Regulation of Type III Secretion ofTranslocon and Effector Proteins by theEsaB/EsaL/EsaM Complex in Edwardsiellatarda

Lu Yi Liu,a,b Pin Nie,b,c Hong Bing Yu,d Hai Xia Xieb,c

College of Fisheries, Huazhong Agricultural University, Wuhan, Hubei Province, Chinaa; State Key Laboratory ofFreshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan,Hubei Province, Chinab; Key Laboratory of Aquaculture Disease Control, Ministry of Agriculture, Wuhan, HubeiProvince, Chinac; Department of Pediatrics, BC Children's Hospital Research Institute and the University ofBritish Columbia, Vancouver, Canadad

ABSTRACT The type III secretion system (T3SS) plays a crucial role in the pathogen-esis of many Gram-negative bacteria, including Edwardsiella tarda, an important fishpathogen. Within the E. tarda T3SS, there are three proteins (EsaB/EsaL/EsaM) thatare homologous to proteins present in many other bacteria, including SpiC/SsaL/SsaM in Salmonella, SepD/SepL/CesL in enteropathogenic Escherichia coli (EPEC) andenterohemorrhagic E. coli (EHEC), and YscB/YopN/SycN in Yersinia. EsaL was found tointeract with both EsaB and EsaM within the bacterial cell, as revealed by a coimmu-noprecipitation assay. Moreover, EsaM is required for EsaB stability, and the two pro-teins interact with each other. EsaB, EsaL, and EsaM are all indispensable for the se-cretion of the T3SS translocon protein EseC into supernatants under pH 5.5 and pH7.2 conditions. Unlike EseC, EseG is a T3SS effector whose secretion is suppressed byEsaL at pH 7.2 while it is promoted at pH 5.5 condition. Despite this finding, mutantstrains lacking EsaB, EsaL, or EsaM (i.e., the ΔesaB, ΔesaL, or ΔesaM strain, respec-tively) were all outcompeted by wild-type E. tarda during a coinfection model. Theseresults demonstrate that EsaB/EsaL/EsaM form a ternary complex controlling the se-cretion of T3SS translocon and effector proteins and contributing to E. tarda patho-genesis.

KEYWORDS Edwardsiella tarda, EsaB/EsaL/EsaM, T3SS

Edwardsiella tarda is a facultative intracellular bacterium that belongs to the Enter-obacteriaceae family. It can cause gastrointestinal and systemic infections in humans

and hemorrhagic septicemia in fish (1, 2). E. tarda is able to invade epithelial cells andmacrophages, where it multiplies in an Edwardsiella-containing vacuole (ECV), contrib-uting to E. tarda pathogenesis (3, 4).

A comparative proteomics study has shown that the type III secretion system (T3SS)is one of the most important virulence factors of E. tarda (3, 5). T3SSs are also presentin many other Gram-negative pathogens, and they are used to deliver bacterial proteins(effectors) into host cells for bacterial pathogenesis. E. tarda T3SS belongs to the Ssa-Escfamily, which includes the T3SS encoded by Salmonella pathogenicity island 2 (SPI-2) inSalmonella enterica serovar Typhimurium, the locus of enterocyte effacement (LEE) inenteropathogenic Escherichia coli (EPEC), and Chromobacterium pathogenicity island 2(CPI2) in Chromobacterium violaceum (3, 6–8). The core components of E. tarda T3SS areencoded by 34 genes and exhibit different functions (3, 9). For instance, the E. tardaT3SS encodes three translocon proteins essential for delivery of effectors into host cells,i.e., EseB, EseC, and EseD (EseB/EseC/EseD) (3). E. tarda T3SS also encodes severalchaperones required for the secretion and/or stability of EseB/EseC/EseD, including

Received 3 May 2017 Returned formodification 29 May 2017 Accepted 14 June2017

Accepted manuscript posted online 19June 2017

Citation Liu LY, Nie P, Yu HB, Xie HX. 2017.Regulation of type III secretion of transloconand effector proteins by the EsaB/EsaL/EsaMcomplex in Edwardsiella tarda. Infect Immun85:e00322-17. https://doi.org/10.1128/IAI.00322-17.

Editor Shelley M. Payne, University of Texas atAustin

Copyright © 2017 American Society forMicrobiology. All Rights Reserved.

Address correspondence to Pin Nie,pinnie@ihb.ac.cn, or Hai Xia Xie, xieh@ihb.ac.cn.

MOLECULAR PATHOGENESIS

crossm

September 2017 Volume 85 Issue 9 e00322-17 iai.asm.org 1Infection and Immunity

on February 22, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

EscA, EscC, and EseE (10–12). We recently identified another protein, EscB, as thechaperone of EseG, the first characterized effector in E. tarda, which shows a strongability to disassemble microtubule structures (13). We along with others have alsoidentified two other effectors (EseJ and EseH) that show different biological functions.EseJ inhibits E. tarda adherence to epithelial cells but facilitates its replication insidemacrophages (9). EseH inhibits the phosphorylation of ERK1/2, p38�, and JunN-terminal protein kinase (JNK) mitogen-activated protein kinase (MAPK) signalingpathways (14). It should be noted that the function of the E. tarda T3SS is also tightlyregulated by several proteins, such as EsrA, EsrB, and EsrC (3, 15).

Upon contact with host cells, the T3SS secretes proteins in a defined order, startingwith needle-like complex proteins, followed by translocators and finally effectors (16,17). The ordered secretion of these proteins is a prerequisite for the T3SS to functionproperly. Of particular interest, a family of conserved proteins acts as a plug orgatekeeper, preventing effector secretion but allowing efficient translocon secretion. InSalmonella, the SPI-2 senses the neutral pH in the host cytosol and triggers thedissociation of a gatekeeper-containing protein complex (SsaL, SpiC, and SsaM), leadingto the translocation of effectors into the host cytosol (18). Similarly, in Chlamydiapneumonia, the gatekeeper protein CopN forms a complex with a chaperone, Scc3, andtranslocon protein, CopB, ensuring the ordered secretion of translocon proteins andeffectors (19). Yersinia sp. also contains such a complex (YopN/SycN/YscB/TyeA) thatprevents unnecessary secretion of effectors prior to its contact with host cells (20).While YopN and TyeA are present as two individual proteins adjacent to each other inYersinia spp., the homologues of YopN and TyeA in other bacteria appear to fuse witheach other and form a single protein, including C. pneumoniae CopN (21), Shigellaflexneri MxiC (22), Salmonella InvE (23), and SepL in enteropathogenic E. coli (EPEC) andenterohemorrhagic E. coli (EHEC) (24–26).

In this study, we identified a gatekeeper-like protein (EsaL) in E. tarda. EsaL shareshigh homology with T3SS gatekeeper proteins in other bacteria, such as SsaL, SepL, andYopN-TyeA. Our results suggest that EsaL forms a ternary complex with two otherT3SS-encoded proteins (EsaB and EsaM) to control the T3SS activity, thus contributingto E. tarda pathogenesis.

RESULTSEsaL in E. tarda has homologues in other Gram-negative pathogens. Through

sequence analysis of the E. tarda T3SS, we identified a protein that contains an HrpJsuperfamily domain (amino acids [aa] 76 to 235; E value, 1.94e�19) and a TyeAsuperfamily domain (aa 298 to 368; E value, 8.84e�05), which was referred to as EsaL.EsaL shares 26.9%, 22.2%, and 22.3% identity with SsaL of Salmonella SPI-2, SepL ofEPEC/EHEC, and YopN of Yersinia enterocolitica, respectively (Table 1). Since SsaL, SepL,and YopN function as a class of gatekeeper proteins to regulate the type III secretionhierarchy of translocators and effectors (18, 27, 28), we hypothesized that EsaL couldalso be a gatekeeper-like protein controlling the T3SS activity in E. tarda.

EsaL is not secreted into culture supernatants and is required for efficientsecretion of translocon proteins EseB, EseC, and EseD. As a gatekeeper protein,

TABLE 1 Similarity matrix for EsaL/EsaB/EsaM homologues

E. tarda protein

Homologous protein (% identity)a

S. enterica (SPI-2) EPEC/EHEC Y. enterocolitica

EsaL SsaL (26.9) SepL (22.2) YopN (22.3)EsaB SpiC (20.3) SepD (15.4) YscB (21.5)EsaM SsaM (26.7) CesL (17.9) SycN (22.3)aProtein sequences of EsaL, EsaB, and EsaM and their homologues in other bacteria were compared. Thepercentage of identical amino acid residues was calculated using the MegAlign program within theDNASTAR package (DNASTAR, Madison, WI, USA). The corresponding protein sequences were retrievedthrough the following GenBank accession numbers: EsaL (AAV69401.1); SsaL (NP_460377.1); SepL(AAK26726.1); YopN (NP_052400.1); EsaB (AAV69410.1); SpiC (AAC44300.1); SepD (KOZ85538.1); YscB(AAC37019.1); EsaM (AAX76922.1); SsaM (NP_460378.1); CesL (EGD65469.1); SycN (NP_783671.1).

