The EMBO Journal vol.5 no.5 pp. 1077 - 1085, 1986

Regulation of the operon encoding ribonucleotide reductase inEscherichia coli: evidence for both positive and negative control

Christopher K.Tuggle and James A.FuchsDepartment of Biochemistry, University of Minnesota, St. Paul, MN 55108,USA

Communicated by A.Munch-Petersen

The ribonucleotide reductase genes (nrd) are induced bythymine starvation. Deletion analysis of the sequences up-stream of the cloned nrd genes was used to identify severalregulatory regions. The start of transcription (nrdP) was map-ped 110 bp upstream of nrdA, the first structural gene. A siterequired for positive regulation of nrd was mapped 135 bpupstream of nrdP in a region with two direct repeat sequencesas well as potential secondary structure. Two other sites (oneupstream of nrdP, the other downstream) were identified assequences whose deletion markedly increase expression. Theselatter sites show sequence homology and probably interactsince the effects of their individual deletion are not additivewhen combined.Key words: ribonucleotide reductase/gene fusion/nrdP/regulatorysites

IntroductionRibonucleotide diphosphate reductase (RDP reductase) is anessential enzyme for all dividing cells, catalyzing the first reac-

tion unique to de novo synthesis of deoxyribonucleotides(Thelander and Reichard, 1979). The Escherichia coli enzyme,which serves as a model for most organisms, consists oftwo non-

identical subunits. The activity of the holoenzyme is intricatelycontrolled by allosteric effectors binding at sites localized to thelarge subunit, B1. The primary structure of B1 and that of theanalogous subunits in mouse and herpes virus have been recent-ly compared and shown to share several regions of strikinghomology (Caras et al., 1985). The smaller subunit, B2, con-

tains a unique stable free radical localized to a tyrosine ring whichis required for enzymatic activity (Thelander and Reichard, 1979).A conserved tyrosine found in the B2 subunit of several organisms(E. coli, clam, herpes and Epstein-Barr viruses) has beenpostulated as the free radical tyrosine residue of the active site(Sjoberg et al., 1985).The synthesis of the two subunits of RDP reductase in E. coli

is coordinately regulated (Fuchs, 1977). Synthesis ofRDP reduc-tase increases when DNA synthesis is inhibited by thymine star-vation, chemical inhibition of DNA elongation or a shift toon-permissive temperature in dna mutants (Filpula and Fuchs,1977, 1978). Although these conditions also cause induction ofanother set of enzymes (the 'SOS' response), control of RDPreductase is different since it is independent of recA, recB, recCor lexA gene products (Filpula and Fuchs, 1977). This increas-ed RDP reductase activity is due to increased RDP reductasemRNA (nrd mRNA) levels in thymine-starved cells (Hanke andFuchs, 1983). Since the half-life of nrd mRNA was unchangedin these cells (Hanke and Fuchs, 1983), it was proposed that in-duction was due to an increased transcriptional rate of the nrd

IRL Press Limited, Oxford, England

operon. The increased rate of transcription was found to be depen-dent on concomitant protein synthesis: nrd mRNA induction uponthymine starvation is eliminated by simultaneous addition ofchloramphenicol or removal of essential amino acids (Hanke andFuchs, 1984).The nrd operon is contained within a 12 000 bp PstI fragment.

This fragment has been cloned into the plasmid vector pBR322(Platz and Sjoberg, 1980) and the nucleotide sequence of the en-tire nrd operon, as well as several kilobases of flanking sequences,has been reported (Carlson et al., 1984). To identify both thetranscriptional start site and the region of DNA responsible forregulation of nrd mRNA synthesis, restriction fragments cover-ing the 1641-bp 5' to the start of the open reading frame for BIwere cloned into several pKO vectors. These plasmids containa promoterless galactokinase (galK) gene (McKenney et al.,1981). DNA fragments inserted in these plasmids can be assayedfor promoter strength and response to in vivo regulatory signalsby measuring galK activity in a galK mutant strain. The initia-tion site for nrd transcription (nrdP) was mapped first to a 1 19-bpfragment, and then precisely identified using SI digestion ofDNA/RNA hybrids. The minimal region required for a correctregulatory response to thymine starvation was identified by dele-tion analysis of the shortest inducible nrd restriction fragment.Two regions were identified by deletion analysis that appear tobe involved in repression of nrd transcription. Effects of addi-tion of multiple copies of nrd on the expression of thechromosomal copy of nrd were also investigated. The implica-tions of these results are discussed and a model for the regula-tion of synthesis of RDP reductase is presented.

ResultsRestriction mapping ofnrdP and the region requiredfor induc-tion of nrd: expression of nrd is independent of copy numberInduction of RDP reductase encoded by nrd carried on pPS2,a pBR322 derivative, by thymine starvation indicated that thenrd genes had not been induced to the level observed for a singlecopy chromosomal gene (data not shown), possibly because theassay used depends on several cellular proteins that may belimiting at these high levels ofRDP reductase. Platz and Sjoberg(1984) have recently shown this to be the case.To circumvent this problem and to obtain an easier as well

as more accurate assay of nrd regulation, gene fusions were utiliz-ed. A promoterless galactokinase (galK) gene with upstreamtranslational stop codons in all three reading frames has been in-serted into a pBR322 derivative and named pKO0 (McKenneyet al., 1981, Figure 1). Two pKO0 derivatives, pKO9 (Adamsand Hatfield, 1984) and pKOTWl (T.Warner, unpublished) wereutilized in this work to clone several restriction fragments locatednear nrd to map the sites of transcriptional initiation and regula-tion. The size of nrd DNA fragments cloned varied from 1641(KpnI - EcoRI) to 119 (Mnll - EcoRI) bp (Figure 1). The EcoRIsite was chosen as the 3' border in these fragments since the sitemaps only 8 bp from the presumed ribosome binding site for nrdA(Carlson et al., 1984) and thus the nrd promoter (nrdP) was ex-

