CentralBringing Excellence in Open Access

Cite this article: Hakhverdyan M, Mamadatokhonova G, Belák S (2016) Development of a TaqMan Real-Time PCR Assay for the Rapid Detection of Bovine Adenovirus Serotypes in Cattle. J Vet Med Res 3(3): 1051.

Journal of Veterinary Medicine and Research

*Corresponding authorMikhayil Hakhverdyan, Department of Microbiology, The National Veterinary Institute, Ulls väg 2B, SE-75189, Sweden, Tel: 46-18-674313; Email:

Submitted: 30 May 2016

Accepted: 16 June 2016

Published: 12 August 2016

ISSN: 2378-931X

Copyright© 2016 Hakhverdyan et al.

OPEN ACCESS

Keywords•Bovine adenovirus•BAdV•Detection•Real-time PCR•TaqMan

Research Article

Development of a TaqMan Real-Time PCR Assay for the Rapid Detection of Bovine Adenovirus Serotypes in CattleMikhayil Hakhverdyan1*, Guldasta Mamadatokhonova2, and Sándor Belák3

1Department of Microbiology, The National Veterinary Institute, Sweden2Laboratory of Animal Viral Disease Diagnostics, State Enterprise “Institute of Biosafety Problem”, Tajik Academy of Agricultural Science, Tajikistan3Department of Biomedical Sciences and Veterinary Public Health, Swedish University of Agricultural Sciences, Sweden

Abstract

The aim of this work was to develop a sensitive and specific real - time PCR diagnostic assay for the rapid detection and identification of bovine adenoviruses (BAdVs) in cattle. A TaqMan real - time PCR assay, capable of simultaneous detection of nine out of ten BAdV serotypes (species) belonging to the genera Atadenovirus and Mastadenovirus, was developed. The oligonucleotide primers and probe were selected from conserved sequences flanking the genome region coding for the hexon protein. DNA from BAdV serotypes 1 to 10 was isolated by standard phenol - chloroform extraction. Standard curve using a ten - fold dilution series of BAdV-8 positive DNA template was generated. The sensitivity of assay was determined using BAdV-8 cloned PCR product and the detection limit was five copies of viral genome equivalents. The efficiency of PCR assay was 97%. BAdV-2 was the only serotype, which was not detected. BAdV-7 has shown low amplification rates and fluorescence due to four mismatches in the probe region. In conclusion, the real - time PCR assay presented here is expected to be a useful and practical alternative tool to the traditional diagnostic methods like virus isolation, ELISA or conventional PCR for the simple and rapid diagnosis of adenovirus infections in Bovidae.

ABBREVIATIONSBAdV: Bovine Adenovirus; BRSV: Bovine Respiratory

Syncytial Virus; BCoV: Bovine Corona Virus; RSV: Respiratory Syncytial Virus; BVDV: Bovine Viral Diarrhea Virus; PCR: Polymerase Chain Reaction; BHQ: Black Hole Quencher; BSA: Bovine Serum Albumin; EDTA: Ethylenediaminetetraacetic acid; ELISA: Enzyme-Linked Immunosorbent Assay; VI: Virus Isolation

INTRODUCTIONThe adenoviruses, so named because initial isolations were

made from human adenoids [1], are associated with a range of disease manifestations and/or symptom - free infections in various host species. Adenoviruses are capable to infect multiple host species and the number of species range is steadily increasing [2]. Many human and animal adenoviruses cause natural outbreaks and bring to acute respiratory or gastro enteric diseases, sometimes leading to death, but in general,

they are not pathogenic [3-5]. Adenoviruses represent a large family of double - stranded DNA viruses. So far, over 100 distinct mammalian adenoviruses have been isolated from the various hosts and discovery of novel adenoviruses is continuously extended [6-12]. According to the official taxonomy, the family Adenoviridae consists of five genera comprising viruses isolated from birds, mammals, amphibians, reptiles and fish [2,13]. The sixth proposed genus provisionally named Testadenovirus with representatives from testudinoid turtles is also suggested [5,14]. Bovine adenoviruses (BAdVs) were first isolated from cattle [15], and later from other animals including sheep, buffalo and fallow deer [16]. They are distributed worldwide, and often a specific serotype (species) dominates at a specific geographical region [17]. At least 10 serotypes of bovine adenovirus are presently recognized [18] and are designated as bovine adenovirus serotypes 1 through 10. These serotypes were further divided into two subgroups. At present, the former BAdV subgroup I (BAdV-1 to 3, BAdV-9 and BAdV-10) belongs to the genus

