repeated sequences similar to insertion elements clustered

Vol. 162, No. 2

Repeated Sequences Similar to Insertion Elements Clustered Aroundthe nif Region of the Rhizobium japonicum Genome

KLAUS KALUZA, MATTHIAS HAHN, AND HAUKE HENNECKE*Mikrobiologisches Institut, Eidgenossische Technische Hochschule, ETH-Zentrum, Universitatstrasse 2,

CH-8092 Zurich, Switzerland

Received 30 November 1984/Accepted 4 February 1985

Two different repeated sequences (RSs) were discovered in the Rhizobiumjaponicum genome: RSRja is 1126base pairs long and is repeated 12 times; RSRji is approximately 950 base pairs long and is repeated at least6 times. Their arrangement in root nodule bacteroid DNA is the same as in DNA from bacteria grown inculture. Deletion analysis showed that many copies of a and ,B are clustered around the nitrogenase genes nifDKand nipfl, or, in general, they are found within a genomic region harboring genes that are nonessential forgrowth. One copy each of a and i are located upstream of nifDK and are adjacent to each other. Neither ofthem, however, is involved in the expression of niJOK. Nucleotide sequence analysis of three copies of RSarevealed many characteristics of procaryotic insertion sequence elements: potential inverted repeats at theirends, potential target site duplication, and large open reading frames. Despite this, their genomic positionsappear to be stable. One possible function of these RSs is in deletion formation probably via recombinationbetween them.

Several reports have appeared that demonstrate the pres-ence of repeated sequences (RSs) in the genome of Rhizo-bium species. Some of them seem to be functionally in-volved in symbiotic nitrogen fixation; others are consideredto be transposable elements.Rhizobium phaseoli strains of different geographical origin

have been found to have up to four reiterated nifH genes

coding for the nitrogenase Fe protein (29, 30), whereasanother R. phaseoli strain has been shown to contain a copyof an unknown RS close to the nodulation (nod) genes (J. W.Lamb, J. A. Downie, and A. W. B. Johnston, submitted forpublication). In Rhizobium meliloti, nif-related repeatedsequences were detected in about six copies per genome:they are approximately 300 base pairs (bp) long, and two ofthem have been shown to carry promoters for nitrogenfixation genes (5). Very similar types of repeats seem to bepresent in the Rhizobium trifolii genome, one of whichcarries the promoter for the nifjI gene (36, 40). Additionalwork will be required to support the idea that they may

represent common control elements for symbiotic genes (5).Insertion sequences (ISs) have been discovered in two

Rhizobium species. In R. meliloti 1021, Ruvkun et al. (32)have obtained evidence for a 1.4-kilobase-pair (kb) insertionelement, ISRml, which is normally present in about 10copies per genome. It was shown to transpose at a highfrequency (10-2), almost always into the same site of a generegion involved in nitrogen fixation, thus making the strainphenotypically Fix-. An even higher frequency of transpo-sition (10-1 to 10-2) has been reported for ISRJ, a 1.15-kbinsertion element (28) isolated from a soil bacterium identi-fied as Rhizobium lupini (18). None of these elements werefurther characterized by DNA sequence analysis.

This report describes two novel types of repeated se-quences in the genome of the slow-growing soybean symbi-ont Rhizobium japonicum USDA110 for which a new ge-neric name, Bradyrhizobium, has been proposed recently(20). These sequences differ from the other ones mentioned

* Corresponding author.

above in several respects: (i) they are clustered around thenif region, but they are apparently not involved in nif- ornod-related functions; (ii) they possess structural character-istics of IS elements; and (iii) they may not be of majorconcern with regard to causing genome instability, buthomologous recombination between them might occur underconditions (such as heat treatment and cointegrate resolu-tion) known to facilitate the formation of deletions.

MATERIALS AND METHODS

Bacterial strains and plasmids. The bacterial strains used inand constructed for this study are listed in Table 1. R.japonicum El, F4, and 45K served as parents for the isola-tion of deletions. Strains with deletions will be describedseparately below (see Fig. 3). Escherichia coli RR28 wasused as the recipient for transformations.

Culture media. E. coli strains were grown in LB medium(26). R. japonicum strains were grown aerobically at 30°C.For growth on agar plates, mannitol-salts-yeast extract me-dium was used (46). For liquid cultures, cells were grown inPSY medium (31). The minimal medium was the same asused previously for microaerobic nif-derepressed cultures(37). All culture transfers with R. japonicum were done in alaminar flow cabinet.Soybean nodulation. Soybean seeds (Glycine max L. Merr.

var. Clark-Li) were provided by the Germplasm ResourcesLaboratory, U.S. Department of Agriculture, Beltsville,Md. They were germinated and nodulated as describedpreviously (14). Preparative amounts of bacteroids for DNAisolation were obtained by the protocol of Sundaresan et al.(45).DNA isolations and recombinant DNA techniques. Total

DNA from R. japonicum cells grown in PSY medium, as

well as from isolated bacteroids, was isolated as describedpreviously (14). Small and large scale plasmid preparationsfrom E. coli were obtained by standard techniques (22).Established methods were used for working with recombi-nant DNA, such as restriction endonuclease cleavage, re-

535

JOURNAL OF BACTERIOLOGY, May 1985, p. 535-5420021-9193/85/050535-08$02.00/0Copyright C) 1985, American Society for Microbiology

on April 9, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

536 KALUZA, HAHN, AND HENNECKE

TABLE 1. Bacterial strains and plasmids

Strain Genotype or phenotype Reference

R. japonicumspc-4 Spcr derivative of USDA 311bllO 31

(wild type)El" Fix' Kanr/Strr (TnS ca. 350 bp up- 14

stream nifDK)F4u Kanr/Strr (pSUP201nifJ::Tn5-cointe- 14

grate in nifD)45K" Tetr Kanr/Strr (pSUP202nifH with TnS This study

ca. 500 bp upstream nifH; cointe-grate)