1077

C.K.Tuggle and J.A.Fuchs

BamHl Kpnl

Kpnl Sau3A

1844

EcoRlnrdA-

Hpa2 Mnll coRl

BamH 1

4260

P1 asmidpCKT2

3159 3291 3362 3485

-MAmpSAUG GalK-

MCS

pCKT8

pCKT25 _

pCKT36 *0

pCKT122 <

0co

Fig. 1. Construction of nrd-galK transcriptional fusions. The top line is aBamHI restriction fragment of nrd DNA from pPS2 (Platz and Sjoberg,1981). Several restriction subfragments of the region 5' to nrdA were clonedinto pKO9 or pKOTWl (see Materials and methods for plasmidconstructions) to measure promoter activity and response to in vivoregulatory signals. The bottom line shows the details of the pKO assaysystem. MCS, multiple cloning sites; V V V, transcriptional stop codons inall three reading frames; CP, constant polarity region.

._

0)

kV

:3

0)

L-

a.cl

co0

Time (min)

Fig. 2. GalK and RDP reductase assays in cells containing single andmultiple copies of nrd. Cultures of N 110 containing pKG1800 (0) or

pCKT2 (A) were starved for thymine and samples taken at 30 min intervalsafter thymine removal for RDP reductase (filled symbols) and galK (closedsymbols) assays. GalK assays were performed and GalK units (in nmolgalactose phosphorylated per min per ml of cells at OD650 = 1.0) were

measured (McKenney et al., 1981). RDP reductase activity (in nmol dUMPproduced per min per mg protein) was measured by the procedure ofFilpula and Fuchs (1977).

pected to map 5' to the EcoRI site. The largest fragment,Kpn-EcoRl, was cloned upstream of galK in this system(pCKT2) and tested for the ability to regulate correctly galK ac-

tivity after thymine starvation of the host bacterium. Figure 2shows the results of thymine starvation of a strain carrying either

1078

Fig. 3. Use of nrd- GalK fusions to map nrdP and the regulatory regionresponsive to thymine starvation. Cultures of N 110 containing variousplasmids (see Figure 1) were starved for thymine and samples taken at 60min intervals following thymine removal for galK assays. GalK activity was

expressed as nmol galactose phosphorylated per min per fmol plasmid(Adams and Hatfield, 1984) to correct for variations in plasmid copynumber. GalK activity in Nl 10 containing pKG1800 increased slightly withthe new protocol and all data points for the nrd-galK fusions were

normalized to N110/pKGl800 (data not shown). (0), pCKT2; (0),pCKT8; (A), pCKT25; (A), pCKT36; (O), pCKTl22.

pCKT2 or pKG1800, a control plasmid with galK controlled bygalP (McKenney et al., 1981). GalK and RDP reductase activitiesincrease in parallel in pCKT2, showing that the nrd restrictionfragment regulates galK activity in this system in the same man-

ner as the chromosomal nrd operon is regulated. The kineticsof expression of the chromosomal nrd operon in a strain witheither plasmid do not differ, indicating that multiple copies ofthe plasmid-borne nrd fragment do not affect expression of thechrQmosomal copy of nrd. There is a small increase in galK ac-

tivity during thymine starvation in cells containing pKG1800 andin the following experiments galK values were normalized to ac-

count for this small non-specific increase in galK activity duringthymine starvation. To eliminate possible differences in plasmidcopy number of different constructs, galK activity was express-

ed per amount of plasmid (Figure 3 legend).Additional restriction fragments of the nrd operon were clon-

ed upstream of galK in this system to map nrdP and the regionrequired for induction. As shown in Figure 3, all plasmids ex-

cept pCKT122 show a low level of galK expression at time 0of thymine starvation (the galK activity seen for pCKT122 was

not significantly above galK activity seen for plasmid withoutthe insert). Therefore, nrdP was tentatively mapped within the19-bp MnlI - EcoRI fragment present in all constructs except

pCKT122 (Figure 1). However, only the KpnI- EcoRl (pCKT2)and the Sau3A-EcoRI (pCKT8) fragments appear to containinformation required for induction of galK activity upon thyminestarvation. Since the HpaII - EcoRl fragment (pCKT25) does notrespond to thymine starvation, a required section of the regulatorymust be located in the 132 bp between the Sau3A and HpaI sitespresent in pCKT8 but not pCKT25. Since a plasmid without this132-bp region shows a low level of expression that cannot be

Pasmd

8

2

25

36

Time (min)

Regulation of nrd operon

a)

ABCDEFGHIJ

= 89=84

b)

-35 -10 +1

.) .--- --tnu P 1'1 a t - 3

~ **.

