the present study showthat the H+ internal concentration of yeast is regulated byseveral systems including the plasmamembraneH+-ATPaseand that Ena1p has an important but undefined role in thecellular response to acid We also demonstrated that theacid stress response is dependent on calcium metabolismand blocked by FK 506 RNA-seq and microarray studiesusing different S cereviseae strains including S boulardii arecurrently being performed to provide some insight into themechanisms of acid stress response In parallel experimentsaiming to characterize the calcium signal (external or inter-nal) and the dependence of the acid response pathway oncalcineurinCrz1p are under way

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

This work was supported by Grants from Fundacao deAmparo a Pesquisa do Estado de Minas Gerais (FAPEMIG)(CBB APQ 00333-10CBB APQ 0048211) and fromConselho Nacional de Desenvolvimento Cientıfico eTecnologico (CNPq) to Ieso Miranda Castro (Process3042592011-0) Julio Cesar Camara Rosa and Ana Paula doCarmo were supported by fellowships from Coordenacao deAperfeicoamento de Pessoal do Ensino Superior (CAPES)English language in the paper was revised by Write ScienceRight (httpwwwwritesciencerightcom)

References

[1] L Trabalzini A Paffetti A Scaloni et al ldquoProteomic responseto physiological fermentation stresses in a wild-type wine strainof Saccharomyces cerevisiaerdquo Biochemical Journal vol 370 no 1pp 35ndash46 2003

[2] M Platara A Ruiz R Serrano A Palomino F Moreno and JArino ldquoThe transcriptional response of the yeast Na+-ATPaseENA1 gene to alkaline stress involves three main signalingpathwaysrdquo The Journal of Biological Chemistry vol 281 no 48pp 36632ndash36642 2006

[3] Y Araki HWuH Kitagaki T Akao H Takagi andH ShimoildquoEthanol stress stimulates the Ca2+-mediated calcineurinCrz1pathway in Saccharomyces cerevisiaerdquo Journal of Bioscience andBioengineering vol 107 no 1 pp 1ndash6 2009


[4] A DaquinagM Fadri S Y Jung J Qin and J Kunz ldquoThe yeastPH domain proteins Slm1 and Slm2 are targets of sphingolipidsignaling during the response to heat stressrdquo Molecular andCellular Biology vol 27 no 2 pp 633ndash650 2007

[5] J Arino ldquoIntegrative responses to high pH stress in S cere-visiaerdquo OMICS A Journal of Integrative Biology vol 14 no 5pp 517ndash523 2010

[6] A P Gasch P T Spellman C M Kao et al ldquoGenomic expres-sion programs in the response of yeast cells to environmentalchangesrdquoMolecular Biology of the Cell vol 11 no 12 pp 4241ndash4257 2000

[7] H F De Melo B M Bonini J Thevelein D A Simoes andM A Morais Jr ldquoPhysiological and molecular analysis of thestress response of Saccharomyces cerevisiae imposed by stronginorganic acid with implication to industrial fermentationsrdquoJournal of Applied Microbiology vol 109 no 1 pp 116ndash127 2010

[8] A K-L Chen C Gelling P L Rogers I W Dawes and BRosche ldquoResponse of Saccharomyces cerevisiae to stress-freeacidificationrdquo Journal of Microbiology vol 47 no 1 pp 1ndash82009

[9] HCCauston B Ren S S K Sang SeokKoh et al ldquoRemodelingof yeast genome expression in response to environmentalchangesrdquo Molecular Biology of the Cell vol 12 no 2 pp 323ndash337 2001

[10] R Serrano A Ruiz D Bernal J R Chambers and J ArinoldquoThe transcriptional response to alkaline pH in Saccharomycescerevisiae evidence for calcium-mediated signallingrdquoMolecularMicrobiology vol 46 no 5 pp 1319ndash1333 2002

[11] R Serrano H Martın A Casamayor and J Arino ldquoSignalingalkaline pH stress in the yeast Saccharomyces cerevisiae throughthe Wsc1 cell surface sensor and the Slt2 MAPK pathwayrdquo TheJournal of Biological Chemistry vol 281 no 52 pp 39785ndash39795 2006