CentralBringing Excellence in Open Access

Hakhverdyan et al. (2016)Email:

J Vet Med Res 3(3): 1051 (2016) 2/7

Mastadenovirus, and the former BAdV subgroup II (BAdV-4 to 8) have been assigned to the new genus Atadenovirus, together with avian adenovirus “egg drop syndrome virus” of fowl. The latest accepted serotype BAdV-10 is distinct from the other BAdVs, but several studies demonstrate that it has similar genome arrangement characteristics as Mastadenoviruses [19,20]. Despite being assigned to this genus, BAdV-10 is very different from other members of Mastadenovirus and occupies a special place in a certain distance from the other members of this subgroup [21]. For example, the degree of similarity exhibited between the BAdV-10 and BAdV-1, BAdV-2 protease was only 51, 5%, BAdV-3 - 56, 3%, BAdV-4 - 36, 0%, BAdV-7 - 33, 0% [20]. Probably, BAdV-10 is not a genuine bovine adenovirus, but might originate from another species and is now in an adaptation process to a new host, cattle.

The timely application of powerful, highly sensitive and specific diagnostic tools is crucial for the proper control of adenoviral diseases and for the prevention/reduction of economic and socio-economic losses. The improper or delayed diagnosis may contribute to the spread of infections and to the occurrence of considerable losses in the cattle populations.

Considering the importance of the diseases caused by BAdV, various diagnostic procedures have been developed so far, e.g., in situ hybridization, electron microscopy, fluorescent antibody assays, DNA restriction enzyme analysis, virus isolation (VI), and enzyme linked immunosorbent assay (ELISA) [21-25]. VI is/has been the most common laboratory method for the direct detection of bovine adenoviruses. The strength of the method is that in case of proper cell cultures and skills, VI is able to detect a wide range of adenoviruses and it yields viral strains, which are very important during the characterization of viral infection biology, for development of diagnostic procedures, as well as for the production of vaccines, among other important tasks. The weaker aspects of VI are that it is time consuming, rather expensive and it requires proper expertise in classical diagnostic virology. The ELISA assays are sensitive and specific, but they require the use of viral protein specific antibodies for detection [26].

The rapid detection of viral infections is important for the immediate introduction of appropriate measures for controlling disease transmission in the population and among herds. PCR assays provide a highly sensitive and specific tool for investigating the significance of adenovirus serotypes [27]. At present, one of the most sensitive and practical diagnostic tools for the direct detection and identification of different BAdV serotypes are the various PCR assays. A number of conventional, nested or real-time PCR assays have been developed so far. In general, the advantages of the PCR methods are the rapidity and the relatively easy applicability. The disadvantages are that these assays detect either individual BAdV serotypes [28-32] or it is necessary to use complex packages, such as several primer sets and two PCR assays, in order to detect successfully different BAdV serotypes in environmental samples [33,34]. Although the nested PCR is undoubtedly effective, the practical application is rather complicated and it takes many steps to achieve the results: two rounds of amplification, gel electrophoresis and photography. The repeated amplification not only delays the

results, but also increases the risk of cross - contamination. Moreover, gel electrophoresis and photography in gel - based PCR may include handling of ethidium bromide, which with its carcinogenic effects presents hazards to the health of laboratory personal. Real - time PCR is a good alternative detection method that is widely accepted due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry over contamination.

The main aim of the present work was to develop a sensitive and specific real - time PCR diagnostic assay for the rapid detection of adenovirus in cattle. The results indicated that real - time PCR provides useful tools for the rapid detection of BAdV and for tracking the origin of the viruses in various host species.