Liu et al. Infection and Immunity

September 2017 Volume 85 Issue 9 e00322-17 iai.asm.org 2

on February 22, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

YopN is secreted into culture supernatants (29). We first asked if EsaL would be secretedby the E. tarda T3SS. To address this, total bacterial proteins (TBP) and extracellularproteins (ECP) from wild-type (WT) E. tarda PPD130/91, its isogenic ΔesaL strain, and theΔesaL/pJN-esaL-2HA (where HA is hemagglutinin) complementation strain were probedwith antibodies against EsaL or EvpC. EvpC, a major protein secreted via the type VIsecretion system (another important virulence program used by E. tarda) but not by theT3SS, was used as a loading control (30). As shown in Fig. 1A, EsaL was detected fromTBP of the wild-type and ΔesaL/pJN-esaL-2HA strains but not from ECP prepared fromall strains, suggesting that EsaL is not a type III secreted protein.

We then determined if deletion of esaL would have a general impact on thesecretion of extracellular proteins. As shown in Fig. 1C, the secretion of the transloconproteins EseB/EseC/EseD was remarkably reduced in the ΔesaL strain compared to thelevel in WT E. tarda. Moreover, the ΔesaL/pJN-esaL-2HA complementation strain and WTstrain showed the same ECP profile, indicating that the esaL deletion does not have apolar effect on the function of downstream genes. To further confirm our findings, TBPand ECP of the above strains were subjected to immunoblotting against EseB/EseC/EseD and EvpC. In the TBP fraction, the ΔesaL strain had dramatically increasedintracellular levels of EseB/EseC/EseD compared to those of the WT strain (Fig. 1A).Additionally, introducing the wild-type copy of EsaL (carried by pJN-esaL-2HA) into theΔesaL strain decreased intracellular EseB/EseC/EseD to levels similar to those of the WTstrain (Fig. 1A). In the ECP fraction, however, significantly less EseB/EseC/EseD wassecreted by the ΔesaL strain than by the WT strain or the complementation strain (Fig.1A and B). These results show that EsaL is required for efficient secretion of EseB/EseC/EseD.

EsaB and EsaM are also required for efficient secretion of translocon proteins.EsaL homologues in other bacteria, such as SsaL, SepL, and YopN, form a complex withtwo other proteins (i.e., SsaL/SpiC/SsaM, SepL/SepD/CesL, and YopN/YscB/SycN) tocontrol the T3SS activity (18, 20, 25, 31, 32). Indeed, further sequence analysis of the E.tarda T3SS identified two proteins (EsaM and EsaB) that might also form a complex withEsaL. EsaM shares 26.7%, 17.9%, and 22.3% identity with SsaM, CesL, and SycN,respectively (18, 25), while EsaB shares 20.3%, 15.4%, and 21.5% identity with SpiC,SepD, and YscB, respectively (24, 33, 34) (Table 1).

We then determined if deletion of esaB or esaM would affect the T3SS activity. TheECP collected from equal amounts of bacteria were subjected to electrophoresis inmorpholineethanesulfonic acid (MES) SDS running buffer, followed by staining withCoomassie blue. As shown in Fig. 2A, a mutant lacking the T3SS ATPase EsaN (ΔesaNstrain) failed to secrete any EseB/EseC/EseD proteins into the supernatant, as expected(9). The secretion of EseB/EseC/EseD was dramatically decreased in esaL, esaB, and esaMmutants compared to levels in the WT strain. To corroborate this observation, wedetermined the extracellular and intracellular levels of EseB/EseC/EseD in these strainsby immunoblotting. As expected, extracellular levels of EseB/EseC/EseD in the ΔesaL,ΔesaB, and ΔesaM strains were significantly lower than those in the WT strain (Fig. 2Band C). In contrast, all three mutants showed increased intracellular levels of EseB/EseC/EseD compared to levels in the WT strain. Moreover, the secretion of EseB/EseC/EseD was restored to the wild-type level when the ΔesaL and ΔesaB strains werecomplemented in trans with plasmid-borne EsaL and EsaB (i.e., the ΔesaL/pJN-esaL-2HAand ΔesaB/pJN-esaB-2HA strains, respectively) (Fig. 2A). However, the secretion ofEseB/EseC/EseD by the ΔesaM/pACYC-esaM complementation strain was only partiallyrestored. Complementing the ΔesaM strain with another plasmid-borne EsaM (pJN-esaM) also failed to restore the secretion of EseB/EseC/EseD (data not shown). We notedthat complementation of the esaM mutant resulted in many more high-molecular-mass(HMM) proteins being secreted. It might be interesting to identify these HMM proteinsby mass spectrometry and test if EsaM positively regulates their expression/secretion.Presumably, to fully restore the secretion of translocon proteins by the ΔesaM strain, weneed to transform the mutant with a chromosomal copy of esaM whose expression ismore physiologically regulated by the T3SS. Nevertheless, these data demonstrate that

Regulation of Type III Secretion in E. tarda Infection and Immunity

September 2017 Volume 85 Issue 9 e00322-17 iai.asm.org 3

on February 22, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

EsaL, EsaB, and EsaM are all required for efficient secretion of the translocon proteinsEseB/EseC/EseD.

EsaL interacts with EsaB as revealed by a yeast two-hybrid assay. We thendecided to examine if EsaL is capable of binding to EsaB and EsaM. To test this

FIG 1 EsaL is not secreted into culture supernatants and is required for efficient secretion of EseB, EseC,and EseD. (A) Total bacterial proteins (TBP) and extracellular proteins (ECP) from similar amounts of theWT, ΔesaL strain, and the ΔesaL/pJN-esaL-2HA complementation strain were probed with antibodiesagainst EsaL, EseB, EseC, EseD, and EvpC. EvpC, a protein secreted by the type VI secretion system butnot by the T3SS, was used as a loading control. The arrowhead indicates the nonspecific band detectedin the bacterial lysate. (B) Quantitative analysis of the secretion of translocon proteins EseB, EseC, andEseD. The extracellular protein levels of EseB, EseC, and EseD were normalized against the level of EvpC,and the value is presented as relative intensity. The graphs show the relative ratios (plus SEM) of secretedEseB, EseC, and EseD, which are averages of the results of three independent experiments. ***, P � 0.001.(C) Secretion profiles of the WT, ΔesaL strain, and ΔesaL/pJN-esaL-2HA complementation strain. Samplesof ECP from similar amounts of bacteria grown in DMEM were separated using SDS-PAGE and stainedwith Coomassie blue. T3SS proteins are EseC, EseB, and EseD, and T6SS proteins are EvpI and EvpC. Theidentity of the bands shown was confirmed by matrix-assisted laser desorption ionization–time of flightmass spectrometry analysis.