[12] L Viladevall R Serrano A Ruiz et al ldquoCharacterization of thecalcium-mediated response to alkaline stress in SaccharomycescerevisiaerdquoThe Journal of Biological Chemistry vol 279 no 42pp 43614ndash43624 2004

[13] M Karababa E Valentino G Pardini A T Coste J Billeand D Sanglard ldquoCRZ1 a target of the calcineurin pathway inCandida albicansrdquo Molecular Microbiology vol 59 no 5 pp1429ndash1451 2006

[14] H Wang Y Liang B Zhang W Zheng L Xing and M LildquoAlkaline stress triggers an immediate calcium fluctuation inCandida albicansmediated by Rim101p and Crz1p transcriptionfactorsrdquo FEMS Yeast Research vol 11 no 5 pp 430ndash439 2011

[15] S H Denison ldquopH regulation of gene expression in fungirdquoFungal Genetics and Biology vol 29 no 2 pp 61ndash71 2000

[16] MA Penalva J Tilburn E Bignell andHN Arst Jr ldquoAmbientpH gene regulation in fungi making connectionsrdquo Trends inMicrobiology vol 16 no 6 pp 291ndash300 2008

[17] M Kawahata K Masaki T Fujii and H Iefuji ldquoYeast genesinvolved in response to lactic acid and acetic acid acidic con-ditions caused by the organic acids in Saccharomyces cerevisiaecultures induce expression of intracellular metal metabolismgenes regulated by Aft1prdquo FEMS Yeast Research vol 6 no 6pp 924ndash936 2006

[18] P Piper C O Calderon K Hatzixanthis and M MollapourldquoWeak acid adaptation the stress response that confers yeastswith resistance to organic acid food preservativesrdquo Microbiol-ogy vol 147 no 10 pp 2635ndash2642 2001

[19] M G Cabral I Sa-Correia and C A Viegas ldquoAdaptativeresponses in yeast to the herbicide 2-methyl-4- chlorophenoxy-acetic acid at the level of intracellular pH homeostasisrdquo Journalof Applied Microbiology vol 96 no 3 pp 603ndash612 2004

[20] M Mollapour and P W Piper ldquoTargeted gene deletion inZygosaccharomyces bailiirdquoYeast vol 18 no 10 pp 173ndash186 2001

[21] P Eraso andC Gancedo ldquoActivation of yeast plasmamembraneATPase by acid pH during growthrdquo FEBS Letters vol 224 no1 pp 187ndash192 1987

[22] S Claret X Gatti F Doignon D Thoraval and M CrouzetldquoThe Rgd1p Rho GTPase-activating protein and the Mid2p cellwall sensor are required at low pH for protein kinase C path-way activation and cell survival in Saccharomyces cerevisiaerdquoEukaryotic Cell vol 4 no 8 pp 1375ndash1386 2005

[23] XGatti GDeBettignies S Claret FDoignonMCrouzet andD Thoraval ldquoRGD1 encoding a RhoGAP involved in low-pHsurvival is an Msn2pMsn4p regulated gene in Saccharomycescerevisiaerdquo Gene vol 351 pp 159ndash169 2005

[24] H Fernandes O Roumanie S Claret et al ldquoThe Rho3 andRho4 small GTPases interact functionally with Wsc1p a cellsurface sensor of the protein kinase C cell-integrity pathway inSaccharomyces cerevisiaerdquoMicrobiology vol 152 no 3 pp 695ndash708 2006

[25] K W Cunningham ldquoAcidic calcium stores of Saccharomycescerevisiaerdquo Cell Calcium vol 50 no 2 pp 129ndash138 2011

[26] T K Matsumoto A J Ellsmore S G Cessna et al ldquoAn osmot-ically induced cytosolic Ca2+ transient activates calcineurinsignaling to mediate ion homeostasis and salt tolerance ofSaccharomyces cerevisiaerdquo The Journal of Biological Chemistryvol 277 no 36 pp 33075ndash33080 2002