MATERIALS AND METHODS

Samples

Cell cultures of BAdV serotypes 1 to 10 were obtained from the Veterinary Science Division, Stormont (Belfast, UK). Twenty - four random fecal samples were collected from calves with respiratory and/or diarrhea signs from different farms in Sweden.

Isolation of DNA

DNA of cell culture samples was isolated by standard phenol - chloroform extraction. Briefly, 166 µl of BAdV cell culture was mixed with 33 µl of 6X Proteinase K buffer, 5 µl of Proteinase K (Roche, Germany) and incubated at 56°C for one hour. DNA was extracted with phenol/chloroform/isoamyl alcohol (25:24:1), cleaned with 200 µl of chloroform and precipitated with two volumes of 95% ethanol in the presence of 0.3M sodium acetate (pH 5.2) overnight at -20°C. The precipitated DNA was centrifuged at 13500 X g for 30 min and the pellet was recovered in 50 µl of sterile water. Concentration of nucleic acids was measured using NanoDrop® ND-1000 spectrophotometer (NanoDrop® Technologies, Wilmington, DE, USA). DNA stored at -70°C until further analysis.

DNA of fecal samples was isolated with Genovision M48 extraction robot and MagAttract Virus Mini Kit protocol (Qiagen, Hilden, Germany) according manufacturer’s instructions. The nucleic acid from each sample was eluted in 50 µl of elution buffer and stored at -70°C until use.

Primers and taqman® probe design

The oligonucleotide primers and probe against BAdV were designed from the published sequence of the Hexon gene of BAdV-5 strain B4/65 (GenBank accession No. AF207658). Different sequences of BAdV species were aligned with Laser gene software (DNASTAR, Inc., version 5, Madison, WI, USA). Primers and probes for real -time PCR were selected with Primer ExpressTM software (Applied Biosystems, Foster City, CA, USA). The sequences of the primers were (5’-3’): BAdV-Hex-33F, GAAATGCGAGGGAATATCTGTCT (23 bp, forward), and BAdV-Hex-138R, TGWTGGAGCTACAAAAGGATCTCTAA (26 bp, reverse). The primers were ordered and synthesized at CyberGene AB (Solna, Sweden). The TaqMan® probe, termed BAdV-HEX-65-TaqMan, had the following sequence (5’-3’): TGCAGTTCATCACTGCCACWCAAAGC (26 bp). The probe was labeled with a TET fluorophore at the 5’-end and with non -

CentralBringing Excellence in Open Access

Hakhverdyan et al. (2016)Email:

J Vet Med Res 3(3): 1051 (2016) 3/7

fluorescent Black Hole Quencher Dye (BHQ-1) at the 3’-end (Bio search Technologies, Novato, CA, USA).

Procedure and efficiency

Real - time PCR was carried out on a RotorGene3000 instrument (Corbett Research, Australia) and optimized by a titration series of primers, probe and magnesium ion concentration. The assay was in a total volume of 25 µl with 0.2 ml optical tubes (Corbett Research, Australia). Each 25 µl reaction mixture contained 2 µl of extracted DNA in sterile water, 0.9 µM of each BAdV primer, 0.4 µM of probe, 0.5 mM 4X dNTPs, 3.0 mM MgCl2, 2.5 U/µl of TaqGold DNA polymerase (Applied Biosystems), 10X PCR Gold buffer and 2 µl of 1 mg/ml of BSA. The final volume was adjusted to 25 µl with sterile water. The thermodynamic profile was 95°C for 10 min (initial denaturation) followed by 45-50 cycles of amplification: 95°C for 30 sec; 55°C for 30 sec (data collected); and 72°C for 45 sec.

Cloning, transformation, sequencing

PCR products of nine BAdV serotypes were purified using Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA), cloned into the TA cloning vector pCR®II-TOPO® (Invitrogen, Carlsbad, CA, USA) and transformed into E. coli INVαF´ cells according to manufacturer’s instructions. Recombinant plasmids were isolated using the QIAprep Spin Miniprep kit (Qiagen, Hilden, Germany) and subsequently sequenced on ABI PRISM 310 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) following the manufacturer’s instructions.

