regulated release of p-tefb from the 7sk snrnp

University of IowaIowa Research Online

Theses and Dissertations

2009

Regulated release of P-Tefb from the 7sk SnrnpBrian KruegerUniversity of Iowa

Copyright 2009 Brian J. Krueger

This dissertation is available at Iowa Research Online: https://ir.uiowa.edu/etd/839

Follow this and additional works at: https://ir.uiowa.edu/etd

Part of the Cell Biology Commons

Recommended CitationKrueger, Brian. "Regulated release of P-Tefb from the 7sk Snrnp." PhD (Doctor of Philosophy) thesis, University of Iowa, 2009.https://doi.org/10.17077/etd.n88s3gow.

https://ir.uiowa.edu?utm_source=ir.uiowa.edu%2Fetd%2F839&utm_medium=PDF&utm_campaign=PDFCoverPages

https://ir.uiowa.edu/etd?utm_source=ir.uiowa.edu%2Fetd%2F839&utm_medium=PDF&utm_campaign=PDFCoverPages

https://doi.org/10.17077/etd.n88s3gow

https://ir.uiowa.edu/etd?utm_source=ir.uiowa.edu%2Fetd%2F839&utm_medium=PDF&utm_campaign=PDFCoverPages

http://network.bepress.com/hgg/discipline/10?utm_source=ir.uiowa.edu%2Fetd%2F839&utm_medium=PDF&utm_campaign=PDFCoverPages

REGULATED RELEASE OF P-TEFB FROM THE 7SK SNRNP

by

Brian Krueger

An Abstract

Of a thesis submitted in partial fulfillment of the requirements for the Doctor of

Philosophy degree in Molecular and Cellular Biology in the Graduate College of

The University of Iowa

December 2009

Thesis Supervisor: Professor David H. Price

1

ABSTRACT

Regulation of transcription elongation by P-TEFb is critical for proper gene

expression and cell survival. The cell possesses large quantities of P-TEFb, but the vast

majority of it is inactive in the 7SK snRNP. The 7SK snRNP is composed of the small

nuclear RNA 7SK, an inhibitory protein HEXIM which mediates the interaction between

P-TEFb and 7SK, the Methyl Phosphate Capping Enzyme, and the 7SK stability protein

LARP7. Since the discovery of the 7SK snRNP, research has been conducted to

determine how P-TEFb is released from this complex. The goal of the research presented

in this thesis is to better understand how the 7SK snRNP regulates P-TEFb and

ultimately, gene expression.

This work documents the discovery and characterization of the 7SK stability

protein LARP7. LARP7 is is associated with 7SK regardless of the presence of P-TEFb

and HEXIM1. Stabilization of 7SK is essential for maintenance of the RNP because loss

of LARP7 results in an increase in free P-TEFb and a significant reduction in the amount

of 7SK. These results indicate that stabilization of the 7SK snRNP by LARP7 is

important for regulating P-TEFb homeostasis.

Although P-TEFb was first characterized from Drosophila lysates, the

conservation of the 7SK snRNP and the mechanisms regulating P-TEFb inhibition have

not been described. Here, the Drosophila melanogaster homologues of LARP7 and 7SK

are characterized. These studies show that the system of P-TEFb regulation is similar in

flies and this makes Drosophila an attractive model system for studying P-TEFb

regulation through embryonic and larval development.

Finally, factors and modifications involved in releasing P-TEFb directly are

explored. An assay was developed for discovering proteins that can bind to and release

P-TEFb from the 7SK snRNP. Use of this assay showed phosphorylation,

dephosphorylation, and acetylation of the components of the 7SK snRNP do not cause P-

2

TEFb release directly. However, HIV Tat and the C-terminal P-TEFb binding region of

the bromodomain containing protein, Brd4, are capable of extracting P-TEFb directly.

Most importantly, the release of P-TEFb is followed by a conformational change in 7SK

RNA that causes HEXIM1 to dissociate from the complex. P-TEFb release from the 7SK

snRNP is the result of direct extraction of P-TEFb by viral or cellular proteins, and not

post-translational modifications or a competition between HEXIM1 and hnRNP proteins

for 7SK binding.

Abstract Approved: __________________________________ Thesis Supervisor

__________________________________ Title and Department

__________________________________ Date

REGULATED RELEASE OF P-TEFB FROM THE 7SK SNRNP

by

Brian Krueger

A thesis submitted in partial fulfillment of the requirements for the Doctor of

Philosophy degree in Molecular and Cellular Biology in the Graduate College of

The University of Iowa

December 2009

Thesis Supervisor: Professor David H. Price

Graduate College The University of Iowa

Iowa City, Iowa

CERTIFICATE OF APPROVAL

_______________________

PH.D. THESIS

_______________

This is to certify that the Ph.D. thesis of

Brian Krueger

has been approved by the Examining Committee for the thesis requirement for the Doctor of Philosophy degree in Molecular and Cellular Biology at the December 2009 graduation.

Thesis Committee: ___________________________________ David H. Price, Thesis Supervisor

___________________________________ John Colgan

___________________________________ Anton McCaffrey

___________________________________ Madeline Shea

___________________________________ Lori Wallrath

ii

ACKNOWLEDGMENTS

I would like to thank my thesis advisor Dr. David Price for his support and

guidance throughout my graduate study. Working with him has resulted tremendous

growth in me as a scientist and I appreciate all of the discussions we have had during my

graduate career.

I would also like to thank the current and past members of the Price Lab. My

original project came as a result of Sarah Byers and Qintong Li’s thesis work. I thank

them for their patience and support while teaching me all of the techniques of the Price

Lab. Stanley Sedore, Bo Cheng, and Yan Jiang were always nearby for entertainment. I

thank them for the many good laughs and stories we shared throughout the years. I

would also like to thank Courtney Searcey for her LARP7 EMSA work.

Finally, I’d especially like to thank Jeff Cooper and Kathy Varzavand. Jeff was

instrumental in helping me to express and purify the proteins and antibodies I used

throughout my thesis work. I thank Kathy for taking care of much of my cell culture

work and always having cells ready for me when I needed them.

iii

ABSTRACT

Regulation of transcription elongation by P-TEFb is critical for proper gene

expression and cell survival. The cell possesses large quantities of P-TEFb, but the vast

majority of it is inactive in the 7SK snRNP. The 7SK snRNP is composed of the small

nuclear RNA 7SK, an inhibitory protein HEXIM which mediates the interaction between

P-TEFb and 7SK, the Methyl Phosphate Capping Enzyme, and the 7SK stability protein

LARP7. Since the discovery of the 7SK snRNP, research has been conducted to

determine how P-TEFb is released from this complex. The goal of the research presented

in this thesis is to better understand how the 7SK snRNP regulates P-TEFb and

ultimately, gene expression.

This work documents the discovery and characterization of the 7SK stability

protein LARP7. LARP7 is is associated with 7SK regardless of the presence of P-TEFb

and HEXIM1. Stabilization of 7SK is essential for maintenance of the RNP because loss

of LARP7 results in an increase in free P-TEFb and a significant reduction in the amount

of 7SK. These results indicate that stabilization of the 7SK snRNP by LARP7 is

important for regulating P-TEFb homeostasis.

Although P-TEFb was first characterized from Drosophila lysates, the

conservation of the 7SK snRNP and the mechanisms regulating P-TEFb inhibition have

not been described. Here, the Drosophila melanogaster homologues of LARP7 and 7SK

are characterized. These studies show that the system of P-TEFb regulation is similar in

flies and this makes Drosophila an attractive model system for studying P-TEFb

regulation through embryonic and larval development.

Finally, factors and modifications involved in releasing P-TEFb directly are

explored. An assay was developed for discovering proteins that can bind to and release

P-TEFb from the 7SK snRNP. Use of this assay showed that phosphorylation,

dephosphorylation, and acetylation of the components of the 7SK snRNP do not cause P-

iv

TEFb release directly. However, HIV Tat and the C-terminal P-TEFb binding region of

the bromodomain containing protein, Brd4, are capable of extracting P-TEFb directly.

Most importantly, the release of P-TEFb is followed by a conformational change in 7SK

RNA that causes HEXIM1 to dissociate from the complex. P-TEFb release from the 7SK

snRNP is the result of direct extraction of P-TEFb by viral or cellular proteins, and not

post-translational modifications or a competition between HEXIM1 and hnRNP proteins

for 7SK binding.

v

TABLE OF CONTENTS

LIST OF FIGURES .......................................................................................................... vii LIST OF ABBREVIATIONS ............................................................................................ ix

CHAPTER 1 INTRODUCTION ........................................................................................1 The RNA Polymerases .....................................................................................2 Transcription Initiation .....................................................................................3 RNAPII Transcription Elongation Control .......................................................4 Transcription Termination and 3′ End Formation ............................................5 Regulation of P-TEFb by the 7SK snRNP .......................................................6 Gene Specific Regulation of Transcription by P-TEFb ....................................7 P-TEFb Regulation and Associated Diseases ...................................................9 Focus of the Thesis .........................................................................................10

CHAPTER 2 LARP7, A NOVEL COMPONENT OF THE 7SK SNRNP STABILIZES 7SK SNRNA IN HUMAN CELLS .........................................14 Introduction .....................................................................................................14 Materials and Methods ...................................................................................16

Generation and Affinity Purification of LARP7 Antibodies ...................16 Glycerol Gradient Sedimentation Analysis .............................................17 Western Blotting ......................................................................................17 Immunoprecipitation ...............................................................................18 Small Interfering RNA Knockdown of LARP7 and MePCE ..................19 Electrophoretic Mobility Shift Assay ......................................................19

Results .............................................................................................................19 LARP7 Co-sediments with the 7SK snRNP ...........................................19 LARP7 is a Stable Component of the 7SK snRNP .................................21 Knockdown of LARP7 Disrupts the 7SK snRNP ...................................22

Discussion .......................................................................................................23

CHAPTER 3 DISCOVERY AND CHARACTERIZATION OF THE DROSOPHILA MELANOGASTER 7SK SNRNP .......................................38 Introduction .....................................................................................................38 Materials and Methods ...................................................................................40

Generation of Affinity Purified Drosophila LARP7 Antibodies .............40 Glycerol Gradient Sedimentation Analysis .............................................41 Immunoprecipitation ...............................................................................41 Western Blotting ......................................................................................42 RNA Isolation and Northern Blotting .....................................................42 Conservation Analysis .............................................................................43

Results .............................................................................................................43 Identification of dLARP7 ........................................................................43 dLARP7 Co-sediments and Co-immunoprecipitates with CyclinT and dHEXIM in an RNase Sensitive Complex .......................................44 Characterization of d7SK and the Drosophila 7SK snRNP ....................46

Discussion .......................................................................................................48

vi

CHAPTER 4 MECHANISM OF RELEASE OF P-TEFB FROM THE 7SK SNRNP ...........................................................................................................64 Introduction .....................................................................................................65 Materials and Methods ...................................................................................69

Expression and Purification of Recombinant Proteins ............................69 Release Assay ..........................................................................................70 Western Blotting ......................................................................................71 Chemical Modification of 7SK RNA ......................................................71 In vitro Transcription of 7SK RNA .........................................................72 Hybridization and Primer Extension Reactions ......................................72

Results .............................................................................................................73 Phosphorylation, Dephosphorylation, and Acetylation of the 7SK snRNP does not Result in P-TEFb Release .............................................73 DSIF, Gdown1, DRB and Flavopiridol do not Cause P-TEFb Release Directly .......................................................................................75 HIV Tat and Brd4 Can Release P-TEFb Directly from the 7SK snRNP ......................................................................................................76 A Conformational Change Occurs in 7SK snRNA After P-TEFb Release Preventing the Binding of HEXIM1 ..........................................79

Discussion .......................................................................................................82

CHAPTER 5 SUMMARY AND FUTURE DIRECTIONS ............................................116 LARP7 Stabilizes 7SK snRNA in Human Cells ..........................................117 Conservation and Regulation of P-TEFb by the 7SK snRNP in Drosophila .....................................................................................................118 Regulated Release of P-TEFb from the 7SK snRNP for Viral and Cellular Gain .................................................................................................119

REFERENCES ................................................................................................................123

vii

LIST OF FIGURES

Figure 1: Model of transcription elongation control and P-TEFb regulation ....................12

Figure 2: Expression and purification of human LARP7 for antibody generation ............26

Figure 3: LARP7 co-sediments with the 7SK snRNP before and after the release ofP-TEFb and HEXIM..............................................................................................28

