research article eucalyptus tree: a potential source of

Research ArticleEucalyptus Tree A Potential Source ofCryptococcus neoformans in Egyptian Environment

Mahmoud Elhariri1 Dalia Hamza2 Rehab Elhelw1 and Mohamed Refai1

1Department of Microbiology Faculty of Veterinary Medicine Cairo University Giza 12211 Egypt2Department of Zoonoses Faculty of Veterinary Medicine Cairo University Giza 12211 Egypt

Correspondence should be addressed to Mahmoud Elhariri mahmoud elhaririyahoocom andDalia Hamza dodo zoonosisyahoocom

Received 16 June 2015 Revised 22 September 2015 Accepted 27 September 2015

Academic Editor Joseph Falkinham

Copyright copy 2016 Mahmoud Elhariri et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

In Egypt the River Red Gum (Eucalyptus camaldulensis) is a well-known tree and is highly appreciated by the rural and urbandwellers The role of Eucalyptus trees in the ecology of Cryptococcus neoformans is documented worldwide The aim of this surveywas to show the prevalence of C neoformans during the flowering season of E camaldulensis at the Delta region in Egypt Threehundred and eleven samples out of two hundred Eucalyptus trees including leaves flowers and woody trunks were collectedfrom four governorates in the Delta regionThirteen isolates of C neoformanswere recovered from Eucalyptus tree samples (42)Molecular identification of C neoformans was done by capsular gene specific primer CAP64 and serotype identification was donedepending on LAC1 gene This study represents an update on the ecology of C neoformans associated with Eucalyptus tree inEgyptian environment

1 Introduction

The basidiomycetes yeast of genus Cryptococcus includes CneoformansC gattii species complex which is composed oftwo separate species C neoformans and C deneoformansand five species within C gattii The most clinically relevantcomplex species were recently revised based on phenotypicand genotypic diversity supported by the presence of distinctand consistent lines and it proposes to recognize C neofor-mans var grubii (represented by genotypes VNI and VNII)and C neoformans (VNIII and VNIV) as separate species aswell as five species ofC gattii (represented by genotypes VGIVGII VGIII and VGIV) [1 2]

C neoformans has a worldwide distribution and has beenrecovered from pigeon droppings (Columba livia) urbanenvironments and soilManyreportshave shown the presenceofC neoformans inthehollowsofdifferent tree species propos-ing that trees play a major role in Cryptococcus infection[3 4] The most common isolate responsible for this fungalinfection is C neoformans var grubii serotype A [1 5ndash7]

C gattii has been proposed to have a specific ecologicalassociation with a number of Eucalyptus species [8]

E camaldulensis is a well-known tree in Egypt since it wasimported by Mohamed Ali the Governor of Egypt (1805ndash1848) for fixing the River Nile banks in the 19th century Itis one of the most widely distributed trees in most of thearid and semiarid areas This kind of tree exists on almostevery roadside in Egypt but there are no data about its roleas potential carrier of fungal elements

In Egypt the incidence of Cryptococcus neoformans fromEucalyptus trees and pigeon droppings has been reported[9] In this report the author depended on the conven-tional differentiation methods to determine C neoformansvarieties There is no recent noticeable information aboutthe Eucalyptus tree role in the ecology of C neoformansin Egyptian environment Therefore the present study wasaimed at determining the possible role of this tree as apotential dispersing source of C neoformans in Delta regionrsquosenvironment

Hindawi Publishing CorporationInternational Journal of MicrobiologyVolume 2016 Article ID 4080725 5 pageshttpdxdoiorg10115520164080725

2 International Journal of Microbiology

Table 1 Eucalyptus tree collected samples in the Delta region

Governorate Tree number Samples type TotalLeaves Flowers Wood trunks

Giza 50 40 25 30 95Cairo 50 31 13 15 59Al-Sharqia 50 50 30 30 110Elmenofia 50 17 20 10 47Total 200 138 88 85 311

2 Materials and Methods

21 Study Area and Sampling Collection The study area inDelta region covered 240 kilometers (150mi) of Mediter-ranean coastline of Egypt A total 311 samples out of 200Eucalyptus trees including leaves flowers andwoody trunkswere collected from four different governorates in the Deltaregion (Cairo Giza Elmenofia Al-Sharqia) by the rate offifty samples for each region (Table 1) The samples werestored on ice in clean sterile plastic bags and transferred tothe Microbiology Department laboratory Faculty of Veteri-nary Medicine The samples were rinsed in sterile distilledwater then immersed in sterile saline solution supplementedwith chloramphenicol (100mgmL) and homogenized withultrahomogenization for 4minThe bottle was left for 30minat room temperature to settle the sediment