Detection limit and analytical specificity

The plasmids with of BAdV-3, -7,-8 and -10 inserts were used in ten-fold dilution series experiment to determine detection limit of the assay. Concentration of the plasmids with insert was determined with NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). The number of copies in the stock solution was calculated using the molarity of the template and Avogadro’s formulae. Ten - fold dilutions series from 109 to 1 copy were prepared in TE buffer (10 mM Tris-HCl, pH 8.0, 1mM EDTA) containing 10 µg/ml salmon sperm DNA (Ambion, Austin, TX, USA) to assure a constant amount of nucleic acids in the diluted samples. Dilution containing five copies of BAdV with insert was included in the sensitivity test as well. A standard curve was generated and PCR efficiency was calculated

using RotorGene3000 instrument integrated software. All tests were performed in triplicate.

Specificity was tested using ten BAdV serotypes obtained from the Veterinary Science Division, Stormont (Belfast, UK). Heterologous virus strains such as bovine corona virus (BCoV), bovine respiratory syncytial virus (BRSV), bovine viral diarrhea virus BVDV, and human RSV were included as well.

RESULTS AND DISCUSSIONReal - time PCR assay after optimization indicated successful

amplification of nine out of ten BAdV serotypes used. The PCR products were analyzed by 2% agarose gel electrophoresis to confirm the predicted product size, which was, as expected, 107 bases. BAdV-7 serotype had low level of fluorescence and amplification rates. Sequencing of PCR products revealed four mismatches in the probe region (Table 1). Nevertheless, BAdV-7 PCR product had only single specific band of correct size when tested by agarose gel electrophoresis (not shown).

BAdV-4 showed delayed amplification with Ct value of 34,0 (Figure 1A). The respective PCR product analyzed by agarose gel electrophoresis corresponded to the expected size. However, the intensity of the electrophoresis band was lower as compared to those of the other members of genus Atadenovirus (Figure 1B) reflecting the lower sample concentration which was confirmed by NanoDrop® spectrophotometer showing lowest DNA concentration for BAdV-4 of 1.4 ng/µl. The concentration range for the other samples was 3.2-9.3 ng/µl.

BAdV TaqMan real - time PCR assay was tested on representatives of genus Mastadenovirus (BAdV-1, -2, -3, -9 and -10). All serotypes, except BAdV-2, were amplified (Figure 2).

The analytical sensitivity (detection limit) of TaqMan real - time PCR assay was tested in triplicate with ten - fold dilution series of BAdV-3, -8 and -10 with a range from 10-9 down to five copy of synthetic template. Dilutions down to one and 0,1 copy of viral genome equivalents were also prepared and tested in separate experiments, but showed negative results. Thus these dilutions were not included in the main experiments. Five copies of viral genome equivalents were included instead. Three strains listed above belong to two BAdV genera and two of them have different number of mutations in the probe and/or reverse primer region as it was shown after sequencing of PCR products

Table 1 Nucleotide sequencing of PCR products of nine BAdV serotypes with primers and probe position on it.aComplementary sequenceIUPAC nucleotide code: W = T or APCR amplicon corresponds to 107 bp fragment of BAdV hexon gene. Nucleotide mismatches shown as basesAbbreviations: BAdV: Bovine Adenovirus; PCR: Polymerase Chain Reaction

CentralBringing Excellence in Open Access

Hakhverdyan et al. (2016)Email:

J Vet Med Res 3(3): 1051 (2016) 4/7

Figure 1 (A) –Amplification of all five BAdV serotypes of genus Atadenovirus. NTC is a negative control (water) that stays below the threshold. (B) - The products of real-time PCR as shown by gel electrophoresis. Numbers 1-5 correspond to BAdV serotypes 4-8, number 6 is negative control and number 7 is 100-base size marker. Predicted PCR product size is 107 bp.

Figure 2 PCR amplification of 4 out of 5 serotypes of genus Mastadenovirus. Only BAdV-2 was negative. BAdV-8 used as a PCR positive control. NTC is PCR negative control (water).

(Table 1). Even though, the detection limit for BAdV-3, -8 and -10 was 5 copies of viral genome equivalents. Only results with BAdV-8 decimal dilution series are shown in this study (Figure 3A).