Figure 4: 7SK snRNA exhibits the same glycerol gradient sedimentation pattern as LARP7 ......................................................................................................................30

Figure 5:LARP7 is a stable component of the 7SK snRNP ...............................................32

Figure 6: Knockdown of LARP7 results in a relative increase of free P-TEFb but an overall decrease of total P-TEFb ..............................................................................34

Figure 7: LARP7 and a model of current mechanism of P-TEFb release .........................36

Figure 8: Schematic diagram of LARP7 conservation in eukaryotes ................................52

Figure 9: Expression and purification of dLARP7 for affinity purified antibody generation..................................................................................................................54

Figure 10: dLARP7, dHEXIM, and CyclinT co-sediment and co-immunoprecipitate in an RNase sensitive complex ..................................................56

Figure 11: d7SK RNA is conserved in Drosophila and immunoprecipitates with dLARP7 ....................................................................................................................58

Figure 12: d7SK co-immunoprecipitates with dHEXIM, dLARP7, and CyclinT .............60

Figure 13: A comparison of the human and Drosophila 7SK snRNP ...............................62

Figure 14: Phosphorylation, dephosphorylation, and acetylation do not release P-TEFb .........................................................................................................................88

Figure 15: Negative elongation factors, Myc, and ATP analogs do not cause release of P-TEFb .................................................................................................................90

Figure 16: Schematic of mutants and expression in E. coli ...............................................92

Figure 17: ...........................................................................................................................94

Figure 19: The RNA binding domain of Tat is not required for P-TEFb release ..............98

Figure 20: Brd4 can extract P-TEFb directly from the 7SK snRNP ................................100

Figure 21: Summary and quantification of the Brd4 release data ...................................102

Figure 22: Schematic of TAR and 7SK RNA secondary structure .................................104

viii

Figure 23: CMCT modification and primer extension ....................................................106

Figure 24: Release of P-TEFb by flavopiridol causes a conformational change in 7SK .........................................................................................................................108

Figure 25: Tat release of P-TEFb from the 7SK snRNP causes a conformational change in 7SK and results in HEXIM release from the complex ...........................110

Figure 26: Model of P-TEFb release from the 7SK snRNP ............................................112

Figure 27: Model of P-TEFb release by Brd4 and Tat ....................................................114

ix

LIST OF ABBREVIATIONS

Akt Murine Thymoma Viral Oncogene ATP Adenosine Tri-Phosphate BD1 Bromodomain 1 BD2 Bromodomain 2 Brd4 Bromodomain Protein 4 Bur1 Bypass UAS Requirement 1 CDK Cyclin Dependent Kinase CDK7 Cyclin Dependent Kinase 7 CDK9 Cyclin Dependent Kinase 9 CIITA Class II Major Histocompatibility Complex Transactivator CLL Chronic Lymphocytic Leukemia CLP1 Cardiac Lineage Protein-1 CMCT

1-cyclohexyl-3-(2-morpholinoethyl) carbodiimide metho-p-toluene sulfonate

CPSF Cleavage-Polyadenylation Specificity Factor CTD Carboxy Terminal Domain Ctk1 CTD Kinase 1 CtsF Cleavage Stimulation Factor d7SK Drosophila La Related Protein 7 dHEXIM Drosophila Hexamethylene Bisacetamide Induced 1 dLARP7 Drosophila La Related Protein 7 DMSO Dimethyl sulfoxide DNA Deoxyribonucleic Acid DRB 5,6-Dichloro-1-β-D-ribofuranosylbenzimidazole DSIF DRB Sensitivity Inducing Factor EBNA2 Epstein-Barr Virus EBV Epstein-Barr Virus EtBr Ethidium Bromide FPLC Fast Protein Liquid Chromatography HEXIM1 Hexamethylene Bisacetamide Induced 1 HEXIM2 Hexamethylene Bisacetamide Induced 2 HIV Human Immunodeficiency Virus HMBA Hexamethylene Bisacetamide hnRNP Heterogeneous Nuclear Ribonucleoprotein HSP70 Heat Shock Protein 70 HSV Herpes Simplex Virus HTLV Human T-lymphotropic virus IL-6 Interleukin-6 IP Immunoprecipitation

x

LARP7 La Related Protein 7 LTR Long Terminal Repeat m7G 7-methyl-guanosine MePCE Methyl-phosphate Capping Enzyme mRNA Messenger RNA MXC Multi Sex Combs myc Myelocytomatosis Viral Oncogene MyoD Myoblast Determination Protein NE Nuclear Extract NELF Negative ELongation Factor NF-κB Nuclear Factor kappa-light-chain-enhancer of Activated B cells N-TEF Negative Transcription Elongation Factor p65/RELA Reticuloendotheliosis Viral Oncogene PAF Polymerase II-Associated Factor Complex PI3K Phosphoinositide 3-kinase PKC Protein Kinase C poly(A) poly adenosine PP1α Protein Phosphatase 1 alpha P-TEF Positive Transcription Elongation Factor RNA Ribonucleic Acid RNAi RNA interference RNAPII RNA Polymerase II RNAPIII RNA polymerase III RPB1 RNA Polymerase core protein 1 RPBII RNA Polymerase core protein 2 RRM1 RNA Recognition Motif 1 RRM3 RNA Recognition Motif 1 Ser Serine siRNA Small Interfering RNA snRNA Small Nuclear RNA snRNP Small Nuclear Ribonucleoprotein TAF TBP Associated Factor TAK Tat Associated Kinase TAP-tagging Tandem Affinity Purification tagging TAR Trans-activation Response Element Tat Trans-Activator of Transcription TatC Tat CyclinT1 Binding Mutant TatR Tat RNA Binding Mutant Tax Transcriptional activator TBP TATA Binding Protein TFIIA Transcription Factor for polymerase II A

xi

TFIIB Transcription Factor for polymerase II B TFIID Transcription Factor for polymerase II D TFIIE Transcription Factor for polymerase II E TFIIF Transcription Factor for polymerase II F TFIIH Transcription Factor for polymerase II H Thr Threonine TNF Tumor Necrosis Factor TSS Transcription Start Site TTF2 Transcription Termination Factor 2 UCSC University of California Santa Cruz UTR Untranslated Region UV Ultraviolet VP16 Viral Protein 16 WCE Whole Cell Extract

1

CHAPTER 1

INTRODUCTION

The amount of observable diversity in our world is astounding. From the people

we interact with on a daily basis to the model organisms that we use in the lab, we are

surrounded by diversity. One of the central goals of biology has been to understand how

this diversity is produced. In 1869, Friedrich Miescher first described nuclein which he

isolated from the nuclei of white blood cells. Sixty years later, in 1928, Frederick

Griffith discovered the transformative properties of mixing killed virulent bacteria with

non-virulent bacteria, showing that virulence could be transferred via the genetic material

to innocuous strains of bacteria. Although disputed for years by Linus Pauling and others

who favored protein as the genetic material, Avery, MacLeod, and McCarty showed that

deoxyribonucleic acid (DNA) conferred virulence in Griffith’s 1928 work. The

discovery of the genetic material, its crystal structure, and the development of the central

dogma provided the basis for understanding how the genetic material contributes to

diversity.

Though scientists knew that DNA, its replication or copying, and its conversion

into ribonucleic acid (RNA) were regulated processes, the importance of this regulation

in controlling diversity could not be fully appreciated until the sequencing of multiple

genomes. In September of 2005, Nature magazine published the comparison of the

Human and Chimpanzee genome sequences. It was found that although chimps and

humans differ significantly in appearance, they only differ on the genetic level by 1.23%

(Consortium, 2005). This fact shed significant light on the importance of the regulation

of gene expression and put its associated fields in the spotlight. Since these early

discoveries, chromatin packaging, epigenetics, and transcription regulation have been

invaluable in helping to explain how genetically similar animals can appear so distinctly

different.

2

The molecular biology and biochemistry behind transcription, or the conversion

of the DNA message into RNA, has been studied for decades. The focus of many of the

early studies in this field has been on initiation, or how the polymerase is loaded onto the

promoter. Research on the important factors controlling transcription elongation and

termination has lagged behind as a result. More recently, the discovery that the majority

of actively transcribed genes have RNA polymerase II (RNAPII) poised just downstream

of their promoters has added a level of complexity to gene expression that was previously

underappreciated by many in the transcription field (Guenther et al., 2007; Muse et al.,

2007; Zeitlinger et al., 2007). RNAPII elongation control is now recognized as an

important regulatory step in gene expression and not as an artifact of in vitro transcription

assays or a special case at the HSP70 promoter (Rasmussen and Lis, 1993).

The RNA Polymerases

There are three major RNA polymerases in the cell and each performs specific

functions. RNA polymerase I localizes to the nucleolus of the nucleus and transcribes the

28S, 5.8S, and 18S ribosomal RNAs required for the assembly of the ribosome. RNA

polymerase III is responsible for the transcription of the transfer RNAs, 5S ribosomal

RNA, many of the small nuclear RNAs (snRNA) including 7SK, and the splicing RNAs.

The focus of this thesis will be on the steps that lead to the regulation of RNA

polymerase II, which is responsible for the transcription of microRNAs, some snRNAs,

and protein coding mRNAs.

RNAPII is a 550kD protein complex composed of 12 subunits. The two largest

subunits of eukaryotic RNAPII (RPB1 and RPB2) make up the bulk of the protein

complex, and RPB1 contains an essential Carboxyl Terminal Domain (CTD) that is

critical for regulation and cell viability (Darst et al., 1991; Meredith et al., 1996).

RNAPII catalyzes the production of mRNA through three distinct phases: initiation,

3

elongation, and termination. Each phase of transcription is thought to be a highly

regulated process requiring the concerted efforts of multiple protein complexes.

Transcription Initiation

Localizing RNAPII to gene promoters is a complicated process. Its recruitment is

dependent on a variety of factors. Cis acting elements in the DNA sequence are

important for recruiting transcription factors (trans acting factors) to enhancer elements

(Szutorisz et al., 2005). A well studied studied cis acting element is the TATA box that

is recognized by TATA binding protein (TBP) and is located approximately 25 base pairs

(bp) upstream of the transcription start site (TSS) (Comai et al., 1992; Cormack and

Struhl, 1992; Killeen et al., 1992). Other enhancer sequences can be found very far away

from TSSs and are important for opening chromatin, recruiting activator proteins, and

regulating initiation complex formation (Woychik and Hampsey, 2002).

TBP and TBP associated factors (TAFs) make up Transcription Factor for

polymerase II D (TFIID) which is the first protein complex involved in forming the pre-

initiation complex that recruits RNAPII to the promoter. TFIID is then joined by a host

of transcription factors including TFIIA and TFIIB which stabilize the interaction of

TFIID with the TATA box (Conaway and Conaway, 1993). TFIIF then recruits RNAPII

to this growing complex. TFIIE and TFIIH join the complex at the same time. TFIIH

contains the cyclin dependent kinase (CDK), CDK7/CyclinH, and a DNA helicase

required for the synthesis of the first 8-12 nucleotides (Conaway and Conaway, 1993).

CDK7 plays an important role in regulating RNAPII by phosphorylating Serine 5 of the

heptapeptide repeat YSPTSPS of the RNAPII CTD (Roeder, 1996). This results in

promoter clearance, the synthesis of the first 30-50 bases of the transcript, and RNA

capping by the capping enzyme which adds a protective 7-methylguanosime (m7G) cap to

the nascent RNA.

4

RNAPII Transcription Elongation Control

After promoter clearance, RNAPII comes under the control of Negative

Transcription Elongation Factors (N-TEFs) that cause the promoter proximal pausing of

RNAPII. The founding member of the N-TEFs is DRB Sensitivity Inducing Factor

(DSIF) which was first discovered while studying the effects of the ATP analog 5,6-

Dichloro-1-β-D-ribofuranosylbenzimidazole (DRB) on RNAPII. It had been known for

decade that treatment of cells with DRB resulted in the stalling of RNAPII in in vitro

transcription reactions with crude extracts, but this drug had no effect on purified

RNAPII (Chodosh et al., 1989). The protein responsible for this activity, DSIF, was

finally found by fractionating HeLa nuclear extract and then adding those fractions to

purified RNAPII until a DRB sensitive fraction was discovered (Wada et al., 1998a).