Liu et al. Infection and Immunity

September 2017 Volume 85 Issue 9 e00322-17 iai.asm.org 4

on February 22, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

possibility, we cloned esaL, esaB, and esaM into yeast two-hybrid system vectors(pGBKT7 and pGADT7) and explored the pairwise interaction between EsaB/EsaL/EsaMand EsaL. The recombinant plasmid pGBKT7-esaL expresses the bait protein, whereasplasmids pGADT7-esaL, pGADT7-esaB, and pGADT7-esaM express prey proteins. In thisassay, the positive interaction of bait and prey proteins will activate the transcription offour reporter genes (TRP1, LEU2, HIS3, and ADE2) and the gene MEL1 encoding�-galactosidase, leading to the formation of blue colonies on plates containing selec-tive synthetic dropout (SD) medium lacking adenine, histidine, leucine, and tryptophan(SD Ade� His� Leu� Trp�) and supplemented with 5-bromo-4-chloro-3-indolyl-�-galactopyranoside (X-�-Gal). As shown in Fig. 3A, Saccharomyces cerevisiae strainstransformed with pGBKT7-esaL plus pGADT7-esaL or with pGBKT7-esaL plus pGADT7-esaB were able to grow in the selective medium as blue colonies, similar to growth ofthe positive control where the yeast was transformed with pGBKT7-53 plus pGADT7-T.In contrast, the negative-control and yeast strains transformed with other plasmids

FIG 2 EsaL, EsaB, and EsaM control the secretion of translocon proteins EseB/EseC/EseD. (A) Secretionprofiles of E. tarda ΔesaL, ΔesaB, ΔesaM, and ΔesaN mutant strains and the ΔesaL/pJN-esaL-2HA,ΔesaB/pJN-esaB-2HA, and ΔesaM/pACYC-esaM complementation strains. Samples of ECP from similaramounts of bacteria grown in DMEM were separated using SDS-PAGE and stained with Coomassie blue.The T3SS translocon proteins are EseC, EseB, and EseD, and the T6SS proteins are EvpI and EvpC. (B)Expression and secretion of translocon proteins from the E. tarda WT, ΔesaL, ΔesaB, and ΔesaM mutantstrains as revealed by immunoblotting. The arrowhead indicates the nonspecific band detected in thebacterial lysate. (C) Quantitative analysis of the secretion of translocon proteins EseB, EseC, and EseD. Theextracellular protein levels of EseB, EseC, and EseD were normalized against the level of EvpC, andthe value is presented as relative intensity. The graphs show the relative ratios (plus SEM) of secretedEseB, EseC, and EseD, which are averages of the results of three independent experiments. *, P � 0.05;**, P � 0.01; ***, P � 0.001.

Regulation of Type III Secretion in E. tarda Infection and Immunity

September 2017 Volume 85 Issue 9 e00322-17 iai.asm.org 5

on February 22, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

failed to grow in the selective medium. Our result indicates that EsaB, but not EsaM,interacts with EsaL and that EsaL interacts with itself in the yeast two-hybrid system.

EsaL interacts with EsaB and EsaM as revealed by co-IP. We next determined ifEsaL could interact with both EsaB and EsaM within bacterial cells. Accordingly, acoimmunoprecipitation (co-IP) assay was performed using bacterial lysates preparedfrom the WT, ΔesaB, and ΔesaM strains. As shown in Fig. 3B, both EsaB and EsaM werecoimmunoprecipitated from the WT strain with an anti-EsaL antibody. In the absenceof EsaB, EsaM was still coimmunoprecipitated with EsaL. Deletion of esaM did notimpair an EsaB-EsaL interaction although there was much less EsaB in the lysate of theΔesaM strains. These results suggest that EsaB and EsaM can independently interactwith EsaL within bacterial cells. However, EsaB and EsaM also appear to affect theirexpression or stability reciprocally, suggesting that EsaB and EsaM might interact witheach other. Consistent with this hypothesis, EsaB was coprecipitated with EsaM from

FIG 3 EsaL, EsaB, and EsaM form a protein complex. (A) Yeast two-hybrid assay to determine interactionsbetween EsaL and EsaL, EsaB, or EsaM in E. tarda PPD130/91. Yeast two-hybrid results using high-stringency SD medium lacking Trp, Leu, His, and Ade (upper) and medium-stringency SD medium lackingTrp and Leu (lower) are shown. The positive control comprised a fusion construct of the SV40 largeT-antigen and the GAL4 activation domain in the prey vector (pGADT7-T) and a murine p53 protein andthe GAL4 DNA-binding domain in the bait vector (pGBKT7-53). The negative control comprised a fusionconstruct of the SV40 large T-antigen and the GAL4 activation domain (pGADT7-T) and a fusion of thehuman lamin C protein and the GAL4 DNA-binding domain (pGBKT7-Lam). Yeast strains transformedwith pGBKT7-esaL plus pGADT7-esaL or with pGBKT7-esaL plus pGADT7-esaB were able to grow in theselective medium as blue colonies, similar to the positive control where the yeast was transformed withpGBKT7-53 plus pGADT7-T. The negative control and other yeast strains transformed with differentplasmids failed to grow in the selective medium. (B) Interaction between EsaL, EsaM, and EsaB. Whole-celllysates from the E. tarda wild-type, ΔesaB, or ΔesaM strain were coimmunoprecipitated with antibodyagainst EsaL. The presence of EsaB, EsaL, and EsaM was detected in input samples (input) and afterimmunoprecipitation (IP; output) by immunoblotting. The arrowhead indicates the nonspecific banddetected in the ΔesaM strain cell lysate. (C) The interaction between EsaM and EsaB is independent ofEsaL. Whole-cell lysates from the E. tarda WT, ΔesaL, or ΔesaM strain were immunoprecipitated with anEsaM antibody. The presence of the EsaB and EsaM was detected in cell lysates (input) and afterimmunoprecipitation (output) by immunoblotting.

Liu et al. Infection and Immunity

September 2017 Volume 85 Issue 9 e00322-17 iai.asm.org 6

on February 22, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

the WT and ΔesaL strain (Fig. 3C), demonstrating that EsaB is able to interact with EsaMeven in the absence of EsaL. Thus, we show that EsaL is able to interact with both EsaBand EsaM within bacterial cells and that EsaB can bind to EsaM independent of EsaL.

EsaB and EsaM are not secreted and can stabilize each other. We hypothesizedthat EsaB and EsaM could not be secreted into culture supernatants (i.e., similar to EsaL).The TBP and ECP fractions of the WT, ΔesaL, ΔesaB, and ΔesaM strains were thussubjected to immunoblotting analysis with antibodies against EsaB and EsaM. Asexpected, EsaB and EsaM, similar to EsaL, were not detected in the ECP fractions of anyof the strains (Fig. 4A), suggesting that none of these proteins are secreted into culturesupernatants. Interestingly, we also found that the steady-state protein levels of EsaBand EsaM were reduced in the absence of either protein (Fig. 4A), suggesting that EsaBand EsaM may stabilize each other. To test this possibility, the WT, ΔesaB, and ΔesaMstrains were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented withchloramphenicol (Cm) to inhibit further protein synthesis. The protein levels of EsaB, EsaM,

FIG 4 EsaB and EsaM are not secreted, and they stabilize each other. (A) EsaB and EsaM are not secreted.TBP and ECP from similar amounts of the WT, ΔesaL, ΔesaB, and ΔesaM strains were probed with the EsaB,EsaM, and EvpC antibodies. EvpC, a type VI secreted protein, was used as a loading control. (B) EsaM isrequired for maintaining EsaB stability. The E. tarda WT strain, ΔesaM strain, and ΔesaB strain werecultured in the presence of 200 �g/ml Cm for different times, as indicated, and the bacterial pelletssampled were subjected to immunoblotting with EsaB, EsaM, and OmpA antibodies. OmpA, an outermembrane protein of E. tarda, was used to as a loading control. The immunoblotting data shown arerepresentative images of three independent experiments. (C) Quantitative analysis of the protein levelsof EsaM and EsaB in panel B. The protein levels of EsaB and EsaM were normalized against the level ofEvpC, and the values are presented as relative intensity. The graphs show the relative ratios (plus SEM)of intracellular EsaB and EsaM, which are averages of the results of three independent experiments. **,P � 0.01; ***, P � 0.001.

Regulation of Type III Secretion in E. tarda Infection and Immunity

September 2017 Volume 85 Issue 9 e00322-17 iai.asm.org 7

on February 22, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

and OmpA were examined at 30-min intervals until 180 min post-chloramphenicol treat-ment. OmpA, an outer membrane protein of E. tarda, was used as a loading control. Asshown in Fig. 4B and C, the intracellular EsaB protein level decreased drastically in theΔesaM strain, compared to the WT level, starting as early as 30 min post-chloramphenicoltreatment, while the intracellular EsaM protein level decreased only at 180 min posttreat-ment in the ΔesaB strain. These data suggest that the interaction between EsaB and EsaMis important for maintaining EsaB stability within bacterial cells.