E. coli RR28 hsdR hsdM recA pheS12 thi leu pro 17lac gal ara mtl xyl supE44 endA

PlasmidspHE3 Camr pheS 17pBR322 Ampr Tetr 6pACYC177 Ampr Kanr 7pSUP201 Ampr Camr oriT (from RP4) 41pSUP202 Ampr Camr Tetr oriT (from RP4) 41pRJ4060b Ampr(pACYC177), 2.4-kb XhoI insert This studypRJ4053b Ampr(pSUP201), 2.7-kb EcoRI- This study

Hindlil insertpRJ13Cbb Camr(pHE3), 12.9-kb Pstl insert This studypRJ1818b Tetr(pBR322), 4-kb Pstl insert This studypRJ4063b Ampr(pBR322), 10.7-kb EcoRI-Sall This study

inserta The positions of the insertions in these strains are shown in Fig. 3.b The inserts of these recombinant plasmids are depicted in Fig. 1.

striction site mapping, ligation to vectors, transformations,and agarose gel electrophoresis (22).

Generation of deletions. Some of the strains (E1-7dl,E1-8d4, F4-6) have been described recently (15); the others(El-6dl, E1-8dl, F4-4, 45K-13, 45K-29) were constructedfor this study. Strains with the prefix El were derived fromthe Tn5 insertion mutant El by heat treatment (36°C for 6 to8 days) and were found among kanamycin-sensitive survi-vors (15). Strains with the prefix F4 or 45K were alsoobtained as kanamycin-sensitive strains after spontaneouscointegrate resolution from the cointegrate-containing strainsF4 (14) or 45K (Table 1).

Hybridizations. Southern blots obtained after uni- or bidi-rectional transfer (43, 44) from agarose gels to Gene-Screen(New England Nuclear Corp., Boston, Mass.) or to nitrocel-lulose membranes (Schleicher & Schuell, Inc., Keene, N.H.)were prehybridized at 67°C in a solution containing 6x SSC(lx SSC is 15 mM sodium citrate plus 150 mM NaCI), 5xDenhardt solution (8), 0.5% sodium dodecyl sulfate (SDS),200 ,ug of sonicated boiled salmon sperm DNA per ml, and20 mM sodium phosphate (pH 6.8). Hybridizations with32P-labeled DNA (107 to 108 cpm/,Lg) were also carried out at67°C in the same solution. DNA probes were made radioac-tive by nick translation (22) or synthesized as complemen-tary [32P]DNA strands on single-stranded M13 clones (25).After hybridization, the membranes were washed with sev-eral changes of 2x SSC-0.1% SDS at 67°C. For subsequentautoradiography, the membranes were not completely dried,in the event that it was desired to remove the radioactivitybefore hybridizing the blot to another probe. Removal of thefirst probe was achieved by washing the membranes twice in0.1 x SSC-0.1% SDS and twice in 0.01 x SSC-0.1% SDS (allwashes were for 2 h each). Colony hybridizations were doneas described previously (11, 14).

DNA sequencing. Nucleotide sequence data were obtainedby the chemical as well as the chain termination method.Chemical sequencing was carried out by the methods ofMaxam and Gilbert (23), except that the A+G modificationprocedure was done as described by Gray et al. (13). For thechain termination method of Sanger et al. (33), DNA frag-ments were first subcloned into single-stranded bacterio-phage M13 derivatives (24). The M13-specific primer (15-mer)was purchased from New England BioLabs, Inc. (Boston,Mass.), whereas the R. japonicum RS-specific primers and aTnS-specific primer were synthesized in a DNA synthesizer(model 380A; Applied Biosystems, Foster City, Calif.) andpurified by polyacrylamide gel electrophoresis. The penta-decameric Tn5 primer has been described previously (B.Thony, K. Kaluza, and H. Hennecke, Mol. Gen. Genet., inpress). The two synthesized RS-specific oligonucleotidescorresponding to numbered nucleotide positions (see Fig. 5)have the following sequences: 5'(193)GACCGGGTGCTGC(181)3' ;5'(609)CGCTCGCTCCAAAG(596)3'.

RESULTS

Two different repeated sequences are inserted upstream ofni:DK. We have previously cloned a 35-kb region from the R.japonicum genome containing the nitrogenase genes niJDKand niJH (11, 12, 16). When individual 32P-labeled DNAfragments from this region were probed to Southern blots oftotal R. japonicum DNA digested with XhoI, PstI, EcoRI, orHindIII, it was found that probes from the 5'-flanking side ofnifDK hybridized to a large number of restriction fragments.By using smaller subfragments as probes, the hybridizingregion was narrowed and shown to consist of two separatesequences (Fig. 1) which we have named RSRja and RSRj,Bwhere Rj is R. japonicum. Further numbering of the a and ,Bsequences was done with reference to the sizes of RS-con-taining XhoI fragments in total R. japonicum DNA (see Fig.2). The following is a brief description of the two RS types.One copy of RSa is located at a distance of 1.6 kb

upstream of the nifDK operon (Fig. 1). It is 1126 bp long, asdetermined by DNA sequencing (see below). All probesfrom the a sequence uniquely hybridize to 12 XhoI frag-ments from the R. japonicum genome (Fig. 2A, lane 1). Thesequence upstream of niJDK is contained within the 2.4-kbXhoI fragment and, hence, is RSa9. All RSa copies possessone site each for HindIII and ClaI (Fig. 1) but do not havesites for XhoI (see below). It is possible that all XhoIfragments seen in Fig. 2A, lane 1, contain full-length copiesof RSa.A second repeated sequence (RS,B) was located between

RSa and nifljK (Fig. 1). It is approximately 950 bp long, withits right end being about 450 bp away from the nifjKpromoter (1, 21). Almost all probes from RS1 hybridizestrongly to six characteristic XhoI fragments of the R.japonicum genome (Fig. 2B, lane 1). The RS,B copy up-stream of niJDK is on the 2.5-kb XhoI fragment and, hence,is 13. The hybridization pattern of Fig. 2B (lane 1) revealsfurther weakly hybridizing bands which are not numbered.Probably, these do not represent full-length copies of RS.The XhoI site on the far left of 133 is characteristic of all RS1copies, because the TaqI probe b to the left of the XhoI site(cf. Fig. 1) yields a reiterated hybridization pattern differentfrom the one seen in Fig. 2B, lane 1.

