relatedtotestes-specific,vespid,andpathogenesisprotein-1 ......(pr-1) proteins, which play major...

Related to Testes-Specific, Vespid, and Pathogenesis Protein-1

(RTVP-1) Is Overexpressed in Gliomas and Regulates

the Growth, Survival, and Invasion of Glioma Cells

Tovit Rosenzweig,1Amotz Ziv-Av,

1Cunli Xiang,

2Wei Lu,

2Simona Cazacu,

2Dvir Taler,

1

Cathie G. Miller,2Reuven Reich,

3Yigal Shoshan,

1Yair Anikster,

1Gila Kazimirsky,

1

Ronit Sarid,1and Chaya Brodie

1,2

1Gonda (Goldschmied) Medical Diagnosis Research Center, Faculty of Life-Sciences, Bar-Ilan University, Ramat-Gan, Israel;2William and Karen Davidson Laboratory of Cell Signaling and Tumorigenesis, Hermelin Brain Tumor Center,Department of Neurosurgery, Henry Ford Hospital, Detroit, Michigan; and 3Department of Pharmacology,School of Pharmacy, Faculty of Medicine, The Hebrew University, Jerusalem, Israel

Abstract

In this study, we examined the expression and functions ofrelated to testes-specific, vespid, and pathogenesis protein 1(RTVP-1) in glioma cells. RTVP-1 was expressed in high levelsin glioblastomas, whereas its expression in low-grade astro-cytomas and normal brains was very low. Transfection ofglioma cells with small interfering RNAs targeting RTVP-1decreased cell proliferation in all the cell lines examined andinduced cell apoptosis in some of them. Overexpression ofRTVP-1 increased astrocyte and glioma cell proliferation andthe anchorage-independent growth of the cells. In addition,overexpression of RTVP-1 rendered glioma cells more resis-tant to the apoptotic effect of tumor necrosis factor–relatedapoptosis-inducing ligand and serum deprivation. To delin-eate the molecular mechanisms involved in the survival effectsof RTVP-1, we examined the expression and phosphorylationof various apoptosis-related proteins. We found that over-expression of RTVP-1 decreased the phosphorylation of c-Jun-NH2-kinase and increased the expression of Bcl2 and thatthe protective effect of RTVP-1 was partially mediated byBcl2. Finally, we found that RTVP-1 regulated the invasion ofglioma cells as was evident by their enhanced migrationthrough Matrigel and by their increased invasion in aspheroid confrontation assay. The increased invasive potentialof the RTVP-1 overexpressors was also shown by the increasedactivity of matrix metalloproteinase 2 in these cells. Ourresults suggest that the expression of RTVP-1 is correlatedwith the degree of malignancy of astrocytic tumors and thatRTVP-1 is involved in the regulation of the growth, survival,and invasion of glioma cells. Collectively, these findingssuggest that RTVP-1 is a potential therapeutic target ingliomas. (Cancer Res 2006; 66(8): 4139-48)

Introduction

Gliomas are the most frequent primary brain tumors, accountingfor >50% of all brain tumors (1, 2). Glioblastomas, the mostmalignant form, are characterized by increased proliferation and

invasion into the surrounding normal brain tissue (3). Currenttreatment options include surgery, radiation therapy, and chemo-therapy. Unfortunately, the prognosis of patients with glioblasto-mas remains extremely poor, and the median survival of 12 monthsfrom the time of diagnosis has not significantly changed duringthe last years (4, 5). Limitations to therapy include the infiltrativenature and enhanced angiogenesis of these tumors (6, 7). Inaddition, glioma cells are resistant to current modalities ofirradiation, chemotherapy, and immunotherapy (8). Therefore,innovative approaches are essential for the treatment of patientswith gliomas, especially because the occurrence of these tumors isincreasing.Related to testes-specific, vespid, and pathogenesis protein 1

(RTVP-1) is a novel gene that was cloned from human glioblastomacell lines by two groups and was identified as glioma pathogenesis–related protein (9) or RTVP-1 (10). RTVP-1 was reported tobe expressed in high levels in gliomas and glioma cell lines,whereas no expression was observed in other cells or tumors ofthe central nervous system (9, 10). In addition, RTVP-1 has alsobeen implicated as a marker of myelomonocytic differentiation inmacrophages (11) and has been reported to act as a tumor-suppressor gene in prostate cancer (12, 13). RTVP-1 contains atransmembrane domain and a putative signal peptide and it hashigh homology with the human testis-specific protein, TPX1 (14),the venom allergen, antigen 5 (15), and with a mouse acidicepididymal glycoprotein–like molecule (16). In addition, RTVP-1 isstructurally related to group 1 of the plant pathogenesis–related(PR-1) proteins, which play major roles in plant defense responseto viral, bacterial, and fungal infection (17, 18). Because the TPX-1and the PR-1 proteins are all secreted (14, 18), it has been suggestedthat RTVP-1 is a secreted protein as well.

The functions of RTVP-1 have been mainly studied in prostatecancer cells (12, 13). RTVP-1 has been reported to be regulated byp53 and by DNA-damaging agents (12). Overexpression of thehuman RTVP-1, similar to its mouse homologue, induced apoptosisin various prostate cell lines (13) and this effect was dependent onthe presence of the signal peptide, suggesting a role of a secretedform of RTVP-1 in this effect (12).

Although RTVP-1 has been reported to be expressed in gliomas,its expression in astrocytic tumors with different degree ofmalignancy and its role in glioma cell function have not beenreported. In this study, we show that the expression of RTVP-1 iscorrelated with the malignancy of astrocytic tumors, and thatRTVP-1 is involved in the regulation of the proliferation, survival,and invasion of glioma cells.

Note: T. Rosenzweig and A. Ziv-Av contributed equally to this work.Requests for reprints: Chaya Brodie, Hermelin Brain Tumor Center, Department

of Neurosurgery, Henry Ford Hospital, Detroit, MI 48202. Phone: 313-916-8619; Fax:313-916-9855; E-mail: [email protected].

I2006 American Association for Cancer Research.doi:10.1158/0008-5472.CAN-05-2851

www.aacrjournals.org 4139 Cancer Res 2006; 66: (8). April 15, 2006

Research Article

Research. on April 19, 2017. © 2006 American Association for Cancercancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

Materials and Methods

Materials. An affinity-purified monoclonal anti-FLAG antibody, leupep-

tin, aprotinin, phenylmethylsulfonyl fluoride (PMSF), and sodium vanadate

were obtained from Sigma Chemical Co. (St. Louis, MO) and a polyclonal

anti–protein kinase Cq antibody was purchased from Santa Cruz

Biotechnology (Santa Cruz, CA). Human tumor necrosis factor–related

apoptosis-inducing ligand (TRAIL) was from Peprotech (Rocky Hill, NJ),

and anti-pAKT, AKT, phosphorylated c-Jun-NH2-kinase (pJNK), JNK,

poly(ADP)ribose polymerase (PARP), active caspase-3, Bax, and Bcl2antibodies were obtained from Cell Signaling Technology (Beverly, MA).

Tumors and primary cultures. Tumors were collected from patients

operated at Henry Ford Hospital (Detroit, MI). Tumors were classified

according to the WHO criteria into the various subtypes of low-grade

astrocytomas, anaplastic astrocytomas, and glioblastomas using formalin-

fixed paraffin-embedded H&E-stained tissue slices. Fresh tissues were

frozen immediately following surgery in liquid nitrogen and stored at

�70jC until processing.