-ea r 1< ;f t C; t t t 'L; J

Fig. 4. Use of SI nuclease to map the transcriptional start of nrd. (a)mRNA from CR34 with or without pPS2 was isolated (Summers, 1970)either before or after 180 min of thymine starvation. The DNA probe (aSall-EcoRI restriction fragment from pCKT8 radiolabelled at the EcoRIsite with polynucleotide kinase) and either 5 or 50 jig of mRNA were

hybridized (Berk and Sharp, 1977), digested with SI nuclease (Weaver andWeismann, 1979) and run on a DNA sequencing gel next to a set ofdideoxy sequencing reactions. Lanes: A-D, unstarved mRNA; A: 5 tg

CR34, B: 50 Ag CR34, C: 5 yg CR34/pPS2, D: 50 Ag CR34/pPS2, E:DNA probe without mRNA or S1 nuclease treatment, F: DNA probe alone,treated with S1 nuclease, G-J, starved mRNA; G: 5 ug CR34, H: 50 AgCR34, I: 50 Ag CR34/pPS2, J: 5 Ag CR34/pPS2. An autoradiogram of thedried gel shows six protected fragments of 84-89 nucleotides in lanes D(barely visible) and G-J. (b) DNA sequence of nrdP showing initiationsites as well as the -10 and -35 region, compared with prokaryoticpromoter consensus sequence (Hawley and McClure, 1983). Capital lettersin nrd designate identity to the consensus sequence, where capital lettersindicate degree of conservation (von Hippel et al., 1984). +1 indicates siteof consensus transriptional initiation, and slashes above the nrd sequence

correspond to the six protected fragments indicated in A. Arrows indicatethe position of an inverted repeat sequence (Carlson et al., 1984).

induced by thymine starvation, this region must contain a sitefor positive regulation.

Induction ofRDP reductase encoded by the chromosomal genes

in cells containing these constructions was tested by measuringRDP reductase activity following thymine starvation and was

found not to differ from a control strain (data not shown).Mapping of nrd transcriptional initiation siteStudies with the nrd-galK fusion plasmids indicated that the

transcriptional initiation site of the nrd operon lies within the1 19-bp Mnll - EcoRI fragment (Figures 1 and 3). To defineprecisely the 5' end of nrd mRNA, a 350-bp Sall - EcoRI restric-tion fragment from pCKT8 (the Sail site maps upstream of theBamHI site in pKO9) was labelled at the EcoRI site with T4polynucleotide kinase and hybridized (Berk and Sharp, 1977) tomRNA isolated from exponentially growing or thymine-starvedcells with or without pPS2. The DNA-DNA hybrids weretreated with SI nuclease (Weaver and Weissmann, 1979) andthe SI-resistant products were electrophoresed next to a DNAsequencing ladder as a size marker. An autoradiogram of theresulting gel is shown in Figure 4a. The 5' end of nrd mRNAmaps at nucleotides -84 to -89 relative to the EcoRI site ter-minal T residue. Multiple ends are observed for bothchromosomal and plasmid encoded nrdP in thymine-starved cells(lanes g -j), as well as in uninduced plasmid-containing cells(lane d, barely visible).

Figure 4b shows the DNA sequence at nrdP, which is upstreamof the region suggested to be nrdP (Carlson et al., 1984) solelyon the basis of sequence homology to the consensus promotersequence. The DNA sequences at the -35 and -10 regions ofnrdP shows strong agreement with the consensus promoter se-quence (Hawley and McClure, 1983). Such agreement with theconsensus sequence usually correlates well with a high promoterstrength (Raibaud and Schwartz, 1984), but nrdP is relativelyweak (compare galK expression in pCKT2 versus pKG1800 attime 0 in Figure 2). Secondary structure involving both the -35and -10 regions of nrdP (Carlson et al., 1984) (Figure 4b) couldlower the in vivo strength of nrdP, or additional regulatorymechanisms may be functioning to repress transcription at nrdP.Deletion mapping of nrd region required for inductionTo define the region of DNA involved in regulation of RDPreductase synthesis, deletion analysis of the smallest regulatednrd restriction fragment was performed. pCKT8 was digestedwith SaiI, and treated with Bal3I for various times. BamHIlinkers were then ligated to the linear plasmid DNA, the pro-ducts were circularized with T4 ligase and transformed into strainNi 10. Transformants were screened both for the ability to in-duce galK activity upon thymine starvation and for the size ofthe BamHI - EcoRI fragment present. All transformants obtain-ed in this procedure were able to regulate galK activity the sameas pCKT8, even though up to 79 bp had been deleted (data notshown). pCKT300, the shortest clone, was then digested withBamHI, treated with exonuclease HI and S1 nuclease for varioustimes, digested with EcoRI and the small fragments ligated intopKOTWl at the SnaI and EcoRI sites. Transformants werescreened and analyzed as for the Bal31 procedure to producethe data presented in Figure 5. The exact endpoints of the clonesassayed were identified by DNA sequence analysis (Sanger etal., 1977, Figure 6). Results presented in Figure 5 indicate thatthe fusions fall into three phenotypic regulatory classes. Class1, (pCKT8, 229, 300) the original phenotype in which galK ac-tivity is low but inducible upon thymine starvation to - 10 timesthe initial value; class 2, (pCKT308, 324-326) in which galKactivity at all times during induction, as well as in uninducedcells, is - 5 times that of class 1; and class 3, (pCKT25, 302,307, 327) in which galK activity is low and cannot be inducedby thymine starvation (Figures 5 and 6). Deletion of nrd DNApast nucleotide -124 relative to nrdP (pCKT307, class 3) clearlyremoves the regulatory response to thymine starvation, whiledeletion up to nucleotide -139 (pCKT325, class 2) appears notto affect inducibility of the construct. It appears, therefore, thatthe upstream border of the site required for response to thymine

1079

qi 1'--4*

0-IIP!b.-M Mr...