DSIF is composed of spt4 and spt5 and has functional homologues through yeasts

(Peterlin and Price, 2006). It was not long after that a second factor, Negative

ELongation Factor (NELF), involved in promoter proximal pausing was discovered and

later shown to be required for the negative effects of DSIF (Renner et al., 2001;

Yamaguchi et al., 1999). Promoter proximal pausing provides the cell with a significant

point for gene expression regulation (Figure 1A).

The negative effects of DSIF and NELF can be reversed by the Positive

Transcription Factor (P-TEF) P-TEFb that is a kinase composed of one of three cyclins

(cyclin T1, cyclin T2, or cyclin K) and one of two cyclin dependent kinases (CDK9 or a

larger isoform CDK955). P-TEFb, which was discovered by adding fractionated

Drosophila Kc cell lysates back to purified elongation complexes to reconstitute DRB

sensitive transcription, alleviates the stall on the paused polymerase and phosphorylates

the CTD of RNAPII on Serine 2 of the heptapeptide repeat (Marshall and Price, 1995).

Phosphorylation of the NELF-e subunit of NELF by P-TEFb causes NELF to leave the

elongation complex and phosphorylation of the spt5 subunit of DSIF by P-TEFb turns

DSIF from a negative factor into a positive factor (Ping and Rana, 2001; Wada et al.,

5

1998b) (Figure 1A). After P-TEFb function, TFIIF rebinds the freed polymerase to

stimulate transcription elongation (Cheng and Price, 2007).

As RNAPII elongates and synthesizes RNA, it produces a number of distinct

regions. The 5′ untranslated region (UTR) is a stretch of RNA between the cap structure

and the translation start site. The polymerase continues through the coding sequence

(CDS) that is defined by the translation start and stop sites. The polymerase continues to

synthesize RNA and produces the 3′ UTR. Both the 5′ and 3′ UTRs of messenger RNA

(mRNA) have been shown to be important for the regulation of translation as targets of

both proteins and microRNAs that modulate protein translation. Finally, the polymerase

transcribes a poly adenylation signal that results in the addition of a poly(A) tail.

Transcription Termination and 3′ End Formation

Transcription termination is the process in which the RNAPII releases both the

polymerase and the RNA transcript from the DNA template. This process is not well

understood in eukaryotes. An ATP dependent SWI/SNF family protein, transcription

termination factor 2 (TTF2) has been described and is involved in terminating

polymerases before entry into mitosis (Jiang et al., 2004). The role of TTF2 in general

transcription termination has not been explored further. There is also evidence that

RNAPII termination in yeast may be caused by an RNA helicase, Sen1p and the

nucleases Rat1p and Rnt1p, that scan the RNA until they encounter the polymerase and

cause it to dissociate from the DNA template; however, this torpedo model of termination

is controversial (Kawauchi et al., 2008).

Although the exact process of RNAPII termination is not well understood, it is

thought to be linked to 3′ end formation (Bentley, 1999; Neugebauer, 2002). Most

protein coding mRNA contains a poly(A) tail that is important for mRNA stability,

promotes nuclear export and is required for efficient translation of the message by the

ribosome. 3′ end formation is catalyzed by the cleavage-polyadenylation specificity

6

factor (CPSF) that scans the nascent RNA for its binding recognition sequence,

AAUAAA. This results in the recruitment of cleavage stimulation factor (CstF),

cleavage factors I and II, and poly(A) polymerase which cleave the nascent transcript

near the CPSF binding recognition sequence and catalyze the addition of the poly(A) tail

(Zorio and Bentley, 2004). The fate of the polymerase after this cleavage is not known,

but it is assumed to be terminated.

Additionally, termination in the classical prokaryotic sense may not occur in

eukaryotes. A new theory has emerged that suggests the 5′ and 3′ ends of the DNA

coding sequence may form loops, much like the loops formed by mRNA to increase

ribosome translation efficiency (Ansari and Hampsey, 2005; O'Sullivan et al., 2004;

Perkins et al., 2008). This would provide an elegant mechanism for the reloading of

polymerase at the TSS.

Regulation of P-TEFb by the 7SK snRNP

Controlling the fate of RNAPII is extremely important for gene regulation. This

is highlighted exquisitely in cancers in which many oncogenes lead to the deregulation of

transcription by removing repressors and taking advantage of activators to promote

cellular proliferation. The recent finding that a large number of actively transcribed

genes have poised polymerases (Guenther et al., 2007; Muse et al., 2007; Zeitlinger et

al., 2007) underscores the importance of tightly controlling the only known factor

implicated in releasing the polymerase from this poised state, P-TEFb.

P-TEFb is present in two forms within the nucleus: the small active form that is

involved in phosphorylating the CTD of RNAPII, and the large inactive form that is

comprised of P-TEFb, HEXIM1 or HEXIM2, and the small nuclear RNA (snRNA) 7SK

(Byers et al., 2005; Yik et al., 2003) (Figure 1B). HEXIM, or hexamethylene-bis-

acetamide-inducible, was first discovered as a protein whose expression increased

dramatically after treatment of cells with HMBA (Kusuhara, 1999), but later it was

7

shown to be the P-TEFb inhibitory protein (Yik et al., 2003). Both HEXIM and the

CyclinT1 subunit of P-TEFb are capable of binding 7SK; however, binding of P-TEFb to

7SK without HEXIM is not sufficient for inhibition in vitro (Michels et al., 2003; Yik et

al., 2003). It is believed that HEXIM and 7SK form an inhibitory complex with P-TEFb

to prevent aberrant activation of RNAPII transcription and to serve as a readily accessible

pool that can be activated during times of stress (Nguyen et al., 2001). After P-TEFb

release, HEXIM leaves the complex and the RNA is protected from degradation by the

binding of hnRNP proteins (Krueger et al., 2008; Van Herreweghe et al., 2007) (Figure

1B).

How regulated release of P-TEFb from the 7SK snRNP occurs is not understood.

Phosphorylation of threonine 186 on CDK9 is required for P-TEFb to complex with 7SK

(Chen et al., 2004), and while dephosphorylation would likely lead to the release of P-

TEFb from the large complex (Chen et al., 2008), it would be catalytically inactive. It

has also been suggested that activation of the PI3K/Akt pathway by HMBA treatment of

cells results in the release of P-TEFb from the 7SK snRNP through the phosphorylation

of HEXIM1(Barboric et al., 2007; Contreras et al., 2007). Finally, acetylation of P-TEFb

also appears to be a hallmark of free active P-TEFb and may play an important role in

release (Cho et al., 2009). The current body of literature provides evidence that post-

translational modifications are important for releasing P-TEFb from the 7SK snRNP to

activate transcription; however, specific extraction of P-TEFb from this complex is also a

possibility.

Gene Specific Regulation of Transcription by P-TEFb

The discovery of P-TEFb has been significant for many reasons. RNAPII

elongation control has since emerged as an important stage in regulating gene expression.

P-TEFb is likely to be intricately regulated during development, stress responses, and

disease states (Peterlin and Price, 2006). Although P-TEFb appears to be required as a

8

general transcription factor, cases of gene specific regulation by P-TEFb are known. The

first of these was the discovery that P-TEFb was the HIV-Tat associated kinase (TAK)

(Zhu et al., 1997). Human immunodeficiency virus (HIV) expresses a small 15 kD

protein Trans-Activator of Transcription (Tat) which is required for HIV replication

(Frankel, 1992; Laspia et al., 1989). Tat expression and recruitment of P-TEFb to the

HIV long terminal repeat (LTR) are required for the vast increase in HIV RNA that is

seen during HIV virulency. Tat binds specifically to CyclinT1 of P-TEFb through a zinc

binding domain and recruits P-TEFb to the HIV LTR by binding to a viral RNA stem

loop, the Trans-Activation Response element (TAR) (Dingwall et al., 1990; Dingwall et

al., 1989). HIV, however, is not the only virus that takes advantage of P-TEFb. Human

T-lymphotropic virus (HTLV) has been shown to encode a transcriptional activator (Tax)

that functions similarly to Tat by binding to a region in CyclinT1 of P-TEFb and

recruiting it to the HTLV viral promoter (Rosenblatt et al., 1988; Zhou et al., 2006).

Gene specific regulation is not limited to viral high-jacking of P-TEFb. Other

endogenous transcription activators have been shown to associate with and recruit P-

TEFb specifically to RNAPII promoters. These include the p65/RELA subunit of nuclear

factor kappa-light-chain-enhancer of activated B cells (NF-κB), class II major

histocompatibility complex transactivator (CIITA), the transcription factor Myc, the

myogenic regulatory factor MyoD, and a number of nuclear receptors including the

androgen receptor (Lee and Chang, 2003; Lee et al., 2001), and estrogen receptor

(Wittmann et al., 2005). All of these interactions act to recruit P-TEFb to sites of

transcription and activate RNAPII. A bromodomain protein, Brd4, has also been

discovered that binds to CyclinT1 and recruits P-TEFb to sites of acetylated and

potentially active chromatin (Jang et al., 2005; Yang et al., 2005). It seems likely that

these activator proteins serve as the link between transcription initiation and elongation.

Their role as P-TEFb recruiters is important; however, a more general mechanism for

9

P-TEFb release and recruitment outside of this small subset of special cases is still

elusive.

P-TEFb Regulation and Associated Diseases

The association of P-TEFb with disease is not surprising given its tissue

expression profile and connections with cellular differentiation. P-TEFb is highly

expressed in terminally differentiated tissues such as brain and muscle, but is also found

in proliferating cells (Bagella et al., 1998). It has been shown to be an important factor in

regulating the differentiation of neuronal, muscle and lymphocytic cells (Marshall and

Grana, 2006). The role of P-TEFb during embryonic development is also likely to be

important and highly regulated. Receptor specific regulation of P-TEFb has also been

described for tumor necrosis factor (TNF) and interleukin-6 (IL-6) implicating P-TEFb as

a central player in inflammation and cell growth and survival (Brasier, 2008; Falco et al.,

2002; Hou et al., 2007; Shan et al., 2005).

Cancerous transformation of cells is typically accompanied by deregulation and

over-expression of anti-apoptotic and pro-survival proteins. The use of flavopiridol, a

potent inhibitor of CDK9, in phase II clinical trials is an indication of the importance of

P-TEFb in both transcription and cancer. Inhibition of P-TEFb is associated with

hypophosphorylation of the CTD of RNAPII and p53 dependent apoptosis in chronic

lymphocytic leukemia (CLL) (Alvi et al., 2005) and other leukemia cells (Gao et al.,

2006). Inhibition of P-TEFb will be relevant for a wide variety of cancers because P-

TEFb has been shown to be associated with both Myc and NF-κB (Shapiro, 2006).

Finally, P-TEFb is implicated in both prostate and breast cancer due to its association

with the androgen receptor (Lee and Chang, 2003; Lee et al., 2001) and estrogen receptor

(Wittmann et al., 2005).

The importance of P-TEFb in HIV and HTLV was discussed earlier in this

chapter, but it is also significant to note that other viruses take advantage of P-TEFb.

10

EBNA2 of Epstein-Barr Virus (EBV) has been shown to be dependent on the CTD kinase

activity of P-TEFb. Both expression of a dominant negative version of CDK9 or

treatment of EBV infected cells with DRB results inhibition of EBV viral gene

expression (Bark-Jones et al., 2006). Additionally, VP16 of herpes simplex virus has

been shown to interact directly with CyclinT1 and may be important for recruiting P-

TEFb to herpes virus promoters (Kurosu and Peterlin, 2004).

Myocardial infarction, or heart attack, is a leading cause of death in developed

countries with 1 in 5 at risk of suffering a heart attack in the United States alone. Since

cardiac myocytes are terminally differentiated, they do not proliferate after enduring

stress, they become larger or hypotrophic. The molecular hallmarks of cardiac

hypertrophy include an increase in cell size and a dramatic increase in both RNAPII

transcription and cellular mRNA content. As a result, it seems obvious that P-TEFb

would be closely associated with cardiac hypertrophy (Sano et al., 2002; Sano and

Schneider, 2004; Sano et al., 2004). Activation of P-TEFb using anti-sense 7SK in

cardiac cell cultures or heart specific over expression of P-TEFb in mice recapitulated the

effects seen in mice in which cardiac infarction was induced (Sano and Schneider, 2004).

Furthermore, the mouse cardiac lineage protein-1 (CLP-1) that was shown to be

important for regulating cardiac hypertrophy in mice actually turned out to be the mouse

homologue of human HEXIM1 (Huang et al., 2002). Mice with a CLP-1/HEXIM1

knockout die early in fetal development and show all of the genetic and physical

characterisitcs of cardiac hypertrophy (Huang et al., 2004).