Primary cultures were obtained from freshly resected tissues immedi-

ately following 1 hour of surgical removal. Samples were first washed in PBS

and then minced into small pieces in DMEM with 10% FCS and were further

triturated to obtain maximal cell dispersion. Cells were plated in 25 cm2

tissue culture flasks and were grown for 7 to 10 days. Cultures were used up

to passage 7.Sample collection and processing were done according to the regulations

of the committee on research involving human subjects of the Organization

Institutional Review Board.

Cell lines. The glioma cell lines A172, U87, LN-18, T98G, and LN-229

were obtained from American Type Culture Collection (Manassas, VA), and

the U251 and LNZ308 were obtained from Oliver Bogler (Department of

Neurosurgery, Henry Ford Hospital). Cells were grown on tissue culture

dishes in medium consisting of DMEM containing 10% heat-inactivated

FCS, 2 mmol/L glutamine, penicillin (50 units/mL), and streptomycin (0.05

mg/mL). Medium was changed every 3 to 4 days and cultures were split

using 0.25% trypsin.

Normal astrocytes were obtained from Cambrex (Walkersville, MD). Cellswere grown in an astrocyte-specific medium provided by Cambrex.

RNA extraction and reverse transcription-PCR. Total RNA was

extracted from the tissue samples by RNeasy (Qiagen, Santa Clarita, CA)

according to instructions of the manufacturer. One microgram of total RNA

was transcribed into cDNA using the Reverse Transcriptase System

(Promega, Madison, WI) and pd(N)6 random nucleotides. Relative levels

of RTVP-1 mRNA were estimated by a semiquantitative PCR compared with

the mRNA levels of the ribosomal protein S-12. PCR amplification was done

using Taq DNA Polymerase (Takara, Otsu, Shiga, Japan). Amplification step

consisted of 95jC for 2 minutes and 26 ( for RTVP-1) or 30 ( for S-12) cycles

of 95jC for 30 seconds, 65jC for 30 seconds, and 72jC for 90 seconds. In a

preliminary study, each cDNA was amplified in series of 20 to 40 cycles to

obtain data within the linear range of the assay. PCR products were size

fractionated by electrophoresis in 2% agarose gels and stained with

ethidium bromide. The specificity of the PCR product was verified by DNA

sequencing. Bands from reverse transcription-PCR (RT-PCR) using RTVP-1

and S12 primers were scanned and quantified by Scion Image. RTVP-1

products were normalized to S12 products to control for differences in

loading and sample integrity.

The following primers were used for semiquantitative RT-PCR. For

RTVP-1, forward primer: 5’-TGAGCACTCAGGCAATCACACTCT; reverse

primer: 5V-AGTGCTGGGTCCCAAGTCATGTAT (271 bp product) and

forward primer: 5V-CACAAGCTGCACCCAAACTTCACT; reverse primer: 5V-ATGGGCCAGCCTGGATATACAACA (430 bp product). For S12, the

following primers were used: forward primer, 5V-GGAAGGCATTGCT-

GCTGG, reverse primer, 5V-CCTCAATGACATCCTTGG (285 bp product).

Primers for S-12 and RTVP-1 span exon-intron junctions to avoid

amplification of contaminating genomic DNA.

The expression profile of RTVP-1 mRNA in the different human tissues

was determined in a Human Rapid-Scan panel (Origene, Rockville, MD).

mRNA levels of S12 were determined to control for equal loading.

Real-time RT-PCR. Total RNA was extracted using RNeasy midi kit

according to the instructions of the manufacturer (Qiagen). Reverse

transcription reaction was carried out using 2 Ag total RNA as described

for the RT-PCR analysis. A primer optimization step was tested for each set of

primers to determine the optimal primer concentrations. Once the optimal

primer concentrations were determined, primers, 25 AL of 2� SYBR Green

Master Mix (Invitrogen, Carlsbad, CA), and 30 to 100 ng cDNA samples were

resuspended in a total volume of 50 AL PCR amplification solution. The

following primers were used: RTVP-1 forward, TGCCAGTTTTCACATAATA-

CAC; RTVP-1 reverse, GGATTTCGTCATACCAGTTT and S12 forward,

TGCTGGAGGTGTAATGGACG; S12 reverse, CAAGCACACAAAGATGGGCT.

Reactions were run on an ABI Prism 7000 Sequence Detection System(Applied Biosystems, Foster City, CA). The cycling conditions composed of

4-minute polymerase activation at 95jC and 40 cycles, 95jC for 30 seconds,

60jC for 30 seconds, and 72jC for 1 minute. Cycle threshold (Ct) valueswere obtained from the ABI 7000 software. S12 or h-actin levels were also

determined for each RNA sample as controls. Fold change of relative mRNA

expression was determined using the 2�DCt method (19).

Northern blot analysis. Northern blotting was done on 10 Ag total RNAby using 1% formaldehyde-agarose gel and transfer onto nylon membranes

(Schleicher & Schuell, Dassel, Germany). DNA probes for the RTVP-1 and

glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were synthesized by

PCR and 32P-labeled by random priming (Biological Industries, Beit Haemek,Israel). Hybridization was done at 42jC in 5� SSC-50% formamide-5�Denhardt’s solution-2% SDS-10% dextran sulfate-100 Ag denatured sheared

salmon sperm DNA/mL. GAPDH probe was used to standardize loading.

The Multiple Human Tissue Northern blots were obtained from BDBioscience (Mountain View, CA) and were similarly hybridized with the

RTVP-1 and GAPDH probes.

Construction of RTVP-1 plasmids. The full-length RTVP-1 wasamplified by RT-PCR on template of RNA obtained from U87 cells using

specific primers (5V-TAATAActcgagACCATGCGTGTCACACTTGCTAC-3Vand 5V-TAATAAacgcgtGTCCAAAAGAACTAAATTAG-3V). Xho and MluI sites,

indicated by lowercase letters, were incorporated to facilitate cloning. Thesequence of the PCR product was found to be identical to the published

sequence of RTVP-1 (GI 15217074). The PCR product was cut with Xho,

MluI and cloned into pCMV-tag 2B (Stratagene, La Jolla, CA), which was

previously constructed to contain the MluI site between the XhoI and theApaI sites (20). RTVP-1 was similarly cloned into the MTH vector (21). The

integrity of the inserts was verified by DNA sequencing.

Cell transfection. Cells were transfected either with the control vectoror with the RTVP-1 expression vector by electroporation using the

Nucleofector device, protocol number A29 (Amaxa Biosystems, Gaithers-

burg, MD). Transfection efficiency using nucleofection was between 70%

and 90%. Stable clones were isolated using selection medium containing750 Ag/mL geneticin (Life Technologies, Gaithersburg, MD). All the results

were confirmed on one pool and an additional individual clone.

Small interfering RNA transfection. Small interfering RNA (siRNA)

duplexes were synthesized and purified by Dharmacon (Lafayette, CO). ThesiRNA sequence for targeting RTVP-1 mRNA was 5V-AAGACTGCGTTC-

GAATCCATA-3V(siRNA1). In addition, we used a pool of four RTVP-1 siRNA

duplexes that was also obtained from Dharmacon. A pool of Bcl2 duplexes

was obtained from Dharmacon and a scrambled sequence was used as anegative control. Transfection of siRNAs was done using OligofectAMINE

(Invitrogen) according to the instructions of the manufacturer. Experiments

were done 72 hours after transfection.Adenovirus preparation and infection. The AdEasy system was kindly

provided by Dr. Vogelstein (The Johns Hopkins University School of

Medicine, Baltimore, MD; ref. 22). Adenoviruses expressing RTVP-1 were

prepared as previously described (23). Briefly, RTVP-1 was first cloned intothe pShuttle-CMV. The linearized plasmid was transformed into Escherichia

coli BJ5183-AD-1 competent cells (Stratagene) carrying the pAdEasy-1

plasmid that encodes the adenovirus-5 backbone. Recombination was

confirmed by restriction and PCR analyses. The linearized recombinantplasmid was transfected into HEK293 cells, viruses were collected after 7 to

10 days and were further amplified. Cells were incubated with 5 multiplicity

of infection of the recombinant adenovirus vectors for 1 hour. The medium

Cancer Research

Cancer Res 2006; 66: (8). April 15, 2006 4140 www.aacrjournals.org



was then replaced with fresh medium and the cells were used 24 to 48 hourspost infection.

