research article genetic diversity of eight domestic goat populations raised...

Research ArticleGenetic Diversity of Eight Domestic Goat PopulationsRaised in Turkey

Zafer Bulut1 Ercan Kurar2 Yusuf Ozsensoy3

Vahdettin Altunok1 and Mehmet Nizamlioglu1

1Faculty of Veterinary Medicine Department of Biochemistry Selcuk University 42031 Konya Turkey2Meram Faculty of Medicine Department of Medical Biology Necmettin Erbakan University 42080 Konya Turkey3Faculty of Veterinary Medicine Department of Biometrics and Genetics Cumhuriyet University 58140 Sivas Turkey

Correspondence should be addressed to Zafer Bulut zbulutselcukedutr

Received 13 January 2016 Revised 10 March 2016 Accepted 13 March 2016

Academic Editor Giuseppe Piccione

Copyright copy 2016 Zafer Bulut et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

The objective of this study was to determine the intra- and intergenetic diversities of eight different goat populations in Turkeyincluding Hair Angora Kilis Yayladag Shami Honamli Saanen and Alpine A total of 244 DNA samples were genotyped using11 microsatellites loci The genetic differentiation between breeds was considerable as a result of the statistically significant (119875 lt0001) pairwise 119865ST values of each pair of breeds Exceptionally 119865ST values calculated for Honamli and Hair breeds were statisticallynonsignificant (119875 gt 005) Heterozygosity values ranged between 062 and 073 According to the structure and assignment testAngora and Yayladag goats were assigned to the breed they belong to while other breeds were assigned to two or more differentgroups Because this study for the first time presented genetic data on the Yayladag goat results of structure analysis and assignedtest suggest that further analyses are needed using additional and different molecular markers

1 Introduction

While goat breeding has decreased between 1991 and 2009the number of Hair goats continuously and significantlyincreased between 2009 and 2014 in Turkey Among goatpopulations Hair goat is the predominant (98) type raisedin Turkey [1] Although Hair goat is most widely rearedin the Mediterranean Aegean and Southeastern Anatolianregions it is considered themost commonnative breed raisednationwide Angora goat is raised in the Central Anatoliaregion primarily in Ankara as well as in a few provinces ofthe Southeastern Anatolia and Eastern Anatolia regions [2]Kilis goat is distributed in the Southeastern Anatolia regionprimarily in Gaziantep Kilis and Hatay provinces Honamligoat is reared in the Mediterranean region in the foothillsof the Taurus Mountains primarily in Konya Isparta andAntalya provinces [2] Compared to other populations Saa-nen Alpine Shami and Yayladag goats are rarer in Turkeyhowever other goat populations except for Hair and Tiftikgoats have not been included in TUIK data [1] In Turkey

there were no data or information particularly about thepopulation reported as Yayladag goat in the present studyYayladag and Shami goats are raised in the southern partof Turkey mainly in Hatay Province and close to the Syrianborder Phenotypic population and geographical propertiesof these breeds were described in detail elsewhere [3 4]

The earliest phylogenetic analysis of goat populations inTurkey comprises protein and enzyme polymorphism [5ndash7]However microsatellite markers are widely used in geneticcharacterization studies The genetic relation between dif-ferent goat populations was investigated using microsatellitemarkers in various countries [8ndash11] It was reported thatmicrosatellites had been most frequently used in geneticcharacterization studies conducted in Asian and Africancountries [12] In Turkey genetic diversity studies withmicrosatellites had been conducted in goat [13] cattle [14 15]and horse [16] populations

Determination of genetic structure and genetic character-ization of animals is the first step in developing gene sourcesprotection strategies Therefore the present study aimed to

Hindawi Publishing CorporationBioMed Research InternationalVolume 2016 Article ID 2830394 6 pageshttpdxdoiorg10115520162830394

2 BioMed Research International

Table 1 Microsatellites used in the study

Locus Chromosome Primer sequence Allele range (bp)Forward (51015840 rarr 31015840) Reverse (51015840 rarr 31015840)

MAF70 4 cacggagtcacaaagagtcagacc gcaggactctacggggcctttgc 134ndash168INRA023 3 gagtagagctacaagataaacttc taactacagggtgttagatgaact 196ndash215SPS113 10 cctccacacaggcttctctgactt cctaacttgcttgagttattgccc 134ndash158CSRD247 14 ggacttgccagaactctgcaat cactgtggtttgtattagtcagg 220ndash247McM527 5 gtccattgcctcaaatcaattc aaaccacttgactactccccaa 165ndash187ILSTS087 28 agcagacatgatgactcagc ctgcctcttttcttgagag 135ndash155BM6444 2 ctctgggtacaacactgagtcc tagagagtttccctgtccatcc 118ndash200P19 (DYA) 20 aacaccatcaaacagtaagag catagtaacagatcttcctaca 160ndash196TCRVB6 Unknown gagtcctcagcaagcaggtc ccaggaattggatcacacct 217ndash255DRBP1 23 atggtgcagcagcaaggtgagca gggactcagtctctctatctctttg 195ndash229ETH10 5 gttcaggactggccctgctaaca cctccagcccactttctcttctc 200ndash210