EsaL, EsaB, and EsaM are required to keep the activity of T3SS at acidic pH.Salmonella SpiC, SsaL, and SsaM are homologues of EsaB, EsaL, and EsaM, respectively,and they form a heterotrimeric complex at acidic pH, promoting the secretion oftranslocon proteins but suppressing the secretion of effectors from the Salmonella-containing vacuole (18). However, this complex dissociates at neutral pH, triggering thesecretion of effectors but not translocon proteins. Similar to Salmonella, Edwardsiellaictaluri, a fish pathogen that shares a common virulence strategy with E. tarda (35–37),resides in E. ictaluri-containing vacuoles (EiCVs) that undergo an initial acidification andsubsequent neutralization, ultimately leading to the translocation of effectors into thehost cytosol (37–39). We hypothesized that a pH shift might also trigger the secretionof effectors by the E. tarda T3SS. To investigate this, E. tarda strains (the WT and ΔesaLstrains) were grown in tryptic soy broth (TSB) overnight and subcultured in DMEM at pH5.5 for 4 h. This step was followed by culturing bacteria in DMEM at pH 5.5, 6.0, 6.5, and7.2 for an additional 90 min. The TBP and ECP fractions prepared from the WT and ΔesaLstrains were probed with antibodies against EseC, EseG, and EvpC. As shown in Fig. 5A,there were no detectable EseC proteins in the ECP fraction of the ΔesaL strain under allpH conditions, whereas a large amount of EseC was observed in the TBP fraction of theΔesaL strain compared to the WT level. The secretion of EseG seems to be very differentfrom that of EseC by the ΔesaL strain. A higher proportion of EseG was secreted into thesupernatants by the ΔesaL strain than by the WT strain at higher pH (7.2) but not atacidic pH 5.5. Moreover, this change is most striking when culturing conditions wereshifted from pH 5.5 to pH 7.2. In contrast to secretion of EseC and EseG, the secretionof EvpC (a type VI secreted protein) was not affected by the absence of EsaL at all pHconditions. These results suggest that EsaL promotes secretion of EseC and EseG at pH5.5 but suppresses the secretion of EseG upon shifting pH from acidic to neutral.

We then explored if EsaB and EsaM would regulate the secretion of EseC and EseGin a similar way. The TBP and ECP fractions of E. tarda strains (WT, ΔesaB, and ΔesaMstrains) were prepared as described above except for the pH conditions tested (i.e., onlypH 5.5 and pH 7.2 were used). Similar to the ΔesaL strain, neither the ΔesaB strain northe ΔesaM strain secreted EseC and EseG in their ECP fractions at pH 5.5 (Fig. 5B).However, the secretion of EseG by the ΔesaB and ΔesaM strains was drasticallydecreased compared to WT levels at pH 7.2. Thus, although EsaB, EsaL, and EsaM are allrequired for the secretion of EseC and EseG at pH 5.5, they differentially regulate theexpression and secretion of EseG upon a pH shift from acidic to neutral conditions.

Next, we examined whether EsaL, EsaB, and EsaM would affect the translocation ofthe T3SS effector EseG. This was addressed using a CyaA-based assay as previouslydescribed (40). We transformed the pACYC-eseG::cyaA plasmid into the ΔesaL, ΔesaB,ΔesaM, ΔesaN, and wild-type strains, and the resulting bacterial strains were used toinfect J774A.1 cells. The ΔesaN strain does not secrete/translocate effectors into thehost cytosol (9, 13) and was used as a negative control in this assay. At 5 h postinfec-tion, the intracellular cyclic AMP (cAMP) level was measured as a readout of translo-cation of EseG::CyaA. As shown in Fig. 5C, the cAMP level in cells infected with the WT,ΔesaL, ΔesaB, ΔesaM, or ΔesaN strain was 71.10 � 7.62, 74.63 � 11.95, 27.00 � 3.42,8.12 � 1.64, or 4.41 � 0.90 fmol per �g of protein, respectively (Fig. 5C). These datademonstrate that the translocation of EseG is positively regulated by EsaM and EsaB butnot by EsaL. Moreover, the translocation efficiency of EseG correlates well with thesecretion efficiency of EseG by these mutants.

The �esaL, �esaB, and �esaM strains are all attenuated in a blue gourami fishinfection model. To determine if EsaB, EsaL, and EsaM contribute to E. tarda patho-

Liu et al. Infection and Immunity

September 2017 Volume 85 Issue 9 e00322-17 iai.asm.org 8

on February 22, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

genesis in vivo, we performed a competitive index (CI) assay using a blue gourami fishinfection model. One of the three mutant strains (ΔesaL, ΔesaB, or ΔesaM strain) wasmixed with equal amounts of wild-type E. tarda and injected into blue gourami fish viathe intramuscular route. At 48 h postinfection (hpi), the CIs from spleens infected withthe ΔesaL, ΔesaB, or ΔesaM strain were 0.17 � 0.05, 0.12 � 0.03, and 0.05 � 0.03,respectively (Fig. 6C), indicating that each of the mutant strains is out-competed by thewild-type strain. Thus, EsaB, EsaL, and EsaM are all important for E. tarda pathogenesis.

DISCUSSION

In this study, we show that EsaB, EsaL, and EsaM encoded within the E. tarda T3SSinteract with each other and regulate the secretion of T3SS translocon and effectorproteins. We also provide in vivo evidence that EsaB, EsaL, and EsaM contribute to E.tarda pathogenesis.

EsaB, EsaL, and EsaM are not secreted into culture supernatants and form a ternary

FIG 5 Regulation of type III secretion of translocon and effector proteins by EsaL, EsaB, and EsaM underdifferent pH conditions. (A) EsaL promotes the secretion of EseC but differentially regulates the secretionof EseG under different pH conditions. The E. tarda WT and ΔesaL strains cultured overnight in TSB weresubcultured into DMEM, pH 5.5, to an OD540 of 0.3 for 4 h before exposure to pH 5.5, pH 6.0, pH 6.5, andpH 7.2 medium for 90 min. Secreted and bacterium-associated (lysate) translocon EseC and effector EseGwere examined by immunoblotting. EvpC was used as a loading control. (B) EsaB and EsaM are requiredfor secretion of EseC and EseG. Bacteria were cultured as described for panel A. Secreted and bacterium-associated (lysate) EseC and EseG were examined by immunoblotting. EvpC was used as a loadingcontrol. (C) Translocation of EseG depends on EsaB and EsaM but not on EsaL. J774A.1 cells were infectedwith the indicated E. tarda strains carrying the plasmid pACYC-eseG::cyaA, and intracellular cAMP levelswere determined at 5 h postinfection, as described in Materials and Methods. Means � SD from onerepresentative experiment are shown. **, P � 0.01; ***, P � 0.001; NS, not significant.

Regulation of Type III Secretion in E. tarda Infection and Immunity

September 2017 Volume 85 Issue 9 e00322-17 iai.asm.org 9

on February 22, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

complex, similar to their Salmonella homologues (SpiC, SsaL, and SsaM) (18). Both theE. tarda EsaB/EsaL/EsaM complex and Salmonella SpiC/SsaL/SsaM complex promote thesecretion of translocon proteins. Interestingly, EsaB/EsaL/EsaM and their Salmonellahomologues also show some functional differences. For instance, comparable levels ofT3S effectors were secreted from spiC, ssaL, or ssaM mutant strains under both acidicand neutral culture conditions (18), suggesting that SpiC, SsaL, and SsaM functionsimilarly. In contrast, E. tarda EsaB, EsaL, and EsaM do not seem to function in parallelunder neutral culturing conditions, where EsaL suppresses EseG secretion whereas EsaBand EsaM promote the expression/secretion of EseG. Moreover, EsaB, EsaL, and EsaMcan also form a complex at pH 5.5 controlling the secretion of EseC and EseG (data notshown), indicating that they are required for the proper function of the E. tarda T3SSat acidic pH. This might be critical for the intracellular life of E. tarda. It has been shownthat upon entry into the host cell, E. tarda resides in a lysosome-like compartmentcalled the E. tarda-containing vacuole (EtCV) (4). Although the pH of the EtCV remainsunclear, we believe it undergoes dynamic changes during the maturation of EtCV.Closely related to E. tarda, Edwardsiella ictaluri is another fish pathogen that multiplieswithin the Edwardsiella ictaluri-containing vacuole (EiCV). The EiCV demonstrates aninitial acidification and subsequent neutralization, which leads to the translocation ofeffectors into the host cytosol (37–39). Although it remains to be determined if EtCVsand EiCVs display similar pH dynamics during their maturation, we believe that theEsaB/EsaL/EsaM complex ensured proper function of the T3SS at acidic pH and is idealfor E. tarda to adapt to its intracellular life.