22 Isolation and Identification From the supernatant fluidof each homogenized sample a loopful was streaked ontoplates of Sabouraud dextrose agar with chloramphenicol andincubated at 30∘C for 48 hours The colonies suspected to beC neoformanswere streaked on Eucalyptus leaves agar media[12] The isolates were identified by classical mycologicalprocedures of C neoformans [13]

23 Molecular Characterization

231 DNA Extraction The yeast cells from SDA slants werecollected after 48-hour incubation with sterile PBS Thecollected pellets were mixed into a microtube with 500 120583LTES (100mM Tris pH 80 10mM EDTA and 2 SDS)50ndash100 120583g Proteinase K from an appropriate stock solutionwas added and then incubated for 30min (minimum) upto 1 h at 55∘ndash60∘C with occasional gentle mixing The lysatemix salt concentration was adjusted to 14M with 5M NaCl(=140 120583L) 110 vol (=65 120583L) of 10 CTAB was added andincubated for 30min at 65∘C The lysate was mixed gentlyand then incubated for 30min at 0∘C finally the mix wascentrifuged for 10min at 4∘C at 15000 rpm The supernatantwas transferred to a 15mL tube followed by the addition of055 vol isopropanol (=510 120583L) to precipitate DNA followedby immediate centrifugation for 5min at 15000 rpm

24 Molecular Identification by Capsular Gene Detectionof C neoformans was done by using specific capsular geneprimersCAP64The primers forCAP64were designed on thebasis of DNA sequences (Table 2) [10]

Figure 1 Brown color effect of C neoformans on Eucalyptus leavesagarmedia white colonies ofC albicans negative control and brownpigmented colonies of positive control and environmental isolates

25 Molecular Differentiation of Serotypes This was appliedby subjecting genomic DNA of identified strains by CAP64gene to multiplex PCR amplification using a set of fourprimers of the laccase gene (LAC1) (Table 2) which were usedfor differentiating four major serotypes A D B and C of Cneoformans [11]

3 Results

31 Recovery Rate of C neoformans from Eucalyptus camaldu-lensis In this studyE camaldulensis trees acted as a potentialrefuge for C neoformans A total of 13 (42) C neoformansisolates out of 311 examined samples in Delta region wererecovered during the flowering season of Eucalyptus treeAll the recovered Cryptococcus isolates were identified as Cneoformans strains based on all conventional and physiolog-ical characters of C neoformans (Figure 1) Among these 7isolates (79) were recovered from 88 Eucalyptus flowers5 isolates (36) were recovered from 138 Eucalyptus treeleaves and 1 isolate (11) was recovered from 85 woody trunks(Table 3)

32 Molecular Identification and Differentiation of C neofor-mans All tested isolates and reference strain were produced(400 bp) by CAP64 specific capsular gene primer (Figure 2)Molecular typing of C neoformans isolates was done byfour primers for LAC1 gene (Table 2) which were usedfor amplification serotype A strains produced three DNAfragments with sizes of 088 076 and 025 kb (Figure 3) Alltested C neoformans strains were identified as C neoformansvar grubii and there are no other serotypes of C neoformansdetected

4 Discussion

In Egypt Eucalyptus trees are in abundance mainly as wind-breaks and for afforestation of the drains and canals or other

International Journal of Microbiology 3

Table 2 Primers used in this study

Primer Primer sequence 31015840-51015840 PCR product Reference

CAP64 GCCAAGGGAGTCTTATATGGGCAAAGGGTTCACCAAATCG 400 bp [10]

LAC1GGAACAGCAACCACACTACTGCATATTGGGTGGCATCTTACTGAGGGACCAGGGAACATGTTGTTGACGTTGTGGAAGGCAAAGAAAC

250 bp760 bp880 bp

[11]

Table 3 Recovery rate and distribution of C neoformans in tested Eucalyptus trees sampled in the Delta region

Total samples Giza Cairo Al-Sharqia Elmenofia Total Recovery rateNumber of C neoformans isolates