The association of P-TEFb with at least two major causes of death in the

developed world (heart disease and cancer) and one in the developing world (HIV), make

it a medically relevant protein complex. Further study of P-TEFb, its activation, and

regulation of transcription are essential for understanding the pathogenesis these diseases.

11

Focus of the Thesis

The goal of the research presented in this thesis is to better understand how the

7SK snRNP regulates P-TEFb and gene expression. Chapter 2 describes the discovery

and characterization of the 7SK stability protein, La related protein 7 (LARP7). These

data show that LARP7 is one of the only proteins that remains associated with 7SK after

P-TEFb and HEXIM1 are released. Loss of LARP7 also results in an increase in free P-

TEFb and a significant reduction in the amount of 7SK in the cell. These results indicate

that the maintenance of the 7SK snRNP is important for transcription regulation and

survival.

In Chapter 3, the conservation of the 7SK snRNP is explored by characterizing

the Drosophila melanogaster homologues of LARP7 and 7SK. These studies show that

the system of P-TEFb regulation is similar in flies and this model system may be useful

in characterizing the role of P-TEFb in development.

In Chapter 4, factors and modifications involved in releasing P-TEFb are

explored. Using the LARP7 antibody developed for the studies conducted in Chapter 2,

an assay was developed for discovering proteins that can bind to and release P-TEFb

from the 7SK snRNP. This assay shows that post-translational modifications of P-TEFb

including phosphorylation of HEXIM and acetylation or dephosphorylation of P-TEFb do

not cause P-TEFb release directly. However, addition of HIV Tat, or the C-terminal

region of Brd4 are capable of extracting P-TEFb in this in vitro assay. Most importantly,

the release of P-TEFb is followed by a conformational change in 7SK RNA that prevents

the continued binding of HEXIM1 to the complex.

Finally, in Chapter 5 a summary of the significant findings is presented and future

directions are discussed.

12

Figure 1: Model of transcription elongation control and P-TEFb regulation

A) A model of transcription elongation highlighting both abortive elongation and

productive transcription elongation. After the polymerase initiates and is phosphorylated

on Ser5 by TFIIH it comes under the negative regulation of DSIF and NELF. If this

stalled polymerase is not released, transcription aborts and produces short transcripts. If

the kinase P-TEFb acts on the stalled polymerase, it phosphorylates Ser2 of the CTD, the

spt5 subunit of DSIF, and the NELF-e subunit of NELF. This results in the conversion of

DSIF from a negative factor to a positive one and the loss of NELF from the complex.

The polymerase is then released from the pause and enter productive transcription

elongation. B) P-TEFb is regulated in the cell by a cycle of inhibition by and release

from a small ribonuceloprotein complex in the nucleus. This complex is composed of the

small nuclear RNA 7SK, the major inhibitory protein HEXIM which mediates the

interaction of P-TEFb with the RNP, the stability protein LARP7, and finally the methyl

phosphate capping enzyme which adds a methyl cap to 7SK RNA and remains bound to

the complex to provide further stability. After P-TEFb is released from the 7SK snRNP,

HEXIM leaves the complex and the RNA is then bound by a variety of hnRNP proteins.

14

CHAPTER 2

LARP7, A NOVEL COMPONENT OF THE 7SK SNRNP STABILIZES

7SK SNRNA IN HUMAN CELLS

Regulated inhibition of P-TEFb is important for control of RNAPII transcription

elongation. P-TEFb exists in two distinct protein complexes in the cell: one that is

composed of free active CyclinT1 and CDK9 and the other in which these proteins are

bound to and inhibited by the 7SK snRNP. The goal of the research presented in this

chapter was to discover new proteins that were bound to and potentially regulate P-TEFb

release. Through a collaboration with Benoit Coulombe (Institut de recherches cliniques

de Montréal), the La Related Protein 7 (LARP7) was discovered as component of the

7SK snRNP. To confirm and further characterize this interaction, a LARP7 antibody was

developed in sheep and analyses were performed to determine the association and role of

LARP7 as a component of the 7SK snRNP. It was discovered that LARP7 co-sediments

with the 7SK snRNP and remains associated with this complex after P-TEFb release.

Co-immunoprecipitation experiments showed that LARP7 is associated with all of the

known components of the 7SK snRNP and LARP7 mediates the interaction with this

complex by binding directly to 7SK. Loss of LARP7 through siRNA knockdown

resulted in a significant decrease in 7SK snRNA and P-TEFb highlighting its importance

in maintaining the stability of the 7SK snRNP.

Introduction

P-TEFb performs an essential function in regulating the transcription of cellular

genes. Its activity is controlled by a small nuclear ribonucleoprotein complex composed

of a 332bp small nuclear RNA, 7SK (Nguyen et al., 2001; Yang et al., 2001), and the

RNA binding proteins HEXIM1 and/or HEXIM2 (Byers et al., 2005; Yik et al., 2005).

HEXIM alone is not sufficient to inhibit P-TEFb and requires RNA to cause a

conformational change in HEXIM to open up its P-TEFb binding pocket (Li et al., 2007).

15

Prior to 2007, the only known components of the 7SK snRNP were 7SK, HEXIM,

and P-TEFb; however, there was significant evidence that other proteins were likely

involved in binding to this complex. In the original classification of 7SK, Wassarman

and Steitz showed that the 7SK snRNP contained at least 5 proteins ranging in size from

40 – 120kD. We can speculate that CyclinT1 (~120kD), CDK9 (~40kD), and HEXIM1

(~60kD) account for 3 of these proteins (Wassarman and Steitz, 1991). To identify the

other proteins bound in this complex, we entered into a collaboration with Benoit

Coulombe who was conducting experiments to determine the transcription and RNA

processing proteome. He accomplished this using tandem affinity purification tagging

(TAP-tagging) of proteins coupled with tandem mass spectrometry to determine protein

interaction networks. The first screen discovered a number of very interesting proteins.

This initial experiment identified a methyl transferase that was tightly associated with

CDK9, CyclinT1, and HEXIM (Jeronimo et al., 2007). It was originally thought that this

methyl transferase would be important for modifying histones, but it was later discovered

that it added the special mono-methyl-guanosine cap to the γ-phosphate of 7SK RNA.

This factor was renamed the methyl phosphate capping enzyme because of its capping

activity (MePCE) (Jeronimo et al., 2007). This screen also identified a La related

protein, LARP7, associated with P-TEFb and HEXIM. Considering the fact that 7SK

RNA is the product of RNAPIII, it seemed fitting that a La related protein might be

helpful in stabilizing the 7SK snRNP and protecting the RNA from decay.

Autoantigen La was first identified as a highly expressed RNA binding protein

(Wolin and Cedervall, 2002). Human La protein is involved in the stabilization and

maturation of many RNAPIII transcripts (Rinke and Steitz, 1982; Rinke and Steitz,

1985). The primary function of La is to bind to the 3′ UUU-OH of RNAPIII RNAs after

transcription termination and protect them from degradation by exonucleases (Reddy et

al., 1983; Saito et al., 1994; Stefano, 1984). Modification of the 3′ UUU-OH results in

the release of La from the transcript (Stefano, 1984). La is also known to bind to the 5′

16

end of newly synthesized RNAPIII RNAs; however, removal of the triphospahte or the

addition of a methyl group decreases the affinity of La for these transcripts

(Bhattacharya et al., 2002; Fan et al., 1998; Intine et al., 2000; Maraia and Intine, 2001).

Which La domains specifically bind to each of these structures is not known, but it is

thought that the La-motif and first RNA Recognition Motif (RRM) are responsible

(Goodier et al., 1997; Ohndorf et al., 2001). La has also been credited with aiding in

nuclear retention of snRNAs and their assembly into functional RNP complexes (Boelens

et al., 1995; Grimm et al., 1997; Pannone et al., 1998; Simons et al., 1996; Xue et al.,

2000). The diverse roles that La plays in RNAPIII RNA maturation are intriguing when

considering how LARP7 may be involved in protecting 7SK or regulating P-TEFb

release from the 7SK snRNP.

Materials and Methods

Generation and Affinity Purification of LARP7 Antibodies

Human LARP7 was cloned into pET21a (Novagene) from MGC clone 87333

with a C-terminal histidine tag. The clone was transformed into Escherichia coli BL21

CodonPlus (DE3) RILX cells (Stratagene). Cells were grown to an OD of .500 and then

induced overnight at 18oC with 0.1mM IPTG. Purification was carried out by sonicating

the cells, spinning out any large insoluble material at 200 x g for 45 minutes in a

Beckmann Ultracentrifuge, and binding the expressed protein to Ni-NTA resin. The

protein eluted from the nickel resin was then further purified by fast protein liquid

chromatography (FPLC) over a mono S column. One fraction from the Mono S elution

which contained a single 38kD C-terminal LARP7 proteolysis product was used as an

antigen to generate sheep antibodies (Elmira Biologicals). LARP7 antibodies were then

affinity purified by covalently attaching LARP7 antigen to Actigel ALD beads

(Sterogene) according to the manufacturer’s recommendation for antibody affinity

17

purification. Sheep serum was bound to this column and then affinity purified antibodies

were eluted with Tris-glycine buffer.

Glycerol Gradient Sedimentation Analysis

HeLa cells were grown to 90% confluence in T-150 flasks. Half of the flasks

were then treated for 1 h with 500 nM flavopiridol while the other half were mock treat

with 0.004% DMSO carrier. Cells were then harvested, washed, lysed with a buffer

consisting of 10 mM HEPES, 150 mM NaCl, 2 mM MgCl2, 10 mM KCl, 0.5% NP-40,

0.5 mM EDTA, 1 mM DTT, 0.1% PMSF, 1U/mL Roche EDTA free complete protease

inhibitor cocktail, and 10U/mL RNaseOut (Invitrogen) and subjected to glycerol gradient

fractionation over a 5%-45% glycerol range. This was done by overnight (16 h)

ultracentrifugation at 200xg in a Beckmann Ultracentrifuge. Gradients were then

fractionated in to 16 fractions and resolved by 9% SDS-PAGE followed by transfer to

nitrocellulose membranes.

Western Analysis

After transfer to nitrocellulose, the membranes were cut and incubated in 0.1%

tween PBS and 3% milk overnight at 4oC with the appropriate primary antibodies.

Membranes were then washed 3 times in 0.1% tween PBS and incubated with

horseradish peroxidase-conjugated secondary antibody (Sigma). The membranes were

treated with Super Signal Dura West Extended Duration Substrate (Pierce) and imaged

using a cooled charge-coupled camera (UVP).

The antibodies used for western analysis were: sheep anti-cyclin T1, rabbit anti-

CDK9 (sc-8338; Santa Cruz Biotechnology), affinity-purified sheep anti-HEXIM1, rabbit

anti-MEPCE, and affinity-purified sheep anti-LARP7.

18

Immunoprecipitation

Fractions 8-11 of control and flavopiridol-treated glycerol gradients were pooled

because they contain the majority LARP7 and the P-TEFb containing 7SK snRNP.

Affinity purified LARP7 antibodies were covalently attached to actigel ALD beads

(Sterogene) according to the manufacturer’s instructions for immunoprecipitation. The

pooled glycerol gradients were pre-cleared with beads alone at 4oC for 1 h. The flow

through was then added to the beads bound with affinity purified LARP7 antibody or to

beads alone and rotated for 1 h at 4oC. The beads were washed with IP wash buffer (10

mM HEPES, 2 mM MgCl2, 10 mM KCl, 0.1% NP-40, 0.5 mM EDTA, 150 mM NaCl.

Trizol reagent (Invitrogen) was added directly to the beads to extract immunoprecipitated

7SK according to the manufacturer’s protocol. Extracted RNA was resolved on a

denaturing 6% TBE acrylamide RNA gel, ethidium bromide (EtBr) stained, and

visualized on the UVP system. RNAs were transferred from the acrylamide gels to 0.2

µm Nytran N nylon membranes (Whatman) and then blocked for 1 hour at 65°C in

Ultrahybe Hybridization Buffer (Ambion). An RNA oligo for 7SK was then

radioactively labeled using PNK and γ-P32-ATP and added to the hybridization buffer

and incubated overnight at 65°C. Membranes were visualized using a Packard

InstantImager and also exposed to film.