Generation of anti-RTVP-1 antibody. Anti-RTVP-1 antibody was

generated by 21st Century Biochemicals (Marlboro, MA) by immunizing

rabbits with synthetic pept ides VRIHNKFRSEVKPTAC andCVQLKYPNLVLLD corresponding to amino acids 38 to 53 and 255 to 266

of human RTVP-1, respectively. The anti-RTVP-1 serum was affinity purified

and characterized by ELISA and Western blot analysis.

Quantitation of cell growth. Cells (2 � 104) were seeded in triplicate intissue culture dishes and were harvested at 24-hour intervals using trypsin.

Cells were washed in PBS and were then counted using a phase microscope.

Cell numbers were then calculated per milliliter of the original dilution.

Each assay was done in quadruplets.Soft agar assays. Cells were harvested, washed, and plated in a soft

agar (0.4%) overlaying a 0.9% base agar. The agar plates were incubated at

37jC for 10 days and colonies (containing >50 cells) were viewed by themicroscope and counted. Each assay was done in triplicate.

Preparation of cell homogenates and immunoblot analysis. Cell

pellets (106 cells/mL) were resuspended in 100 AL lysis buffer [25 mmol/L

Tris-HCl (pH 7.4), 50 mmol/L NaCl, 0.5% Na deoxycholate, 2% NP40,0.2% SDS, 1 mmol/L PMSF, 50 Ag/mL aprotinin, 50 Amol/L leupeptin, and

0.5 mmol/L Na3VO4] on ice for 15 minutes. Sample buffer (2�) was added

and the samples were boiled for 5 minutes.

Lysates (30 Ag protein) were resolved by SDS-PAGE and were transferred

to nitrocellulose membranes. The membranes were blocked with 5% dry

milk in PBS and subsequently stained with the primary antibody. Specific

reactive bands were detected using a goat anti-rabbit or goat anti-mouse

IgG conjugated to horseradish peroxidase (Bio-Rad, Hercules, CA) and the

immunoreactive bands were visualized by the ECL Western blotting

detection kit (Amersham, Arlington Heights, IL).

Measurement of cell apoptosis. Cell apoptosis was measured by flow

cytometry after propidium iodide staining as previously described (23).

Briefly, cells were treated according to the specific experiment. The cellswere scraped and centrifuged with the supernatant medium at 3,500 rpm

for 5 minutes. Cells were resuspended in PBS and fixed in 70% ethanol for

1 hour on ice. Fixed cells were washed with PBS and stained with propidium

iodide (5 Ag/mL) solution containing RNase (50 Amol/L). Cells were thenanalyzed on a Becton-Dickinson FACSCalibur.

Cell apoptosis was also measured using antihistone ELISA (Cell Death

Detection kit). For these experiments, extracts of cells containing histone-associated DNA fragments were incubated in 96-well plates coated with

antihistone antibodies for 2 hours. Plates were than washed and incubated

with anti-DNA antibodies conjugated to peroxidase for an additional

2 hours. Substrate solution was added and absorbance was measured ata wavelength of 405 nm. In addition, cell apoptosis was evaluated by

Western blot analysis of PARP and caspase-3 cleavage using anti-PARP

antibody and anti–active caspase-3 antibody.

Invasion assay. Boyden chamber chemoinvasion assays were done as

previously described by Reich et al. (24). Matrigel (reconstituted basement

membrane; 25 Ag) was dried on a polycarbonated filter (polyvinyl

pyrrolidone-free; Nucleopore; Whatmann, Madistone, United Kingdom).

Cells were harvested by brief exposure to 1 mmol/L EDTA, washed with

DMEM containing 0.1% bovine serum albumin, and added to the Boyden

chamber (200,000 cells). Cells were incubated for 6 hours at 37jC in

humidified atmosphere of 95% air and 5% CO2. Cells that transversed the

Matrigel layer and attached to the filter were stained with Diff Quik kit (Dade

Diagnostics, Aguada, Puerto Rico) and counted in five randomized fields.

Results are expressed as the mean F SE of three independent experiments.

Analysis of matrix metalloproteinase isoforms (zymography). Cells

(200,000) were incubated for 24 hours in serum-free DMEM, and theirsupernatant was analyzed for matrix metalloproteinase (MMP) activity on a

gelatin impregnated (1 mg/mL; Difco, Detroit, MI), SDS-PAGE 8% gel, as

described previously by Reich et al. (24, 25). Culture medium samples were

separated on substrate-impregnated gels under nonreducing conditions,followed by 30 minutes of incubation in 2.5% Triton X-100 (BDH, Poole,

United Kingdom). Gels were then incubated for 16 hours at 37jC in 50

mmol/L Tris, 0.2 mol/L NaCl, 5 mmol/L CaCl2, and 0.02% (w/w) Brij 35

(pH 7.6). At the end of the incubation period, gels were stained with 0.5%Coomassie G250 (Bio-Rad) in methanol/acetic acid/H2O (30:10:60).

Spheroid confrontation model. The spheroid confrontation assay was

done as previously described (26). Briefly, fetal rat brains were collected

from Sprague-Dawley rats at embryonic day 18. Single-cell suspensions weremade by digestion of whole brains in 0.1% tyrpsin/HBSS. Cell suspensions

were cultured on agar-coated plates for 3 weeks to allow for the

development of brain aggregates. Cells of interest are also cultured on

agar coated plates for 2 weeks to allow for the development of spheroids. Atthe beginning of culture and once per week thereafter, either Cell Tracker

Red or Cell Tracker Green (Invitrogen) was added to separate wells of

aggregates and spheroids to allow for the visualization of confrontations.

One aggregate and one spheroid were then transferred to a single agar-coated well of a 48-well culture plate and confronted mechanically.

Confrontations were visualized at 24, 48, and 72 hours using an Olympus

fluorescent microscope. Green and red fluorescence was visualizedseparately and merged to visualize invasion.

Statistical analysis. The results are presented as the mean values F SE.

Data were analyzed using ANOVA and a Student’s t test. For real-time PCR

data, Student’s t test (with correction for data sets with unequal variances)was done using Prism 4 (GraphPad Software, Inc., San Diego, CA).

Results

Expression of RTVP-1 in various human tissues. We firstexamined the expression of RTVP-1 in various human tissues byRT-PCR and Northern blot analysis. Using RT-PCR, we found thatthe expression of RTVP-1 was very low in normal brain andundetectable in fetal brain. Similarly, RTVP-1 expression was notdetected in the colon, pancreas, skin, lymphocytes, and fetal liver,whereas higher levels were detected in the heart, spleen, muscle,lung, bone marrow, placenta, adrenal gland, and prostate (Fig. 1A).