Leaves 138 1 1 2 1 5 36Flowers 88 1 1 3 2 7 79Woody trunks 85 1 0 0 0 1 11Total 311 3 2 5 3 13 42

Figure 2 Agarose gel electropheresis of CAP64 gene specific PCRof all the examined C neoformans isolates with production ofamplicons of 400 bp marker 100 bp DNA ladder (Jena Bioscience)

Figure 3 Agarose gel electropheresis of LAC1 gene specific PCRof all the examined C neoformans isolates with production ofamplicons of 250 760 and 880 bp marker 100 bp DNA plus ladder(Jena Bioscience)

watercourses plus the highways and roads in rural or urbanareas E camaldulensis has a potential role in C neoformansecology particularly var gattii In Australia (home countryof E camaldulensis) Ellis and Pfeiffer 1990 reported thefirst environmental isolation of C gattii from wood barkleaves and plant debris of Eucalyptus trees [14] AlthoughEucalyptus is present in many of the areas known to haveC gattii cryptococcosis the actual isolation of C gattii fromEucalyptus trees is rare outsideAustraliaMoreover importedEucalyptus has not been associated with the environmentalpresence of C gattii in Spain Central Africa Canada PapuaNew Guinea Egypt and Italy [15]

On the African level the isolation of C gattii fromthe environment is somewhat limited in comparison to theisolation of C neoformans Only two cases were recordedin isolation of C gattii from E camaldulensis in Africancountries Egypt [9] and Tunisia [16]

In Egypt earlier report ofMahmoud (1999) [9] dependedon canavanine-glycine-bromothymol blue (CGB) agar to

determine C neoformans variety which evoked a high needto investigate the environmental ecology of this fungusdepending on molecular techniques to determine the actualvariety of C neoformans in relation to E camaldulensis inorder to establish a real surveillance program and applyingthe preventive measures for this pathogen infection

This study was applied on Eucalyptus trees during theflowering season as most C neoformans and C gattiireported cases were associated with Eucalyptus showingstrong seasonality in its occurrence which coincides with theperiods of flowering [17]

The results show that the isolation of C neoformans fromEucalyptus flowers is more frequent than from leaves andwoody trunk (Table 3) All examined isolates were identifiedas C neoformans var grubii with a recovery rate of 42 ofthe total examined samples It is normally the high isolationrate of var grubii as the global distributed isolate responsiblefor cryptococcal infection [1 5ndash7] Also it is commonly therecovering ofC neoformans from pigeon droppings soil anddecaying wood in hollow trees [3]

Ambitiously the present study documents the first recordfor the isolation of var grubii from E camaldulensis leavesflower and woody trunks in Egypt Most of the previousreports stated that C grubii association with Eucalyptus treesor other types of trees is interpreted in one sentence ldquoCneoformans presence might represent fecal contamination bybirds inhabiting these treesrdquo [9 14 16]

Globally many reports are recorded for isolation of Cgrubii from Eucalyptus tree parts or other types of treesIn India more than one report states that C grubii treeassociation and its distribution differ from each part of treeor season or time of the study The prevalence of C grubii(556) andC gattii (926) fromdecayedwood inside trunkhollows of diverse tree species was reported [18]

Recently C grubii was isolated from the bark of Euca-lyptus trees followed by flower bud fruit and detritus [19]The prevalence of C grubii in this study (42) is somewhatnear to the rate of Nawange et alrsquos (2006) [18] study (55)while the recovery rate ofC grubii is the highest from flowers


(79) then leaves (36) and finally woody trunks (11)(Table 3)

In sunny countries C neoformans can escape from lethaleffects of sunlight and drying by taking trees as a good naturalhabitat in the environment because these pathogens can liveinside woody debris as well as trunk hollowsThe result ofthe present study highlighted the potential role of tree partsof E camaldulensis in environmental ecology of C grubiiEucalyptus flowers were the best natural habitat and a suitabletransporting means for these pathogen infectious propagulesin the surrounding environment Flowering season of Euca-lyptus tree is mainly in winter and spring from Novemberto February At this time of year in Egypt the temperatureis slightly low to temperate which gives a potential chancefor isolation of this pathogen The association between Cgrubii and tree is controlled by many environmental factorsincluding humidity temperature and solar radiation [13 17]