Table 2 Microsatellite markers and observed number of alleles

Loci PopulationKilis Yayladag Shami Honamli Saanen Hair Angora Alpine Total

SPS113 7 6 6 7 9 7 10 5 11McM527 8 5 6 7 6 7 6 6 10CSRD247 10 7 9 8 6 8 9 8 11BM6444 16 13 18 17 15 20 25 10 33ILSTS087 7 5 6 8 7 9 8 6 10TCRVB6 12 10 9 11 9 11 12 8 14DRBP1 6 8 6 6 4 6 8 4 14MAF70 7 11 11 9 9 11 9 7 18ETH10 4 6 5 5 4 6 8 4 14P19 (DYA) 8 7 11 10 10 9 8 7 13INRA023 8 8 9 6 4 6 8 5 12Mean 845 782 873 855 755 909 1009 636 1455

investigate genetic diversity among some goat populations inTurkey using microsatellite markers Also this study is thefirst report regarding Yayladag goat population

2 Materials and Methods

21 Samples In the present study a total of 244 bloodsamples which were obtained from Kilis (119899 = 32) Yayladag(119899 = 32) Shami (119899 = 32) Honamli (119899 = 32) Saanen(119899 = 28) Hair (119899 = 32) Angora (119899 = 43) and Alpine(119899 = 13) goat populations were drawn into tubes containingK3-EDTA DNA isolation was performed using standard

phenolchloroform method [17] The study was approved bySelcuk University Veterinary Faculty Experimental AnimalResearch Ethical Committee (decision number 201569)

22 Methods Genomic DNAs were amplified by Poly-merase Chain Reaction (PCR) using 11microsatellitemarkers(Table 1) which were selected from the list recommendedby the United Nations Food and Agriculture Organization(FAO) and International Society of Animal Genetics (ISAG)As per the PCR protocol 1x Mg++ free PCR buffer (Fermen-tas) 200120583M dNTP (Fermentas) 15mM MgCl++ 0375 unitTaq polymerase (Fermentas) 5 pmol of each primary pair(Table 1) and 50ndash100 ng template DNA were used in a singlereaction Each PCR reactionwas prepared as 15 120583L in volume

PCRs were performed at two steps using MJ ResearchPTC-200 Thermal Cycler After a complete denaturationat 95∘C for 2 minutes step I consisted of denaturation at94∘C for 45 seconds for five cycles annealing at 59∘C for45 seconds and elongation at 72∘C for 30 seconds Step IIconsisted of a total of 30 cycles each including 94∘C for30 seconds 60∘C for 30 seconds and 72∘C for 20 secondsFinally a complete adenylation was enabled by keeping thesamples at 72∘C for 10 minutes

The resulting PCR products were loaded onto a BeckmanCoulter CEQndash8000 Genetic Analysis System and allele geno-types were identified eluting by capillary electrophoresis

23 Statistical Analysis Number of alleles (Na) expected(He) and observed (Ho) heterozygosity levels 119865-statisticsfactorial correspondence analysis (FCA) phylogenetictrees (NJT) and structure analysis were determined usingGenAlEx6 [18] Population 10 [19] TreeWiev [20] GENETIX40 [21] and Structure v22 [22] package programs

3 ResultsAmong general population parameters number of observedalleles (Na Table 2) expected (He) and observed (Ho) het-erozygosity levels (Table 3) NJT (Figure 1) FCA (Figure 2)and structure (Figure 3) were summarized

BioMed Research International 3

Table 3 Observed (Ho) and expected (He) heterozygosities at eleven microsatellite loci

Loci HoHePopulation

Kilis(119899 = 32)

Yayladag(119899 = 32)

Shami(119899 = 32)

Honamli(119899 = 32)

Saanen(119899 = 28)

Hair(119899 = 32)

Angora(119899 = 43)

Alpine(119899 = 13)

SPS113 Ho 0600 0692 0781 0767 0893 0862 0707 0923He 0729 0661 0709 0756 0821 0807 0801 0769

McM527 Ho 0700 0704 0594 0700 0704 0759 0675 0692He 0761 0604 0733 0704 0645 0754 0690 0710

CSRD247 Ho 0833 0926 0844 0967 0607 0767 0805 0846He 0819 0791 0797 0845 0612 0812 0842 0793