Co-Immunoprecipitation of LARP7 associated proteins was similar; however,

protein G Sepharose beads (Sigma) were used as the immunoprecipitation media. After

immunoprecipitation, beads were resuspended in SDS loading buffer and boiled for 10

minutes at 100°C to release the bound protein from the beads. The immunoprecipitated

proteins were resolved, westerned and probed with LARP7, CDK9, MePCE, and

HEXIM1 antibodies as described above.

19

Small Interfering RNA Knockdown of LARP7 and MePCE

LARP7-specific siRNA (custom synthesized by Integrated DNA Technologies),

MEPCE-specific siRNA and control siRNA (Dharmacon siCONTROL Non-targeting

pool) were transfected into HeLa cells using Lipofectamine 2000 according to the

manufacturer’s instructions. Cells were then harvested 72 h post-transfection and

subjected to glycerol gradient analysis.

Electrophoretic Mobility Shift Assay

0, 10, or 30 ng of recombinant LARP7 was combined in binding buffer (25 mM

HEPES pH 7.6, 15% glycerol, 60 mM KCl, 0.1 mM EDTA, 5 mM DTT, 0.01% NP-40,

100 ng/mL BSA, 200 ng/rxn yeast tRNA) with 1 ng α-32P-UTP labeled 7SK for 20

minutes at room temperature and then resolved on a 4% native Tris polyacrylamide gel.

7SK was transcribed in vitro from a cut pCR2.1 (Invitrogen) template driven by a T7

promoter using T7 polymerase (Stratagene) in the presence of α-32P-UTP.

Results

LARP7 Co-sediments with the 7SK snRNP

Although our collaborators discovered that LARP7 was associated with TAP-

tagged CDK9, CyclinT1, HEXIM1, HEXIM2, and MePCE, these associations do not

prove an endogenous physical interaction. To facilitate the analysis of endogenous

LAPR7, it was expressed in E. coli and purified to generate an antibody (Figure 2A).

This highly specific affinity purified antibody detects a band near the predicted molecular

weight (70kD) of LARP7 (Figure 2B). To analyze the potential association of LARP7

with the 7SK snRNP, glycerol gradient analysis was performed to determine if it co-

sediments with the 7SK snRNP. HeLa cells were either mock treated with DMSO carrier

or with 500 nM flavopiridol for 1 h. Flavopiridol is a potent inhibitor of P-TEFb that

leads to the inhibition of RNAPII transcription and the subsequent release of P-TEFb and

20

HEXIM from the 7SK snRNP. Flavopiridol causes the release of P-TEFb from the 7SK

snRNP by inhibiting transcription. This sets up a cycle of release of P-TEFb from the

7SK snRNP that results in the eventual depletion of P-TEFb from the complex because as

P-TEFb is released it is inhibited from activating transcription. Flavopiridol inhibits

P-TEFb because it has a similar backbone ring structure to ATP and binds tightly to

Cdk9. As has been previously shown in untreated cells, P-TEFb (CyclinT1 and CDK9)

and about 10% of the HEXIM1 were found associated with the 7SK snRNP (Fractions 9-

11) (Figure 3A). Half of the 7SK capping enzyme, MePCE, appears to co-sediment with

the 7SK snRNP. This is not surprising because it is implicated in capping U6 snRNA

and could potentially be associated with other snRNPs that it targets for capping. Finally,

LARP7 completely co-sedimented with the large molecular weight P-TEFb and HEXIM1

complex indicating that it is a component of the 7SK snRNP (Figure 3A). Treatment of

the cells with flavopiridol led to the expected release of P-TEFb and HEXIM1; however,

LARP7 and MePCE remained in the large molecular weight complex. Interestingly,

LARP7 appeared to shift down the gradient (become heavier) by one fraction (Figure

3B).

To determine if the sedimentation pattern of LARP7 is consistent with it

maintaining an association with 7SK before and after the release of P-TEFb, RNA was

extracted from the glycerol gradient fractions and analyzed by northern and ethidium

bromide staining. Confirming the western results of P-TEFb and HEXIM, 7SK was

found in the high molecular weight fractions 8-14 (Figure 4A). However, after treatment

with flavopiridol, 7SK shifted about one fraction down the gradient (became heavier),

mimicking the results obtained for LARP7 after flavopiridol treatment (Figure 4A). To

be sure that the changes observed in 7SK and LARP7 were not due to differences in the

overall sedimentation of the gradients, the sedimentation pattern of 3 other RNAs (U6,

7SL, and an undetermined species) in the gradients were compared using ethidium

bromide staining. The sedimentation pattern of these other RNAs did not change

21

between the two treatments, but 7SK did, confirming that the changes observed in

LARP7 and 7SK are due to a specific change in the 7SK snRNP (Figure 4B). These

results suggest that LARP7 is a component of the 7SK snRNP and remains associated

with 7SK even after P-TEFb and HEXIM dissociate.

LARP7 is a Stable Component of the 7SK snRNP

Although the glycerol gradient sedimentation experiments strongly suggested that

LAPR7 was a component of the 7SK snRNP, they do not provide evidence of a direct

interaction with the complex. To determine if LARP7 is actually a component of the

RNP, co-immunoprecipitation experiments were carried out. Glycerol gradient fractions

8-11, which contain most of the LARP7, were pooled from the flavopiridol treated or

untreated cells and then passed over naked immunoprecipitation beads or beads that were

bound with affinity purified LARP7 antibody. Both northern and ethidium bromide

analysis show that 90% of the 7SK in these fractions was immunoprecipitated regardless

of the presence of P-TEFb and HEXIM1 (Figure 5A). The immunoprecipitation of 7SK

was highly specific and is supported by the fact that the other RNAs found in these

fractions are unaffected by the immunoprecipitation conditions (Figure 5A, ethidium

bromide). Immunoprecipitation of LARP7 also resulted in the immunodepletion of both

CDK9 and HEXIM1 from the control glycerol gradient fractions. As expected, CDK9

and HEXIM1 were absent in the immunoprecipitations done from the flavopiridol treated

cells (Figure 5A, western). A small fraction of MePCE was associated with the LARP7

immunoprecipitation before and after flavopiridol treatment; however, flavopiridol

treatment did appear to cause less MePCE to be associated with LARP7 and 7SK (Figure

5A, western).

Though LARP7 is a La related protein and it is assumed that LARP7 interacts

directly with 7SK, co-immunoprecipitations do not prove this interaction. To determine

if LARP7 binds directly to 7SK, a rotation student, Courtney Searcey-Galle, performed

22

an in vitro electrophorectic mobility shift assay using recombinant human LARP7 protein

and radioactively labeled 7SK RNA as a probe (Figure 5B). As increasing amounts of

LARP7 protein were added to the reactions, two LARP7 mobility shifts became apparent.

This could be due to a single LAPR7 protein binding to more than one molecule of 7SK,

or more than one molecule of LARP7 being bound to a single molecule of 7SK. These

results show conclusively that LARP7 binds directly to 7SK RNA.

Knockdown of LARP7 Disrupts the 7SK snRNP

Since LARP7 is a La related protein, it was thought that it would be important for

the stability of the 7SK snRNP. To determine the effect of the loss of LARP7 on the

stability of the 7SK snRNP, LARP7 was knocked down using small interfering RNA

technology. Our collaborators explored the direct effects of LARP7 knockdown on 7SK

levels in the cell and found that LARP7 knockdown caused a 50% reduction in total 7SK

(Krueger et al., 2008). Since 7SK stability was significantly affected by LARP7

knockdown, the effect of this knockdown on the stability of 7SK snRNP was also

explored by glycerol gradient analysis. The effect of MePCE loss from the 7SK snRNP

was also determined because it has also been shown to be important for 7SK stability

(Jeronimo et al., 2007). Both LARP7 and MePCE were knocked down by ~70% (Figure

6A and B). Control and knockdown cell lysates were loaded onto glycerol gradients and

the fractionation pattern of CDK9 was analyzed by western. As was expected in control

cells, CDK9 appeared in the high molecular weight fractions (9-11) associated with the

7SK snRNP. After MePCE knockdown, slightly less CDK9 was found in the 7SK

snRNP with a detectable increase in the amount of free P-TEFb in fractions (4-6).

LARP7 knockdown had a much more dramatic effect on increasing the amount of free P-

TEFb found in the cell (Figure 6C). Although the relative amount of free CDK9

increased, the total amount of CDK9 in the gradients appeared to decrease significantly.

To explore this overall reduction further, LARP7 was knocked down with increasing

23

amounts of siRNA and the levels of CDK9, CyclinT1, and HEXIM1 were determined.

As the amount of LARP7 decreased, so did the levels of CDK9 and CyclinT1 (Figure

6D). HEXIM1 levels were unaffected due to the fact that the majority of HEXIM1 in the

cell is not complexed with the 7SK snRNP. These results suggest that the cell possesses

a compensatory mechanism to regulate the overall level of free active P-TEFb.

Discussion

The experiments presented in this chapter demonstrate that LARP7 is a

component of the 7SK snRNP and functions to stabilize 7SK in the presence and absence

of P-TEFb and HEXIM1. Glycerol gradient sedimentation analysis and

co-immunoprecipitation experiments showed that LARP7 is associated with 7SK before

and after P-TEFb release. Knockdown of LARP7 resulted in an increase in free P-TEFb

and an overall reduction of P-TEFb and the 7SK snRNP. The apparent increase in

molecular weight of the 7SK snRNP is likely due to the replacement of P-TEFb and

HEXIM1 with hnRNP proteins (Krueger et al., 2008; Van Herreweghe et al., 2007). A

model of the current 7SK snRNP is provided in Figure 7B.

A bioinformatic analysis of LARP7 shows that of the 12 LARP proteins, it is the

most closely related to autoantigen La. Both La and LARP7 contain a La domain and an

associated RNA recognition motif (RRM1) (Figure 7A). Each also contains a second

RRM (RRM3), and at least in the case of LARP7 it is dispensable for 7SK binding (He et

al., 2008). La is responsible for binding to and protecting RNAPIII transcripts (Wolin

and Cedervall, 2002). It has been shown to be recruited to the 7SK promoter and also to

be associated with 7SK RNA (Fairley et al., 2005; Van Herreweghe et al., 2007). It is

likely that La passes 7SK off to LARP7 after 7SK maturation has occurred because La

loses its affinity for RNAs once they are capped and post-transcriptionally adenylated by

a terminal adneyl transferase (Bhattacharya et al., 2002; Chen et al., 2000; Sinha et al.,

1998). The affect of capping and adenylation on the affinity of LARP7 for 7SK has not

24

been determined, but it is estimated that greater than 70% of 7SK RNA is post-

transcriptionally adenylated on its 3′ end. LARP7 likely associates with the mature form

of 7SK RNA which represents a stark difference in function between LARP7 and La.

LARP7 association with 7SK may be an important control point for regulating the

release of P-TEFb from the 7SK snRNP. Human La protein association with RNAPIII

transcripts is regulated three separate ways. Modifications to either the 3′ or 5′ end of

RNA result in a reduced affinity of La for these targets (Bhattacharya et al., 2002; Chen

et al., 2000; Sinha et al., 1998). Additionally, phosphorylation of Ser366 has been shown

to decrease the ability of La to bind to target RNAs (Fan et al., 1997). It is possible that

the association of LARP7 with 7SK could be similarly regulated. The methylation state

of 7SK bound to LARP7 has yet to be determined. Methylation of 7SK by MePCE could

also regulate LARP7 binding to the 7SK snRNP. The ability of LARP7 to bind 7SK

could play a role in stabilizing or destabilizing conformations of 7SK that allow or

prevent binding of HEXIM and P-TEFb.

The LARP7 knockdown experiments highlight the importance of P-TEFb

homeostasis in the the cell. Recent work, including experiments done by the Coulombe

Lab, shows that the initial loss of the 7SK snRNP and increase in free P-TEFb results in a

~2 fold increase in expression of the HIV LTR (Krueger et al., 2008). It is important to

note that this level of HIV LTR activation is very low compared to what is typically

observed in transcription activation assays. Maintenance of proper P-TEFb activity is

further supported by the apparent compensation made by the cell to reduce the level of

free active P-TEFb after LARP7 knockdown. The exact mechanism employed to cause

this reduction was not followed up, but the decay is likely due to proteasome mediated

degradation because when P-TEFb is overexpressed in cells it is quickly ubquitinated and

degraded (Garriga et al., 2003; Kiernan et al., 2001). Degradation would explain the

slight increase in P-TEFb activity after LARP7 knockdown and also why loss of CDK9

and CyclinT1 was seen. Further, the idea that the cell regulates transcription by

25

maintaining a balance between free P-TEFb and inactivation in the 7SK snRNP is

supported by the previous observation that knockdown of CDK9 or CyclinT1 reduced the

total amount of P-TEFb but had little effect on cell viability or transcription activation of

a reporter gene (Chiu et al., 2004). In this case it was speculated that CDK9 and

CyclinT1 expression was upregulated or decay mechanisms were inhibited to maintain

the basal level of P-TEFb kinase activity required for survival. Similar results have also

been seen in cells treated with the differentiation inducing agent hexamethylene

bisacetamide (HMBA) in which an initial increase in free P-TEFb and kinase activity is

observed, but after long term treatment the cell compensates by reducing the total amount

of P-TEFb and shifting the equilibrium back to inactivation by the 7SK snRNP

(Contreras et al., 2007; He et al., 2006).