Investigation into the possible arrangement of several RSsusing large deletions. The fact that two different RSs arelocated close to the niJDK operon prompted us to determinewhether more copies of RSa and RS,3 were located around

J. BACTERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

REPEATED SEQUENCES IN THE R. JAPONICUM GENOME

C X HC X. . . a

RSOll0P HC X B H C H P

RSCL7

HC X Bg _CBI I 3

RSCL9 133

CP E X PS'v Ite

E BgP E P S

nif D nif K

X pRJ 4060() X

E pRJ4053(+) H

b TT (x)TT (.)

d Bg (.1 BgS? (.1

f C. (-) C I1kb,

FIG. 1. DNA clones containing RSRja, and the organization of RSRja9 and RSRj,B3 upstream of the nifDK operon. Recombinant plasmidswith the pRJ code are also described in Table 1; only their R. japonicum DNA inserts are shown here. The inserts of pRJ4060 and pRJ4053,as well as the small DNA fragments designated a to f, were derived from pRJ4063 and were used as hybridization probes to genomic blotsof XhoI-digested R. japonicum DNA. Their hybridization response with respect to the typical RS-specific pattern is symbolized as follows:+, probes yielding the RSa-specific pattern shown in Fig. 2A, lane 1; *, probes yielding the RS3-specific pattern of Fig. 2B, lane 1; x, 121-bpprobe b hybridizing very weakly to a pattern that is totally different from the previous two (with the exception of the 2.4-kb XhoI fragmentrepresented by pRJ4060; this hybridization pattern is too weak to be detected in response to the XhoI insert of pRJ4060 as probe); -, no

hybridization of probe f to either of the previous patterns, except to the 2.5-kb XhoI fragment harboring it. Restriction sites are as follows:BamHI (B), BgIII (Bg), ClaI (C), EcoRI (E), HindIlI (H), HpaIl (H'), PstI (P), Sall (S), SmaI (S'), TaqI (T), XhoI (X).

3~IL -t -t LU

'o r~ 4T 1ovLU-

,~ -L-, LU.~

kb

13

10.5

6.0

4 6O,.S26

~2.6 04

1 75

1.70

10 w _! 51.55

2- i * - 1 P _ = 1-625

the nif region. Total DNA was isolated from mutants of R.japonicum containing large deletions (15) and was examinedfor the presence or absence of the RS-characteristic XhoIfragments by Southern blot hybridization. The results forfive of the deletions are given in Fig. 2A and B, lanes 2 to 6.As an example, the experiment reveals that strain E1-6dl isdeleted for al, a4, a8, a9, and al2 (Fig. 2A, lane 2), as wellas for 13 and 15 (Fig. 2B, lane 2). All deletions analyzed inFig. 2 are different from each other. In some strains new

bands appear (arrows, Fig. 2): strains F4-4 and 45K-13 havenew RSa-specific bands of 1.75 and 2.45 kb, respectively;strain E1-7dl has a new RS-specific band of 2.4 kb. Fromthe results of this deletion analysis, a tentative genetic mapof the positions of several a and sequences relative to eachother can be deduced easily (Fig. 3). The map in Fig. 3 isdrawn with the following two assumptions: (i) in each strain,contiguous DNA material may have been removed by onesingle deletion event; (ii) whenever a new RS-specific XhoIband appears in the hybridization experiment and one orboth of the deletion endpoints map somewhere outside thecloned 35-kb region, the deletion may have resulted from

A 1 2 3 4 5 6 B 1 2 3 4 5 6

FIG. 2. Autoradiographs of duplicate Southern blot hybridiza-tions to total genomic DNA of wild-type and deletion strains. Thesource of the DNA is indicated above each lane. All DNA sampleswere digested with XhoI before electrophoresis and blotting. (A andB) Hybridizations to the same blot. First, the blot was hybridized to

the 32P-labeled ,B-specific fragment c (cf. Fig. 1) and autoradio-graphed (B); then the radioactivity was washed off (see text), and theblot was hybridized to the a-internal probe a (cf. Fig. 1) and auto-radiographed again (A). In the left and right margins the RSa andRS1 sequences, respectively, are numbered according to the sizes ofthe XhoI fragments. Their sizes (in kb) are given in the middle.Arrows indicate the positions where, in strains F4-4, 45K-13, andE1-7dl, new hybridizing bands appear.