A standard curve was designed after each dilution series experiment and the reaction efficiency (E) with correlation coefficient (R2) calculated by integrated RotorGene3000 software were following: BAdV-3 (E =1,01; R2 = 0,994), BAdV-10 (E =0,92; R2 = 0,997) and BAdV-8 (E =0,97; R2 = 0,997). See Figure 3B for BAdV-8 standard curve generated after 10-fold dilution series.

In the specificity test nine out of ten BAdV serotypes were

detected, while BCoV, BRSV, BVDV and human RSV were negative. PCR products were tested by a 2% agarose gel electrophoresis to confirm predicted product size, which was 107 bp, as expected (results not shown).

BAdV TaqMan real - time PCR assay was tested on random clinical samples (feces) from calves obtained from outbreaks of respiratory and/or diarrhea disease in different Swedish farms. In total, 24 clinical samples were tested among which 11 samples showed positive amplification for BAdV (results not shown). Earlier, 12 fecal samples from calves with respiratory symptoms were tested positive by BCoV antigen ELISA (Madeleine Tråven, personal communication). Six out of the same 12 samples

CentralBringing Excellence in Open Access

Hakhverdyan et al. (2016)Email:

J Vet Med Res 3(3): 1051 (2016) 5/7

Figure 3 (A) –BAdV-8 standard (plasmid with insert) 10-fold dilution series from 109 to 5 copies, in triplicate. Detection limit is 5 viral genome equivalents. (B) –A standard curve based on 10-fold dilution series of BAdV-8.

Figure 4 (A) -Six out of 12 fecal samples that were positive for BCoV tested by antigen ELISA, were positive for BAdV TaqMan real-time PCR, as well. Single amplification plot with Ct = 20, 7 is a PCR positive control (BAdV-8, diluted 1:100). Lines below the threshold are three negative controls and 6 BAdV negative samples; (B) -2% agarose gel electrophoresis of six BAdV positive samples (lines 1-6), positive control (line 7), negative control (line 8, water) and two random BAdV negative samples (lines 9-10). SM is a 100-base size marker. Amplicon size is 107 bp.

showed positive amplification by BAdV real - time PCR (Figure 4A). Predicted PCR products had correct size when tested by 2% agarose gel electrophoresis (Figure 4B).

VI, the “gold standard of classical virology”, is one of the most useful methods to detect and identify adenoviruses in various hosts. This classical method of virus detection and identification has resulted to the detection of a wide range of adenoviruses from a wide range of host species in the last decades and did help the studies of infection biology. Unfortunately, the use of VI is rapidly decreasing today in many diagnostic laboratories all over the world, due to high costs to obtain and to maintain proper cell cultures in the laboratories and due to the difficulties to maintain the specific skills and expertise required for this technique. Other “classical” diagnostic methods, such as electron microscopy and immunofluorescence are still applied in many laboratories, but their use is also decreasing. One main reason is that although these methods are relatively rapid, their sensitivity is not always satisfactory [35]. A general tendency is, that various

methods of molecular diagnostic virology, such as real - time PCR are recently “taking over” and start to dominate the diagnosis of adenoviral infections. Accordingly, herewith we are reporting on the development of a novel real - time PCR assay, which allows the simultaneous and rapid detection of adenoviruses in Bovidae.

Real - time PCR is faster than conventional PCR, as results from the former are available in approximately 3 h, compared to 5 h or more for the conventional PCR, which is the time required to run separate PCR and to visualize the PCR product by electrophoresis. PCR assay would be the best method of the detection of adenoviruses, which are difficult to isolate and grow (Kiss et al., 1996). It is important to stress that the TaqMan real - time PCR assay described in this paper was initially designed only against BAdV Atadenovirus serotypes 4-8. Alignments of nucleotide sequences available from the NCBI database showed large variation between two genera - Mastadenovirus (BAdV serotypes 1-3, -9 and -10) and Atadenovirus (BAdV serotypes 4-8). Our first intension was the design of two real - time PCR

CentralBringing Excellence in Open Access

Hakhverdyan et al. (2016)Email:

J Vet Med Res 3(3): 1051 (2016) 6/7

assays that would allow detection of all 10 serotypes of BAdV.