BM6444 Ho 0875 0875 0938 0903 0704 0774 0805 0833He 0863 0863 0917 0877 0867 0851 0903 0858

ILSTS087 Ho 0469 0656 0656 0813 0704 0781 0575 0727He 0484 0635 0667 0756 0769 0748 0525 0702

TCRVB6 Ho 0875 0969 0781 0844 0630 0871 0744 0692He 0896 0854 0853 0819 0755 0869 0858 0669

DRBP1 Ho 0281 0406 0387 0188 0464 0219 0550 0222He 0738 0669 0687 0446 0576 0487 0747 0451

MAF70 Ho 0677 0688 0806 0742 0643 0813 0732 0769He 0779 0763 0836 0797 0738 0796 0784 0757

ETH10 Ho 0531 0281 0484 0688 0321 0625 0800 0750He 0703 0579 0673 0558 0427 0608 0704 0681

P19 (DYA) Ho 0625 0452 0833 0719 0643 0656 0860 0700He 0767 0789 0821 0821 0841 0815 0855 0810

INRA023 Ho 0688 0935 0900 0625 0519 0548 0667 0500He 0691 0817 0835 0488 0445 0445 0733 0705

Mean Ho 0650 0689 0728 0723 0621 0698 0720 0696He 0748 0729 0775 0715 0681 0727 0767 0719

Saanen

Yayladag

Honamli

Hair

Kilis

Shami

Angora

Alpine

25

19

34

87

82

77

Figure 1 Neighbor-joining tree indicating phylogenetic relation-ship between Turkish native goat breeds

In the present study a total of 160 different alleles wereobserved and the mean Na was found to be 1455The highestnumber of alleles (33 alleles) was observed in BM6444whereas the lowest number of alleles (10 alleles) was observedin McM527 and ILSTS087 markers

It was determined that the mean Ho level changedbetween 0188 and 0969 whereas the mean He levels wereobserved between 0427 and 0917 (Table 3) Mean Ho and

minus5000

minus100minus

90minus

80minus

70minus

60minus

50minus

40minus

30minus

20minus

100

10

20

30

40

50

60

70

80

90

100110

0 5000 10000 15000 20000 25000

YayladagKilisAlpineShami

Angora

Axe 1 (2531)

Axe

2 (2

239

)

Axe 3

(166

3)

Saan

en

HonamliHair

minus6000minus4000minus20000

20004000600080001

00001

2000

Figure 2 The FCA plot of the populations

He levels were similar in general and heterozygosity amongpopulations was generally high

In order to evaluate genetic variation between popula-tions Wrightrsquos 119865-statistics was used and 119865ST values werebetween 0005 and 0125 (Table 4) Total 119865ST value (0075)calculated for all loci was found to be statistically important(119875 lt 0001)

When the tree showing phylogenetic relation was ana-lyzed by neighbor-joining tree (NJT) method using 119863

119860


Table 4 119865ST (lower diagonal) and 119863119860 (upper diagonal) values

Kilis Yayladag Shami Honamli Saanen Hair Angora AlpineKilis mdash 0252 0131 0191 0225 0176 0176 0221Yayladag 0075lowastlowastlowast mdash 0254 0215 0321 0207 0285 0293Shami 0038lowastlowastlowast 0072lowastlowastlowast mdash 0178 0226 0170 0207 0248Honamli 0079lowastlowastlowast 0080lowastlowastlowast 0072lowastlowastlowast mdash 0194 0071 0247 0269Saanen 0110lowastlowastlowast 0125lowastlowastlowast 0104lowastlowastlowast 0070lowastlowastlowast mdash 0174 0262 0262Hair 0074lowastlowastlowast 0078lowastlowastlowast 0075lowastlowastlowast 0005 ns 0062lowastlowastlowast mdash 0210 0254Angora 0049lowastlowastlowast 0086lowastlowastlowast 0057lowastlowastlowast 0090lowastlowastlowast 0108lowastlowastlowast 0078lowastlowastlowast mdash 0198Alpine 0054lowastlowastlowast 0099lowastlowastlowast 0071lowastlowastlowast 0094lowastlowastlowast 0090lowastlowastlowast 0084lowastlowastlowast 0046lowastlowastlowast mdash(lowastlowastlowast119875 lt 0001 ns nonsignificant)

Kilis

Yayl

adag

Sham

i

Hon

amli

Saan

en

Hai

r

Ang

ora

Alp

ine

100080060040020000

Figure 3 Structure analysis

genetic distance values of Nei it was observed that the popu-lations have been clustered in three main groups (Figure 1)Among these Saanen Yayladag Honamli and Hair wereclustered together The other groups including Kilis andShami Angora and Alpine populations were separated indifferent radiation