C XP XpRJ 13Cb

pRJ 1818

X H

pRJ 4063E XX

jf,

p

VOL. 162, 1985 537


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


wid-type

El - 7d1

F4-6

45K-29

45K -13

F4- 4

El - 6d1

El -8d4

El -8d1

suggested order of RS .I. cloned region(-35kb) I. suggested order of RS<.--- > < - > < -- -11

3-2 c-4 CA- /3-5 'o9B9-3 x-l w12 oc-3n mJ m --

--a 4P _.1 40 EO - _- - _ _---EFEl FK 45K

- --_(TM5)

Ea ---m------- - - - _

-- cJ I F Ea ------

-- c m r- 7c -4 -

ESc .r m 4---------I--4

#Z# ^ - -- - -- - q- - - - - - - - - - - - - -

-----------°I~~~~~~~~~~~~~----~~----------r------~----------

----------------- -

FIG. 3. Deletion analysis which permits deduction of the possible arrangement of RSa and RSp copies around the nifDK-nifH region ofthe R. japonicum genome. Numbering of the repeats corresponds to the numbering of the XhoI fragments in Fig. 2. Strain designations areindicated on the left. In the top line (wild-type) the positions of the Tn5 insertion in strain El and the cointegrates in strains F4 and 45K areindicated by vertical arrows. In El-7dl the position of remnant TnS DNA (see text) is marked. The vertical dashed lines mark the boundariesknown from cloned DNA. Deleted DNA is indicated by horizontal dashed lines, whereby the absolute lengths of the deletions beyond thevertical boundary lines are not known. In strains 45K-29, 45K-13, and F4-4 the deletions are believed to have resulted from recombinationbetween RSoa copies. Spaces are introduced between the RS copies outside the cloned region, indicating that the suggested linkage has notbeen proved by overlapped cloning; hence, the distances between the individual RS copies are not known.

recombination between two RS copies of the same kind (i.e.,between a8 and a12 in strain F4-4, between a9 and cl2 instrain 45K-29, and between a9 and a3 in strain 45K-13; thisalso implies that a8, a9, a12, and a3 would have the sameorientation for them to be involved in deletion formation). Inother strains, the possible mechanism by which the deletionsmay have been formed is less clear. In many cases, thedeletion endpoints may be in DNA regions between repeatedsequences, i.e., outside the RS-carrying XhoI fragments;such a case is certainly true for strain F4-6, in which one

xRs9ag .1I

xRS a7 1//

c

deletion endpoint was mapped exactly 8 kb downstream ofnifDK (H.-M. Fischer, unpublished data). One strain wasfound, namely El-7dl, in which a Tn5-mediated deletion (4)may have occurrred. DNA analysis of this strain revealedthat the right deletion endpoint is within TnS DNA, whereasthe left deletion endpoint must be in close proximity to RS,B2since the same ,-specific XhoI fragment (arrow; Fig. 2B,lane 3) also hybridizes to a 32P-labeled TnS probe (data notshown).

Regardless of the mechanism that caused the deletion, the

Tn32 Tn -24

T t1S T 14T1$TlwTTT C 4HTI T X T X9. .0 I a I I I I i I II4I IC

..--

X0

| , . . _PF2 r-w

* p, *a

ID pOp-.- to

a H CI I

H

b-~~~~~0*-J |..~~~ ~ ~ ~~~~~~* r

x H C x xI ,1

FIG. 4. Strategy for the sequencing of three copies of RSRja. The RSa numbers are given on the left. Thick DNA lines indicate theextension of the a sequences. The positions with TnS insertions located in a9 are shown by vertical arrowheads. The dashed arrows indicatethat these regions were sequenced by the chemical method (23), whereas the other horizontal arrows denote that the sequencing was doneby the chain termination method (33). Horizontal arrowheads marked with p indicate the location at which primer-assisted sequencing wasdone with RSa- and TnS-specific oligonucleotides. Restriction sites are abbreviated as described in the legend of Fig. 1.

J. BACTERIOL.

0.4 * 4 P-0 0-4-91 q1- 0 o 4

1. -0-1o .4 I... *


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


most important result emerging from the tentative map inFig. 3 is the apparent clustering of several RS copies near thenif region: three 1 copies and six a copies seem to be locatedthere. Apart from their defects in symbiotic nitrogen fixa-tion, the deletion mutants are indistinguishable from the wildtype with respect to their ability to grow on yeast extract-mannitol medium (46) and on minimal medium (37). Thisleads to the more general conclusion that the RSs areclustered in an area of the R. japonicum genome harboringgenes (including niJ) which are nonessential for growth.

Analysis of DNA from soybean root nodule bacteroids andother R. japonicum strains. DNA isolated from root nodulebacteroids (3 weeks after infection of G. max var. Clark-1)was compared with DNA from bacteria grown in culture;both were found to have the identical pattern of RSox- andRSP-specific XhoI fragments, which is known from theresults shown in Fig. 2 (data not shown). Thus, the RSot andRS( copies do not appear to be involved in genome rear-rangements during bacteroid development. We also per-formed some initial comparative studies with R. japonicumstrains other than 110, with the preliminary result thatrepeated sequences of the a type may be widespread. Amore extensive survey with more strains is in progress.

Cloning of further copies of RSa. Using the 2.4-kb XhoIinsert of pRJ4060 (Fig. 1) as the RSx-specific probe, wedetected further clones in R. japonicum clone banks (11, 17)by colony hybridization. Two of the clones, pRJ1818 andpRJ13Cb, were picked at random for further analysis. Re-striction site mapping and Southern blot hybridizations (datanot shown) revealed that they contained c7 and cx10, respec-tively (Fig. 1). As expected, they possessed the HindIll andClal sites that are characteristic of RSO.. None of the twonew clones contained RS,B; moreover, when RS( DNA wasprobed in the colony hybridization experiment, most of thehybridizing clones were different from those obtained withthe ox probe. This shows that the case of ox and a beingimmediately adjacent (upstream from niJDK) is the excep-tion rather than the rule. Although the lengths of thedeletions in Fig. 3 are not yet known, and although we havenot yet linked the repeated sequences by overlapped clon-ing, it appears that larger segments of DNA separate theindividual RS copies.DNA sequencing of RSx. To determine the total length of