Maintenance of the 7SK snRNP by LARP7 appears to be important for the

molecular pathogenesis of certain forms of cancer. Mutations in LARP7 are associated

with both human gastric tumors and cervical cancer (Biewenga et al., 2008; He et al.,

2008; Mori et al., 2002). One study found that both the N-terminal La domain and the C-

terminal end containing RRM3 are specifically associated with gastric cancers (He et al.,

2008). Loss of the La domain would reduce the ability of LARP7 to bind and stabilize

the 7SK snRNP and loss of the C-terminal region may provide a potential role for RRM3

in 7SK binding specificity. Cancer cells activate the expression of pro-survival proteins

by altering the balance between active and inactive P-TEFb. In compromised cells, the

mechanisms in place to regulate normal P-TEFb homeostasis are also likely to be

impaired. Loss or deregulation of the 7SK snRNP through mutation of LARP7 provides

yet another mechanism for cancer cells to gain control of gene expression.

26

Figure 2: Expression and purification of human LARP7 for antibody generation

A) Human LARP7 was cloned into pET21a, transformed into E. coli, and induced

overnight at 18oC. Cells were then lysed, the lysate sonicated and then the expressed

protein was bound to a nickel column. The recombinant protein was further purified over

a Mono S column using fast protein liquid chromatography. LARP7 degradation

products can be seen throughout fractions 17-25, while full length LARP7 protein

appears in fractions 20-22. Fraction 19 contained a total of 4 mg of truncated and was

used as an antigen to generate an antibody in sheep. L-Ladder, C-Cells, LC-Lysed cells,

SC-Sonicated cells, P-Pellet, FT- Nickel column flowthrough, E-Nickel Elution. B) After

affinity purification, the sheep LARP7 antibody was tested using HeLa whole cell extract

or HeLa nuclear extract. A strong specific LARP7 band appears just under 80kD. The

band at 55kD is either a LARP7 proteolysis product or a non-specific band detected by

the affinity purified antibody. FPLC and western by Jeff Cooper. WCE – Whole Cell

Extract, NE – Nuclear Extract

28

Figure 3: LARP7 co-sediments with the 7SK snRNP before and after the release ofP-TEFb and HEXIM

A) Glycerol gradient sedimentation analysis of mock treated HeLa cells. Western

analysis was performed with the indicated antibodies. The fractions of low and high

molecular weight P-TEFb complex are labeled. B) Glycerol gradient analysis of cells

treated with 500 nM flavopiridol for 1 hr.

30

Figure 4: 7SK snRNA exhibits the same glycerol gradient sedimentation pattern as LARP7

A) 7SK northern of control cell glycerol gradients. B) Ethidium bromide staining

of A showing 7SL, U6 and an unidentified RNA species are unaffected by glycerol

gradient conditions or flavopiridol treatment. An unidentified RNA resides between the

U6 and 7SL bands.

32

Figure 5:LARP7 is a stable component of the 7SK snRNP

A) Glycerol gradient fraction 8-11 were pooled from both control and flavopiridol

treated cells. RNA and protein were isolated and analyzed by northern, ethidium

bromide staining, and western with the labeled antibodies. B) An autoradiogram from

the EMSA analysis of radioactive 7SK bound to increasing amounts of recombinant

human LARP7 protein. EMSA assay by Courtney Searcey-Galle, a former rotation

student.

34

Figure 6: Knockdown of LARP7 results in a relative increase of free P-TEFb but an overall decrease of total P-TEFb

A) Knockdown of LARP7 or MePCE in HeLa cell glycerol gradient input or the

leftover nuclear pellet 72 hours post-transfection was determined by western and

comparison with an actin loading control. Glycerol gradient analysis of the large form of

P-TEFb after siRNA knockdown of LARP7 and MEPCE using the CDK9 antibody. B)

HeLa cells were treated with the indicated amount of LARP7 siRNA for 48 hours, lysed

in SDS loading buffer, and westerned with the indicated antibodies. Non-specific bands

(ns) are provided as a loading control.

36

Figure 7: LARP7 and a model of current mechanism of P-TEFb release

A) Schematic comparison of La with LARP7 with information obtained by

querying NCBI’s Conserved Domain Database. La – La domain, RRM1 – RNA

recognition motif 1, RRM3 – RNA recognition motif 3. B) Before treatment with P-

TEFb inhibitors or cellular stress, the 7SK snRNP contains P-TEFb, a HEXIM dimer,

MEPCE, LARP7 and 7SK. Following release, the 7SK snRNP is composed of, LARP7,

7SK, and hnRNP proteins which bind to many small nuclear RNAs.

38

CHAPTER 3

DISCOVERY AND CHARACTERIZATION OF THE DROSOPHILA

MELANOGASTER 7SK SNRNP

P-TEFb was originally isolated from Drosophila melanogaster Kc cells

(Marshall and Price, 1995); however, conservation of the regulatory mechanisms

controlling P-TEFb activity in Drosophila has not been described. The goal of the

research presented in this chapter is to determine if a 7SK snRNP exists in Drosophila

and performs a conserved function. A bioinformatic search was performed and

Drosophila do have HEXIM and LARP7 homologues. Antibodies were developed to

these proteins and it was found that LARP7 and the 7SK snRNP do exist in Drosophila.

Half of Drosophila LARP7 (dLARP7) resides in a high molecular weight complex that is

RNase sensitive. Treatment of Kc cells with P-TEFb and transcription inhibitors results

in the release of dHEXIM and CyclinT from the complex. dLARP7 also co-sediments

with and immunoprecipitates the recently discovered Drosophila homologue of 7SK

(d7SK). Co-immunoprecipitation experiments using dLARP7, dHEXIM and CyclinT

antibodies show that all are capable of immunoprecipitating one another along with d7SK

indicating that they are associated with one another in an inhibitory complex.

Characterization of the mechanisms regulating P-TEFb in Drosophila melanogaster is

important because of Drosophila’s utility as a genetic and developmental model system.

Introduction

P-TEFb is a highly conserved kinase and homologues have been described

or identified in many organisms. Yeast contain transcription regulating kinases but the

functions of P-TEFb appear to be split in these organisms between Bur1 and Ctk1 (Wood

and Shilatifard, 2006). Loss of Bur1 kinase inhibits RNAPII in yeasts without affecting

RNAPII CTD phosphorylation by preventing PAF complex recruitment and histone

aceytlation, while Ctk1 is the CTD kinase and affects association of methylases and

39

processing factors with the elongating polymerase (Wood and Shilatifard, 2006). In

higher organisms, CTD phosphorylation, elongation, and co-transcriptional processing

are regulated by P-TEFb (Peterlin and Price, 2006).

Regulation of transcription elongation appears to be an important mechanism for

controlling gene expression because the most conserved elongation regulatory protein is

DSIF (Peterlin and Price, 2006). Although it plays a dual role as a positive and a

negative regulatory factor in vertebrates (Guo et al., 2000; Renner et al., 2001; Wada et

al., 1998b), the strong negative effects of DSIF have not been observed in yeasts (Pei and

Shuman, 2003). This may underscore the importance of NELF, which is absent in worms

and yeasts, as an important negative regulator of transcription in vertebrates and higher

order organisms where tight control of gene expression during development is likely

more critical for survival (Peterlin and Price, 2006). NELF may potentiate the negative

effects of DSIF that are required for this level of control.

The role of P-TEFb in releasing stalled polymerases was first described using

fractionated Kc cell lysates, yet conservation of the negative regulatory machinery of P-

TEFb had not been explored in other organisms. A bioinformatic search for the known

7SK snRNP components turns up clear homologues of HEXIM and LARP7 in flies, sea

urchins, and fish, but LARP7 is lost in worms, and neither is not found in yeasts (Marz et

al., 2009a). Yeasts and worms express La proteins, but it is difficult to determine

computationally if these proteins are functioning as more than RNAPIII chaperones.

Furthermore, a 7SK RNA homologue has not been found in yeasts. 7SK homologues

have been described in many organisms (Copeland et al., 2009; Gruber et al., 2008a;

Gruber et al., 2008b; Marz et al., 2009b). Conservation of sequence identity, however, is

less important than the structure of 7SK RNA. This point is highlighted by the recent

bioinformatic screens that discovered 7SK homologues in Drosophila and Caenorhabditis

based on structural rather than sequence homology (Gruber et al., 2008a; Marz et al.,

2009b). The fact that worms do not have an obvious LARP7 homologue, but do appear

40

to have HEXIM and 7SK homologues raises interesting questions about how P-TEFb

may be regulated in worms (Marz et al., 2009b). Though bioinformatic screens are

helpful in identifying putative protein homologues in other organisms, they do not

provide concrete biochemical evidence that the functional interactions among these

proteins are the same.

It is important to understand how P-TEFb is regulated in relevant model

organisms because of the vital role of P-TEFb in regulating RNAPII transcription. It is

predicted based on human cell culture studies and work with undifferentiated cells that P-

TEFb is a regulator of cellular differentiation (Peterlin and Price, 2006; Romano and

Giordano, 2008). The role of P-TEFb in embryonic development is not known. Fly

genetics offers an attractive model system to make or obtain flies and embryos with

specific gene knockouts. Confirming that P-TEFb functions and is regulated similarly in

flies is an important first step in being able to use Drosophila for the purpose of studying

P-TEFb throughout embryonic development.


Generation of Affinity Purified Drosophila LARP7

Antibodies

A gold clone, LD09531, for Drosophila MXC (dLAPR7) protein was obtained

from the Drosophila Genomics Research Center. MXC was then cloned into a pET21a

(Novagene) expression vector with a C-terminal histidine tag and the clone was verified

by sequencing. E. coli BL21 star (DE3) cells were transformed with the verified pET21a

clone, used to inoculate 4 liters of LB, gown to an OD of 0.5 and then expression was

induced with IPTG overnight at 18oC. Cells were then harvested, lysed, and sonicated.

Sonicated lysates were cleared by centrifugation at 200xg in a Beckmann Ultracentrifuge

for 45 minutes. Nickel resin (Invitrogen) was then added to the cleared lysates and MXC

protein was bound to the resin while rotating at 4oC for 1 hr. The resin was washed and

41

MXC protein was eluted by addition of imidizole to the nickel resin. The elution was

then cleared by centrifugation to remove any precipitated proteins and loaded onto the

FPLC. The protein was bound to a mono Q cation exchange column because of its slight

negative charge. Unfortunately, MXC did not bind to this column so the flow through

was then run over a mono S column which the protein bound to well. The protein was

eluted with a linear salt gradient. A fraction containing a single proteolysis product of

MXC was used as an antigen to inoculate a sheep. Affinity purified antibodies were

isolated by covalently attaching MXC protein to actigel ALD beads (Sterogene)

according to the manufacturer’s instructions and passing sheep serum over the bead

column. The column was washed and affinity purified antibodies were eluted with Tris-

glycine buffer.

Glycerol Gradient Sedimentation Analysis

Kc cells were grown to 90% confluence in T-150 flasks. Cells were harvested,

washed, and lysed with a buffer consisting of 10 mM HEPES, 150 mM NaCl, 2 mM

MgCl2, 10 mM KCl, 0.5% NP-40, 0.5 mM EDTA, 1 mM DTT, 0.1% PMSF, 1U/mL

Roche EDTA free complete protease inhibitor cocktail, and 10U/mL RNaseOut

(Invitrogen). For the RNase treated samples, RNase inhibitor was excluded from the

buffer and RNase A was added to a final concentration of 10U/mL and lysates were

incubated with rotation at room temperature for 10 min. Lysates were then subjected to

glycerol gradient fractionation over a 5%-45% glycerol range. This was done by

overnight (16 h) ultracentrifugation at 200 x g in a Beckmann Ultracentrifuge. Gradients

were then fractionated and resolved by 9% SDS-PAGE followed by transfer to

nitrocellulose membranes and analyzed by western.