In Egypt the Eucalyptus tree exists almost along everyroadside especially in the Delta region around River Nile andits tributaries These study results confirm the potential roleof Eucalyptus trees as a major source for C grubii in Egyptianenvironment which act as a high risk for immunocompro-mised patients

Most of the reported cases of human cryptococcosiswere registered as cryptococcal meningitis Cryptococcalmeningitis in Egypt is rarely diagnosed but this may bedue to inadequate investigation rather than absence ofdefinite epidemiological data about the organism in EgyptMore attention should be considered for human cases ofunexplained chronic meningitis that is not responding toconventional therapy as C neoformans could be the maincause of such fetal meningitis [20ndash23]

The only survey for fungal meningitis was done in Egyptat NAMRU-3 during the period of 1998 to 2001 of 1000 CSFsamples where 10 C neoformans were recovered at a rate of001 All isolates belonged to serotype A (C neoformans vargrubii) [24] Recently C neoformans serotype A is the mostcommon variety in association of pet birds droppings in theEgyptian environment [25]

This studyrsquos findings come in the same direction withthe previous surveillance of the main causes of cryptococcalinfection in Egypt and it confirmed that C neoformans vargrubii is the main etiological agent of cryptococcal infectionin Egypt

Conclusively this is the first record describing isolationof C neoformans var grubii from E camaldulensis in Africaand Egypt The results highlighted the potential role and riskof Eucalyptus tree as a carrier reservoir of one of the highpathogenic fungal elements in Egypt

Conflict of Interests

There is no conflict of interests

References

[1] W Meyer A Castaneda S Jackson et al ldquoMolecular typingof IberoAmerican Cryptococcus neoformans isolatesrdquo EmergingInfectious Diseases vol 9 no 2 pp 189ndash195 2003

[2] F Hagen K Khayhan B Theelen et al ldquoRecognition of sevenspecies in the Cryptococcus gattiiCryptococcus neoformansspecies complexrdquo Fungal Genetics and Biology vol 78 pp 16ndash48 2015

[3] M S Lazera M A Salmito Cavalcanti A T Londero L TrillesM M Nishikawa and B Wanke ldquoPossible primary ecologicalniche of Cryptococcus neoformansrdquo Medical Mycology vol 38no 5 pp 379ndash383 2000

[4] D Castro e Silva D Santos M Martins L Oliveira M Szeszsand M Melhem ldquoFirst isolation of Cryptococcus neoformansgenotype VNI MAT-alpha from wood inside hollow trunks ofHymenaea courbarirdquoMedical Mycology 2015

[5] A K Casali L Goulart L K Rosa e Silva et al ldquoMoleculartyping of clinical and environmental Cryptococcus neoformansisolates in the Brazilian state Rio Grande do Sulrdquo FEMS YeastResearch vol 3 no 4 pp 405ndash415 2003

[6] W Meyer K Marszewska M Amirmostofian et al ldquoMoleculartyping of global isolates of Cryptococcus neoformans var neo-formans by polymerase chain reaction fingerprinting and ran-domly amplified polymorphicDNA a pilot study to standardizetechniques on which to base a detailed epidemiological surveyrdquoElectrophoresis vol 20 no 8 pp 1790ndash1799 1999

[7] M A Viviani M Cogliati M C Esposto et al ldquoMolecularanalysis of 311 Cryptococcus neoformans isolates from a 30-month ECMMsurvey of cryptococcosis in Europerdquo FEMSYeastResearch vol 6 no 4 pp 614ndash619 2006

[8] T J Pfeiffer and D H Ellis ldquoEcology of Cryptococcus neo-formans var gattiirdquo in Proceedings of the 2nd InternationalConference on Cryptococcus amp Cryptococcosis vol 42 MilanItaly 1983

[9] Y A-G Mahmoud ldquoFirst environmental isolation of Cryp-tococcus neoformans var neoformans and var gatti from theGharbia Governorate Egyptrdquo Mycopathologia vol 148 no 2pp 83ndash86 1999

[10] Y C Chang L A Penoyer and K J Kwon-Chung ldquoThe secondcapsule gene of Cryptococcus neoformans CAP64 is essentialfor virulencerdquo Infection and Immunity vol 64 no 6 pp 1977ndash1983 1996

[11] S Ito-Kuwa K Nakamura S Aoki and V Vidotto ldquoSerotypeidentification of Cryptococcus neoformans by multiplex PCRrdquoMycoses vol 50 no 4 pp 277ndash281 2007