the repetitive region and the degree of homology betweenRSu copies, it was necessary to sequence more than onecopy. We established the nucleotide sequences of 09, (X7,and cx10 (Fig. 4). In the case of O7 and cU10, less extensivesequencing sufficed, as they turned out to be almost identicalto 09. The total sequence for RSO9 is shown in Fig. 5. It isbased on the maximum length of sequence homology toRSox7 and RScxlO, which is 1126 nucleotides. The threesequences differ from each other by only 4 bp. In addition,(x9 has one triplet more than a7 and oU0 (Fig. 5; cf. Fig. 6;see below). We found three large open reading fratnes withinthe RSx9 sequence, starting with an ATG sequence. Read-ing frame I (from nucleotide 48 to 839) has 264 codons.Reading frame II (from nucleotide 412 to 1110) has 233codons. Reading frame III runs in the opposite direction(from nucleotide 560 to 120) and has 147 codons; it overlapswith reading frame I in the same frame, although it is on theother DNA strand. The translated polypeptides would be inthe 27,000-molecular-weight range (for reading frames I andII) or smaller (M,. = ca. 16,000 for reading frame III). If anyof these regions are expressed in R. japonicum, we believe itis more likely to be reading frame II for the followingreasons: (i) reading frame II is preceded by a potential

5 10 20 30 40 0CTAGTACCCAGCTTTTCTTGGAACGTGAGTCGTGATTCAAGGTCGGGhff

ATACCCGAAGCAAGAGAAGTCCACCTTTCGAGGAAAGATCGCAAGGTGCT150

TGAGGCGGTCTGTCGL~ IGTGACGTTGCAGCOCGATTTGAAGCGGGGTn5-32 200

CGCGO'ATAGTTCTGTTGGCGGCGGATGGGCGCAGCACCCGGTCGATCGCC250

AAGGAAGTTGGGGTCCAGCCGCGGATTGTCAGCCTTTGGCGGCATCGCTA300

TGCCGACCATGGCCTTGAAGGGCTGCAAGACAAGCCGCG CCTGGCAAGC350

AGCCGATCTATACGAAGACGACCGACAAGCGGATTCTGAAGCTGCTGGAT.400

AAGCCGCCACCGCAAGGGTTTGCGCGCTGGACCGGCCCCCTGCTGGCCGA450

GGCGCTGGGGCG ATGTCCAATATGTCTGGCGGTTCCTGCGCAGCCCACAAGATTGACCTGGTGGCTCGCAAGTCCTGGTGCGAGAGCAACGACCCG

550AACTTTCGGCCAAAGCCGCCGATGTTGTCGGCCTCTATGTCCGCCGCC.GG

600CGA TG CTGTGCGTGGACGAG AAGCCCTCGATCCAGGCTTTOO-_ . ~~~~~~~~~~650

GAGCGAGCGCAGGGTTATCTGAAGTTGCCCAGTGGCCGCGCCTTAACCGO700

CCAAAGCCACGATTACAAGCGGCATG.GCACCACAACATTGTTTGCGCGC750

TCGAAGTCGCCACCGGAAAGATCATCGCGACCCATTCAAAACGCCGGCGCw Tn5-24 800

CGCGTCGAGTTTCTCGATT ATGAACAGCGTCACCGCGGCTTTTCCGAAH indIII 850

CCGCAAGCT¶CACGTCATCCTCGACAACCTCAACACqC AAAGAACG0 ~~~oo

AGGACTGGCTCAAGGCCCACCCCAACGTGOCAATTTCATTTCACGCCCO ACA950AGTGCGCCATGGCTCAATC'AGGTCGAAGT'ATGGTTTTCCATCTTGCAGGG1000GCAGTCGCTCAGCGGCACCTCCTTCACGA'GCCTCAAGCAGCTTCAGGAAC

ClaI 1050ACATCGATGCCTACGTCAACGCATACAACGACAGAGCCGAGCCCTTCGTC

1100TGGACCAAGAAAAAGGTCCGTCAACGCCGTTTCAAAGGCCGTCGCCGTATCACTCA C TCCGGGACTAG

FIG. 5. Complete nucleotide sequence of RSRj(x9. The 5' to 3'DNA strand is shown. The displayed sequence corresponds to themaximal extension of homology to RSoL7 and RSalO (1126 bp), i.e.,the 5'- and 3'-flanking regions are totally divergent (cf. Fig. 6). Theonly nucleotide positions where bp exchanges were observed ineither (7 or od0 are underlined (632, 790, 895, 1068, and 1088 to1090). The insertion sites of Th5-32 and Tn5-24, as well as theconserved HindlIl and Clal sites, are marked. Open reading framesare indicated with roman numerals. They all begin with an ATGstart codon (boxed) and terminate at TAA or TGA stop codons,which are also boxed. Note that reading frame III would be in theopposite orientation on the DNA strand. In front of reading frame IIa potential E. coli-type ribosome binding site is emphasized (over-scored and underlined hexanucleotide).

Shine-Dalgarno sequence for ribosome binding (39); (ii) the 4bp exchanged in the other two copies would lead to tripletsencoding the same or functionally conserved amino acids(35); (iii) the triplets missing in (x7 and cxlO (at position 1090)would not disrupt the reading frame and, when translated,would only lead to one arginine less in a cluster of threeadjacent arginines encoded by (x9 (Fig. 6); (iv) of the threereading frames, frame II has the highest content of hypothet-ical, primitive RNY triplets (38), indicating that it maycontain biologically significant information.