C.K.Tuggle and J.A.Fuchs

b

Plasmid

16-4 -306

325

Plasmid 14-326324

8

123

229

> 10

0 6012018300

Time (min) Time (min)~e

C2 c0

307327302

0- 0 ~~~~25

Time (min) Time (min)

Fig. 5. Deletion analysis of nird shows both negative and positive effects on transcription. Thymine starvations of cells containing various deletion plasmids of'pCKT8 were performed (see Materials and method for deletion protocol) and aliquots taken at 60 min intervals following thymine removal. GaIK activity (innmol galactose phosphorylated per min per fmol plasmid) was then measured as in Figure 3. See Figure 6 for deletion endpoints of these plasmids. (a) ()pCKT8; (0) pCKT25; (A), pCKT229; (A), pCKT300; (U), pCKT302; (LI), pCKT307; (V), pCKT310O; (7). pCKT327. (b) (0), pCKT308; (0),pCKT324; (A), pCKT325; (A), pCKT326.

Class 1 Class 2 Class 3

8 229 300 324 326 1325 310 307 327 302 25I I III1 I i I I

GATC-60bp- TTATGCCCGTTCAAG.GAAATCGCCCGAACAGTTATTTTTAACAAPmITTTGGATTGACTTTCCCGGACACCTTGTCTDRI *

-170 -160 -150 -140 -130 -120 -110 -100

36 Hi nf 1 EcoRl

rACCTAAGGTGCGCGAAAGCCATTTCC GAGTTATCCACAAAGTTATGCACTTGCAAGAGGGTCATTTTCACACTATCTTGCAGTGAATC- 78bp- GAATTCDR2 -

-90 -80 - 70 -60 -50 -40 -30 -20 -10

Fig. 6. Endpoints of deletion plasmids indicate DNA regions required for induction and repression of ,irdIP activity. Vertical arrows indicate border betweenvector and nrd sequences in various deleted fusion plasmids. Direct repeats I and 2 are boxed (DRI and DR2), and horizontal arrows indicate inverted repeatregion. Numbering system is relative to + 1, the first base of the longest protected fragment (see Figure 4b). Apostrophes indicate SI nuclease mapping dataresults.

starvation (regulatory site 2) is bounded by nucleotides - 139and -124 (Figure 6, sequences present in class 1 and 2 but notclass 3 fusions). A clone with approximate intermediate pheno-type is pCKT310, whose deletion endpoint (-129) maps insidethis region. During thymine starvation, the increase in rate ofgalK expression in this clone is somewhat lower than that seenfor longer fragments, but significantly higher than the uninduci-ble clone pCKT307. Inspection of the sequence in this area showsseveral intriguing regions (Figure 6). There are two 1 l-bp near-ly perfect direct repeats in the sequence 5' to nrdP at -128 to

1080

- 117 and -67 to -57, one of which partially maps inside site2. Between these two repeats is a large inverted repeat, whosestem loop structure has a calculated (Tinoco et al., 1973) poten-tial energy of -18.4 kcal (Figure 6).

Deletion of sequences upstream of site 2 (see Figures Sb and6, clones pCKT308, 324-326) results in an 55-fold increasedlevel in galK expression without affecting the ability to respondto thymine starvation. The upstream border of this region(regulatory site 1) maps between - 157 and -150 (Figure 6, se-quences present in class 1 but not class 2 fusions). Deletion of

Regulation of nrd operon

Iable I. RDP reductase activity is unchanged in cells containing class twotird-galK fusions

Plasmid RDP reductasespecific activitya

Class One and Class Three fusions

pCKT8 0.09pCKT25 0.15pCKT300 0.13pCKT302 0.10pCKT307 0.09pCKT310 0.12pCKT327 0.12

Class Two fusions

pCKT308 0.10pCKT324 0.08pCKT325 0.08pCKT326 0.10

'In nmoles dUMP produced/min/mg protein

site 1 in Figure 6 appears to make nrdP a stronger promoter.It is possible that the results observed in these clones are dueto an artifact of ligating these particular plasmid and nrd se-quences together, but since identical induction curves are seenfor four individual fusions, this seems unlikely. RDP reductaseactivity encoded by the chromosome in these clones is not altered(Table I), eliminating the possibility of trans-acting elements hav-ing been altered in these clones. A more interesting and likelypossibility may be that a negative regulatory site is present inthis region and has been deleted in these constructions, leavingthe positive site intact. This would explain the overall increasein transcription, as well as the inducible phenotype observed.A negative regulatory site maps 3' to nrdPTo investigate the role of the 110 bp of untranslated mRNAbefore the nrdA initiation codon (Figure 6), the DNA betweennrdP and the EcoRI site was deleted. pCKT300 was digestedwith HinfI and the ends filled in with Klenow enzyme. Theresulting fragments were digested with BamHI and theBamHI - Hinfl (blunt) fragment cloned into pKOTWl to pro-duce pCKT400. As expected, cells containing pCKT400 show-ed both promoter activity and inducibility upon thymine starvation(Figure 7). This result reinforces the previous mapping data, sincenrdP must now map between the MnII and Hinfl sites (Figure6). However, the promoter strength of this fragment was sur-prisingly high, 10-fold higher than expected at all time points.This fusion represents a new regulatory phenotype, class 4. Theseresults indicate that another site of negative regulation (site 3)may exist between nrdP and the start of translation. It is alsopossible that this increase in galK activity was due to a decreasein polarity since the region of untranslated mRNA between nrdPand galK has been shortened in pCKT400 relative to pCKT300.To determine if the effect of deleting the DNA between the Hinfland EcoRI sites was due to an artifactual decrease in transcrip-tion termination or the deletion of a true negative regulatory site,the DNA between nrdP and the EcoRI site in pCKT325 wasdeleted as for pCKT300 (see above) to produce pCKT402, anrd-galK fusion with both site 1 and site 3 deleted. Since thedeletion of site 1 also increase galK activity and cannot be directlyinvolved in transcription termination, and if deleting site 3decreases polarity, the galK activity seen for pCKT402 would