Our study demonstrates that the interaction between EsaB and EsaM is importantfor their stability within bacterial cells. Moreover, while the presence of EsaL is notcritical for the interaction between EsaB and EsaM, mutants lacking EsaB or EsaMproduced reduced amounts of EsaM or EsaB coprecipitated with EsaL, respectively.Analogous to these results, Yersinia YscB (homologous to EsaB) and SycN (homologousto EsaM) interact with each other, and the absence of either one of them will affect thestability of the other (34). The deletion of either sycN or yscB also diminishes theinteraction of YscB or SycN with YopN (EsaL homologue) (34). It is tempting to proposethat EsaB and EsaM function as a chaperone complex for EsaL, as is the case for theYscB/SycN/YopN complex (34). In this regard, SpiC and SsaM, the Salmonella homo-logues of EsaB and EsaM, behave differently as they negatively regulate the secretionof T3SS effectors at pH 5.0 (18, 33), and they do not stabilize each other (Xiu-Jun Yu,personal communication).

Mutant strains lacking EsaB, EsaL, or EsaM were all attenuated in fish. It is likely thatthese mutants are unable to assemble a functional translocon that is essential for thepathogenesis of E. tarda. Future work is required to understand how exactly theEsaB/EsaL/EsaM complex works during infection in vivo.

Collectively, we demonstrate that the E. tarda EsaB/EsaL/EsaM complex regulates

FIG 6 EsaB, EsaL, and EsaM contribute to E. tarda pathogenicity toward fish. Results of a competitiveindex (CI) assay in blue gourami fish are shown. Blue gourami fish were injected intramuscularly withmixtures of equal numbers of the E. tarda wild-type strain and the ΔesaL, ΔesaB, or ΔesaM mutant strainand sacrificed at 48 hpi. CIs from spleens for each fish are presented as means � SD. An SPSS t test wasused to calculate the P value with the hypothetical mean of 1.0. ***, P � 0.001.

Liu et al. Infection and Immunity

September 2017 Volume 85 Issue 9 e00322-17 iai.asm.org 10

on February 22, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

the type III secretion of translocon and effector proteins and plays an important role inE. tarda pathogenesis. Our study also suggests that therapeutic inhibitors targeting theEsaB/EsaL/EsaM complex and their homologues could be used to combat infectionscaused by E. tarda and other T3SS-containing pathogens.

MATERIALS AND METHODSBacterial strains and culture conditions. The bacterial strains and plasmids used in this study are

described in Table 2. For general culture, E. tarda PPD130/91 (41) and its derived strains were grown at25°C in tryptic soy broth (TSB; BD Biosciences), and Escherichia coli strains were grown at 37°C inLuria-Bertani (LB) broth (BD Biosciences). To induce the T3SS activity, E. tarda strains were grown at 25°Cin Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) under a 5% (vol/vol) CO2 atmosphere.Antibiotics were supplemented at the following concentrations when necessary: 100 �g/ml ampicillin(Amp; Sigma), 12.5 �g/ml colistin (Col; Sigma), 34 �g/ml chloramphenicol (Cm; Amresco), 15 �g/mltetracycline (Tet; Amresco), and 50 �g/ml gentamicin (Gem; Amresco).

Construction of deletion mutants and complementation plasmids. The esaB gene was deletedfrom the chromosome of E. tarda PPD130/91 by sacB-based allelic exchange as described previously (15).In brief, upstream and downstream flanking fragments of esaB were obtained with the primer pairsesaB-for plus esaB-int-rev and esaB-int-for plus esaB-rev with E. tarda PPD130/91 genomic DNA as thetemplate (Table 3), and they were fused together by overlapping PCR with primers esaB-for and esaB-rev.

TABLE 2 Strains and plasmids used in this study

Strain or plasmid Description and/or genotypea

Reference orsource

StrainsE. tarda strains

PPD130/91 Wild type, Kms Colr Amps 41ΔesaL strain PPD130/91, esaL in-frame deletion of aa 40 to 366 Lab stockΔesaB strain PPD130/91, esaB in-frame deletion of aa 1 to 149 This studyΔesaM strain PPD130/91, esaM in-frame deletion of aa 1 to 113 This studyΔesaL/pJN-esaL-2HA strain ΔesaL with pJN-esaL-2HA This studyΔesaB/pJN-esaB-2HA strain ΔesaB with pJN-esaB-2HA This studyΔesaM/pACYC-esaM strain ΔesaM with pACYC-esaM This studyWT/pACYC-eseG::cyaA PPD130/91 transformed with pACYC-eseG::cyaA 9ΔesaN/pACYC-eseG::cyaA strain ΔesaN mutant transformed with pACYC-eseG::cyaA 9ΔesaL/pACYC-eseG::cyaA strain ΔesaL mutant transformed with pACYC-eseG::cyaA This studyΔesaB/pACYC-eseG::cyaA strain ΔesaB mutant transformed with pACYC-eseG::cyaA This studyΔesaM/pACYC-eseG::cyaA strain ΔesaM mutant transformed with pACYC-eseG::cyaA This study

E. coli DH5� Alpha complementation StratageneE. coli S17-1 �pir RK2 tra regulon, �pir 43S. cerevisiae AH109 MATa, trp1-901, leu2-3,112, ura3-52, his3-200 gal4 Δgal80 ΔLYS2::GAL1UAS-GAL1TATA-HIS3,

GAL2UAS-GAL2TATA-ADE2 URA3::MEL1UAS-MEL1TATA-lacZClontech

PlasmidspMD18-T Cloning vector, Ampr TaKaRapRE112 Suicide plasmid, pir dependent, Cmr, oriT, oriV, sacB 42pRE-ΔesaL pRE112 with esaL flanking fragments This studypRE-ΔesaB pRE112 with esaB flanking fragments This studypRE-ΔesaM pRE112 with esaM flanking fragments This studypJN-105 Arabinose-inducible gene expression vector, araC-PBAD; Gmr 44pACYC-184 Tetr Cmr AmershampACYC-eseG::cyaA pACYC184 with eseG-cyaA, Cmr 9pJN-esaL-2HA pJN-105 with esaL-2HA This studypJN-esaB-2HA pJN-105 with esaB-2HA This studypACYC-esaM pACYC-184 with esaM This studypGBKT7 GAL4(1–147) DNA-BD, TRP1, Kmr, c-Myc epitope tag ClontechpGBKT7-53 Encodes a fusion of the murine p53 protein (aa 72 to 390) and the GAL4 DNA-BD

(aa 1 to 147)Clontech

pGBKT7-Lam Encodes a fusion of the human lamin C protein (aa 66 to 230) and the GAL4 DNA-BD(aa 1 to 147)

Clontech

pGBKT7-esaL Encodes a fusion of EsaL and the GAL4 DNA-BD (aa 1 to 147) This studypGADT7 GAL4768–881 AD, LEU2, Ampr, HA epitope tag ClontechpGADT7-T Encodes a fusion of the SV40 large T-antigen (aa 86 to 708) and the GAL4 AD

(aa 768 to 881)Clontech

pGADT7-esaL Encodes a fusion of EsaL and the GAL4 AD (aa 768 to 881) This studypGADT7-esaB Encodes a fusion of EsaB and the GAL4 AD (aa 768 to 881) This studypGADT7-esaM Encodes a fusion of EsaM and the GAL4 AD (aa 768 to 881) This study

aCol, colistin; Amp, ampicillin; Tet, tetracycline; Cm, chloramphenicol; Gm, gentamicin; r, resistance; s, sensitivity; BD, binding domain; AD, activation domain.

Regulation of Type III Secretion in E. tarda Infection and Immunity

September 2017 Volume 85 Issue 9 e00322-17 iai.asm.org 11

on February 22, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

The resulting PCR product was cloned into the suicide vector pRE112 (42) before being transformed intoE. coli S17-1 �pir (43). The single-crossover mutants were obtained by conjugal transfer of the plasmidinto E. tarda PPD130/91, and double-crossover mutants were screened on tryptic soy agar (TSA) platescontaining 15% sucrose and 12.5 �g/ml colistin. The resulting mutants were further verified by sequenc-ing PCR and immunoblotting. In a similar way, esaL and esaM deletion mutants were constructed.

The esaB gene and its ribosome binding site sequences were amplified with primers esaB-com-forand esaB-com-rev (Table 3) and were then ligated into EcoRI and XbaI restriction sites of pJN-105 (44) toobtain the complementation plasmid pJN-esaB-2HA. The sequence of pJN-esaB-2HA was verified by DNAsequencing before being transferred into the ΔesaB strain, resulting in the esaB complementation strain,i.e., the ΔesaB/pJN-esaB-2HA strain. The ΔesaL and ΔesaM complementation strains (i.e., the ΔesaL/pJN-esaL-2HA and ΔesaM/pACYC-esaM strains, respectively) were constructed similarly. pACYC refers to theplasmid pACYC184 (Amersham). All complementation strains were confirmed by immunoblotting withanti-HA or anti-EsaM antibodies.