[12] M Refai M R Kotb H Abo El-Yazeed W Tawakkol RElAarosi and M El-Hariri ldquoDevelopment of brown coloniesand capsule of Cryptococcus neoformans on plant extract agarand media containing oils Mycologyrdquo in Proceedings of theAnnual Meeting of the German-Speaking Mycological Society(DMykG rsquo05) vol 3 pp 25ndash27 2005

[13] D P Granados and E Castaneda ldquoIsolation and character-ization of Cryptococcus neoformans varieties recovered fromnatural sources in Bogota Colombia and study of ecologicalconditions in the areardquoMicrobial Ecology vol 49 no 2 pp 282ndash290 2005

[14] D H Ellis and T J Pfeiffer ldquoNatural habitat of Cryptococcusneoformans var gattiirdquo Journal of Clinical Microbiology vol 28no 7 pp 1642ndash1644 1990

[15] D J Springer and V Chaturvedi ldquoProjecting global occurrenceof Cryptococcus gattiirdquo Emerging Infectious Diseases vol 16 no1 pp 14ndash20 2010

[16] F Mseddi A Sellami M A Jarboui H Sellami F Makniand A Ayadi ldquoFirst environmental isolations of Cryptococcusneoformans and Cryptococcus gattii in Tunisia and review


of published studies on environmental isolations in AfricardquoMycopathologia vol 171 no 5 pp 355ndash360 2011

[17] H Montenegro and C R Paula ldquoEnvironmental isolation ofCryptococcus neoformans var gattii and C neoformans varneoformans in the city of Sao Paulo Brazilrdquo Medical Mycologyvol 38 no 5 pp 385ndash390 2000

[18] S R Nawange K Shakya J Naidu S M Singh N Jhariaand S Garg ldquoDecayed wood inside hollow trunks of livingtrees of Tamarindus indica Syzygium cumini and Mangiferaindica as natural habitat of Cryptococcus neoformans and theirserotypes in Jabalpur City of Central Indiardquo Journal de Mycolo-gie Medicale vol 16 no 2 pp 63ndash71 2006

[19] N G Bedi S R Nawange S M Singh J Naidu and AKavishwar ldquoSeasonal prevalence of Cryptococcus neoformansvar grubii and Cryptococcus gattii inhabiting Eucalyptus terreti-cornis and Eucalyptus camaldulensis trees in Jabalpur City ofMadhya Pradesh Central Indiardquo Journal deMycologieMedicalevol 22 no 4 pp 341ndash347 2012

[20] N I Girgis Z Farid H H Youssef A HafezM NHassan andC K Wallace ldquoFatal cryptococcal meningitis in four Egyptianpatientsrdquo Ain Shams Medical Journal vol 36 pp 93ndash99 1985

[21] A Soliman D Tribble M Louis et al ldquoCryptococcal meningitisin Cairo Egypt report of five casesrdquo Transactions of the RoyalSociety of Tropical Medicine and Hygiene vol 89 no 4 p 4101995

[22] H A Abdel-Salam ldquoCharacterization of Cryptococcus neofor-mans var neoformans serotype A and AD in samples fromEgyptrdquo Folia Microbiologica vol 48 no 2 pp 261ndash268 2003

[23] A Mansour I Nakhla M El Sherif Y A Sultan and R WFrench ldquoCryptococcus neoformans var gattii meningitis inEgypt a case reportrdquo EasternMediterraneanHealth Journal vol12 no 1-2 pp 241ndash244 2006

[24] M L Elias A K Soliman F J Mahoney et al ldquoIsolation ofCryptococcus Candida Aspergillus Rhodotorula and Nocardiafrom meningitis patients in EgyptrdquoThe Journal of the EgyptianPublic Health Association vol 84 no 1-2 pp 169ndash181 2009

[25] M Elhariri D Hamza R Elhelw and M Refai ldquoLovebirdsand cockatiels risk reservoir of Cryptococcus neoformans apotential hazard to human healthrdquo Journal of Veterinary Scienceamp Medical Diagnosis vol 4 no 4 2015

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


Table 1 Eucalyptus tree collected samples in the Delta region

Governorate Tree number Samples type TotalLeaves Flowers Wood trunks

Giza 50 40 25 30 95Cairo 50 31 13 15 59Al-Sharqia 50 50 30 30 110Elmenofia 50 17 20 10 47Total 200 138 88 85 311