Immunoprecipitation

For the co-immunoprecipitation experiments with dLARP7, CyclinT, and

dHEXIM antibodies, T-150 flasks of Kc cells were grown to 90% confluence, harvested,

42

washed, and lysates were made by lysing the cells in glycerol gradient lysis buffer. For

immunoprecipitation from glycerol gradient fractions, fractions 10-13 of the gradients

were pooled. 10 µg of affinity purified antibody was then bound overnight to 50 µL of

paramagnetic protein G dynabeads (Invitrogen) that were blocked and washed with PBS

containing 0.5% BSA. After the overnight antibody binding, the beads were washed 4

times with 0.5% BSA PBS. The beads were then concentrated and resuspended in 200

µL of Kc cell lysate or in 200 µL of pooled glycerol gradient fractions and incubated with

rotation at 4oC for 2 hr. After the immunoprecipitation incubation, the beads were

collected and washed four time with 500 µL immunoprecipitation wash buffer (10mM

HEPES, 150 mM NaCl, 2 mM MgCl2, 10mM KCl, 0.1% NP-40, 0.5 mM EDTA).

Depending on the downstream visualization, the beads were either resuspended in 20 µL

of SDS loading buffer or 500 µL Trizol.

Western Analysis

For western analysis, samples were resolved by 9% SDS-PAGE on 15 cm gels

and then transferred to .45 µm nitrocellulose using a semidry transfer apparatus. After

transfer, the membranes were cut and incubated in 0.1% tween PBS and 3% milk

overnight at 4oC with the appropriate primary antibody. Membranes were washed 3

times in 0.1% tween PBS and incubated with horseradish peroxidase-conjugated

secondary antibody (Sigma). The membranes were treated with Super Signal Dura West

Extended Duration Substrate (Pierce) and imaged using a cooled charge-coupled camera

(UVP). The antibodies used for western analysis were: affinity purified sheep anti-

CyclinT, affinity purified sheep anti-dLARP7, and affinity-purified sheep anti-

dHEXIM1.

RNA Isolation and Northern Analysis

To obtain RNA from the glycerol gradient sedimentation analysis, 100 µL of each

gradient fraction was combined with 500 µL of Trizol (Invitrogen) and 20 µg of yeast

43

carrier tRNA. RNA was then extracted according to the manufacturer’s protocol.

Extracted RNA was analyzed on 6% acrylamide TBE-Urea gels, transferred to 0.2 µm

Nytran nylon membrane and UV cross linked to the membrane using a Stratalinker.

Northern membranes were blocked for 1 hr at 65°C in Ultrahybe Hybridization Buffer

(Ambion). A DNA oligo for d7SK (Custom synthesis by IDT) was radioactively tagged

using T4 PNK and was added to the hybridization buffer and incubated overnight at

37°C. Membranes were visualized using a Packard InstantImager and then exposed to

film. For immunoprecipitations, beads were concentrated and combined with 500 µL of

Trizol. Analysis was performed as above.

Conservation Analysis

The human LARP7 protein sequence (GenBank: AAH66945.1) was input into

BLAST and scanned against the Zebrafish, Sea Urchin, Drosophila, Caenorhabditis, and

budding yeasts genome databases. High e-value hits were then assessed using NCBI’s

conserved domains tool. Proteins that contained La, RRM1, and RRM3 domains were

then aligned using ClustalW to calculate identity to human LARP7. Finally, scale

models of the proteins with the location of the important La and RNA binding domains

was created in PowerPoint.

Results

Identification of dLARP7

A bioinformatic search for LARP7 homologues in other organisms was carried

out (Figure 8). Clear homologues are found in fish and flies in which the La motif and

both RRMs are conserved (Figure 8). Initially, the fly homologue stood out because it

appeared to be an important developmental protein, multi sex combs (MXC). It was

originally described as a Polycomb Group protein involved in Drosophila development

and cancerous transformation of blood cells. Unfortunately, our collaborators at the

44

University of North Carolina at Chapel Hill discovered that this was a misannotation and

dLARP7 is actually an uncharacterized Drosophila protein (CG42569). Since the

developmental characterization of MXC is not accurate for dLARP7, our collaborators

have obtained dLARP7 hypomorphs and are currently in the process of eliminating

dLARP7 using transposon excision.

To aid in the proper identification and characterization of dLARP7, an affinity

purified antibody was developed in sheep. Full length dLARP7 clones were obtained

from the Drosophila Genome Research Center and cloned into a pET21a expression

vector. Recombinant protein was expressed and purified from E. coli (Figure 9A) and

fraction 41 which contained a single C-terminal proteolysis product was used as an

antigen for antibody generation in sheep. After affinity purification, specificity of the

antibody was tested by probing Kc cell whole cell extracts and Kc cell nuclear extracts

with a specific band detected around 90 kD (Figure 9B). The predicted molecular weight

of dLARP7 is 67kD with a PI of 6.91.

dLARP7 Co-sediments and Co-immunoprecipitates with

CyclinT and dHEXIM in an RNase Sensitive Complex

To characterize the Drosophila 7SK snRNP, the sedimentation pattern of

dHEXIM, CyclinT, and dLARP7 were analyzed. Kc cell lysates were made, fractionated

over a glycerol gradient, and the sedimentation pattern of each protein was determined by

western. CyclinT sedimented predominantly in a high molecular weight complex in

fractions 9-13 and peaked in fractions 11-12 (Figure 10A). dLARP7 sedimented

throughout the gradient with two protein peaks: one in fraction 6 and the other in fraction

12. The glycerol gradient sedimentation pattern of the putative dHEXIM protein was

more similar to that of CyclinT with the majority of the protein sedimenting in a high

molecular weight complex throughout fractions 9-13; though it peaked in fractions 10-11,

which is one fraction higher (closer to the top of the gradient) than CyclinT (Figure 10A).

45

Drosophila 7SK, which will be covered in greater detail in the next section, sedimented

similarly to CyclinT in fractions 9-16 and peaked in fractions 11-12 (Figure 10A). The

sedimentation pattern of dLARP7 is the most dissimilar when compared with the patterns

observed for the human homologues. Human LARP7 is found only in the high molecular

weight fractions. The broad sedimentation pattern in Drosophila is likely indicative of

the association of dLARP7 with other protein complexes and it may perform additional

functions in Drosophila that are not conserved in Humans.

To determine if these proteins are associated with an snRNP, the sedimentation

pattern of CyclinT, dLARP7, and dHEXIM was analyzed after RNase treatment.

Glycerol gradient fractionation was again performed, but prior to loading of the samples

on the gradient, the lysates were treated with RNase A. Treatment of the lysates with

RNase A had significant effects on the sedimentation pattern of all three proteins (Figure

10A). CyclinT changed from sedimenting in fractions 9-13, and crashed down to

fractions 4-9. The sedimentation pattern of dLARP7 also changed dramatically with the

complete loss of dLARP7 in fractions 11-16. The fractionation pattern of dHEXIM

changed the least, but an obvious increase of dHEXIM in fractions 4-7 is observed as

well as a shift of dHEXIM up the gradient to fractions 8-13 with dHEXIM now peaking

in fractions 9-10 (Figure 10A). The understated changes observed in dHEXIM after

RNase treatment could be due to the continued association of HEXIM with other protein

complexes that are not dependent on RNA for their stability. The RNase sensitivity of

these protein complexes in addition to their cofractionation with d7SK is strong evidence

that they are associated with one another in an RNP. Additionally, Stanley Sedore, a

former graduate student in the lab, showed that dHEXIM and CyclinT exhibit similar

changes in their sedimentation pattern after treatment of cells with three different

inhibitors of transcription. Mimicking the effects of these drugs in humans, d7SK and

dLARP7 were unaffected providing further evidence that Drosophila P-TEFb regulation

is similar to the human system.

46

Finally, to determine a direct interaction among these proteins in a large

molecular weight complex, fractions 10-13 of the control Kc cell lysate glycerol gradient

shown in Figure 10 were combined and co-immunoprecipitation experiments were

performed. Immunoprecipitation of the complex using dHEXIM antibodies resulted in

immunoprecipitation of both CyclinT and dLARP7 (Figure 10B). Likewise,

immunoprecipitation with dLARP7 resulted in immunoprecipitation of CyclinT, and

finally, immunoprecipitation with CyclinT antibodies resulted in the immunoprecipitation

of dLARP7 (Figure 10B). dHEXIM does not appear to be immunoprecipitated with

either dLARP7 or CyclinT antibodies, but this cannot be accurate considering dHEXIM

immunoprecipitation removed nearly half of dLARP7 and CyclinT from these fractions.

The inability to detect dHEXIM in this assay is due to two factors. The vast majority of

dHEXIM is not bound in this complex and dHEXIM resolve in the same region as the

heavy chain immunoglobulins (IgGs) used for the immunoprecipitation. All of the

antibodies used in this set of experiments were made in sheep, so all elute heavy chain

IgGs in the same region that dHEXIM resolves. This, combined with the small amount

of dHEXIM protein bound in the complex makes it impossible to see dHEXIM above the

IgG background. This set of co-immunoprecipitation experiments shows convincingly

that dHEXIM, dLARP7, and CyclinT are bound to one another in a complex. The

glycerol gradient sedimentation analysis after RNase indicates that this complex is likely

to be associated with a small RNA species.

Characterization of d7SK and the Drosophila 7SK snRNP

While characterization of the Drosophila P-TEFb inhibitory machinery was being

conducted in the lab, the identity of the Drosophila 7SK homologue was not known. One

of the main goals of this project was to find and sequence this RNA. It is likely that an

RNA component of the complex could be isolated because the complexes that CyclinT,

dHEXIM, and dLARP7 belonged to appeared to be RNase sensitive and these proteins

47

immunoprecipitated each other in co-immunoprecipitation experiments. To isolate this

RNA, another control glycerol gradient was performed and fractions 10-13 were pooled

for an immunoprecipitation with the dLARP7 antibody. After immunoprecipitation, the

beads were trizol extracted and the associated RNAs were analyzed by ethidium bromide

staining (Figure 11A). The bound fraction of RNA shows that four RNAs are pulled

down. A 600 bp RNA is immunodepleted from the flow through while the RNAs at 350

bp, 290 bp, and 175 bp are not and may be bound non-specifically. The RNA was then

transferred to a nytran membrane and saved for a future northern analysis. Since the 600

bp RNA was immunodepleted from the pooled gradient fractions, much like was

observed for human 7SK RNA, it was assumed that this RNA was the Drosophila

homolog of 7SK.

Interestingly, the same week that this dLARP7 immunoprecipitation experiment

was planned to be redone to obtain RNA for reverse transcription, cloning, and

sequencing, a paper came out proposing the identity of the arthropod 7SK RNA. Gruber

et al. performed a bioinformatic screen for uncharacterized RNAPIII RNAs in Drosophila

that shared structural conservation with the 5′ and 3′ hairpin stem loops of human 7SK

RNA. The RNA that was located was a 444 bp RNAPIII transcript that resolved

anomalously on a northern as a smear between 400 and 800 bp. The 5′ and 3′ regions of

the RNA are highly conserved in flies (Figure 11B), and interestingly, the 5′ stem of

d7SK contains a double repeat of the HIV Tat recognition sequence AUCUG. Human

7SK RNA contains 3 of these AUCUG repeats in its first 100 bases (Figure 11C). No

biochemical characterization of the RNA was performed, other than to show that the

RNA existed (Gruber et al., 2008a).

To determine if the RNA that was isolated in the dLARP7 immunoprecipitation

was the same RNA that Gruber et al. found with their bioinformatic screen, a DNA oligo

probe was designed for northern analysis (Figure 11B). This probe was then radiolabeled

and hybridized to the nytran membrane that was saved from the week before.

48

Surprisingly, the northern showed a strong recognition of the 600 bp band in the dLARP7

bound fraction (Figure 11D). d7SK may form a dimer or be highly structured and

resistant to urea denaturation since it does not resolve at its predicted size of 444 bp.

Interestingly, in vitro transcribed d7SK RNA resolves at 600 bp while the 460 bp DNA

template used for the T7 transcription reaction resolves at the correct size (Figure 12, IVT

Lane of EtBr staining). Finally, co-immunoprecipitations were performed to determine if

dHEXIM and CyclinT also associate with d7SK. Co-immunoprecipitations were

performed from crude Kc cell lysates and not from purified glycerol gradient fractions.