The results illustrate that the TaqMan assay described above worked well, after some optimization steps, when tested with BAdV Mastadenovirus serotypes 1, 3, 9 and 10, for exception BAdV-2. Amplification of 9 out of 10 BAdV serotypes showed that primers and probe initially designed to detect only the members of genus Atadenovirus, were specific for the members of genus Mastadenovirus, as well. The predicted size of PCR product also confirmed specificity of the real - time PCR assay.

One can speculate why negative results so far where only obtained with BAdV-2, while the majority of the variants of bovine adenoviruses (nine out of ten BAdV serotypes) were detected. A plausible reason can be that the target viral nucleic acid molecules were in proper condition in the specimens of nine BAdVs, but not in the specimen of BAdV-2 (poor sample quality). Another possibility is that BAdV-2 has rather unique infection biology and genome composition, referring to our previous studies, when we found BAdV-2 related viruses not only in Bovidae, but also in Ovidae as natural hosts [3,4,36]. Since adenoviruses, in general, are considered extremely host - specific and not able to establish infections in other hosts, BAdV-2 can be considered as a rather unique member of the Adenoviridae family, from aspects of infection biology, with special regard to host range.

Low level of fluorescence was observed during BAdV-7 serotype amplification, but as revealed by sequencing of PCR product it contained four mismatches in the probe region that had an impact on the final result. The delayed amplification and decreased level of fluorescence of BAdV-4 was most probably the result of the low concentration of the isolated DNA since the sequencing of BAdV-4PCR product did not reveal any mismatches in the primer and probe region (Table 1).

Considering the above listed scenarios, further work is required to investigate the background and to adapt the new TaqMan assay to BAdV-2 detection. In the future, a new primer set for the detection of BAdV-2 serotype will be designed. Alternatively, existing primers can be modified so that they could detect the last missing BAdV serotype.

CONCLUSIONThe present study suggests that TaqMan real - time PCR assay

can sensitively detect BAdV DNA in clinical samples. Twenty - four bovine fecal samples and 12 fecal samples from calves with respiratory symptoms tested gave additional evidence that the assay has good performance when applied for the detection of BAdV during outbreaks.

In conclusion, the real - time PCR assay presented in this paper is expected to be a practical alternative tool to the recently used diagnostic methods, e.g., VI, ELISA or conventional PCR in order to detect and identify various adenoviral infections in the bovine populations, to support the diagnostic work and to apply the control measures in proper structure and in right time.

ACKNOWLEDGEMENTSProf. Brian Adair from Veterinary Science Division,

Department of Agriculture for Northern Ireland, The Queen’s

University of Belfast, (Stormont, UK) kindly provided cell cultures of BAdV species 1 to 10. BAdV clinical samples were kindly provided by Dr. Kerstin de Verdier, Ms. Helena Reineck-Bosaeus (the National Veterinary Institute, SVA, Uppsala, Sweden), Dr. Madeleine Tråven and Prof. Stefan Alenius (Swedish University of Agricultural Sciences, SLU). We are also grateful to Dr. Lihong Liu (the National Veterinary Institute, SVA, Uppsala, Sweden) for his excellent assistance in sequencing of PCR product. The work was supported by Swedish Farmers’ Foundation for Agricultural Research (SLF, Stockholm, Sweden, project no. 0230011) and Swedish Institute (SI, Stockholm, Sweden).

REFERENCES1. Enders JF, Bell JA, Dingle JH, Francis T Jr, Hilleman MR, Huebner RJ,

et al. Adenoviruses: group name proposed for new respiratory-tract viruses. Science. 1956; 124: 119-120.

2. Benkö M, Harrach B. Molecular evolution of adenoviruses. Curr Top Microbiol Immunol. 2003; 272: 3-35.

3. Belák S, Berencsi G, Rusvay M, Lukács K, Nász I. DNA structure, and hemagglutination properties of bovine adenovirus type 2 strains which bypass species specificity. Arch Virol. 1983; 77: 181-194.