[27] M Bonilla and KW Cunningham ldquoMitogen-activated proteinkinase stimulation of Ca2+ signaling is required for survival ofendoplasmic reticulum stress in yeastrdquoMolecular Biology of theCell vol 14 no 10 pp 4296ndash4305 2003

[28] C-V Popa I Dumitru L L Ruta A F Danet and I CFarcasanu ldquoExogenous oxidative stress induces Ca2+ release inthe yeast Saccharomyces cerevisiaerdquo FEBS Journal vol 277 no19 pp 4027ndash4038 2010

[29] G Dos Santos SantrsquoAna L Da Silva Paes A F Vieira Paiva etal ldquoProtective effect of ions against cell death induced by acidstress in Saccharomycesrdquo FEMS Yeast Research vol 9 no 5 pp701ndash712 2009

[30] T A Krulwich R Agus M Schneier and A A GuffantildquoBuffering capacity of bacilli that grow at different pH rangesrdquoJournal of Bacteriology vol 162 no 2 pp 768ndash772 1985

[31] J Becher Dos Passos M Vanhalewyn R Lopes Brandao IM Castro J R Nicoli and J M Thevelein ldquoGlucose-inducedactivation of plasma membrane H+-ATPase in mutants of theyeast Saccharomyces cerevisiae affected in cAMP metabolismcAMP-dependent protein phosphorylation and the initiationof glycolysisrdquo Biochimica et Biophysica Acta Molecular CellResearch vol 1136 no 1 pp 57ndash67 1992

[32] O H Lowry N J Rosebrough A L Farr and R J RandallldquoProtein measurement with the Folin phenol reagentrdquo TheJournal of Biological Chemistry vol 193 no 1 pp 265ndash275 1951

[33] R Tisi S Baldassa F Belotti and E Martegani ldquoPhospholipaseC is required for glucose-induced calcium influx in buddingyeastrdquo FEBS Letters vol 520 no 1ndash3 pp 133ndash138 2002

[34] M C Pereira N M Vieira M R Totola and M C MKasuya ldquoTotal fatty acid composition in the characterizationand identification of orchid mycorrhizal fungi Epulorhiza spprdquo


Revista Brasileira de Ciencia do Solo vol 35 no 4 pp 1159ndash11652011

[35] C D Cruz Programa genes diversidade genetica [PhD thesis]Universidade Federal de Vicosa Vicosa MG Brazil 2008

[36] J Sambrook E F Fritsch and TManiatisMolecular Cloning ALaboratoryManual Cold SpringHarbor Laboratory Press ColdSpring Harbor NY USA 2nd edition 1989

[37] H Ito Y Fukuda K Murata and A Kimura ldquoTransformationof intact yeast cells treated with alkali cationsrdquo Journal ofBacteriology vol 153 no 1 pp 163ndash168 1983

[38] A Ruiz and J Arino ldquoFunction and regulation of the Sac-charomyces cerevisiae ENA sodium ATPase systemrdquo EukaryoticCell vol 6 no 12 pp 2175ndash2183 2007

[39] M J M Tropia A S Cardoso R Tisi et al ldquoCalcium signalingand sugar-induced activation of plasma membrane H+-ATPasein Saccharomyces cerevisiae cellsrdquo Biochemical and BiophysicalResearch Communications vol 343 no 4 pp 1234ndash1243 2006

[40] Y Zang Q Xie J B Robertson and C H Johnson ldquopHlash anew genetically encoded and ratiometric luminescence sensorof intracellular pHrdquo PLoS ONE vol 7 Article ID 43072 2012

[41] M J Carlisle S C Watkinson and G W Gooday The FungiAcademic Press San Diego Calif USA 2nd edition 2001

[42] R Serrano M C Kielland-Brandt and G R Fink ldquoYeastplasma membrane ATPase is essential for growth and hashomology with (Na+K+) K+ and Ca2+-ATPasesrdquo Nature vol319 no 6055 pp 689ndash693 1986