Using Northern blot analysis, we observed three main transcriptsthat were detected by the RTVP-1 DNA probe in the heart, placenta,liver, and skeletal muscle (Fig. 1B). This observation is similar to theresults reported by Rich et al. (10). In line with the RT-PCR results,the expression of RTVP-1 in the brain was barely detected by theNorthern blot analysis. In contrast, the expression of RTVP-1 in thelung was detected by RT-PCR but only weakly by Northern blotanalysis. Similarly, five additional samples of lung tissues expressedRTVP-1 mRNA as detected by RT-PCR (data not shown), suggestingthat the discrepancy in the results of the RT-PCR and the Northernblot analysis may represent differences in assay sensitivity orvariability in RTVP-1 expression in different individuals.

Expression of RTVP-1 in astrocytic tumors with differentdegrees of malignancy. RTVP-1 has been previously reported to beexpressed in glioblastomas (9, 10); however, its expression in othertypes of astrocytic tumors has not been reported. To characterizethe expression of RTVP-1 in different types of astrocytic tumors, weused tumor samples from low-grade astrocytomas (grade 2),anaplastic astrocytomas (grade 3), and glioblastomas (grade 4).The expression of RTVP-1 in these tumors was compared with thatof normal brains using semiquantitative RT-PCR. As presented inFig. 2A , the expression of RTVP-1 in normal brains was barelydetected. Similarly, most low-grade astrocytomas expressed verylow levels of RTVP-1. In contrast, higher levels of RTVP-1 wereobserved in anaplastic astrocytomas and glioblastomas (Fig. 2A).Quantitation of RTVP-1 expression compared with that of S12clearly shows that the expression of RTVP-1 in significantly higherin glioblastomas and anaplastic astrocytomas compared with low-grade astrocytomas and normal brains (Fig. 2B).

Similar results were obtained using real-time RT-PCR (Fig. 2C).Thus, the relative RTVP-1 mRNA expression to S12 in brains and

RTVP-1 Expression and Functions in Glioma Cells




low-grade astrocytomas was very low (1.30 F 0.22 and 2.2 F 0.34,respectively), whereas glioblastomas expressed significantly higherlevels of RTVP-1 (6.9 F 0.92).

The expression of RTVP-1 was also examined in glioma cell linesand primary glioma cultures. As presented in Fig. 2D , RTVP-1 wasexpressed in all the glioma cells examined, whereas it was barelydetected in human fetal astrocytes.

Using Northern blot analysis, we observed a strong expressionof the 4.2, 3.2, and 1.1 kb transcripts in the U87 and A172 gliomacell lines and a weaker expression of the 1.6 kb transcript in thesecells (Fig. 2E).

Previous studies reported the expression of four distinct mRNAsof 4.2, 3.2, 1.6, and 1.0 kb by using an RTVP-1 DNA probe. To furtherexplore this point, we examined the effect of the RTVP-1 siRNA onthe expression of the different mRNAs. We found that the RTVP-1siRNA, which targets the first exon of RTVP-1, significantly reducedthe expression of the 1.6 and 1.0 kb mRNAs, whereas it did notsignificantly affect the expression of the 4.2 and 3.2 transcripts(data not shown).

The expression of the RTVP-1 protein was examined using ananti-RTVP-1 antibody and Western blot analysis. The anti-RTVP-1antibody recognized a band around 28 kDa and this band wasblocked by the addition of the immunizing peptides. Similar to the

mRNA results, RTVP-1 was highly expressed in glioblastoma,whereas low expression was observed in normal brains and low-grade astrocytomas (Fig. 2F). Thus, the relative RTVP-1 proteinexpression compared with actin was 4.8 F 0.7 in glioblastomas, 0.56F 0.07 in low-grade astrocytomas, and 0.11 F 0.2 in normal brains.

Silencing of RTVP-1 decreases cell proliferation and inducescell apoptosis. To examine the role of RTVP-1 in glioma cellfunction, we first used siRNAs directed against the RTVP-1 mRNA.Transfection of the glioma cell lines, U87 and A172, with a siRNAduplex for 3 days resulted in around 90% and 70% decrease in theexpression of the RTVP-1 mRNA, respectively, whereas no decreasein the expression of RTVP-1 was observed with a scrambled controlsiRNA (Fig. 3A). The RTVP-1 siRNA also decreased the expressionof the RTVP-1 protein. Transfection of U87 and A172 cells withRTVP-1 siRNA significantly decreased the expression of RTVP-1after 72 hours as detected by anti-RTVP-1 antibody, whereas acontrol siRNA did not have a significant effect (Fig. 3B).

The RTVP-1 siRNA–transfected U87 cells exhibited a significantdecrease in cell proliferation (Fig. 3C) and in cell growth in soft agar(Fig. 3D). In addition, f30% of the U87 cells were apoptotic asdetermined by propidium iodide staining and fluorescence-activated cell sorting (FACS) analysis (Fig. 3E). The A172 cells, inwhich RTVP-1 expression was less reduced by the siRNAs, exhibiteda significant decrease in cell proliferation (Fig. 3C) and cell growthin soft agar (Fig. 3D), but a smaller degree of cell apoptosis asdetermined by propidium iodide staining (Fig. 3E). Similar resultswere observed with another set of RTVP-1 duplex (data not shown).

To further examine the effect of RTVP-1 silencing, we usedestablished primary glioma cultures. Transfection of the primarycultures with RTVP-1 siRNAs reduced the expression of RTVP-1mRNA (Fig. 3A) or protein levels (Fig. 3B) to a different degree.Similar to the results obtained with the glioma cell lines, cells inwhich RTVP-1 was significantly depleted (HF1308) exhibited both adecrease in cell number (Fig. 3C) and an increase in cell apoptosis(Fig. 3E). In contrast, cells in which RTVP-1 expression was onlypartially reduced (HF1254) showed a similar decrease in cellnumber but only a small increase in cell apoptosis (Fig. 3C and E).

Similar results of cell apoptosis were also observed usingadditional apoptosis assays, including anti–active caspase-3antibody (Fig. 3F) and antihistone ELISA (Fig. 3G).

Overexpression of RTVP-1 increases glioma cell growth.Recent studies reported that overexpression of RTVP-1 in prostatecancer cell lines induced cell apoptosis in these cells (12, 13). Toexamine the effect of RTVP-1 on glioma cells, we used glioma cellsstably expressing RTVP-1 (Fig. 4A). For these experiments, we usedtwo clones of control vector cells, CV1 and CV2, and the RTVP-1-overexpressing cells, RTVP1-1 and RTVP1-2. Overexpression ofRTVP-1 is presented in Fig. 4A using anti-FLAG antibody. We foundthat U87 cells stably expressing RTVP-1 (RTVP1-1 and RTVP1-2cells) exhibited higher degree of cell proliferation compared withcontrol vector (CV1 and CV2) cells (Fig. 4B). In addition, we foundthat overexpression of RTVP-1 enhanced the colony-forming abilityof the U87 cells on soft agar (Fig. 4C and D). Thus, RTVP-1-overexpressing cells exhibited an increase in the size and numberof colonies formed on the soft agar compared with the controlvector cells, suggesting that RTVP-1 increased also the anchorage-independent growth of glioma cells. Similar results were obtainedwith two clones of A172 cells overexpressing RTVP-1 (data notshown).

Because RTVP-1 expression is higher in glioma cells comparedwith astrocytes, we examined the effect of RTVP-1 overexpression

Figure 1. The expression profile of RTVP-1 in human tissues. The expressionprofile of RTVP-1 was determined in various human tissues by semiquantitativeRT-PCR using the Human Rapid-Scan panel (Origene). The expression ofS12 was used as a control for equal loading (A ). The expression of RTVP-1mRNA was also determined using Northern blot hybridization with RTVP-1probe of the Multiple Human Tissue Northern Blots (BD Bioscience). Afterhybridization, membranes were rehybridized using a GAPDH probe to control forvariations in gel loading and transfer efficiency (B). Representative of twosimilar experiments.