Plasmid

\ 402

i 400

<15 325

10

300

0 60 120 180

Time (min)

Fig. 7. Removal of the region of untranslated mRNA (site 3) dramaticallyincreases transcription from nrdP: site 3 shows interaction with site 1. Todelete the Hinfl-EcoRI region in pCKT300 or pCKT325 (see Figures 6and 8), these two plasmids were digested with Hinfl, the ends filled in withKlenow enzyme, the resulting fragments digested with BamHI, and clonedinto pKOTWI via the BamHI and SmaI sites to create pCKT400 andpCKT402, respectively. Samples were taken at 60 min intervals followingthymine removal of cultures containing these plasmids, as well as pCKT300and pCKT325, and assayed for galK activity (in nmol galactosephosphorylated per min per fmol plasmid) as before (Figure 3 legend). (0),pCKT300; (0), pCKT325; (A), pCKT400; (A), pCKT402.

be expected to be much higher than either pCKT325 or pCKT400since the effects of deletion of sites 1 and 3 should be indepen-dent of each other and cumulative. The results shown in Figure7 indicate that there is no additional effect upon deletion of theupstream site (compare pCKT400 and pCKT402), implying in-teraction between these two sites and decreases the probabilitythat site 3 is an artifact of decreased polarity. However, deletionof site 3 alone results in an - 2-fold larger effect that deletionof site 1 alone.

Deletion analysis of this region was performed to define site3. pCKT8 was linearized by digestion with the enzyme EcoRIand deletion was made by the exonuclease II and SI nucleaseprocedure discussed earlier. Since all deletions assayed (Figure8a) and mapped (Figure 8b) had very high promoter strength(class 4 phenotype), the downstream border of the negativeregulatory site 3' to nrdP must map between + 79, the shortestdeletion (pCKT413) and +90, the terminal C residue in theEcoRI site. Since site 1 and site 3 apparently interact and dele-

1081

C.K.Tuggle and J.A.Fuchs

Plasmid

V 430

)4001 419

3 422

I 421L 413

bClass 4

400 421 422 419 430 413 aI ~~II .1I_I

GCAG TGAATCC -30bp-GCAGCTTCCCGTACTACAGGTAGTC TGCATGAAAC TAT TGCGGAAAGAAT TCCAAAAAd1,GSGCGACATACAT(..1 +40 +50 +60 +10 +80 '90 .100

C413 P

5'...GCATGAT ;i; fA I G A T1TCr0AAAA. 3' Site 3 Sequence

...AAAAAIAA.C1 CILcC TL2i TGAAC...3' Site Sequence325 394 300 (Comple"entary Strand)

180

Time (min)

Fig. 8. Site 3 maps very near to the start of nrdA and shows homology to site 1. (a) deletion analysis of pCKT8 was performed exactly as for pCKT300 (seeMaterials and methods) except that deletion started from the EcoRI site. GalK assays after thymine starvations of N 110 containing plasmids from this deletionprotocol were performed as before (see Figure 3 legend). (O), pCKT8; (0), pCKT400; (A), pCKT413; (A), pCKT419; (A), pCKT421; (LI), pCKT422;(V), pCKT430. (b) Endpoints of deletions are indicated by arrows as in Figure 6. ATG initiation codon of ur(dA is underlined, and the presumptive ribosomebinding site is boxed. (c) Comparison of the DNA sequence at site 3 with complementary strand sequence at site I shows significant homology. Homologoussequences are boxed, indicates insertion of a space to maximize homology.

tion of either site has a similar effect on trasncription, it was ofinterest to compare the nucleotide sequence at these sites (Figure8c). There is significant homology (70%) between sequences atsite 3 with the complementary strand at site 1. Site 1 is an in-verted repeat of site 3.

DiscussionAn earlier model for regulation of the synthesis of RDP reduc-tase proposed a pool of effector molecules that accumulate inthe cell whenever the rate of synthesis of DNA is insufficientfor the growth requirements of the cell (Filpula and Fuchs, 1977).Hanke and Fuchs (1984) showed that protein synthesis is requiredfor induction of nrd and they speculated that a regulatory pro-tein accumulates during inhibition of DNA replication and actspositively to induce RDP reductase synthesis. The observationreported here that expression of the chromosomal nrd genes isnot affected by the presence of the regulatory region of the nrdoperon on a multicopy plasmid (Figure 2) suggests that eitherthere is a large pool of regulatory molecules or that the regulatoryprotein is autoregulated. The result reported in this paper thatdeletion of a region (site 2) upstream of nrdP prevents the in-creased expression of nrdP during thymine starvation stronglysupports the model of control by positive regulation. An alter-

native model would suggest that a small molecule or protein thatis synthesized during thymine starvation acts as a co-repressorto remove a negatively acting protein at nrd and induce RDPreductase synthesis. This model would predict a constitutivelyhigh promoter strength for pCKT25 where site 2, the region re-quired for induction, has been deleted without deletion of nrdP.Since pCKT25 shows no such increase in galK activity overpCKT8 (Figure 3), this simple repressor theory cannot explainregulation of nrd. However, the results from deletion of sites1 and 3 indicate that regulation of the nrd operon is more com-plex than previously suggested and that, in addition to positiveregulation, the nrd operon is also subject to negative regulation.The start site of transcription of the nrd operon was mapped