Factorial correspondence analysis (FCA) was performedto determine the genetic relation between the individualsused in the study and each individual was placed on 3-dimensional plane according to their genotypes (Figure 2)Individuals of Ankara Saanen and Yayladag populationsusually formed their own groups However it was observedthat the subjects of other goat populationswere grouped closeto each other but did not much differ

Structure test was performed to identify which popula-tion or populations the study subjects belong to as well asgroup them (Figure 3) 119870 = 4 analyses revealed that allpopulations differed from each other and that Angora Alpinand Yayladag populations in particular are more pure breedcompared to the others

4 Discussion

The mean number of alleles observed in the study (1455)and the number of alleles at each loci (10ndash33) were close tothe findings of the other study which was also conducted inTurkish goat populations using 20microsatellitemarkers [13]Three loci (CSRD247 MAF70 and INRA023) were the samebetween these studies and numbers of alleles were similaralthough the highest number of alleles was reported between7 and 24 in other goat populations [8 23ndash28]

The mean Ho and He values (0690 and 0733 resp)found in the present study were higher than those found ingoat genetic characterization studies conducted in differentcountries using different numbers of microsatellites [29ndash31]Moreover Na Ho and He values reported in almost all Asianand African countries [12] were lower than those obtainedin the present study These results indicate higher geneticdiversity among Turkish goat populationsThe reason for thismight be the facts that Turkey is located on migration routeand is close to the initial domestication centers [32 33]

In a genetic study conducted using 13 microsatellites 6indigenous Iranian goat populations were separated into twomain groups based on phylogenetic tree and FCA analysis[34] Mitochondrial DNA analysis of local Chinese goat pop-ulations [35] revealed that they formed 4 haplogroups and theresults were consistent with archeological and genetic studiesIn addition genetic characterization studies which wereperformed using 30 microsatellites [36] reported that thepopulations which were raised in northwest and southwestas two sets in accordance with their geographical regionsheaped up within themselves

In the present study it was observed that Honamli andHair goat populations grouped together on the NJT Thissuggests that there is high relationship between Honamliand Hair goats and that gene flow is possible as they areraised in close geographical regions In addition FCA graphdemonstrated that Honamli and Hair goats grouped togetherin line with these findings Assignment test was performedto identify the populations using genotypic data and it wasobserved that animals were generally (93) assigned intheir own populations It was determined that 8 differentpopulations which were used also in the structure test werediscriminated from each other and that Angora Alpineand Yayladag were more pure breed compared to otherpopulations Results of assignment and structure analysesrevealed that microsatellites used in the study are very usefulin discriminating the populations

There is no data or information in Turkey about Yayladaggoat population used in the present study However previousresearch [37 38] indicated that Hatay goat was obtained byhybridization of Hair times Kilis However Yayladag does notseem to be genetically so close to Hair or Kilis Althoughthey appear in the same group on NJT Yayladag is groupedas a different population in the FCA and structure analyses


It was thought that suitable geographical structure of Hatayprovince for goat breeding and presence of many populationsmay be effective in the formation of a new genotype

In conclusion microsatellites are quite reliable markersto be used in the studies to investigate genetic variety andgenetic structures of populations and to determine whetherthe subjects belong to the claimed populations In additionthere is need for further studies using different markerssystem to obtain additional data on Yayladag goat

Disclosure

The study has been presented as an abstract at the XXXIConference of the International Society for Animal Genetics

Competing Interests

The authors declare that they have no competing interests

Acknowledgments

This research was supported by Selcuk University BAP(Project no 05401104)

References

[1] TUIK ldquoHayvansal Uretim Istatistiklerirdquo December 2015httpwwwtuikgovtrPreIstatistikTablodoistab id=682

[2] M Keskin O Gokdal O Atay and A Konyalı ldquoTurkiyersquodeyetistirilen keci ırklarırdquo Tarım Turk vol 35 no 7 pp 71ndash742012

[3] TAGEM ldquoTurkiye Evcil Hayvan Genetik Kaynakları TanıtımKatalogurdquo Ankara Turkey 2009httpwwwtarimgovtrTAGEMBelgeleryayinKatalog20TC3BCrkC3A7epdf

[4] O K Agaoglu andO Ertugrul ldquoAssessment of genetic diversitygenetic relationship and bottleneck using microsatellites insome native Turkish goat breedsrdquo Small Ruminant Research vol105 no 1ndash3 pp 53ndash60 2012

[5] C Elmacı and S Asal ldquoAnkara kecilerinde transferin (beta-globulin) polimorfizmirdquo Turkish Journal of Veterinary andAnimal Sciences vol 22 no 4 pp 321ndash323 1998