[43] F Portillo ldquoRegulation of plasma membrane H+-ATPase infungi and plantsrdquo Biochimica et Biophysica Acta Reviews onBiomembranes vol 1469 no 1 pp 31ndash42 2000

[44] V Carmelo H Santos and I Sa-Correia ldquoEffect of extracellularacidification on the activity of plasma membrane ATPase andon the cytosolic and vacuolar pH of Saccharomyces cerevisiaerdquoBiochimica et Biophysica Acta Biomembranes vol 1325 no 1pp 63ndash70 1997

[45] G A Martınez-Munoz and P Kane ldquoVacuolar and plasmamembrane proton pumps collaborate to achieve cytosolic pHhomeostasis in yeastrdquo The Journal of Biological Chemistry vol283 no 29 pp 20309ndash20319 2008

[46] J Ding X Huang L Zhang N Zhao D Yang and K ZhangldquoTolerance and stress response to ethanol in the yeast Saccha-romyces cerevisiaerdquoAppliedMicrobiology andBiotechnology vol85 no 2 pp 253ndash263 2009

[47] N P Mira M Palma J F Guerreiro and I Sa-CorreialdquoGenome-wide identification of Saccharomyces cerevisiae genesrequired for tolerance to acetic acidrdquo Microbial Cell Factoriesvol 9 article 79 2010

[48] M Bollo S Bonansea and E E Machado ldquoInvolvement ofNa+H+ exchanger in the calcium signaling in epimastigotes ofTrypanosoma cruzirdquo FEBS Letters vol 580 no 11 pp 2686ndash2690 2006

[49] J C Kapteyn B Ter Riet E Vink et al ldquoLow external phinduces HOG1-dependent changes in the organization of theSaccharomyces cerevisiae cell wallrdquoMolecular Microbiology vol39 no 2 pp 469ndash479 2001

[50] R M de Lucena C Elsztein D A Simoes andM A Morais JrldquoParticipation of CW1 HOG and calcineurin pathways in thetolerance of Saccharomyces to lowpHby inorganic acidrdquo Journalof Applied Microbiology vol 113 no 3 pp 629ndash640 2012

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


Table 1 Saccharomyces cerevisiae strains used in this study

Strain Genotype SourceS boulardii Wild type FLORATIL Merck SA

W303 119872119886119905120572 leu2-3 112 ura3-1 trp1-1 his3-1115 ade2-1 can1-100 GAL mal SUC2 Johan MThevelein

LBCM 479 W303119872119886119905120572 ena1HIS3ena4 Jose RamosLBCM 690 LBCM479 [p417] This workLBCM 691 LBCM479 [p427] This workLBCM 692 LBCM479 [p417ENA1] This workLBCM 693 LBCM479 [p427ENA1] This workBY4741 MATa his3Δ1 leu2Δ0 lis2Δ0 ura3Δ0 EuroscarfYKL190W BY4741 cnb1KanMX4 EuroscarfYNL027W BY4741 crz1KanMX4 Euroscarf

genes involved in response to lactic acetic and hydrochloricacids suggest that acidic conditions affect cell wall architec-ture the expression of genes involved in metal metabolismvacuolar H+-ATPase (V-ATPase) and HOG MAPK proteinlevels [17]

Similar to the response to weak acids resistance toinorganic acid exposure involves changes in the membraneconductivity to H+ active extrusion of protons from thecell [21] and the modulation of gene expression [8 17]Previous studies have shown that the protein kinase C (PKC)pathway involved in cell integrity in S cerevisiae is activatedin response to acid stress and that this activation is dependenton the cell wall sensor Mid2p [22ndash24] Claret et al havesuggested the existence of two distinct pathways involvingMid2p (cell wall sensor) or Rgd1p (Hog pathway) that acttogether to induce cell integrity pathway and to increaseacidic tolerance [22]