2 Materials and Methods

21 Study Area and Sampling Collection The study area inDelta region covered 240 kilometers (150mi) of Mediter-ranean coastline of Egypt A total 311 samples out of 200Eucalyptus trees including leaves flowers andwoody trunkswere collected from four different governorates in the Deltaregion (Cairo Giza Elmenofia Al-Sharqia) by the rate offifty samples for each region (Table 1) The samples werestored on ice in clean sterile plastic bags and transferred tothe Microbiology Department laboratory Faculty of Veteri-nary Medicine The samples were rinsed in sterile distilledwater then immersed in sterile saline solution supplementedwith chloramphenicol (100mgmL) and homogenized withultrahomogenization for 4minThe bottle was left for 30minat room temperature to settle the sediment

22 Isolation and Identification From the supernatant fluidof each homogenized sample a loopful was streaked ontoplates of Sabouraud dextrose agar with chloramphenicol andincubated at 30∘C for 48 hours The colonies suspected to beC neoformanswere streaked on Eucalyptus leaves agar media[12] The isolates were identified by classical mycologicalprocedures of C neoformans [13]

23 Molecular Characterization

231 DNA Extraction The yeast cells from SDA slants werecollected after 48-hour incubation with sterile PBS Thecollected pellets were mixed into a microtube with 500 120583LTES (100mM Tris pH 80 10mM EDTA and 2 SDS)50ndash100 120583g Proteinase K from an appropriate stock solutionwas added and then incubated for 30min (minimum) upto 1 h at 55∘ndash60∘C with occasional gentle mixing The lysatemix salt concentration was adjusted to 14M with 5M NaCl(=140 120583L) 110 vol (=65 120583L) of 10 CTAB was added andincubated for 30min at 65∘C The lysate was mixed gentlyand then incubated for 30min at 0∘C finally the mix wascentrifuged for 10min at 4∘C at 15000 rpm The supernatantwas transferred to a 15mL tube followed by the addition of055 vol isopropanol (=510 120583L) to precipitate DNA followedby immediate centrifugation for 5min at 15000 rpm

24 Molecular Identification by Capsular Gene Detectionof C neoformans was done by using specific capsular geneprimersCAP64The primers forCAP64were designed on thebasis of DNA sequences (Table 2) [10]

Figure 1 Brown color effect of C neoformans on Eucalyptus leavesagarmedia white colonies ofC albicans negative control and brownpigmented colonies of positive control and environmental isolates

25 Molecular Differentiation of Serotypes This was appliedby subjecting genomic DNA of identified strains by CAP64gene to multiplex PCR amplification using a set of fourprimers of the laccase gene (LAC1) (Table 2) which were usedfor differentiating four major serotypes A D B and C of Cneoformans [11]

3 Results

31 Recovery Rate of C neoformans from Eucalyptus camaldu-lensis In this studyE camaldulensis trees acted as a potentialrefuge for C neoformans A total of 13 (42) C neoformansisolates out of 311 examined samples in Delta region wererecovered during the flowering season of Eucalyptus treeAll the recovered Cryptococcus isolates were identified as Cneoformans strains based on all conventional and physiolog-ical characters of C neoformans (Figure 1) Among these 7isolates (79) were recovered from 88 Eucalyptus flowers5 isolates (36) were recovered from 138 Eucalyptus treeleaves and 1 isolate (11) was recovered from 85 woody trunks(Table 3)

32 Molecular Identification and Differentiation of C neofor-mans All tested isolates and reference strain were produced(400 bp) by CAP64 specific capsular gene primer (Figure 2)Molecular typing of C neoformans isolates was done byfour primers for LAC1 gene (Table 2) which were usedfor amplification serotype A strains produced three DNAfragments with sizes of 088 076 and 025 kb (Figure 3) Alltested C neoformans strains were identified as C neoformansvar grubii and there are no other serotypes of C neoformansdetected

4 Discussion

In Egypt Eucalyptus trees are in abundance mainly as wind-breaks and for afforestation of the drains and canals or other






250 bp760 bp880 bp

[11]

























References



































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology






250 bp760 bp880 bp

[11]

























References



































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology











References



































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology



















Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

research article eucalyptus tree: a potential source of

Documents