[6] O Ertugrul and B Akyuz ldquoHalk elinde yetistirilen Ankarakecilerinde (Capra hircus) bazı kan protein polimorfizmirdquoAnkara Universitesi Veteriner Fakultesi Dergisi vol 47 no 1 pp23ndash29 2000

[7] V Altunok M Nizamlıoglu and Z Bulut ldquoAnkara kecileriningenetik yapılarının nisasta jel elektroforezi yontemiyle arastırıl-masırdquo Veteriner Bilimleri Dergisi vol 21 no 2 pp 67ndash72 2007

[8] M-H Li S-H Zhao C Bian et al ldquoGenetic relationshipsamong twelve Chinese indigenous goat populations based onmicrosatellite analysisrdquo Genetics Selection Evolution vol 34 no6 pp 729ndash744 2002

[9] R Behl N Sheoran J Behl R K Vijh and M S TantialdquoAnalysis of 22 heterologous microsatellite markers for geneticvariability in Indian goatsrdquo Animal Biotechnology vol 14 no 2pp 167ndash175 2003

[10] OM Jandurova T Kott B Kottova andV Czernekova ldquoSevenmicrosatellitemarkers useful for determining genetic variabilityinWhite andBrown Short-Haired goat breedsrdquo Small RuminantResearch vol 52 no 3 pp 271ndash274 2004

[11] Y-J Zhang Y-Z Zhao Y-Q Liu Y Li S-H Sun and H-XXing ldquoGenetic polymorphism of 4 microsatellites DNA in 3goat populations and relationshipwith heterosisrdquoYi Chuan vol26 no 5 pp 631ndash636 2004

[12] F M M T Marikar and M M Musthafa ldquoUsefulness of shortsequence repeat markers in goat genetic diversity studies on theAsian andAfrican continentsrdquoTurkish Journal of Veterinary andAnimal Sciences vol 38 no 6 pp 606ndash611 2014


[14] Y Ozsensoy E Kurar Z Bulut and M Nizamlioglu ldquoY chro-mosome analysis of native Turkish cattle breeds by microsatel-lite markersrdquo Turkish Journal of Biology vol 38 no 3 pp 388ndash395 2014

[15] Y Ozsensoy E KurarM Dogan et al ldquoTurkiyersquode bulunan bazıyerli sıgır ırklarının STR markorler ile genetik karakterizasy-onurdquo Biyoloji Bilimleri Arastırma Dergisi vol 3 no 1 pp 163ndash171 2010

[16] S Aksu D Aktopraklıgil E Koban et al ldquoGen kaynaklarınınve biyocesitliligin korunması kapsamında yerli at ırklarınıngenetik karakterizasyonurdquo Biyoloji Bilimleri Arastırma Dergisivol 3 no 1 pp 129ndash138 2010

[17] J Sambrook E F Fritsch and T ManiatisMolecular ClonningA Laboratory Manual vol 2 Cold-Spring Harbor New YorkNY USA 2nd edition 1989

[18] R Peakall and P E Smouse ldquoGENALEX 6 genetic analysis inexcel Population genetic software for teaching and researchrdquoMolecular Ecology Notes vol 6 no 1 pp 288ndash295 2006

[19] D B Goldstein and D D Pollock ldquoLaunching microsatellitesa review of mutation processes and methods of phylogeneticinferencerdquo Journal of Heredity vol 88 no 5 pp 335ndash342 1997

[20] RDM Page ldquoTreeView an application to display phylogenetictrees on personal computersrdquo Computer Applications in theBiosciences vol 12 no 4 pp 357ndash358 1996

[21] K Belkhir P Borsa L Chikhi J Goudet and F BonhommeGenetix 400 Windows Software Population Genetics Labora-toire Genome Populations Interactions University of Mont-pellier Montpellier France 1996ndash2000

[22] D Falush M Stephens and J K Pritchard ldquoInference ofpopulation structure usingmultilocus genotype data dominantmarkers and null allelesrdquoMolecular Ecology Notes vol 7 no 4pp 574ndash578 2007

[23] G Luikart M-P Biju-Duval O Ertugrul Y Zagdsuren CMaudet and P Taberlet ldquoPower of 22 microsatellite markersin fluorescent multiplexes for parentage testing in goats (Caprahircus)rdquo Animal Genetics vol 30 no 6 pp 431ndash438 1999

[24] A M de Araujo S E F Guimaraes T M M Machado et alldquoGenetic diversity between herds of Alpine and Saanen dairygoats and the naturalized BrazilianMoxoto breedrdquoGenetics andMolecular Biology vol 29 no 1 pp 67ndash74 2006

[25] S Bolormaa A Ruvinsky S Walkden-Brown and J van derWerf ldquoDNA-based parentage verification in twoAustralian goatherdsrdquo Small Ruminant Research vol 80 no 1ndash3 pp 95ndash1002008