Expression and secretion assays using immunoblotting. For T3SS protein expression and secre-tion assays, overnight cultures of the E. tarda strains were diluted 1:200 in DMEM and grown withoutshaking for 24 h at 25°C under 5% CO2. For pH shift experiments, bacteria cultured overnight in TSB wereresuspended into prewarmed DMEM (at an optical density at 540 nm [OD540] of 0.3) at pH 5.5 for 4 hbefore being shifted to pH 5.5 or pH 7.2 medium for an additional 90 min. Secreted proteins (extracellularproteins [ECP]) and bacterial lysate proteins (total bacterial proteins [TBP]) were then prepared andloaded for immunoblotting according to equivalent OD540 values of the cultures, as described previously(30). ECP and TBP samples were separated on a NuPAGE 12% or 10% gel for electrophoresis in MES ormorpholinepropanesulfonic acid (MOPS) SDS running buffer (Invitrogen) and transferred onto polyvi-nylidene difluoride (PVDF) membrane (Millipore) before being probed with primary antibodies, includingrabbit antibodies against EseB (1:1,000) (45), EseC (1:1,000) (40), EseD (1:1,000) (40), EseG (1:1,000) (13),EvpC (1:5,000) (30), EsaL (1:1,000), EsaB (1:2,000), and EsaM (1:2,000). The anti-EsaL, anti-EsaB, andanti-EsaM antibodies were raised in rabbits against keyhole limpet hemocyanin-conjugated peptides ofEsaL (EsaL aa 41 to 54; PTDRQTIVPHAAPG), EsaB (EsaB aa 146 to 159; RDTHPESPFIGRYA), and EsaM (EsaMaa 113 to 126; LLDRVMENPHENGQ), respectively, by Genscript, China, and purified using the specificpeptides as the ligand. Horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (Millipore) wasused as the secondary antibody. Antigen-antibody complexes were detected with Super Signal West Picochemiluminescent substrate (Thermo) and imaged with a ChemiDoc MP imaging system (Bio-Rad).Immunoblotting experiments were repeated at least three times on independently collected samples,and densitometric calculations of immunoblotting bands were conducted using Image Lab, version 4.1,software.

TABLE 3 Primers used in this study

Primer name Nucleotide sequence

esaL-com-for GAATTCCGGAGAATCAATCAGCTCGTCesaL-com-rev TCTAGATTACTAGAGGCTAGCATAATCAGGAACATCATACGGATAG

GAGACGATACTATCGCTAAGGTesaB-for CGGGGTACCCGCCAGCGACGAAAGGGCCCGesaB-int-rev GAACGGGCTTTCGGGACCGGCCGCAGGGGCGCCGCCGGTATGGGAesaB-int-for CCCGAAAGCCCGTTCATTGGGesaB-rev CGGGGTACCCCAGCGTGGCCTGCTCCATCTesaB-com-for GAATTCGAGATAGCCCAGAGCesaB-com-rev TCTAGATTACTAGAGGCTAGCATAATCAGGAACATCATACGGATAT

GCATACCTCCCAATesaM-for CGGGGTACCACAGCGCAATGTTCGGGGGGAesaM-int-rev CATCACGCGATCGAGGAATATCCTCCGCGATCGTGATGCesaM-int-for CTCGATCGCGTGATGGAGAATesaM-rev CGGGGTACCGGTAATGATGGCGAACACGATesaM-com-for GAATTCCGGTTGTTCTGTCAGesaM-com-rev AGTACTCTATTGACCGTTTTCATGpGBKT7-esaL-for CATATGATGACGGGCTGCTGCGCATTCpGBKT7-esaL-rev GAATTCTCAGGAGACGATACTATCGCTAAGpGADT7-esaL-for ACATATGATGACGGGCTGCTGCGCATpGADT7-esaL-rev ACTCGAGTCAGGAGACGATACTATCGCpGADT7-esaB-for ACATATGATGCCCGCGCGCCGCTCGCACpGADT7-esaB-rev ACTCGAGTCATGCATACCTCCCAATGAACGpGADT7-esaM-for ACATATGATGGACCTACAGTGGCAACGpGADT7-esaM-rev ACTCGAGCTATTGACCGTTTTCATGGGCI-esaL-for ACCAGCTAGCGCAGCGCTCI-esaL-rev GGTTCACAAGGATAGTCTCI-esaB-for ATGAGATCAACGCCGGCACI-esaB-rev GGGCAACAGTTGGTACAGCI-esaM-for ATTACGATCAGCAGCGGTCI-esaM-rev ATGGTCAGCGCCAGACGA

Liu et al. Infection and Immunity

September 2017 Volume 85 Issue 9 e00322-17 iai.asm.org 12

on February 22, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

Yeast two-hybrid assay. A yeast two-hybrid assay was carried out using a GAL4 DNA-bindingdomain encoding bait vector (pGBKT7) and a GAL4 activation domain encoding prey vector (pGADT7) inthe S. cerevisiae strain AH109. All fusion constructs were made as full-length fusions. The bait and preyplasmids were cotransformed into the yeast strain AH109 according to the manufacturer’s protocol(Clontech), and the yeast transformants were selected on synthetic dropout (SD) agar plates lackingleucine and tryptophan (SD Leu� Trp�) for 3 days at 30°C. Positive interactions were indicated as growthon high-stringency medium lacking adenine, histidine, leucine, and tryptophan (SD Ade� His� Leu�

Trp�) and by the formation of blue colonies induced by X-�-Gal (Sigma) supplemented in the medium.The interaction between a human lamin C bait fusion (pGBKT7-Lam) and simian virus 40 (SV40) preyfusion (pGADT7-T) (Clontech) was used as a negative control, and interaction between a murine p53 baitfusion (pGBKT7-53) and pGADT7-T served as a positive control. All experiments shown here wererepeated at least three times, in at least three different clones, with identical results.

Co-IP assay. The interaction among EsaL, EsaB, and EsaM was assayed by coimmunoprecipitation(Co-IP) according to Yu et al. (18). Briefly, E. tarda cells collected from 40 ml of DMEM culture weresonicated in ice-cold phosphate-buffered saline (PBS) containing 1.5 mM phenylmethanesulfonyl fluoride(PMSF), and unbroken cells and debris were removed by centrifugation at 16,000 � g for 10 min. Thewhole-cell lysate (supernatant) was mixed with Triton X-100 (at a final concentration of 0.2%). Beforeincubation with antibodies, the whole-cell lysate was precleared with protein G-immobilized beads(Thermo) for 1 h at 4°C. The antibody was incubated overnight with precleaned lysate beforeincubation with protein G-immobilized beads for 1.5 h. The beads were washed four times withPBS–PMSF– 0.2% Triton X-100 before being resuspended in sample buffer and analyzed by immu-noblotting.

Protein stability assay. Overnight cultures grown at 25°C (E. tarda wild-type, ΔesaB, and ΔesaMstrains) were subcultured in DMEM at 1:200 and maintained at 25°C with 5% (vol/vol) CO2 until an OD540

value of � 0.5 was reached. Chloramphenicol was supplemented at a final concentration of 200 �g/mlto inhibit protein synthesis. Bacterial cultures (1.0 ml) were sampled at 30-min intervals until 180 minposttreatment. The pellet of each E. tarda strain was resuspended in 15 �l of PBS buffer and boiledin an equal volume of 5� SDS-PAGE loading buffer. These samples were subjected to immunoblot-ting with EsaB, EsaM, EsaL, or OmpA antibody. OmpA, an outer membrane protein, was used as aloading control. The OmpA antibody was raised in rabbits against keyhole limpet hemocyanin-conjugated peptides of OmpA (aa 129 to 142; GAADGGDYTSSHDT), which was produced byGenscript, China, and purified using the specific peptide as the ligand. The protein stabilityexperiment was repeated at least three times, and Image Lab, version 4.1, software was used fordensitometric analysis of immunoblotting bands.