Analysis of the RSa termini. With the idea that RSot mayresemble a procaryotic IS-like transposable element (19), weexamined the ends of the sequenced RSot copies for anypotential target site duplications or inverted repeats. Bothsuch structures were indeed found (Fig. 6), but there are twoalternatives. (i) At the left end of RScx7, nine nucleotides(5'-CTAGTACCC-3') have a perfect complementary in-

VOL. 162, 1985 539


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


CD c to

vm a

o E0Cs =C

o -

40

0 * -0

C e C

CD 0s 0 a

E-.4EU 0) 7 C

p3 Es C) J0 0 .0

r 0

0w00u

Qr.l' @-

E o 'o

&E E- ._0

0

0~~~

°CI 'I5 .0D Q0

E-4.-40E-

-

E- E- &4S

0 0

E4 E- E- .

Q_0 0 C

E- E-C: CZOa. *_!e* O 0 C

~

= 00 d t00~ ~ ~

..*CZV

a* %* o maE~~~~F sC O*

0 0 0 C~-4 CZ~-4* CZ.

E* E- E

EDD E *-

0 L) 0, r E d

00

'EC-4

Q _ t_

E4 E- 4

0 43.

E ,0 H°,

| @ i r0 '

0

0C

0), X 0 r 0

.(UoeCreC)_

0 o

e < m ct n o

V. Z M

verted repeat at the right end. Similar structures are presentin a9 and alO, however, with one and two mismatches,respectively. If this is the true inverted repeat of an ISelement, we do not see any obvious target site duplication inthe 5'- and 3'-flanking DNA sequences (Fig. 6). (ii) The 4 bpon the left end (5'-CTAG-3' in a and a7, or 5'-GTAG-3' inalO) are identically duplicated in the respective right ends. Ifthis is the actual target site duplication, the inverted repeatwould be only five nucleotides long (5'-TACCC-3' on theleft, with one mismatch in RSa9), and the total length of RSotwould be 1118 instead of 1126 nucleotides.Another interesting observation was made upon scrutiniz-

ing the DNA sequence on the left border: there are abundantdirect repeats of five or six nucleotides (arrows, Fig. 6) aswell as six nucleotides occurring on one or the other DNAstrand in a left- or rightward orientation (boxes, Fig. 6).None of these structures was found in the DNA on the rightborder. Their possible involvement in any former or presentfunction of RSa remains obscure.

DISCUSSION

Several IS-like elements are present near nif genes. Fromthe deletion analysis shown in Fig. 3, it can be seen that alarge number of copies, if not all, of the two R. japonicumrepeated sequences a and P are clustered in a genomicregion which is dispensable for growth. This region includesnif genes, exemplified by the nifDK and nifH operons.Despite the clustering around the nif region, there is noevidence that the RS elements in general, and RSa9 andRSP3 next to niJDK in particular, are functionally involvedin symbiotic nitrogen fixation. Bacteroid DNA was found tohave an unaltered genomic distribution of the RS copies. ATnS insertion between RSP3 and the nifDK promoter (inmutant El) previously has been shown to have a wild-typephenotype (Fix' [14]). This result, together with the knowntranscription start site 46 nucleotides in front of nifD (1, 21),rules out the possible presence of additional transcriptionalsignals on a9 or P3. Other TnS mutants, in which thetransposons are now known to be located in RS9 (cf. Fig.4), were also shown to be Fix' (15), but in this case it ispossible that the other RSa copies have provided the missingfunctions. Hence, any activity of gene products of RS innitrogen fixation cannot be ruled out completely.

In genomic blots, 32P-labeled probes from the right of P3,including the niJDK promoter, hybridize only once, i.e., tothe corresponding DNA fragments of that region. Thus, theR. japonicum repeated sequences are structurally and func-tionally unrelated to the small repeats (ca. 300 bp) found in

R. meliloti and R. trifolii, some of which have been shown tocarry nif promoters (5, 36). Adams et al. (2) have proposedthat the R. japonicum nifDfk promoter, and perhaps addi-tional nif promoters, might also be part of similar repeats.This conclusion cannot be supported by our experimentalresults.Genome stability in R. japonicum. One of the most desira-

ble properties of Rhizobium inoculum strains for agricultureis that they mnaintain their genetic capacity for competitive-ness, nodulation, and symbiotic N2 fixation on introductioninto the soil. Plasmid loss in fast-growing rhizobia hascaused major concern (for example, see reference 9), and, inlight of the newly discovered repeated sequences in R.japonicum, one may extend this concern to slow growers aswell. So far, however, we have not oibtained evidence whichwould suggest that RSa or RS, causes spontaneous andfrequent genome rearrangements under laboratory condi-

J. BACTERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


tions. Yet, we have not rigorously investigated whether theR. japonicum RS elements are able to transpose and, if so, atwhat frequencies. In contrast, under conditions of heattreatment and cointegrate resolution, deletions have beenfound (15), and in some of the strains the deletions probablyhave resulted from a single crossover between existing RSotcopies (cf. Fig. 2 and 3). In several other deletion strains,RSot and RSP apparently were not involved, and the mech-anism of deletion formation remains unknown. Skogen-Hagenson and Atherly (42) have obtained symbioticallydefective mutants of other slow-growing R.japonicum strains(e.g., USDA 74) by using heat treatment in combination withchemical treatment (acridine orange, ethidium bromide, andSDS). It is tempting to assume that in their experiments, too,RS-mediated deletion formation may have been the under-lying mechanism.