[26] M Siwek and E F Knol ldquoParental reconstruction in ruralgoat population with microsatellite markersrdquo Italian Journal ofAnimal Science vol 9 no 3 article e50 2010

[27] C Visser E V Marle Koster and H Friedrich ldquoParentageverification of South African Angora goats using microsatellite


markersrdquo South African Journal of Animal Sciences vol 41 no3 pp 250ndash255 2011

[28] R S Aljumaah M M Musthafa M A Al-Shaikh O M Badriand M F Hussein ldquoGenetic diversity of Ardi goat based onmicrosatellite analysisrdquo African Journal of Biotechnology vol 11no 100 pp 16539ndash16545 2012

[29] AMMartınez M P Carrera J M Acosta et al ldquoGenetic char-acterisation of the Blanca Andaluza goat based onmicrosatellitemarkersrdquo South African Journal of Animal Sciences vol 34 no5 supplement 1 pp 17ndash19 2004

[30] C Visser C A Hefer E van Marle-Koster and A KotzeldquoGenetic variation of three commercial and three indigenousgoat populations in South Africardquo South African Journal ofAnimal Sciences vol 34 no 5 supplement 1 pp 24ndash27 2004

[31] B Fan J-L Han S-L Chen et al ldquoIndividual-breed assign-ments in caprine populations using microsatellite DNA analy-sisrdquo Small Ruminant Research vol 75 no 2-3 pp 154ndash161 2008

[32] G Luikart L Gielly L Excoffier J-D Vigne J Bouvet andP Taberlet ldquoMultiple maternal origins and weak phylogeo-graphic structure in domestic goatsrdquo Proceedings of the NationalAcademy of Sciences of the United States of America vol 98 no10 pp 5927ndash5932 2001

[33] M W Bruford D G Bradley and G Luikart ldquoDNA mark-ers reveal the complexity of livestock domesticationrdquo NatureReviews Genetics vol 4 no 11 pp 900ndash910 2003

[34] B Mahmoudi B Panahi S A Mohammadi M Daliri andM S Babayev ldquoMicrosatellite based phylogeny and bottle-neck studies of Iranian indigenous goat populationsrdquo AnimalBiotechnology vol 25 no 3 pp 210ndash222 2014

[35] Y Zhao R Zhao Z Zhao H Xu E Zhao and J ZhangldquoGenetic diversity and molecular phylogeography of Chinesedomestic goats by large-scale mitochondrial DNA analysisrdquoMolecular Biology Reports vol 41 no 6 pp 3695ndash3704 2014

[36] C Wei J Lu L Xu et al ldquoGenetic structure of Chineseindigenous goats and the special geographical structure in theSouthwest China as a geographic barrier driving the fragmen-tation of a large populationrdquo PLoS ONE vol 9 no 4 Article IDe94435 2014

[37] M Keskin and O Bicer ldquoHatay bolgesinde yetistirilen kecilerinbazı morfolojik ve fizyolojik ozelliklerirdquo Journal of AgriculturalFaculty MKU vol 2 no 1 pp 73ndash86 1997

[38] O Bicer M Keskin S Kaya and S Gul ldquoComparison of somelactation characteristics of Hatay goat with Taurus dairy goatX Hatay goat crossbreedsrdquo in Animal Production and NaturalResources Utilisation in the Mediterranean Mountain Areas AGeorgoudis A Rosati and C Mosconi Eds pp 287ndash291Wageningen Academic Publishers Wageningen Netherlands2005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


Table 1 Microsatellites used in the study

Locus Chromosome Primer sequence Allele range (bp)Forward (51015840 rarr 31015840) Reverse (51015840 rarr 31015840)

MAF70 4 cacggagtcacaaagagtcagacc gcaggactctacggggcctttgc 134ndash168INRA023 3 gagtagagctacaagataaacttc taactacagggtgttagatgaact 196ndash215SPS113 10 cctccacacaggcttctctgactt cctaacttgcttgagttattgccc 134ndash158CSRD247 14 ggacttgccagaactctgcaat cactgtggtttgtattagtcagg 220ndash247McM527 5 gtccattgcctcaaatcaattc aaaccacttgactactccccaa 165ndash187ILSTS087 28 agcagacatgatgactcagc ctgcctcttttcttgagag 135ndash155BM6444 2 ctctgggtacaacactgagtcc tagagagtttccctgtccatcc 118ndash200P19 (DYA) 20 aacaccatcaaacagtaagag catagtaacagatcttcctaca 160ndash196TCRVB6 Unknown gagtcctcagcaagcaggtc ccaggaattggatcacacct 217ndash255DRBP1 23 atggtgcagcagcaaggtgagca gggactcagtctctctatctctttg 195ndash229ETH10 5 gttcaggactggccctgctaaca cctccagcccactttctcttctc 200ndash210