110 bp 5' to the ATG codon in nrdA in a region of potentialsecondary structure (Carlson et al., 1984). This potentialstem-loop structure would include both the -35 and -10regions of nrdP. The DNA sequence at nrdP shows stronghomology to the consensus promoter sequence (Figure 4b), im-plying that nrdP should be a strong promoter (Raibuad andSchwartz, 1984). However, galK assays show that uninducednrdP is fairly weak, with only - 10-15% the strength of thegal promoter (Figures 2 and 3). The observation that regionsbordering nrdP can be deleted causing increased transcription

a

18~

16

14

12 [

>5

0.

._

0

10o

1082

Regulation of nrd operon

Results ofDeletion %nalysis:

Features in __-__ ,_nrd Sequence: - _ -

DR1 DR2

BP nrdA

-35 -10 +1

Fig. 9. A proposed model for regulation of the nrd operon. See text for explanation. The upper line summarizes the deletion analysis of the nrd operon,combining Figures 6 and 8b. The lower line outlines some features of interest found in the DNA sequence in the region: solid arrows indicate inverted repeat

sequences, open arrows are direct repeat (DR) sequences, the -35 and - 10 regions are boxed and labelled, the start site of transcription is labelled with +and an arrow, and the start of the nrdA open reading frame is shown with an arrow. In the lower diagram, the DNA has been looped to bring sites and 3in close proximity. and the inverted repeat near site 2 has been drawn as a stem -loop structure. Structural representations of proposed binding proteins are

speculative. All features of approximate known size have been drawn to scale.

in uninduced cells (Figures 5, 6 and 7) indicates that some formof repression may contribute to the low in vivo strength of nrdP.The region required for induction of the nrd operon (site 2)

has been mapped - 135 bp upstream from the start of transcrip-tion (Figure 6). Interestingly, two direct repeats are present bet-ween this region and nrdP, and inducibility is lost upon deletioninto repeat 1 (Figure 6). Within the 49 bp that separate thesedirect repeats is a large (22 bp) inverted repeat. These direct andinverted repeats may constitute an activator-binding site. The bin-ding of an activator protein could stabilize the proposed secon-

dary structure by recognizing the direct repeats as a binding siteonly when they are close together. An attractive feature of thismodel (Figure 9) is that site 2, known to be required for induc-tion of transcription 135 bp downstream at nrdP, would be movedphysically closer to nrdP. This model would predict that dele-tion of direct repeat 2 would abolish inducibility as does dele-tion of direct repeat 1 (see Figure 6) and thus should be testable.Two sites have been identified as DNA sequences whose dele-

tion cause an increase in galK activity in uninduced cells andthroughout thymine starvation. One region (site 1) lies 5' to theregion involved in induction (site 2), while the second site lieswithin the nrd transcriptional unit (site 3) near the start of thefirst gene. Comparison of the DNA sequences at these sites shows

70% homology between site 1 and site 3 (Figure 8c). Approx-imately 220 bp separate these two regions, which apparently in-teract since the effects of deleting each site singly are notmultiplicative or even additive when combined (Figure 7). In a

construct with site 3 deleted there is no effect of deleting site1. However, in a construct with site 1 deleted, there is a further2-fold increase in galK expression upon deletion of site 3. Oneinterpretation of these results is that sites 1 and 3 are bindingsites for a regulatory protein and that both sites are required forstable binding. Binding at site 3 may block transcription, whilebinding at site 1 could directly compete with binding of a positive-ly acting protein at site 2. Competition due to steric hindranceis plausible, since site 1 and 2 map very close together (Figure6). The phenotype of class 2 and class 4 fusions, where galKactivity is 5-10 times higher than normal, may thus be due toincreased binding of a positive regulatory protein. The effect ofdeleting site 1 is dependent on the presence of site 3 (Figure 7),indicating that binding at site 3 may be required for binding atsite 1. Competition for binding in the site 1/site 2 region wouldalso explain why deletion of both sites 1 and 2 (class 3 fusions,Figure 6) does not lead to high level uninducible galK expres-sion, which would be the expected phenotype if the positive andnegative regulatory proteins were independent of each other.

1083

site 1 Site 2 Site 3__

I

C.K.Tuggle and J.A.Fuchs

Since the competition model predicts that the increased expres-sion seen in class 2 and class 4 fusions is caused by increasedbinding of the regulatory protein at site 2, the absence of site2 in class 3 fusions cancels the effect of deleting site 1.The results of this deletion analysis of nrd are reminiscent of

the gal and ara operons which have been shown to contain twooperator sites bordering their respective promoters (Dunn et al.,1984; Majumdar and Adhya, 1984). The model used to explainthe functions of these pairs of sites involves looping of the DNAto bring the two sites in close physical proximity. In the ara

operon, insertion between operators of roughly helical turnlengths of DNA (multiples of 10 bp) does not alter regulation,while other size insertions abolish repression (Dunn et al., 1984).In contrast to the ara and gal operons, where the structure andfunction of the two operator sites appears to be identical, nrdsites 1 and 3 share only 70% homology and show a 2-fold dif-ference in repression of nrdP. However, the finding that dele-tion of site 3 has a 2-fold greater effect that deletion of site 1

may be explained by a single protein, with stronger binding atsite 3 as compared with site 1.