CyaA-based translocation assay. A CyaA translocation assay was performed as previously described(40). Briefly, J774A.1 cells were infected at a multiplicity of infection (MOI) of 5 with E. tarda strainsexpressing the EseG::CyaA fusion protein. At 5 h postinfection, cells were lysed with sample diluents(supplied with the cAMP immunoassay kit) supplemented with 0.2% Triton X-100. The cAMP levels wereevaluated using a cAMP enzyme immunoassay (EIA) system (Arbor Assays).

Competitive index assay in vivo. A competitive index assay was used to determine the fitness ofthree mutants (the ΔesaL, ΔesaB, or ΔesaM strain) in vivo. To perform this experiment, equal amounts ofE. tarda wild-type and the ΔesaL, ΔesaB, or ΔesaM mutant strain were mixed to infect blue gourami fish(10.84 � 1.30 g) intramuscularly at 6 � 105 CFU per fish. The fish infection was performed strictlyaccording to the recommendations in the Guide for the Care and Use of Laboratory Animals of theChinese Academy of Sciences. The protocol was approved by the Committee on the Ethics of AnimalExperiments of the Institute of Hydrobiology (permit number Y61310-1-301).

At 48 hpi, spleen from each fish was collected and homogenized before being plated. Wild-type E.tarda was distinguished from the ΔesaL, ΔesaB, or ΔesaM mutant strain by PCR with the primer pairCI-esaL-for and CI-esaL-rev, the pair CI-esaB-for and CI-esaB-rev, or the pair CI-esaM-for and CI-esaM-rev,respectively. Ninety-four colonies per spleen were examined for the ratio of mutant strain to wild-typestrain colonies. The competitive index (CI) was calculated by dividing the ratio of mutant/WT strains inthe output by the ratio of mutant/WT strains in the input (initial inoculum). A CI of 1.0 indicates thatdeletion of a target gene has no impact on the bacteria fitness in vivo, whereas a CI of less than 1.0indicates an attenuation of the mutant.

Statistical analysis. The data on the effector translocation assay or the competitive index assay ofthe ΔesaL, ΔesaB, and ΔesaM strains are representative of at least three independent experiments and areexpressed as means � standard deviations (SD); Western blotting bands quantified are the average ofthree independent experiments, and results are expressed as means � standard error of means (SEM).All data were analyzed using a t test in the Statistical Package for the Social Sciences (SPSS), with P valuesof less than 0.05 considered significant.

ACKNOWLEDGMENTSWe are very grateful to Xiu-Jun Yu at the Imperial College London for his insightful

discussions. We also thank Zubair Ahmed Laghari, Tian Tian He, Ying Zhou, and YuanYuan Zhou for their technical assistance.

This work was funded by the National Natural Science Foundation of China (NSFC)under grant number 31572659 and by the Project of State Key Laboratory of FreshwaterEcology and Biotechnology under the grant number 2016FBZ04.

Regulation of Type III Secretion in E. tarda Infection and Immunity

September 2017 Volume 85 Issue 9 e00322-17 iai.asm.org 13

on February 22, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

REFERENCES1. Schlenker C, Surawicz CM. 2009. Emerging infections of the gastrointes-

tinal tract. Best Pract Res Clin Gastroenterol 23:89 –99. https://doi.org/10.1016/j.bpg.2008.11.014.

2. Leung KY, Siame BA, Tenkink BJ, Noort RJ, Mok YK. 2012. Edwardsiellatarda-virulence mechanisms of an emerging gastroenteritis pathogen.Microbes Infect 14:26 –34. https://doi.org/10.1016/j.micinf.2011.08.005.

3. Tan YP, Zheng J, Tung SL, Rosenshine I, Leung KY. 2005. Role of type IIIsecretion in Edwardsiella tarda virulence. Microbiology 151:2301–2313.https://doi.org/10.1099/mic.0.28005-0.

4. Okuda J, Arikawa Y, Takeuchi Y, Mahmoud MM, Suzaki E, Kataoka K,Suzuki T, Okinaka Y, Nakai T. 2006. Intracellular replication of Edward-siella tarda in murine macrophage is dependent on the type III secretionsystem and induces an up-regulation of anti-apoptotic NF-�B targetgenes protecting the macrophage from staurosporine-induced apopto-sis. Microb Pathog 41:226 –240. https://doi.org/10.1016/j.micpath.2006.08.002.

5. Tan YP, Lin Q, Wang XH, Joshi S, Hew CL, Leung KY. 2002. Comparativeproteomic analysis of extracellular proteins of Edwardsiella tarda. InfectImmun 70:6475– 6480. https://doi.org/10.1128/IAI.70.11.6475-6480.2002.

6. Pallen MJ, Gophna U. 2007. Bacterial flagella and type III secretion: casestudies in the evolution of complexity. Genome Dyn 3:30 – 47. https://doi.org/10.1159/000107602.

7. Mueller CA, Broz P, Cornelis GR. 2008. The type III secretion system tipcomplex and translocon. Mol Microbiol 68:1085–1095. https://doi.org/10.1111/j.1365-2958.2008.06237.x.

8. Sadarangani V, Datta S, Arunachala M. 2013. New players in the same oldgame: a system level in silico study to predict type III secretion systemand effector proteins in bacterial genomes reveals common themes inT3SS mediated pathogenesis. BMC Res Notes 6:297. https://doi.org/10.1186/1756-0500-6-297.

9. Xie HX, Lu JF, Zhou Y, Yi J, Yu XJ, Leung KY, Nie P. 2015. Identificationand functional characterization of the novel Edwardsiella tarda effectorEseJ. Infect Immun 83:1650 –1660. https://doi.org/10.1128/IAI.02566-14.

10. Zheng J, Li N, Tan YP, Sivaraman J, Mok YK, Mo ZL, Leung KY. 2007. EscCis a chaperone for the Edwardsiella tarda type III secretion systemputative translocon components EseB and EseD. Microbiology 153:1953–1962. https://doi.org/10.1099/mic.0.2006/004952-0.

11. Wang B, Mo ZL, Mao YX, Zou YX, Xiao P, Li J, Yang JY, Ye XH, Leung KY,Zhang PJ. 2009. Investigation of EscA as a chaperone for the Edwardsiellatarda type III secretion system putative translocon component EseC.Microbiology 155:1260 –1271. https://doi.org/10.1099/mic.0.021865-0.

12. Yi J, Xiao SB, Zeng ZX, Lu JF, Liu LY, Laghari ZA, Nie P, Yu HB, Xie HX.2016. EseE of Edwardsiella tarda augments secretion of translocon pro-tein EseC and expression of the escC-eseE operon. Infect Immun 84:2336 –2344. https://doi.org/10.1128/IAI.00106-16.

13. Xie HX, Yu HB, Zheng J, Nie P, Foster LJ, Mok YK, Finlay BB, Leung KY.2010. EseG, an effector of the type III secretion system of Edwardsiellatarda, triggers microtubule destabilization. Infect Immun 78:5011–5021.https://doi.org/10.1128/IAI.00152-10.

14. Hou M, Chen R, Yang D, Núñez G, Wang Z, Wang Q, Zhang Y, Liu Q. 2017.Identification and functional characterization of EseH, a new effector ofthe type III secretion system of Edwardsiella piscicida. Cell Microbiol19:e12638. https://doi.org/10.1111/cmi.12638.

15. Zheng J, Tung SL, Leung KY. 2005. Regulation of a type III and a putativesecretion system in Edwardsiella tarda by EsrC is under the control of atwo-component system, EsrA-EsrB. Infect Immun 73:4127– 4137. https://doi.org/10.1128/IAI.73.7.4127-4137.2005.

16. Stamm LM, Goldberg MB. 2011. Establishing the secretion hierarchy.Science 331:1147–1148. https://doi.org/10.1126/science.1203195.

17. Armentrout EI, Rietsch A. 2016. The type III secretion translocation poresenses host cell contact. PLoS Pathog 12:e1005530. https://doi.org/10.1371/journal.ppat.1005530.

18. Yu XJ, McGourty K, Liu M, Unsworth KE, Holden DW. 2010. pH sensing byintracellular Salmonella induces effector translocation. Science 328:1040 –1043. https://doi.org/10.1126/science.1189000.

19. Archuleta TL, Spiller BW. 2014. A gatekeeper chaperone complex directstranslocator secretion during type three secretion. PLoS Pathog 10:e1004498. https://doi.org/10.1371/journal.ppat.1004498.