Cancer Research




on cultured normal human astrocytes. For these experiments, weinfected human astrocytes with an adenovirus vector expressingRTVP-1 and examined the proliferation of the cells following 1 to4 days in culture. As presented in Fig. 4E , astrocytes expressingRTVP-1 exhibited higher degree of cell proliferation after 3 and4 days in culture compared with astrocytes infected with anadenovirus vector expressing LacZ (control vector).

RTVP-1 regulates glioma cell survival. Because silencing ofRTVP-1 induced cell apoptosis in the glioma cell lines, weexamined the role of RTVP-1 overexpression in glioma cell survivalusing the apoptotic stimuli TRAIL and serum starvation. U87 cells

overexpressing control vector cells (CV1 and CV2) exhibited f30%of apoptotic cells in response to TRAIL (100 ng/mL). In contrast,the RTVP1-1 and RTVP1-2 overexpressors exhibited a significantlylower degree of cell apoptosis (Fig. 5A). In addition, we found thatcells overexpressing RTVP-1 were more resistant to cell apoptosisinduced by serum deprivation compared with control vector cells(Fig. 5B). Similar results were obtained using anti-PARP antibody,which detected PARP cleavage (Fig. 5C).

Similarly, RTVP-1 protected A172 from TRAIL-induced apopto-sis. Thus, TRAIL induced apoptosis (24%) in the A172 cells after5 hours of treatment, whereas A172 cells infected with adenovirus

Figure 2. Expression of RTVP-1 in astrocytic tumors and glioma cell lines. Total RNA was extracted from normal brains, low-grade astrocytomas (grade 2), anaplasticastrocytomas (grade 3), and glioblastomas (grade 4). The expression of RTVP-1 was determined using semiquantitative RT-PCR (A and B ) or real-time PCR (C)as described in Materials and Methods. Results of densitometry of the semiquantitative RT-PCR (relative RTVP-1 mRNA to S12) are presented in the graph fornormal brains (n = 8), low-grade astrocytoma (LGA, n = 16), anaplastic astrocytomas (AA, n = 23), and glioblastomas (GBM, n = 33; B). *, P < 0.05; **, P < 0.001.Real-time PCR was done using RTVP-1 and S12 probes of mRNA from five normal brain tissues, 12 low-grade astrocytomas, and 15 glioblastomas. Results arenormalized relative to the levels of S12 mRNA and are presented relative to reference sample. Mean values are marked (C). RNA was extracted from glioma cell lines,primary glioma cultures, and normal human astrocytes. RTVP-1 levels were determined using semiquantitative RT-PCR (D ). The expression of RTVP-1 in the U87and A172 cells was also determined using Northern blot analysis (E ) as described in Fig. 1. After hybridization, membranes were rehybridized using a GAPDH probeto control for variations in gel loading and transfer efficiency. RTVP-1 protein levels were evaluated in seven glioblastomas, five low-grade astrocytomas, and twobrains using Western blot analysis and anti-RTVP-1 antibody (F , 1:500 dilution). One representative of four similar experiments.





vector expressing RTVP-1 showed a significant lower level of cellapoptosis (9%; Fig. 5D).

To delineate the mechanisms involved in the survival effect ofRTVP-1, we examined the expression and phosphorylation ofthe apoptosis-related proteins Bcl2, Bax, AKT, and JNK. We foundthat U87 cells overexpressing RTVP-1 (RTVP1-1 and RTVP1-2)expressed higher levels of Bcl2, whereas no significant differenceswere obtained in the expression of Bax. In addition, cellsoverexpressing RTVP-1 exhibited lower levels of pJNK, whereasno significant changes were observed in the phosphorylation or theexpression of AKT between the two groups of cells (Fig. 5E).

To examine the role of Bcl2 in the protective effect of RTVP-1, wetransfected the RTVP-1-overexpressing U87 cells (RTVP1-1) withBcl2 siRNA and examined the response of the cells to the apoptoticeffect of TRAIL. The expression of Bcl2 was significantly decreasedin RTVP1-1 cells (Fig. 5F) and the CV1 cells (data not shown)transfected with the Bcl2 siRNA for 2 days. We found that silencingof Bcl2 slightly increased the response of the CV1 cells to the

apoptosis induced by TRAIL, whereas it significantly increased theapoptosis of the RTVP-1-overexpressing cells from 12.4% to 22.5%.Thus, the increase in Bcl2 observed in the RTVP-1-overexpressingcells plays a role in the protective effect of RTVP-1 (Fig. 5G).

RTVP-1 regulates the invasion and MMP2 activity in gliomacells. Glioma cells are characterized by increased invasion andmigration (27, 28). To examine the role of RTVP-1 in glioma cellinvasion, we examined the ability of the cells to migrate through aMatrigel layer using Boyden chamber. Overexpression of RTVP-1significantly increased the invasion of U87 cells by f3-foldcompared with control vector cells (Fig. 6A). Similar results wereobserved in A172 cells overexpressing RTVP-1 and these cellsexhibited a 4-fold increase in cell invasion compared with controlvector cells (data not shown).

To further examine the effect of RTVP-1 on glioma cell invasion,we used the spheroid confrontation assay that reflects more thein vivo conditions (25). In this assay, astrocytic and gliomaspheroids were coplated and the degree of invasion of the glioma

Figure 3. Silencing of RTVP-1 decreases cell growth and induces cell apoptosis. U87, A172, HF1254, and HF1308 cells were transfected with siRNAs targeting theRTVP-1 mRNA. The expression of RTVP-1 mRNA was determined after 3 days using semiquantitative RT-PCR (A ). S12 was used to control for equivalent loading/amplification. The effect of the RTVP-1 siRNA on the RTVP-1 protein levels was examined in U87, A172, HF1308, and HF1254 cells using anti-RTVP-1 antibodyand Western blot analysis after 3 days of transfection (B). For determining cell proliferation, cells were counted after 3 days of siRNA transfection (C ). For theanchorage-independent growth of the cells, A172 and U87 cells transfected with control siRNA (Con-siRNA ) and with RTVP-1 siRNA (RT1-siRNA ) were plated in softagar for 8 days and colonies were viewed under a phase contrast microscope and counted (D ).The apoptosis of the cells was determined using propidium iodidestaining and FACS analysis (E ), by anti–active caspase-3 antibody (F ) and by antihistone ELISA (G ). Results are means of three independent experiments(C, D, E , and G ) or one of four separate experiments that gave similar results (A, B , and F ); bars, SE.

Cancer Research




cells into the astrocytic spheroids was than determined. Aspresented in Fig. 6B , U87 overexpressing RTVP-1 started to invadethe astrocytic spheroids within 24 hours of their confrontation,whereas the control vector cells only established a minimal contactwith the astrocytic spheroids at that time. After 48 hours, themajority of the astrocytic spheroids were completely invaded bythe RTVP-1 overexpressors, whereas only a partial invasion ofthe astrocytic spheroids was observed by the control vector cells(Fig. 6B). Similar results were obtained in additional threeexperiments (data not shown). Thus, overexpression of RTVP-1increases the invasive response of glioma cells.

MMPs play important roles in the digestion of extracellularmatrix and in the invasion of tumor cells (28, 29). Using azymography assay, we examined the activation of MMP2 inconditioned medium of control vector and RTVP-1-overexpressingcells. In accordance with our results of the invasion assays, wefound that RTVP-1 increased the activity of MMP2 in the U87cells (Fig. 6C). U87 did not express MMP9 and overexpression ofRTVP-1 did not induce the expression or activation of this MMP(Fig. 6C).