Potential IS elements. The nucleotide sequence analysesperformed with three copies of RScx revealed a number ofcorroborative characteristics for the identification of RSa asa novel bacterial IS element. This holds true with regard tothe size, the potential coding capacity, and the special DNAstructures at both ends, for which two functional interpreta-tions are given. (i) At the ends of RScx there could be a 9-bpinverted repeat (Fig. 6). Compared with other procaryotic ISelements, this is rather short (19), as it is in the case of IS50(3). With the proposed 9-bp repeat, RSot would not beflanked by duplicated target site sequences. This is unusual,but not without precedent, as the examples of Tn554 (27) andISH1.8 (34) have proved. (ii) An alternative structure of theRSo termini can be formulated (Fig. 6) in which the invertedrepeat would only consist of five nucleotides. This is exceed-ingly small, yet IS elements without any obvious repeats are

known (27, 34). This alternative would imply a 4-bp targetsite duplication (19) (Fig. 6). The fact that those duplicated 4bp are almost identical in the three copies (Fig. 6) would beconsistent with a certain specificity of RScx in target siteselection, as is known for IS5 (10). The decision of which ofthe two alternatives is correct cannot be made before thetransposition of RScx into a target DNA, for which thenucleotide sequence is known, can be seen.

Further use of repeated sequences. Besides their contribu-tion to the understanding of the basic biology and genetics ofslow-growing rhizobia, the repeated sequences also offersome attractive practical aspects which we have begun topursue. First, the RS elements represent ideal markers toestablish a consecutive linkage map (e.g., of the regionshown in Fig. 3) by beginning with the cosmid clones (11)that harbor them. Second, the total of 12 RSot copies can beexploited as suitable targets for the integration of clonedDNA into the R. japonicum genome. Third, the preliminaryfinding that RSs may be present in other slow growers givesrise to the idea of using them as additional useful tools instrain identification.

ACKNOWLEDGMENTS

We are grateful to S. Hitz for expert technical assistance. We alsothank our colleagues H.-M. Fischer and M. Fuhrmann for providingthe colony banks. We thank H. Paul for typing the manuscript.

LITERATURE CITED

1. Adams, T. H., and B. K. Chelm. 1984. The nifHI and nifDKpromoter regions from Rhizobium japonicum share structuralhomology with each other and with nitrogen regulated promot-ers from other organisms. J. Mol. Appl. Genet. 2:392-405.

2. Adams, T. H., C. R. McClung, and B. K. Chelm. 1984. Physicalorganization of the Bradyrhizobiumjaponicum nitrogenase gene

region. J. Bacteriol. 159:857-862.3. Auerswald, E. A., G. Ludwig, and H. Schaller. 1980. Structural

analysis of TnS. Cold Spring Harbor Symp. Quant. Biol.45:107-113.

4. Berg, D. E., and C. M. Berg. 1983. The prokaryotic transposa-ble element Tn.5. Biotechnology 1:417-435.

5. Better, M., B. Lewis, D. Corbin, G. Ditta, and D. R. Helinski.1983. Structural relationships among Rhizobium meliloti symbi-otic promoters. Cell 35:479-485.

6. Bolivar, F., R. L. Rodriguez, P. J. Greene, M. C. Betlach, H. L.Heyneker, H. W. Boyer, and S. Falkow. 1977. Construction andcharacterization of new cloning vehicles. II. A multiple cloningsystem. Gene 2:95-113.

7. Chang, A. C. Y., and S. N. Cohen. 1978. Construction andcharacterization of amplifiable multicopy DNA cloning vehiclesderived from the P1SA cryptic miniplasmid. J. Bacteriol.134:1141-1156.

8. Denhardt, D. T. 1966. A membrane filter technique for thedetection of complementary DNA. Biochem. Biophys. Res.Commun. 23:641-646.

9. Djordjevic, M. A., W. Zurkowski, and B. G. Rolfe. 1982.Plasmids and stability of symbiotic properties of Rhizobiumtrifolii. J. Bacteriol. 151:560-568.

10. Engler, J. A., and M. P. van Bree. 1981. The nucleotidesequence and protein-coding capability of the transposableelement IS5. Gene 14:155-163.

11. Fischer, H.-M., and H. Hennecke. 1984. Linkage map of theRhizobium japonicum nifH and nifDK operons encoding thepolypeptides of the nitrogenase enzyme complex. Mol. Gen.Genet. 196:537-540.

12. Fuhrmann, M., and H. Hennecke. 1984. Rhizobium japonicumnitrogenase Fe protein gene (niflH) J. Bacteriol. 158:1005-1011.

13. Gray, C. P., R. Sommer, C. Polke, E. Beck, and H. Schaller.1978. Structure of the origin of DNA replication of bacterio-phage fd. Proc. Natl. Acad. Sci. U.S.A. 75:50-53.

14. Hahn, M., and H. Hennecke. 1984. Localized mutagenesis inRhizobium japonicum. Mol. Gen. Genet. 193:46-52.

15. Hahn, M., L. Meyer, D. Studer, B. Regensburger, and H.Hennecke. 1984. Insertion and deletion mutations within the nifregion of Rhizobium japonicum. Plant Mol. Biol. 3:159-168.

16. Hennecke, H. 1981. Recombinant plasmids carrying nitrogenfixation genes of Rhizobium japonicum. Nature (London)291:354-355.

17. Hennecke, H., F. Binder, and I. Gunther. 1982. A novel cloningvector for the direct selection of recombinant DNA in E. coli.Gene 19:231-234.

18. Heumann, W. 1968. Conjugation in starforming Rhizobiumlupini. Mol. Gen. Genet. 102:132-144.

19. lida, S., J. Meyer, and W. Arber. 1983. Prokaryotic IS ele-ments, p. 159-221. In J. A. Shapiro (ed.), Mobile geneticelements. Academic Press, Inc., New York.

20. Jordan, D. C. 1982. Transfer of Rhizobiumjaponicum Buchanan1980 to Bradyrhizobium gen. nov., a genus of slow-growing rootnodule bacteria from leguminous plants. Int. J. Syst. Bacteriol.32:136-139.

21. Kaluza, K., and H. Hennecke. 1984. Fine structure analysis ofthe nifDK operon encoding the a and P subunits of dinitrogen-ase from Rhizobium japonicum. Mol. Gen. Genet. 196:35-42.

22. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning, a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

23. Maxam, A. M., and W. Gilbert. 1980. Sequencing end-labeledDNA with base-specific chemical cleavages. Methods Enzymol.65:449-561.

24. Messing, J. 1983. New M13 vectors for cloning. MethodsEnzymol. 101:20-78.

25. Messing, J., R. Crea, and H. Seeburg. 1981. A system forshotgun DNA sequencing. Nucleic Acids Res. 9:309-321.

26. Miller, J. H. 1972. Experiments in molecular genetics. ColdSpring Harbor Laboratory, Cold Spring Harbor, N.Y.

27. Murphy, E., and S. Lofdahl. 1984. Transposition of Tn554 doesnot generate a target duplication. Nature (London) 307:292-294.

28. Priefer, U. B., H. J. Burkhardt, W. Klipp, and A. Puhler. 1981.

541VOL. 162, 1985


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


ISRI: an insertion element isolated from the soil bacteriumRhizobium lupini. Cold Spring Harbor Symp. Quant. Biol.45:87-91.

29. Quinto, C., H. de la Vega, M. Flores, L. Fernandez, T. Ballado,G. Soberon, and R. Palacios. 1982. Reiteration of nitrogenfixation gene sequences in Rhizobium phaseoli. Nature (Lon-don) 299:724-726.

30. Quinto, C., M. Flotes, H. de la Vega, R. Azpiros, E. Martinez,M. A. Cevallos4 E. Calva, M. L. Girard, J. Leemans, and R.Palacios. 1984. Organization of nitrogen fixation gene sequencesin Ahizobium phaseoli, p. 696. In C. Veeger and W. E. Newton(ed.), Advances in nitrogen fixation research. Nijhoff/JunkPublishers, The Hague.

31. Regensburger, B., and H. Hennecke. 1983. RNA polymerasefrom Rhizobium japonicum. Arch. Microbiol. 135:103-109.

32. Ruvkun,. G. B., S. R. Long, H. M. Meade, R. C. van den Bos,and F. M. Ausubel. 1982. ISRml: a Rhizobium meliloti insertionsequence that transposes preferentially into nitrogen fixationgenes. J. Mol. Appl. Genet. 1:405-418.

33. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain terminating inhibitors. Proc. Natl. Acad. Sci.U.S.A. 74:5463-5467.

34. Schnabel, H., P. Palm, K. Dick, and B. Grampp. 1984. Sequenceanalysis of the insertion element ISH1.8. and of associatedstructural changes in the genome of phage OFH of the archaebac-terium Halobacterium halobium. EMBO J. 3:1717-1722.

35. Schwartz, R. M., and M. 0. Dayhoff. 1978. Matrices fordetecting distant relationships, p. 353-358. In M. 0. Dayhoff(ed.), Atlas of protein sequence and structure, vol. 5. NationalBiomedical Research Foundation, Washington, D.C.

36. Scott, D. B., C. B. Court, C. W. Ronson, K. F. Scott, J. M.Watson, P. R. Schofield, and J. Shine. 1984. Organisation ofnodulation and nitrogen fixation genes on a Rhizobium trifoliisymbiotic plasmid. Arch. Microbiol. 139:151-157.

37. Scott, D. B., H. Hennecke, and S. T. Lim. 1979. The biosyn-thesis of nitrogenase MoFe protein polypeptides in free-living

cultures of Rhizobium japonicum. Biochim. Biophys. Acta565:365-378.

38. Shepherd, J. C. W. 1981. Method to determine the readingframe of a protein from the purine/pyrimidine genome sequenceand its possible evolutionary justification. Proc. Natl. Acad.Sci. U.S.A. 78:1596-1600.

39. Shine, J., and L. Dalgarno. 1974. The 3'-terminal sequence ofEscherichia coli 16S ribosomal RNA: complementarity to non-sense triplets and ribosome binding sites. Proc. Natl. Acad. Sci.U.S.A. 71:1342-1346.

40. Shine, J., P. R. Schofield, J. J. Weinman, F. Fellows, J.Badenoch-Jones, N. Morrison, K. F. Scott, P. M. Gresshoff,J. M. Watson, and B. G. IRolfe. 1984. Molecular clonirng andorganisation of genes involved in symbiotic nitrogen fixation indifferent Rhizobium species, p. 621-625. In C, Veeger andW. E. Newton (ed.), Advances in nitrogen fixation research.Nijhoff/Junk Publishers, The Hague.

41. Simon, R., U. Priefer, and A. Piuhler. 1983. Vector plasmids forin vivo and in vitro manipulations of gram-negative bacteria, p.98-106. In A. Puhler (ed.), Molecular genetics of the bacteria-plant interaction. Springer Verlag, Heidelberg.

42. Skogen-Hagenson, M. J., and A. G. Atherly. 1983. High-fre-quency induction of nodulation and nitrogen fixation mutants ofRhizobium japonicum. J. Bacteriol. 156:937-940.

43. Smith, G. E., and M. D. Summers. 1980. The bidirectionaltransfer of DNA and RNA to nitrocellulose or diazobenzyl-oxymethyl-paper. Anal. Biochem. 109:123-129.

44. Southern, E. M. 1975. Detection of specific sequences amongDNA fragments separated by gel electrophoresis. J. Mol. Biol.98:503-517.

45. Sundaresan, V., J. D. G. Jones, D. W. Ow, and F. M. Ausubel.1983. Klebsiella pneumoniae nifA product activates the Rhi-zobium meliloti nitrogenase promoter. Nature (London)301:728-732.

46. Vincent, J. M. 1970. A manual for the practical study of the rootnodule bacteria. Blackwell Scientific Publications, Oxford.

J. BACTERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

repeated sequences similar to insertion elements clustered

Documents