In Saccharomyces cytosolic calciumplays an essential rolein the control of the cell cycle budding process and matingAdditionally cytosolic calcium is an important second mes-senger in eukaryotic cells Yeast cells growing under standardlaboratory conditions exhibit low cytosolic calcium levelsand minimal calcineurin activity [25] Exposure to variousenvironmental stresses such as salt oxidative alkali or heatstress causes immediate changes in the cytosolic calciumCalcium levels first increase and then decline rapidly whenyeast cells are exposed to these conditions [10 14 26ndash28] Crz1is the major effector of calcineurin-regulated gene expressionin S cerevisiae but unidentified targets for calcineurin withroles in stress adaptation also exist [5] The Cch1 and Mid1proteins components of membrane calcium channel andeffectors of Slt2p (PKC pathway) are involved in cell viabilityat low pH in Saccharomyces [22] However calcium-mediatedsignallingmechanisms have not been studied under the acid-shock response

In a previous work carried out in our laboratory weestablished that low concentrations of sodium ions conferredprotection to yeast cells exposed to acid stress [29] Ourobservations also suggested that the systems involved inmaintaining the plasma membrane potential (PMA1p H+-ATPase and secondary transporter systems) were linked tothe acid stress response In the present study we focused

experiments on plasma membrane H+-ATPase participationand on calcium signalling events observed in yeast cells inresponse to acid stress

2 Materials and Methods

21 Yeast Strains and Growth Conditions Table 1 lists theyeast strains used in this study Yeast strains were grown in anorbital shaker (200 rpm) at 30∘C in YPDmedium containing(wv) 1 yeast extract 2 peptone and 2 glucose Cellulargrowth was monitored by optical density (OD) at 600 nm

22 Acid Stress Condition and Viability Assays Yeast cellcultures (OD

600 nm sim 10) were harvested by centrifugationat 4750timesg for 5min and washed twice with YP mediaThen pellets were suspended at an OD600 nm of 10 in anaqueous solution previously adjusted to pH 20 with 1MHCl and supplementedwith 86mMNaClThis conditionwasapplied to every acid treatment performed in this study Yeastsamples were then incubated in an orbital shaker at 30∘Cfor 1 h Aliquots were collected after 0 (control cells beforeacid stress) 15 30 and 60min of incubation Cells wereimmediately washed twice with an equal volume of YP anddiluted 20000times Then 50120583L of cell suspension was seededon YPD agar Plates were incubated at 30∘C for 48 to 72 hThe results were expressed as the percentage () of colonyforming units (cfu) relative to the control sample (119905 = 0)

The growth of yeast cells in the presence of Na+ was testedon a series of YPD plates supplemented with increasing con-centrations of NaCl (200ndash500mM) Tenfold serial dilutionsof cell suspensions were prepared and 5 120583L aliquots of eachwere spotted onto YP plates Growth was monitored over 3days

23 H+ Neutralisation Capacity of the Yeast Cells The capac-ity of cells to neutralise added H+ to a cell suspension wasdetermined by an acid-pulse technique with a pH meterBriefly the pH was measured after the addition of acid pulses[30] To estimate the extracellular capacity to neutraliseadded H+ the cells were grown as previously describedwashed and either exposed (stressed cells) or not (control




600of 10ndash











3 Results



1 2 3 4 5 6 7 8

1000

2000

3000

4000

pH

nmol

H+

mg

of ce

lls

(a)

1 2 3 4 5 6 7 8

1000

2000

3000

4000

pH

nmol

H+

mg

of ce

lls

(b)








Control

Control

30998400

60998400

+ NaCl 30998400

+ NaCl 60998400

30998400

60998400

+ NaCl 30998400

+ NaCl 60998400

S cerevisiae

S boulardii

pH 2

pH 2

pH 2

pH 2

pH 2

pH 2

pH 2

pH 2


0 10 20 30 40 50 6000

02

04

06

08

Time (min)

H+

-ATP

ase a

ctiv

ity(120583

mol


g pr

otei

nminus1)








StrainsConditions




844 plusmn 43lowast

673 plusmn 31lowast





0

500

1000

1500

2000

Time (s)

RLU

s

40 140 240 340 440 540minus60

(a)