20. Day JB, Ferracci F, Plano GV. 2003. Translocation of YopE and YopN intoeukaryotic cells by Yersinia pestis yopN, tyeA, sycN, yscB and lcrG deletionmutants measured using a phosphorylatable peptide tag and phospho-

specific antibodies. Mol Microbiol 47:807– 823. https://doi.org/10.1046/j.1365-2958.2003.03343.x.

21. Silva-Herzog E, Joseph SS, Avery AK, Coba JA, Wolf K, Fields KA, Plano GV.2011. Scc1 (CP0432) and Scc4 (CP0033) function as a type III secretionchaperone for CopN of Chlamydia pneumoniae. J Bacteriol 193:3490 –3496. https://doi.org/10.1128/JB.00203-11.

22. Botteaux A, Sory MP, Biskri L, Parsot C, Allaoui A. 2009. MxiC is secretedby and controls the substrate specificity of the Shigella flexneri type IIIsecretion apparatus. Mol Microbiol 71:449 – 460. https://doi.org/10.1111/j.1365-2958.2008.06537.x.

23. Kim JS, Jang JI, Eom JS, Oh CH, Kim HG, Kim BH, Bang IS, Bang SH, ParkYK. 2013. Molecular characterization of the InvE regulator in the secre-tion of type III secretion translocases in Salmonella enterica serovarTyphimurium. Microbiology 159:446 – 461. https://doi.org/10.1099/mic.0.061689-0.

24. O’Connell CB, Creasey EA, Knutton S, Elliott S, Crowther LJ, Luo W, AlbertMJ, Kaper JB, Frankel G, Donnenberg MS. 2004. SepL, a protein requiredfor enteropathogenic Escherichia coli type III translocation, interacts withsecretion component SepD. Mol Microbiol 52:1613–1625. https://doi.org/10.1111/j.1365-2958.2004.04101.x.

25. Younis R, Bingle LE, Rollauer S, Munera D, Busby SJ, Johnson S, Deane JE,Lea SM, Frankel G, Pallen MJ. 2010. SepL resembles an aberrant effectorin binding to a class 1 type III secretion chaperone and carrying anN-terminal secretion signal. J Bacteriol 192:6093– 6098. https://doi.org/10.1128/JB.00760-10.

26. Deng W, Yu HB, Li Y, Finlay BB. 2015. SepD/SepL-dependent secretionsignals of the type III secretion system translocator proteins in entero-pathogenic Escherichia coli. J Bacteriol 197:1263–1275. https://doi.org/10.1128/JB.02401-14.

27. Ferracci F, Schubot FD, Waugh DS, Plano GV. 2005. Selection andcharacterization of Yersinia pestis YopN mutants that constitutively blockYop secretion. Mol Microbiol 57:970 –987. https://doi.org/10.1111/j.1365-2958.2005.04738.x.

28. Burkinshaw BJ, Souza SA, Strynadka NC. 2015. Structural analysis of SepL,an enteropathogenic Escherichia coli type III secretion-system gate-keeper protein. Acta Crystallogr F Struct Biol Commun 71:1300 –1308.https://doi.org/10.1107/S2053230X15016064.

29. Cheng LW, Kay O, Schneewind O. 2001. Regulated secretion of YopN bythe type III machinery of Yersinia enterocolitica. J Bacteriol 183:5293–5301. https://doi.org/10.1128/JB.183.18.5293-5301.2001.

30. Zheng J, Leung KY. 2007. Dissection of a type VI secretion system inEdwardsiella tarda. Mol Microbiol 66:1192–1206. https://doi.org/10.1111/j.1365-2958.2007.05993.x.

31. Deng W, Li Y, Hardwidge PR, Frey EA, Pfuetzner RA, Lee S, Gruenheid S,Strynakda NC, Puente JL, Finlay BB. 2005. Regulation of type III secretionhierarchy of translocators and effectors in attaching and effacing bac-terial pathogens. Infect Immun 73:2135–2146. https://doi.org/10.1128/IAI.73.4.2135-2146.2005.

32. Wang D, Roe AJ, McAteer S, Shipston MJ, Gally DL. 2008. Hierarchal typeIII secretion of translocators and effectors from Escherichia coli O157:H7requires the carboxy terminus of SepL that binds to Tir. Mol Microbiol69:1499 –1512. https://doi.org/10.1111/j.1365-2958.2008.06377.x.

33. Yu XJ, Liu M, Holden DW. 2004. SsaM and SpiC interact and regulatesecretion of Salmonella pathogenicity island 2 type III secretion systemeffectors and translocators. Mol Microbiol 54:604 – 619. https://doi.org/10.1111/j.1365-2958.2004.04297.x.

34. Day JB, Plano GV. 1998. A complex composed of SycN and YscB func-tions as a specific chaperone for YopN in Yersinia pestis. Mol Microbiol30:777–788. https://doi.org/10.1046/j.1365-2958.1998.01110.x.

35. Thune RL, Fernandez DH, Benoit JL, Kelly-Smith M, Rogge ML, Booth NJ,Landry CA, Bologna RA. 2007. Signature-tagged mutagenesis of Edward-siella ictaluri identifies virulence-related genes, including a salmonellapathogenicity island 2 class of type III secretion systems. Appl EnvironMicrobiol 73:7934 –7946. https://doi.org/10.1128/AEM.01115-07.

36. Rogge ML, Thune RL. 2011. Regulation of the Edwardsiella ictaluri type IIIsecretion system by pH and phosphate concentration through EsrA,EsrB, and EsrC. Appl Environ Microbiol 77:4293– 4302. https://doi.org/10.1128/AEM.00195-11.

37. Dubytska LP, Rogge ML, Thune RL. 2016. Identification and character-ization of putative translocated effector proteins of the Edwardsiella

Liu et al. Infection and Immunity

September 2017 Volume 85 Issue 9 e00322-17 iai.asm.org 14

on February 22, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

ictaluri type III secretion system. mSphere 1:e00039-16. https://doi.org/10.1128/mSphere.00039-16.

38. Booth NJ, Beekman JB, Thune RL. 2009. Edwardsiella ictaluri encodes anacid-activated urease that is required for intracellular replication inchannel catfish (Ictalurus punctatus) macrophages. Appl Environ Micro-biol 75:6712– 6720. https://doi.org/10.1128/AEM.01670-09.

39. Baumgartner WA, Dubytska L, Rogge ML, Mottram PJ, Thune RL. 2014.Modulation of vacuolar pH is required for replication of Edwardsiellaictaluri in channel catfish macrophages. Infect Immun 82:2329 –2336.https://doi.org/10.1128/IAI.01616-13.

40. Lu JF, Wang WN, Wang GL, Zhang H, Zhou Y, Gao ZP, Nie P, Xie HX. 2015.Edwardsiella tarda (Orf13 protein) is a type III secretion system-secretedprotein that is required for the injection of effectors, secretion of trans-locators, and pathogenesis in fish. Infect Immun 84:2–10. https://doi.org/10.1128/IAI.00986-15.

41. Ling SHM, Wang XH, Xie L, Lim TM, Leung KY. 2000. Use of greenfluorescent protein (GFP) to track the invasive pathways of Edwardsiella

tarda in the in vivo and in vitro fish models. Microbiology 146:7–19.https://doi.org/10.1099/00221287-146-1-7.

42. Edwards RA, Keller LH, Schifferli DM. 1998. Improved allelic exchangevectors and their use to analyze 987P fimbria gene expression. Gene207:149 –157. https://doi.org/10.1016/S0378-1119(97)00619-7.

43. Simon R, Priefer U, PühlerA. 1983. A broad host range mobilizationsystem for in vivo genetic engineering: transposon mutagenesis in gramnegative bacteria. Nat Biotechnol 1:784 –791. https://doi.org/10.1038/nbt1183-784.

44. Khlebnikov A, Skaug T, Keasling JD. 2002. Modulation of gene expressionfrom the arabinose-inducible araBAD promoter. J Ind Microbiol Biotech-nol 29:34 –37. https://doi.org/10.1038/sj.jim.7000259.

45. Zhou Y, Liu LY, He TT, Laghari ZA, Nie P, Gao Q, Xie HX. 2016. Edward-siella tarda EsaE (Orf19 protein) is required for the secretion of type IIIsubstrates, and pathogenesis in fish. Vet Microbiol 190:12–18. https://doi.org/10.1016/j.vetmic.2016.05.003.

Regulation of Type III Secretion in E. tarda Infection and Immunity

September 2017 Volume 85 Issue 9 e00322-17 iai.asm.org 15

on February 22, 2020 by guest

http://iai.asm.org/

Dow

nloaded from