Discussion

In this study, we examined the expression of RTVP-1 in variousastrocytic tumors and the role of RTVP-1 in glioma cell function.RTVP-1 has been originally cloned from human glioma cell lines(9, 10); however, its expression in human tissues and astrocytic

tumors has not been fully characterized and its functions in gliomacells have not yet been reported.

Using RT-PCR and Northern blot analysis, we found that RTVP-1was expressed in various human tissues, such as prostate, heart,spleen, and bone marrow, whereas its expression in other tissues,such as brain, colon, pancreas, and skin was very low or undetec-table. These findings further extend the results reported by Richet al. (10) that RTVP-1 is expressed in a large number of tissues andsupport their results that the expression of RTVP-1 in normal brainwas absent or barely detected. The role of RTVP-1 in the differentnormal tissues in which it is expressed is currently not understood.Based on its homology to members of the PR-1 proteins (9, 17),RTVP-1 may be involved in immune responses to variouspathogens.

Although RTVP-1 has been reported to be highly expressed ingliomas, its relative expression in astrocytic tumors with differentdegree of malignancy was not examined. Using semiquantitativeRT-PCR, we found that the expression of RTVP-1 was the highest inglioblastomas (grade 4), whereas most low-grade astrocytomas(grade 2) expressed very low levels of RTVP-1. Similar results wereobtained using Western blot analysis and anti-RTVP-1 antibody.Thus, our results show that RTVP-1 is highly expressed in gliomas,similar to previous reports (9, 10), and indicate that the expressionof RTVP-1 is correlated with the degree of malignancy of theastrocytic tumors.

In agreement with previous reports (9, 10), three predominantmRNAs of 4.2, 3.2, and 1.0 kb and a weaker band of 1.6 kb were

Figure 4. Overexpression of RTVP-1 enhances cell proliferationand the anchorage-independent growth of glioma cells.Overexpression of RTVP-1 in two stable clones of U87 (RTVP1-1and RTVP1-2) is shown in a Western blot analysis compared withcontrol vector cells (CV1 and CV2) using anti-FLAG antibody(A). Control vector and RTVP-1 overexpressing U87 cells(1 � 105/mL) were plated in plastic dishes and cell number wasmonitored at 24-hour intervals (B). Soft agar assays were done forcontrol vector and RTVP-1-overexpressing U87 cells. Cells wereplated on a 4% soft agar overlaying a bottom layer of 9% agar.The layer of soft agar was further covered with MEM containing10% fetal bovine serum. After 10 days, colonies were viewed undera phase contrast microscope (C ) and nine different fields in eachwell were counted (D ). Normal human astrocytes (1 � 105/mL)were infected with adenovirus vectors expressing RTVP-1 or LacZ(CV ) for 24 hours and cell proliferation (cell number) was determinedup to 4 days in culture (E). Results are means of three independentexperiments (B and D ) or one of four separate experiments thatgave similar results (A, C , and E); bars, SE.





detected by using an RTVP-1 DNA probe. Suppression of RTVP-1protein expression was evident by using siRNA, which targets thefirst exon of RTVP-1. This was coupled with a selective knockdownof the expression of the 1.6 and 1.0 kb mRNAs. Our results, alongwith database from Genbank, imply for two RTVP-1-encodingtranscripts of 1.6 and 1.0 kb; the first contains a longer 3Vuntranslated region. These transcripts are likely to be functionallyequivalent although they could be differentially regulated andtranscribed. The longer transcripts of 3.2 and 4.2 kb are likely tohave partial overlap with RTVP-1 sequences, excluding exon 1.Therefore, they remained stable in the presence of siRNA, whichtargets the first exon of RTVP-1. These transcripts probablyrepresent different genes, such as the 3,359 bases HIV-1 rev bindingprotein 2 mRNA, which contains sequences that are complemen-tary to RTVP-1 exons 5 to 6 and is being transcribed on theopposite strand.

To delineate the function of RTVP-1 in glioma cells, we first usedsiRNAs targeting the RTVP-1 mRNA. Silencing of RTVP-1expression decreased cell proliferation and anchorage-independent

growth in the cell lines examined. In addition, the silencing ofRTVP-1 induced cell apoptosis in some of the cell lines. Thus, celllines and primary cultures in which RTVP-1 expression was almostcompletely reduced exhibited a large degree of cell apoptosis,whereas a small degree of cell apoptosis was observed in cells inwhich RTVP-1 expression was moderately silenced. Our resultspoint to an important role of RTVP-1 in the control of glioma cellgrowth and survival and suggest that a decrease in the expressionof RTVP-1 affects the proliferation of glioma cells and that even lowlevels of RTVP-1 are sufficient to maintain the survival of thesecells. Alternatively, the differential apoptotic response of the gliomacells to RTVP-1 silencing may be due to differences in theexpression of other apoptosis-related proteins or signaling path-ways, such as p53 or Bcl2.

Our conclusions regarding the roles of RTVP-1 in the regulationof glioma cell proliferation were further supported by the resultsobtained with glioma cell overexpressing RTVP-1. Thus, over-expression of RTVP-1 induced an increase in glioma cellproliferation. Similarly, RTVP-1-overexpressing cells displayed an

Figure 5. Effects of RTVP-1 on glioma cellapoptosis and on the expression andphosphorylation of apoptosis-relatedproteins. U87 cells stably transfected withcontrol vector (CV1 and CV2) or withRTVP-1 (RTVP1-1 and RTVP1-2) weretreated with TRAIL (100 ng/mL) for 24hours (A ) or transferred to serum-freemedium for 48 hours (B ). Cell apoptosiswas determined using propidium iodidestaining and FACS analysis or evaluated byPARP cleavage (C ). A172 cells wereinfected with adenovirus vectorsexpressing RTVP-1 or LacZ (CV ). Cellswere stimulated with TRAIL (100 ng/mL)for 5 hours and cell apoptosis wasdetermined using propidium iodidestaining and FACS analysis (D ). TheU87-overexpressing control vector andRTVP-1 were analyzed for the expressionof RTVP-1, Bcl2, Bax, and actin and for theexpression and phosphorylation of JNK andAKT using Western blot analysis (E).To examine the role of Bcl2 in the protectiveeffect of RTVP-1, control vector and U87cells overexpressing RTVP-1 (CV1 andRTVP1-1) were transfected with Bcl2siRNA and with a control siRNA. Theexpression of Bcl2 was examined after48 hours using Western blot analysis (F )and cell apoptosis was examined inTRAIL-treated cells after 24 hours (G ).Results are means of three independentexperiments (A, B, D , and G ) or one of fourseparate experiments that gave similarresults (C, D, E , and F ); bars, SE.

Cancer Research




increased anchorage-independent growth in soft agar. Further-more, we found that overexpression of RTVP-1 increased theproliferation of cultured normal astrocytes. Collectively, theseresults suggest that RTVP-1 plays an important role in the growthof astrocytes and glioma cells.

We also found that cells overexpressing RTVP-1 by eitheradenovirus vectors or by stable expression exhibited an increasedresistance to the apoptosis induced by serum deprivation and byTRAIL. Thus, these data further support the results of the siRNAstudies that RTVP-1 regulates the survival of glioma cells. In anattempt to explore the mechanisms involved in the survivalfunction of RTVP-1, we examined the expression and phosphor-ylation of various apoptosis-related proteins. We found thatoverexpression of RTVP-1 induced an increase in the expressionof Bcl2, whereas it did not significantly alter the expression of Bax.The increase in Bcl2 partially mediated the protective effectof RTVP-1, because silencing of Bcl2 decreased the protective effectof RTVP-1 against TRAIL-induced apoptosis. The expression of Bcl2has been associated with cell survival in various cellular systems(30), including glioma cells (31, 32). Indeed, overexpression of Bcl2protected glioma cells from diverse apoptotic stimuli, such as FASligation, chemotherapeutic drugs, and radiation (33).