Figure 9 schematically presents a model for nrd regulation.Induction of transcription of nrd may be effected by an activatorprotein binding to the two direct repeats upstream of nrdP.Neither the mechanism of activation of this proposed regulatoryprotein nor the mechanism of its induction of nrdP is known.Sites 1 and 3 may bind another protein(s) which stabilizes a DNAloop containing nrdP and represses the transcription either bypreventing binding of the positive regulatory protein or by block-ing action or movement of RNA polymerase.

Future experiments will attempt to determine, by deletion or

mutagenic analysis, the role of direct repeat 2, if any. Interac-tion of sites 1 and 3 to repress nrd transcription will be in-vestigated by the method of Dunn et al. (1984), to add variouslengths of DNA at the Mnll site to determine if a DNA loopingmechanism similar to that proposed for the ara operon is func-tioning in nrd.

Materials and methodsChemicals and enzymes

[3H]UDP for RDP reductase assays and [3H]galactose for galK assays were ob-tained from Amersham Corp. [32P]ATP and [32P]dATP were obtained from NewEngland Nuclear. All enzymes were obtained from Bethesda Research Labs or

Boering Mannheim Biochemical. All other chemicals were obtained from SigmaChemical Company.Bacterial strains and plasmid constructionsAll work except M13 cloning and mRNA isolations was performed in an

Escherichia coli K-12 thyA derivative of N100 (McKenney et al., 1981) calledNI10. N110 was constructed from N100 by plating N100 on trimethoprim-containing medium and screening the resistant colonies for thymine auxotrophy.M13 cloning was done in JM101 (Messing et al., 1977). pPS2 (Platz and Sjoberg,1980) was the source of nrd DNA transferred into various derivatives of pKO0(McKenney et al., 1981): pCKT2 is pKOTWl with a 1.6-kb KpnI-EcoRI frag-merlt from pPS2 that was first cloned into pUC19 (Norrander et al., 1983) touse the HindIll site (there is no KpnI site in pKOTWl); pCKT8 is PK09 (Adamsand Hatfield, 1984) with a Sau3A - EcoRI fragment directly cloned into theBainHI-EcoRI sites in pKO9; pCKT25 was constructed by cloning a Hpall-EcoRIfragment into pUC19 via the AccI and EcoRl sites and then transferring theHindIII-EcoRI fragment from this plasmid into pKOTW1; pCKT36 was con-structed by cloning a MnlI-EcoRI fragment into pUC19 via the Hincd and EcoRIsites and then transferring the HindII -EcoRl fragment as pCKT25; pCKT122was constructed by Sau3A and Mnll digestion of the 1.6-kb KpnI-EcoRI frag-ment from pPS2, cloning the Sau3A -Mnll fragment into pUC13 via the BamHIand SimaI sites and then transfemng the HindIl-EcoRI fragment from the resultantplasmid into pKOTW1.S1 nuclease mapping

miRNA was isolated (Sunimers, 1970) from CR34 (Bachmann, 1972) eitherplasmidless or containing pPS2. DNA/mRNA hybridizations were performed (Berk

1084

and Sharp, 1977). The DNA probe was the small Sall - EcoRI fragment frompCKT8 labelled at the EcoRI site with [32P]ATP and polynucleotide kinase. SIdigest conditions (Weaver and Weissman, 1979) were: 500 U/ml (BRL units)for 1 -2 h at 37°C. SI -resistant hybrids were then run next to a dideoxy DNAsequencing reaction to determine precisely the endpoints of digestion.Galactokinase activityAssays were performed (McKenney et al., 1981) with the following changes.Cells were grown in Davis - Mingioli medium (Davis and Mingioli, 1950) sup-plemented with casein hydrolysate (0.05%), thymine (40 mg/1), adenosine deoxy-ribose (200 mg/l), ampicillin (50 mg/I), vitamin B1 (4 mg/I) and glucose (0.2%).Thymine was removed for starvations by chilling exponentially growing culturesto 0°C, washing three times with ice-cold unsupplemented Davis - Mingiolimedium and resuspension in the above growth medium minus thymine.[3H]Galactose was used rather than [14C]galactose due to its reduced cost. Thereaction was stopped by placing the tube in a dry ice - ethanol bath.DEAE-cellulose disks after filtration were placed in 1 ml 0.7 M MgC12, 20 mMTris pH 7.0 to elute the labelled galactose-phosphate from the filter and countedafter adding 10 ml Aquasol 2 diluted 2.5:1 with xylenes. Cell extracts for galKassays were made and plasmid copy number was determined (Adams and Hat-field, 1984).RDP reductase activityAssays were performed as previously described (Filpula and Fuchs, 1977).Exonuclease digestionsA, 5' to nrdP. pCKT8 was digested with SalI, an enzyme which cuts once ata site 5' to the inserted fragment. Bal31 was then used as described (Landick,1982) at a concentration of 10 U/mi. At 1 min intervals, aliquots were removedinto buffer-saturated phenol to stop the reaction. The products were pooled, theends repaired with T4 polymerase, BamHI linkers were ligated onto the endsof the plasmid products, digested with BamHI, separated from small linkerfragments with gel filtration chromatography, ligated and transformed into NI 10.Individual recombinant plasmids were screened both for the size of theBamHI - EcoRI fragment they contained and the regulatory phenotype observedin cells containing these plasmids. All fragments tested from this round of diges-tion were still able to correctly regulate galK. Exonuclease III and S1 digestionof the shortest clone screened (pCKT300) was then carried out as described(Roberts et al., 1979). Products were treated with T4 polymerase to blunt ends,digested with EcoRI and the nrd fragments isolated by polyacrylamide gel electro-phoresis. The fragments were then cloned into pKOTWl via the SmaI and EcoRIsites. Resulting plasmids were screened as above.