0

50

100

150

200

40 140 240 340 440minus60

RLU

s

Time (s)

(b)



4 Discussion


0

50

100

BY4741

Time (min)

Viab

ility

()

0 10 30 60













Acknowledgments


References





























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology




600of 10ndash











3 Results



1 2 3 4 5 6 7 8

1000

2000

3000

4000

pH

nmol

H+

mg

of ce

lls

(a)

1 2 3 4 5 6 7 8

1000

2000

3000

4000

pH

nmol

H+

mg

of ce

lls

(b)








Control

Control

30998400

60998400

+ NaCl 30998400

+ NaCl 60998400

30998400

60998400

+ NaCl 30998400

+ NaCl 60998400

S cerevisiae

S boulardii

pH 2

pH 2

pH 2

pH 2

pH 2

pH 2

pH 2

pH 2


0 10 20 30 40 50 6000

02

04

06

08

Time (min)

H+

-ATP

ase a

ctiv

ity(120583

mol


g pr

otei

nminus1)








StrainsConditions




844 plusmn 43lowast

673 plusmn 31lowast





0

500

1000

1500

2000

Time (s)

RLU

s

40 140 240 340 440 540minus60

(a)

0

50

100

150

200

40 140 240 340 440minus60

RLU

s

Time (s)

(b)



4 Discussion


0

50

100

BY4741

Time (min)

Viab

ility

()

0 10 30 60













Acknowledgments


References





























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


1 2 3 4 5 6 7 8

1000

2000

3000

4000

pH

nmol

H+

mg

of ce

lls

(a)

1 2 3 4 5 6 7 8

1000

2000

3000

4000

pH

nmol

H+

mg

of ce

lls

(b)








Control

Control

30998400

60998400

+ NaCl 30998400

+ NaCl 60998400

30998400

60998400

+ NaCl 30998400

+ NaCl 60998400

S cerevisiae

S boulardii

pH 2

pH 2

pH 2

pH 2

pH 2

pH 2

pH 2

pH 2


0 10 20 30 40 50 6000

02

04

06

08

Time (min)

H+

-ATP

ase a

ctiv

ity(120583

mol


g pr

otei

nminus1)








StrainsConditions




844 plusmn 43lowast

673 plusmn 31lowast





0

500

1000

1500

2000

Time (s)

RLU

s

40 140 240 340 440 540minus60

(a)

0

50

100

150

200

40 140 240 340 440minus60

RLU

s

Time (s)

(b)



4 Discussion


0

50

100

BY4741

Time (min)

Viab

ility

()

0 10 30 60













Acknowledgments


References





























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology



Control

Control

30998400

60998400

+ NaCl 30998400

+ NaCl 60998400

30998400

60998400

+ NaCl 30998400

+ NaCl 60998400

S cerevisiae

S boulardii

pH 2

pH 2

pH 2

pH 2

pH 2

pH 2

pH 2

pH 2


0 10 20 30 40 50 6000

02

04

06

08

Time (min)

H+

-ATP

ase a

ctiv

ity(120583

mol


g pr

otei

nminus1)








StrainsConditions




844 plusmn 43lowast

673 plusmn 31lowast





0

500

1000

1500

2000

Time (s)

RLU

s

40 140 240 340 440 540minus60

(a)

0

50

100

150

200

40 140 240 340 440minus60

RLU

s

Time (s)

(b)



4 Discussion


0

50

100

BY4741

Time (min)

Viab

ility

()

0 10 30 60













Acknowledgments


References





























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology



StrainsConditions




844 plusmn 43lowast

673 plusmn 31lowast





0

500

1000

1500

2000

Time (s)

RLU

s

40 140 240 340 440 540minus60

(a)

0

50

100

150

200

40 140 240 340 440minus60

RLU

s

Time (s)

(b)



4 Discussion


0

50

100

BY4741

Time (min)

Viab

ility

()

0 10 30 60













Acknowledgments


References





























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology










Acknowledgments


References





























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

research article investigating acid stress response in...

Documents