Table 2 Microsatellite markers and observed number of alleles

Loci PopulationKilis Yayladag Shami Honamli Saanen Hair Angora Alpine Total

SPS113 7 6 6 7 9 7 10 5 11McM527 8 5 6 7 6 7 6 6 10CSRD247 10 7 9 8 6 8 9 8 11BM6444 16 13 18 17 15 20 25 10 33ILSTS087 7 5 6 8 7 9 8 6 10TCRVB6 12 10 9 11 9 11 12 8 14DRBP1 6 8 6 6 4 6 8 4 14MAF70 7 11 11 9 9 11 9 7 18ETH10 4 6 5 5 4 6 8 4 14P19 (DYA) 8 7 11 10 10 9 8 7 13INRA023 8 8 9 6 4 6 8 5 12Mean 845 782 873 855 755 909 1009 636 1455

investigate genetic diversity among some goat populations inTurkey using microsatellite markers Also this study is thefirst report regarding Yayladag goat population

2 Materials and Methods

21 Samples In the present study a total of 244 bloodsamples which were obtained from Kilis (119899 = 32) Yayladag(119899 = 32) Shami (119899 = 32) Honamli (119899 = 32) Saanen(119899 = 28) Hair (119899 = 32) Angora (119899 = 43) and Alpine(119899 = 13) goat populations were drawn into tubes containingK3-EDTA DNA isolation was performed using standard

phenolchloroform method [17] The study was approved bySelcuk University Veterinary Faculty Experimental AnimalResearch Ethical Committee (decision number 201569)

22 Methods Genomic DNAs were amplified by Poly-merase Chain Reaction (PCR) using 11microsatellitemarkers(Table 1) which were selected from the list recommendedby the United Nations Food and Agriculture Organization(FAO) and International Society of Animal Genetics (ISAG)As per the PCR protocol 1x Mg++ free PCR buffer (Fermen-tas) 200120583M dNTP (Fermentas) 15mM MgCl++ 0375 unitTaq polymerase (Fermentas) 5 pmol of each primary pair(Table 1) and 50ndash100 ng template DNA were used in a singlereaction Each PCR reactionwas prepared as 15 120583L in volume

PCRs were performed at two steps using MJ ResearchPTC-200 Thermal Cycler After a complete denaturationat 95∘C for 2 minutes step I consisted of denaturation at94∘C for 45 seconds for five cycles annealing at 59∘C for45 seconds and elongation at 72∘C for 30 seconds Step IIconsisted of a total of 30 cycles each including 94∘C for30 seconds 60∘C for 30 seconds and 72∘C for 20 secondsFinally a complete adenylation was enabled by keeping thesamples at 72∘C for 10 minutes

The resulting PCR products were loaded onto a BeckmanCoulter CEQndash8000 Genetic Analysis System and allele geno-types were identified eluting by capillary electrophoresis

23 Statistical Analysis Number of alleles (Na) expected(He) and observed (Ho) heterozygosity levels 119865-statisticsfactorial correspondence analysis (FCA) phylogenetictrees (NJT) and structure analysis were determined usingGenAlEx6 [18] Population 10 [19] TreeWiev [20] GENETIX40 [21] and Structure v22 [22] package programs

3 ResultsAmong general population parameters number of observedalleles (Na Table 2) expected (He) and observed (Ho) het-erozygosity levels (Table 3) NJT (Figure 1) FCA (Figure 2)and structure (Figure 3) were summarized



Loci HoHePopulation

Kilis(119899 = 32)

Yayladag(119899 = 32)

Shami(119899 = 32)

Honamli(119899 = 32)

Saanen(119899 = 28)

Hair(119899 = 32)

Angora(119899 = 43)

Alpine(119899 = 13)

SPS113 Ho 0600 0692 0781 0767 0893 0862 0707 0923He 0729 0661 0709 0756 0821 0807 0801 0769

McM527 Ho 0700 0704 0594 0700 0704 0759 0675 0692He 0761 0604 0733 0704 0645 0754 0690 0710

CSRD247 Ho 0833 0926 0844 0967 0607 0767 0805 0846He 0819 0791 0797 0845 0612 0812 0842 0793

BM6444 Ho 0875 0875 0938 0903 0704 0774 0805 0833He 0863 0863 0917 0877 0867 0851 0903 0858

ILSTS087 Ho 0469 0656 0656 0813 0704 0781 0575 0727He 0484 0635 0667 0756 0769 0748 0525 0702

TCRVB6 Ho 0875 0969 0781 0844 0630 0871 0744 0692He 0896 0854 0853 0819 0755 0869 0858 0669