B, 3' to nrdP. pCKT9 was digested with EcoRI; exonuclease III and S1 nucleasewere used as above. The population of deleted plasmids was then digested withSall, the fragments isolated as above and cloned into pKOTWl via the Sall andSmaI sites. Resulting plasmids were screened as above. Endpoints of allexonuclease-produced fragments were identified by transferring theHindIll-EcoRI fragment into Ml3mpl8 or Ml3mpl9 (Norrander et al., 1983)and performing dideoxy sequencing (Sanger et al., 1977).

AcknowledgementsWe thank Den Geraghty for providing the sequencing reactions used in Figure4 and both Janet Schottel and Anath Das for critical review of the manuscript.This work was supported by Public Health Service research grant GM 20884from the National Institutes of Health, National Science Foundation grantDMB-8505055 and by a grant from the University of Minnesota Graduate School,all to J.A.F., and by Public Health Service Cellular and Molecular Biology TrainingGrant GM 07323 from the National Institutes of Health to C.K.T.

ReferencesAdams,C.W. and Hatfield,G.W. (1984) J. Biol. Chem., 259, 7399-7403.Bachman,B. (1972) Bacteriol. Rev., 36, 525-527.Berk,A.J. and Sharp,P.A. (1977) Cell, 12, 721 -732.Caras,I.W., Levinson,B.B., Fabry,M., Williams,S.R. and Martin,D.W.,Jr. (1985)

J. Biol. Chem., 260, 7015 -7022.Carlson,J., Messing,J. and Fuchs,J.A. (1984) Proc. Natl. Acad. Sci. USA, 81,

4294 -4297.Davis,B.D. and Mingioli,E.S. (1950) J. Bacteriol., 60, 17-28.Dunn,T.M., Hann,S., Ogden,S. and Schleif,R.F. (1984) Proc. Natl. Acad. Sci.

USA, 81, 5017-5020.Filpula,D.F. and Fuchs,J.A. (1977) J. Bacteriol., 130, 107- 113.Filpula,D.F. and Fuchs,J.A. (1978) J. Bacteriol., 135, 429-435.Fuchs,J.A. (1977) J. Bacteriol., 130, 957-959.Hanke,P.D. and Fuchs,J.A (1983) J. Bacteriol., 154, 1040- 1045.Hanke,P.D. and Fuchs,J.A. (1984) Mol. Gen. Genet., 193, 327-331.Hawley,D.K. and McClure,W.R. (1983) Nucleic Acids Res., 11, 2237 -2255.Landick,R. (1982) Focus (BRL), 4, 1-5.

Regulation of nrd operon

Majumdar,A. and Adhya,S. (1984) Proc. Natl. Acad. Sci. USA, 81, 6100-6104.McKenney,K., Shimatake,H., Court,D., Scmeissner,U., Brady,C. and Rosen-

burg,M. (1981) In Chirikjian,J.S. and Papas,T.S. (eds.), Gene Amplificationand Analysis. Elsevier North Holland, NY, pp. 383 -415.

Messing,J., Gronenborn,B., Muller-Hill,B. and Hofschneider,P.H. (1977) Proc.Natl. Acad. Sci. USA, 74, 3542-3646.

Norrander,J., Kempe,T. and Messing,J. (1983) Gene, 26, 101 - 106.Platz,A. and Sjoberg,B.-M. (1980) J. Bacteriol., 143, 561 -568.Platz,A. and Sjoberg,B.-M. (1984) J. Bacteriol., 160, 1010- 1016.Raibaud,O. and Schwartz,M. (1984) Annu. Rev. Genet., 18, 173-206.Roberts,T.M., Kacich,R. and Ptashne,M. (1979) Proc. Natl. Acad. Sci. USA,

76, 760-764.Sanger,F., Nickles,S. and Coulsen,A.R. (1977) Proc. Natl. Acad. Sci. USA, 74,

5463 -5467.Sjoberg,B.-M., Eklund,H., Fuchs,J.A., Carlson,J., Standart,N.W., Ruder-

man,J.V., Bray,S.J. and Hunt,T. (1985) FEBS Lett., 183, 99-102.Summers,W.C. (1970) Anal. Biochem., 33, 459-463.Thelander,L. and Reichard,P. (1979) Annu. Rev. Biochem., 48, 133- 158.Tinoco,I.,Jr., Borer,P.N., Dengler,B., Levine,M.D., Uhlenbeck,O.C.,

Crothers,D.M. and Gralla,J. (1973) Nature, 246, 40-41.von Hippel,P.H., Bear,D.G., Morgan,W.D. and McSwiggan,J.A. (1984) Annu.

Rev. Biochem., 53, 389-446.Weaver,R.F. and Weissmann,C. (1979) Nucleic Acids Res., 6, 1175- 1193.

Received on 6 February 1986

1085