Overexpression of RTVP-1 also reduced the phosphorylation ofJNK, whereas it did not affect the phosphorylation of AKT. JNK hasbeen implicated in the regulation of cell apoptosis in response tovarious stimuli (34, 35). Therefore, the decrease in the phosphor-ylated form of JNK together with the increased expression of Bcl2may render the overexpressing cells resistant to the apoptosisinduced by serum-deprivation and TRAIL.

Our results regarding the role of RTVP-1 in glioma cell survivalare different from those reported by Ren et al. (12, 13) for prostate

cancer cells. In their studies, Ren et al. (12, 13) reported thatoverexpression of RTVP-1 using adenovirus vectors induced cellapoptosis in prostate cancer cells and concluded that RTVP-1 actedas a tumor suppressor gene in these cells. The reason for thedifferent results obtained in both studies can be probablyattributed to the different cellular systems that have been used.Interestingly, the expression of RTVP-1 is higher in the normalprostate compared with prostate tumors, opposite to what is foundin normal brain/astrocytes and gliomas, where RTVP-1 expressionis barely detected in the normal brain but is highly expressed in themalignant astrocytic tumors. Thus, RTVP-1 may act as a tumorsuppressor gene in prostate cells and as a tumor promoter ingliomas and exerts opposite effects on cell apoptosis in these twocellular systems. Alternatively, the opposite effects of RTVP-1 in thetwo cellular systems may be due to the different processing ofRTVP-1 in these cells. Based on their deletion studies, Ren et al.(12) suggested that the apoptotic effect of RTVP-1 is mediated by asecreted form of the protein. Thus, differences in the levels ofcellular and extracellular forms of RTVP-1 in gliomas and prostatecancer cells may influence the apoptotic potential of RTVP-1.Additional studies using specific anti-RTVP-1 antibodies areessential to explore these possibilities.

In addition to its role in cell growth and survival, RTVP-1 alsoregulated the invasion of glioma cells in vitro . Thus, RTVP-1-overexpressing cells migrated more through Matrigel comparedwith control vector cells. In addition, we showed that RTVP-1overexpressors exhibited stronger invasive properties into astro-cytic spheroids compared with control vector cells. One of themechanisms that contribute to the increased invasion of gliomacells is the expression and activation of MMPs (36, 37). MMPs are afamily of enzymes involved in the degradation of extracellular

Figure 6. RTVP-1 regulates glioma cellinvasion and MMP2 activation. Controlvector or RTVP-1-overexpressing U87cells were added to the top compartment ofa Boyden chamber. After 8 hours ofincubation, cells that traversed theMatrigel-coated filters were stained andcounted. The RTVP-1-overexpressingcells show increased ability to traverseMatrigel-covered filters compared withcontrol vector or parental cells (A).For spheroid confrontation assays, controlvector and RTVP-1-overexpressing U87cells labeled with Cell Tracker Red, and ratbrain aggregates labeled with Cell TrackerGreen, were confronted for 24 and48 hours. Invasion is documented as acomposite of fluorescence imagescollected with an Olympus IX50 fluorescentmicroscope. Representative results forthe control vector and RTVP-1 clones.B, aliquots (20-30 AL) of supernatantsderived from control vector andRTVP-1-overexpressing U87 cells werenormalized for equal protein concentrationand applied for zymography on gelatin-impregnated SDS-PAGE, as described inMaterials and Methods. The latent andactive forms of MMP2 are shown at 72 and62 kDa, respectively (C). Results aremeans of three independent experiments(A) or one of four separate experimentsthat gave similar results (B, C); bars, SE.





matrix and therefore play a role in tumor invasion and metastasis(38, 39). We found that in control U87 cells, the active forms ofMMP2 and MMP9 were undetected. In contrast, the activity ofMMP2 was significantly increased in cells overexpressing RTVP-1,further suggesting that RTVP-1 increases the invasive potential ofglioma cells. Our results indicate that although U87 expressendogenous RTVP-1, its overexpression further enhances thegrowth, survival, and invasion of these cells.

The activation of MMP2 is regulated by the interaction betweenMMP2, MT1-MMP, and the tissue inhibitor of metalloproteinase-2(40, 41). The mechanisms by which RTVP-1 induces the activationof MMP2 are currently under investigation. However, it isnoteworthy that overexpression of Bcl2 has been recently shownto increase the activity of MMP2 via a furin-dependent pathwayand to regulate the motility and invasiveness of glioma cells(42, 43). Thus, the increased expression of Bcl2 in the RTVP-1-overexpressing cells may also play a role in the increased MMP2activity and invasion of the glioma cells in addition to itsantiapoptotic effect.

In summary, we found that RTVP-1 is highly expressed inglioblastomas compared with low-grade astrocytomas and normalbrains and that it plays a role in the regulation of the growth,survival, and invasion of glioma cells. Gliomas exhibit poorprognosis mainly due to their invasive potential and resistance tocurrent therapeutic modalities. Thus, defining novel moleculartargets is essential for the development of more effectivetherapeutic strategies. The results of this study suggest thatRTVP-1 may serve as a diagnostic marker and a novel therapeutictarget in the treatment of gliomas.

Acknowledgments

Received 8/11/2005; revised 1/9/2006; accepted 2/10/2006.Grant support: James S. McDonnell Foundation 21st Century Scientist Award/

Brain Cancer Research (C. Brodie), National Cancer Institute grant CA-R21-96965, andWilliam and Karen Davidson Fund, Hermelin Brain Tumor Center.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Sandra Rempel for critical review of the manuscript.

Cancer Research


References1. Kleihues P, Louis DN, Scheithauer BW, et al. TheWHO classification of tumors of the nervous system.J Neuropathol Exp Neurol 2002;61:215–25.

2. Sanson M, Thillet J, Hoang-Xuan K. Molecular changesin gliomas. Curr Opin Oncol 2004;16:607–13.

3. Rasheed BK, Wiltshire RN, Bigner SH, et al. Molecularpathogenesis of malignant gliomas. Curr Opin Oncol1999;11:162–7.

4. Desjardins A, Rich JN, Quinn JA, et al. Chemotherapyand novel therapeutic approaches in malignant glioma.Front Biosci 2005;10:2645–68.

5. Prados MD, Levin V. Biology and treatment ofmalignant glioma. Semin Oncol 2000;27:1–10.

6. Giese A, Bjerkvig R, Berens ME, Westphal M. Cost ofmigration: invasion of malignant gliomas and implica-tions for treatment. J Clin Oncol 2003;21:1624–36.

7. Maher EA, Furnari FB, Bachoo RM, et al. Malignantglioma: genetics and biology of a grave matter. GenesDev 2001;15:1311–33.

8. Lefranc F, Brotchi J, Kiss R. Possible future issues inthe treatment of glioblastomas: special emphasis on cellmigration and the resistance of migrating glioblastomacells to apoptosis. J Clin Oncol 2005;23:2411–22.

9. Murphy EV, Zhang Y, Zhu W, Biggs J. The humanglioma pathogenesis-related protein is structurallyrelated to plant pathogenesis-related proteins and itsgene is expressed specifically in brain tumors. Gene1995;159:131–5.

10. Rich T, Chen P, Furman F, Huynh N, Israel MA. RTVP-1, a novel human gene with sequence similarity to genesof diverse species, is expressed in tumor cell lines of glialbut not neuronal origin. Gene 1996;180:125–30.