4. Belák S, Virtanen A, Zabielski J, Rusvai M, Berencsi G, Pettersson U. Subtypes of bovine adenovirus type 2 exhibit major differences in region E3. Virology. 1986; 153: 262-271.

5. Harrach B. Adenoviruses: General Features. In: Reference Module in Biomedical Research Eds: 2014.

6. Raut CG, Yadav PD, Towner JS, Amman BR, Erickson BR, Cannon DL, et al. Isolation of a novel adenovirus from Rousettus leschenaultii bats from India. Intervirology. 2012; 55: 488-490.

7. Kozak RA, Ackford JG, Slaine P, Li A, Carman S, Campbell D, et al. Characterization of a novel adenovirus isolated from a skunk. Virology. 2015; 485: 16-24.

8. Lee SY, Kim JH, Park YM, Shin OS, Kim H, Choi HG, et al. A novel adenovirus in Chinstrap penguins (Pygoscelis antarctica) in Antarctica. Viruses. 2014; 6: 2052-2061.

9. Zheng XY, Qiu M, Ke XM, Guan WJ, Li JM, Huo ST, et al. Detection of novel adenoviruses in fecal specimens from rodents and shrews in southern China. Virus Genes. 2016; 52: 417-421.

10. Rubio-Guerri C, García-Párraga D, Nieto-Pelegrín E, Melero M, Álvaro T, Valls M, et al. Novel adenovirus detected in captive bottlenose dolphins (Tursiops truncatus) suffering from self-limiting gastroenteritis. BMC Vet Res. 2015; 11:

11. Counihan KL, Skerratt LF, Franson JC, Hollmén TE. Phylogenetic and pathogenic characterization of novel adenoviruses isolated from long-tailed ducks (Clangula hyemalis). Virology. 2015; 485: 393-401.

12. Benkö M, Elo P, Ursu K, Ahne W, LaPatra SE, Thomson D, et al. First molecular evidence for the existence of distinct fish and snake adenoviruses. J Virol. 2002; 76: 10056-10059.

13. Harrach B, Benkö M, Both GW, Brown M, Davison AJ, Echavarría M, et al. Family adenoviridae. In: Virus Taxonomy: IXth Report of the International Committee on Taxonomy of Viruses. Eds: King AMQ, Lefkowitz E, Adams MJ, Carstens EB. New York, NY, USA, 2011; 9: 125–141.

14. Doszpoly A, Wellehan JF Jr, Childress AL, Tarján ZL, Kovács ER, Harrach B, et al. Partial characterization of a new adenovirus lineage discovered in testudinoid turtles. Infect Genet Evol. 2013; 17: 106-112.

CentralBringing Excellence in Open Access

Hakhverdyan et al. (2016)Email:

J Vet Med Res 3(3): 1051 (2016) 7/7

Hakhverdyan M, Mamadatokhonova G, Belák S (2016) Development of a TaqMan Real-Time PCR Assay for the Rapid Detection of Bovine Adenovirus Serotypes in Cattle. J Vet Med Res 3(3): 1051.

Cite this article

15. Klein M, Earley E, Zellat J. Isolation from cattle of a virus related to human adenovirus. Proc Soc Exp Biol Med. 1959; 102: 1-4.

16. Boyle DB, Pye AD, Kocherhans R, Adair BM, Vrati S, Both GW. Characterisation of Australian ovine adenovirus isolates. Vet Microbiol. 1994; 41: 281-291.

17. Baber DJ, Condy JB. Isolation and characterisation of bovine adenoviruses types 3, 4 and 8 from free-living African buffaloes (Synceruscaffer). Res Vet Sci. 1981; 31: 69-75.

18. Boros G, Graf Z, Benko M, Bartha A. Isolation of a bovine adenovirus from fallow deer (Damadama). Acta Vet Hung. 1985; 33: 119-123.

19. Bürki F. Bovine adenoviruses. In: Virus Infection of Vertebrates. Eds: Horzinek MC. Amsterdam, 1990; 161-170.

20. Lehmkuhl HD, Cutlip RC, DeBey BM. Isolation of a bovine adenovirus serotype 10 from a calf in the United States. J Vet Diagn Invest. 1999; 11: 485-490.