DRBP1 Ho 0281 0406 0387 0188 0464 0219 0550 0222He 0738 0669 0687 0446 0576 0487 0747 0451

MAF70 Ho 0677 0688 0806 0742 0643 0813 0732 0769He 0779 0763 0836 0797 0738 0796 0784 0757

ETH10 Ho 0531 0281 0484 0688 0321 0625 0800 0750He 0703 0579 0673 0558 0427 0608 0704 0681

P19 (DYA) Ho 0625 0452 0833 0719 0643 0656 0860 0700He 0767 0789 0821 0821 0841 0815 0855 0810

INRA023 Ho 0688 0935 0900 0625 0519 0548 0667 0500He 0691 0817 0835 0488 0445 0445 0733 0705

Mean Ho 0650 0689 0728 0723 0621 0698 0720 0696He 0748 0729 0775 0715 0681 0727 0767 0719

Saanen

Yayladag

Honamli

Hair

Kilis

Shami

Angora

Alpine

25

19

34

87

82

77




minus5000

minus100minus

90minus

80minus

70minus

60minus

50minus

40minus

30minus

20minus

100

10

20

30

40

50

60

70

80

90

100110

0 5000 10000 15000 20000 25000


Angora

Axe 1 (2531)

Axe

2 (2

239

)

Axe 3

(166

3)

Saan

en

HonamliHair


20004000600080001

00001

2000





119860




Kilis

Yayl

adag

Sham

i

Hon

amli

Saan

en

Hai

r

Ang

ora

Alp

ine

100080060040020000





4 Discussion









Disclosure


Competing Interests


Acknowledgments


References
















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology



Loci HoHePopulation

Kilis(119899 = 32)

Yayladag(119899 = 32)

Shami(119899 = 32)

Honamli(119899 = 32)

Saanen(119899 = 28)

Hair(119899 = 32)

Angora(119899 = 43)

Alpine(119899 = 13)

SPS113 Ho 0600 0692 0781 0767 0893 0862 0707 0923He 0729 0661 0709 0756 0821 0807 0801 0769

McM527 Ho 0700 0704 0594 0700 0704 0759 0675 0692He 0761 0604 0733 0704 0645 0754 0690 0710

CSRD247 Ho 0833 0926 0844 0967 0607 0767 0805 0846He 0819 0791 0797 0845 0612 0812 0842 0793

BM6444 Ho 0875 0875 0938 0903 0704 0774 0805 0833He 0863 0863 0917 0877 0867 0851 0903 0858

ILSTS087 Ho 0469 0656 0656 0813 0704 0781 0575 0727He 0484 0635 0667 0756 0769 0748 0525 0702

TCRVB6 Ho 0875 0969 0781 0844 0630 0871 0744 0692He 0896 0854 0853 0819 0755 0869 0858 0669

DRBP1 Ho 0281 0406 0387 0188 0464 0219 0550 0222He 0738 0669 0687 0446 0576 0487 0747 0451

MAF70 Ho 0677 0688 0806 0742 0643 0813 0732 0769He 0779 0763 0836 0797 0738 0796 0784 0757

ETH10 Ho 0531 0281 0484 0688 0321 0625 0800 0750He 0703 0579 0673 0558 0427 0608 0704 0681

P19 (DYA) Ho 0625 0452 0833 0719 0643 0656 0860 0700He 0767 0789 0821 0821 0841 0815 0855 0810

INRA023 Ho 0688 0935 0900 0625 0519 0548 0667 0500He 0691 0817 0835 0488 0445 0445 0733 0705

Mean Ho 0650 0689 0728 0723 0621 0698 0720 0696He 0748 0729 0775 0715 0681 0727 0767 0719

Saanen

Yayladag

Honamli

Hair

Kilis

Shami

Angora

Alpine

25

19

34

87

82

77




minus5000

minus100minus

90minus

80minus

70minus

60minus

50minus

40minus

30minus

20minus

100

10

20

30

40

50

60

70

80

90

100110

0 5000 10000 15000 20000 25000


Angora

Axe 1 (2531)

Axe

2 (2

239

)

Axe 3

(166

3)

Saan

en

HonamliHair


20004000600080001

00001

2000





119860




Kilis

Yayl

adag

Sham

i

Hon

amli

Saan

en

Hai

r

Ang

ora

Alp

ine

100080060040020000





4 Discussion









Disclosure


Competing Interests


Acknowledgments


References
















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology




Kilis

Yayl

adag

Sham

i

Hon

amli

Saan

en

Hai

r

Ang

ora

Alp

ine

100080060040020000





4 Discussion









Disclosure


Competing Interests


Acknowledgments


References
















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology




Disclosure


Competing Interests


Acknowledgments


References
















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology





















Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

research article genetic diversity of eight domestic goat populations raised...

Documents