11. Gingras MC, Margolin JF. Differential expression ofmultiple unexpected genes during U937 cell andmacrophage differentiation detected by suppressivesubtractive hybridization. Exp Hematol 2000;28:65–76.

12. Ren C, Li L, Goltsov AA, Timme TL. mRTVP-1, anovel p53 target gene with proapoptotic activities. MolCell Biol 2002;22:3345–57.

13. Ren C, Li L, Yang G, Timme TL. RTVP-1, a tumorsuppressor inactivated by methylation in prostatecancer. Cancer Res 2004;64:969–76.

14. Foster JA, Gerton GL. Autoantigen 1 of the guinea pigsperm acrosome is the homologue of mouse Tpx-1 andhuman TPX1 and is a member of the cysteine-richsecretary protein (CRISP) family. Mol Reprod Dev 1996;44:221–9.

15. Lu G, Villalba M, Coscia MR, Hoffman DR, King TP.Sequence analysis and antigenic cross-reactivity of a

venom allergen, antigen 5, from hornets, wasps, andyellow jackets. J Immunol 1993;150:2823–30.

16. Mizuki N, Kasahara M. Mouse submandibular glandsexpress an androgen-regulated transcript encoding anacidic epididymal glycoprotein-like molecule. Mol CellEndocrinol 1992;89:25–32.

17. Szyperski T, Fernandez C, Mumenthaler C,Wuthrich K. Structure comparison of human gliomapathogenesis-related protein GliPR and the plantpathogenesis-related protein P14a indicates a func-tional link between the human immune system and aplant defense system. Proc Natl Acad Sci U S A 1998;95:2262–6.

18. Van Loon LC, Van Strien EA. The families ofpathogenesis-related proteins, their activities and com-parative analysis of PR-1 type proteins. Physiol MolPlant Pathol 1999;55:85–97.

19. Livak KJ, Schmittgen TJ. Analysis of relative geneexpression data using real-time quantitative PCR andthe 2(�DDC(T)) method. Methods 2001;25:402–8.

20. Brodie C, Steinhart R, Kazimirsky G, et al. PKCyassociates with and is involved in the phosphorylationof RasGRP3 in response to phorbol esters. MolPharmacol 2004;66:76–4.

21. Olah Z, Lehel C, Jakab G, Anderson WB. A cloningand e-epitope-tagging insert for the expression ofpolymerase chain reaction-generated cDNA fragmentsin Escherichia coli and mammalian cells. Anal Biochem1994;221:94–102.

22. He TC, Zhou S, da Costa LT, Yu J, Kinzler KW,Vogelstein B. A simplified system for generatingrecombinant adenoviruses. Proc Natl Acad Sci U S A1998;95:2509–14.

23. Okhrimenko H, Lu W, Xiang C, et al. Roles of tyrosinephosphorylation and cleavage of protein kinase Cy in itsprotective effect against tumor necrosis factor-relatedapoptosis inducing ligand-induced apoptosis. J BiolChem 2005;280:23643–52.

24. Reich R, Blumenthal M, Liscovitch M. Role ofphopholipase D in laminin induced production ofgelatinase A (MMP-2) in metastatic cells. Clin ExpMetastasis 1995;13:134–40.

25. Givant-Horwitz V, Davidson B, Reich R. Laminin-induced signaling in tumor cells: the role of the M(r)67,000 laminin receptor. Cancer Res 2004;64:3572–9.

26. Golembieski WA, Ge S, Nelson K, Mikkelsen T,Rempel SA. Increased SPARC expression promotes U87glioblastoma invasion in vitro . Int J Dev Neurosci 1999;17:463–72.

27. Giese A, Westphal M. Glioma invasion in the centralnervous system. Neurosurgery 1996;39:232–50.

28. Wild-Bode C, Weller M, Wick W. Molecular determi-nants of glioma cell migration and invasion. J Neurosurg2001;94:978–4.

29. Sternlicht MD, Werb Z. How matrix metalloprotei-nases regulate cell behavior. Annu Rev Cell Dev Biol2001;17:463–16.

30. Cory S, Adams JM. The Bcl2 family: regulators ofthe cellular life-or-death switch. Nat Rev Cancer 2002;2:647–56.

31. Bogler O, Weller M. Apoptosis in gliomas, and its rolein their current and future treatment. Front Biosci 2002;7:339–53.

32. Steinbach JP, Weller M. Apoptosis in gliomas:molecular mechanisms and therapeutic implications.J Neurooncol 2004;70:245–54.

33. Weller M, Malipiero U, Aguzzi A, Reed JC, Fontana A.Protooncogene bcl-2 gene transfer abrogates Fas/APO-1antibody-mediated apoptosis of human malignantglioma cells and confers resistance to chemotherapeuticdrugs and therapeutic irradiation. J Clin Invest 1995;95:2633–43.

34. Davis RJ. Signal transduction by the JNK group ofMAP kinases. Cell 2000;103:239–52.

35. Tsuiki H, Tnani M, Okamoto I, et al. Constitutivelyactive forms of c-Jun NH2-terminal kinase are expressedin primary glial tumors. Cancer Res 2003;63:250–5.

36. Demuth T, Berens ME. Molecular mechanisms ofglioma cell migration and invasion. J Neurooncol 2004;70:217–28.

37. Guo P, Imanishi Y, Cackowski FC. Up-regulation ofangiopoietin-2, matrix metalloprotease-2, membranetype 1 metalloprotease, and laminin 5g2 correlates withthe invasiveness of human glioma. Am J Pathol 2005;166:877–90.

38. Rao JS. Molecular mechanisms of glioma invasiveness:the role of proteases. Nat Rev Cancer 2003;3:489–501.

39. Brinckerhoff CE, Matrisian LM. Matrix metallopro-teinases: a tail of a frog that became a prince. Nat RevMol Cell Biol 2002;3:207–14.

40. Massova I, Kotra LP, Fridman R, Mobashery S. Matrixmetalloproteinases: structures, evolution, and diversifi-cation. FASEB J 1998;12:1075–95.

41. Visse R, Nagase H. Matrix metalloproteinases andtissue inhibitors of metalloproteinases: structure, func-tion, and biochemistry. Circ Res 2003;92:827–39.

42. Wick W, Wagner S, Kerkau S, Dichgans J, Tonn JC,Weller M. BCL-2 promotes migration and invasivenessof human glioma cells. FEBS Lett 1998;440:419–24.

43. Wick W, Wild-Bode C, Frank B, Weller M. BCL-2-induced glioma cell invasiveness depends on furin-likeproteases. J Neurochem 2004;91:1275–83.



2006;66:4139-4148. Cancer Res Tovit Rosenzweig, Amotz Ziv-Av, Cunli Xiang, et al. Regulates the Growth, Survival, and Invasion of Glioma CellsProtein-1 (RTVP-1) Is Overexpressed in Gliomas and Related to Testes-Specific, Vespid, and Pathogenesis

Updated version

http://cancerres.aacrjournals.org/content/66/8/4139

Access the most recent version of this article at:

Cited articles

http://cancerres.aacrjournals.org/content/66/8/4139.full.html#ref-list-1

This article cites 43 articles, 15 of which you can access for free at:

Citing articles

/content/66/8/4139.full.html#related-urls

This article has been cited by 6 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

[email protected] at

To request permission to re-use all or part of this article, contact the AACR Publications


http://cancerres.aacrjournals.org/content/66/8/4139

http://cancerres.aacrjournals.org/content/66/8/4139.full.html#ref-list-1

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

mailto:[email protected]


relatedtotestes-specific,vespid,andpathogenesisprotein-1 ......(pr-1) proteins, which play major...

Documents