21. Dan A, Elo P, Harrach B, Zadori Z, Benkö M. Four new inverted terminal repeat sequences from bovine adenoviruses reveal striking differences in the length and content of the ITRs. Virus Genes. 2001; 22: 175-179.

22. Matiz K, Ursu K, Harrach B, Zadori Z, Benko M. Sequencing and phylogenetic analysis of the protease gene, and genetic mapping of bovine adenovirus type 10 define its relatedness to other bovine adenoviruses. Virus Res. 1998; 55: 29-35.

23. Smyth JA, Benko M, Moffett DA, Harrach B. Bovine adenovirus type 10 identified in fatal cases of adenovirus-associated enteric disease in cattle by in situ hybridization. J Clin Microbiol. 1996; 34: 1270-1274.

24. Adair BM, McKillop ER, Smyth JA, Curran WL, McNulty MS. Bovine adenovirus type 10: properties of viruses isolated from cases of bovine haemorrhagic enterocolitis. Vet Rec. 1996; 138: 250-252.

25. Benkö M, Harrach B. Restriction site mapping of bovine adenovirus type 1. Acta Vet Hung. 1990; 38: 281-284.

26. Giusti AM, Luini M, Benko M, Scanziani E. Pathological and in situ hybridisation findings in calves experimentally infected with bovine adenovirus type 4. Dtsch Tierarztl Wochenschr. 1998; 105: 142-144.

27. Isakova VR, Kiseleva EK, Kirasova MA, Zelivyanskaya ML, Grigoryev VG, Khilko SN, et al. Characterization of a series of monoclonal

antibodies specific for bovine adenovirus serotype BAV3 hexon antigen and their use in an ELISA for detection of adenoviral hexons. Acta Microbiol Hung. 1990; 37: 307-314.

28. Rusvai M, Belák S. Detection of bovine adenovirus nucleic acid sequences in nasal specimens by biotinylated DNA probes. Zentralbl Veterinarmed B. 1992; 39: 311-316.

29. Allard A, Albinsson B, Wadell G. Rapid typing of human adenoviruses by a general PCR combined with restriction endonuclease analysis. J Clin Microbiol. 2001; 39: 498-505.

30. Kiss I, Matiz K, Allard A, Wadell G, Benkö M. Detection of homologous DNA sequences in animal adenoviruses by polymerase chain reaction. Acta Vet Hung. 1996; 44: 243-251.

31. Maluquer de Motes C, Clemente-Casares P, Hundesa A, Martin M, Girones R. Detection of bovine and porcine adenoviruses for tracing the source of fecal contamination. Appl Environ Microbiol. 2004; 70: 1448-1454.

32. Poddar SK. Detection of adenovirus using PCR and molecular beacon. J Virol Methods. 1999; 82: 19-26.

33. Ko WY, Noh NG, Kim IS. TaqMan probe real-time PCR for quantitative detection of bovine adenovirus type 1 during the manufacture of biologics and medical devices using bovine-derived raw materials. Korean Journal of Microbiology. 2015; 51: 199-208.

34. Lehmkuhl HD, Hobbs LA. Serologic and hexon phylogenetic analysis of ruminant adenoviruses. Arch Virol. 2008; 153: 891-897.

35. Wong K, Xagoraraki I. Quantitative PCR assays to survey the bovine adenovirus levels in environmental samples. J Appl Microbiol. 2010; 109: 605-612.

36. Sibley SD, Goldberg TL, Pedersen JA. Detection of known and novel adenoviruses in cattle wastes via broad-spectrum primers. Appl Environ Microbiol. 2011; 77: 5001-5008.

37. Belák S, Thorén P. Molecular diagnosis of animal diseases: some experiences over the past decade. Expert Rev Mol Diagn. 2001; 1: 434-44.

38. Belák S, Pálfi V, Palya V. Adenovirus infection in lambs. I. Epizootiology of the disease. Zentralbl Veterinarmed B. 1976; 23: 320-330.