This is apparent when looking at the ethidium bromide stain of the immunoprecipitation

which is contaminated with ribosomal RNA (Figure 12). d7SK RNA, however, is visible

in the immunoprecipitations performed with all of the antibodies and the northern

confirms that both dHEXIM and CyclinT are complexed with d7SK (Figure 12). These

co-immunoprecipitations provide further evidence that the P-TEFb inhibitory machinery

functions similarly in both flies and humans.

Discussion

The conservation and function of P-TEFb in other organisms has been

characterized, but the conservation of P-TEFb regulatory mechanisms has not. To

determine if inhibition of P-TEFb in a 7SK snRNP occurs in other organisms and is

mediated by a La related protein, a basic bioinformatic screen was conducted for LARP7

homology in fish, sea urchin, flies, worms, and yeasts (Figure 8). LARP7 was found in

fish, sea urchins, and flies but not in worms and yeasts. Characterization of LARP7 was

followed up on in Drosophila with the intent of further characterizing the requirement of

the 7SK snRNP throughout development. The work presented in this chapter shows that

dHEXIM, CyclinT, dLARP7 co-sediment in a high molecular weight complex and that

the interaction with this complex is dependent on an RNA because RNase treatment

results in a significant change their migration through a glycerol gradient.

49

Co-immunoprecipitation experiments show conclusively that CyclinT, dHEXIM, and

dLARP7 can co-immunoprecipitate. Finally, the existence and function of d7SK RNA

was confirmed by co-immunoprecipitation experiments that identified d7SK as a 444 bp

RNA that associates with dLARP7, dHEXIM and CyclinT. The results of these

experiments provide strong evidence that a P-TEFb inhibition complex exists in

Drosophila. Additionally, the fact that CyclinT and dHEXIM are released from the 7SK

snRNP after treatment of cells with transcription inhibitors indicates that the machinery

involved in P-TEFb inhibition observed in humans is also intact in Drosophila.

The known components of the human 7SK snRNP are LARP7, HEXIM1 or its

shorter isoform HEXIM2, MePCE, and P-TEFb (Figure 13). In humans, LARP7 and

MePCE function primarily as 7SK stability factors, while HEXIM1 and HEXIM2

mediate inhibition of P-TEFb by binding to 7SK snRNA (Byers et al., 2005; Nguyen et

al., 2001). Genes encoding these proteins are conserved in flies. dLARP7 binds to and

stabilizes d7SK, and dHEXIM associates with both d7SK and P-TEFb to regulate P-

TEFb activity (Figure 13). The human 7SK snRNP is also known to contain MePCE

(Jeronimo et al., 2007) and human HEXIM1 can be functionally replaced by HEXIM2

(Byers et al., 2005). The fly methyl phosphate capping enzyme, BCDIN3, is also likely

to perform capping functions; however, its role in d7SK snRNP stability and maturation

has not been confirmed. Similarly, a dHEXIM isoform B does exist, but its inclusion in

this complex has not been explored.

The fact that the P-TEFb inhibitory machinery is conserved through flies and

functions similarly is interesting, but the requirement of the 7SK snRNP for survival has

not been explored in depth. Knockdown of LARP7 and loss of the 7SK snRNP does not

appear to have obvious negative effects on the survival of cell culture cells. Although

LAPR7 knockdown in human HeLa cells does result in the appearance of multiple large

vacuoles in the cytoplasm, the cells proliferate at the same rate as untreated controls

(unpublished observations). The association of LARP7 mutants with both gastric and

50

cervical cancers is interesting and the association of HEXIM1 mutations with cardiac

hypertrophy implicates the 7SK snRNP in playing a significant role in regulating the

activity of P-TEFb. The ratio of free active P-TEFb to inhibited inactive P-TEFb in the

cell raises important questions about its function. In HeLa S3 cells, only about 10% of

the P-TEFb in the cell is free, while 90% is inhibited in the 7SK snRNP. The functional

need for such a large inactive pool of P-TEFb could be that it is required for the cell to

respond to stresses such as UV irradiation. UV irradiation does cause the complete loss

of P-TEFb from the 7SK snRNP (Nguyen et al., 2001; Yang et al., 2001), and results in

CTD phosphorylation but a repression in overall transcription (Rockx et al., 2000). In

this case, the release of P-TEFb may be more important in transcription coupled repair of

DNA lesions than for upregulation of target genes. However, similar needs for rapid

response to transcription activating signals can be imagined during the development of

specific tissues where tightly regulating gene expression is crucial for survival.

Determining the role of the 7SK snRNP during development and gene expression

was the impetus for characterizing the 7SK snRNP in Drosophila. To help with the

developmental experiments, a collaboration was started with Greg Matera at UNC. His

lab has obtained dLARP7 hypomorphs and is generating dLARP7 and d7SK knockout fly

lines to determine the effects of the loss of the 7SK snRNP in Drosophila development.

The Matera lab has harvested fly embryos as well as larvae and whole flies to determine

how dLARP7 levels change throughout development. Their results show that dLARP7 is

present in the early embryo and then expression is reduced to nearly zero in larvae.

Expression of dLARP7 increases again in the adult flies but not nearly to the same level

as is seen in the embryo. Similar characterizations through development have been

performed on dLARP7 hypomorphic flies. The hypomorphs survive to adulthood and are

fertile; however, this is most likely due to the fact that dLARP7 is only reduced by 50%

in these flies. The changes observed in dLARP7 from embryo to larvae is interesting and

may point to a maternal loading of the 7SK snRNP, a loss during larval development, and

51

then an increase as terminal differentiation of tissues occurs. In addition, developmental

immunostaining of dLARP7 has been performed. dLARP7 is present in myoblasts that

give rise to smooth muscle. This finding is not surprising given the role of P-TEFb in

cardiac and smooth muscle differentiation and its high expression in these tissues in mice

and humans (Cottone et al., 2006; Dey et al., 2007). dLARP7 can also be found in

salivary glands, fat bodies, and differentially expressed in the developing eye disc. The

preliminary studies conducted by our collaborators indicate that the 7SK snRNP is

present during embryonic development. Recent work out of the Peterlin Lab has shown

that knockout of MePCE and LARP7 in fish results in gross developmental defects 24

hours after injection of embryos with LARP7 or MePCE morphilinos and provides

evidence that the 7SK snRNP is important for brain and head development (Barboric et

al., 2009). However, the effects of LARP7 and MePCE knockdown were not determined

at multiple stages of development. Further experimentation needs to be done to

determine if the 7SK snRNP is required for development.

52

Figure 8: Schematic diagram of LARP7 conservation in eukaryotes

LARP7 is conserved in higher eukaryotes but not in worms or yeasts (not pictured

because no obvious homologues were discovered in a basic bioinformatic search).

Homologues are arranged in order of conservation to the human protein. The location

and sizes of the protein domains are drawn to scale. Conservation to the human protein

was calculated using ClustalW.

54

Figure 9: Expression and purification of dLARP7 for affinity purified antibody generation

A) Drosophila LARP7 was cloned into pET21a, transformed into E. coli, and

induced overnight at 18oC. Cells were then lysed, the lysate was sonicated and then the

expressed protein was bound to a nickel column. The recombinant protein was further

purified over a mono S column using FPLC. dLARP7 degradation products can be seen

throughout fractions 41-46, while full length dLARP7 protein appears in fractions 42-44.

Fraction 41 was used as an antigen to generate an antibody in sheep. L-Ladder, OP-Onput

to the FPLC, 3 – FPLC flow through B) After affinity purification, the sheep dLARP7

antibody was tested using Kc whole cell extract and Kc nuclear extract. A strong

specified LARP7 band appears around 90kD. FPLC, Silver stain and western performed

by Jeff Cooper.

56

Figure 10: dLARP7, dHEXIM, and CyclinT co-sediment and co-immunoprecipitate in an RNase sensitive complex

A) Glycerol gradient fractionation analysis of Kc cell lysates before and after

RNase treatment. Lysates were incubated in the presence of either RNase inhibitors or

RNase A prior to loading on the gradient. Gradients were then analyzed by western with

the indicated antibodies. B) Co-immunoprecipitation analysis of the 7SK snRNP using

the indicated antibodies, ns – non-specific band.

58

Figure 11: d7SK RNA is conserved in Drosophila and immunoprecipitates with dLARP7

A) dLARP7 immunoprecipitation of d7SK from fractions 10-13 of the Kc cell

gradient in Figure 9A analyzed by ethidium bromide staining. B-Bead Bound, UB –

Unbound (Flow through). B) UCSC genome browser view of d7SK conservation in

Drosophila. The blue bar represents the DNA sequence of the northern probe. The bent

arrow depicts the RNAPIII TSS. C) ClustalW alignment of the first 40 bases of human

7SK and d7SK highlighting the sequence conservation of the HIV tat binding sequence

AUCUG. D) Northern of dLARP7 immunoprecipitated d7SK from A. Arrow points to

d7SK. B – Bound, UB – Unbound (Flow through)

60

Figure 12: d7SK co-immunoprecipitates with dHEXIM, dLARP7, and CyclinT

Immunoprecipitations were performed from Kc cell whole cell lysates, trizol

extracted, ethidium bromide stained and analyzed by northern. Bound and unbound

(flow through) fractions are shown. Arrow points to d7SK RNA in ethidium bromide

stained gels. The DNA template used to make in vitro transcribed d7SK RNA is visible

as a weak band at 460bp.

62

Figure 13: A comparison of the human and Drosophila 7SK snRNP

This is a model of the human and Drosophila 7SK snRNP. The human complex

consists of P-TEFb, LARP7, HEXIM1 and/or HEXIM2 and MePCE while the

Drosophila homolog contains P-TEFb, dLARP7, HEXIM, and BCDIN3.

64

CHAPTER 4

MECHANISM OF RELEASE OF P-TEFB FROM THE 7SK SNRNP

The cell possesses large quantities of P-TEFb, but the majority of it is inactived

by the 7SK snRNP. Since the discovery of the 7SK snRNP, research has been conducted

to determine how P-TEFb is released from this complex. The goal of the work presented

in this chapter is to determine how post-translational modifications, direct binding of P-

TEFb extractors to the 7SK snRNP, or changes in the conformation of 7SK affect the

association of P-TEFb with the complex. An in vitro assay was developed to screen for

modifications or proteins capable of releasing P-TEFb from the 7SK snRNP. Using the

LARP7 antibody generated in Chapter 2, the P-TEFb containing 7SK snRNP was

purified from lysates. Proteins or enzymes were then added back to determine if any

could release P-TEFb directly. Using this assay, it was found that addition of acetyl

coenzyme A and P300, ATP and protein kinase C (PKC), protein phosphatase 1 α

(PP1α), Myc, DSIF, Gdown1, DRB, flavopiridol, or a P-TEFb binding domain mutant of

Tat could not release P-TEFb from the 7SK snRNP. In contrast, RNase, HIV Tat, an

RNA binding domain mutant of Tat and the P-TEFb binding region of Brd4 caused

release of P-TEFb. These results indicate that the post-translational modifications tested

do not cause the release of P-TEFb from the 7SK snRNP. It is more likely that P-TEFb is

extracted by proteins that compete with HEXIM for binding and recruit P-TEFb to sites

of active transcription.

The role of 7SK structure in the release of P-TEFb from the 7SK snRNP was also

explored. A review of the original characterization of the structure of the 7SK snRNP

revealed that 7SK potentially exists in more than one conformation. To determine if

more than one structure of 7SK RNA was physiologically relevant, the conformation of

7SK before and after P-TEFb release was analyzed using two completely different

releasing agents. Treatment of cells with flavopiridol or incubating lysates with HIV Tat

65

both resulted in a significant change in the structure of 7SK RNA. This structural change

is functionally significant because in vitro loss of P-TEFb from the 7SK snRNP by Tat

extraction also causes the release HEXIM1 from the complex. The exclusion of HEXIM

from the 7SK snRNP in this assay is most likely due to a conformational change in 7SK

that prohibits binding because HEXIM1 is known to bind to double stranded RNA,.

Introduction

The presence of the 7SK snRNP provides a significant opportunity for the cell to

differentially regulate transcription. However, if the majority of P-TEFb in the cell is

inhibited by the RNP, how does the cell extract P-TEFb to activate transcription?

Endogenous proteins are known recruit P-TEFb to sites of active transcription. These

include the p65/RELA subunit of NF-κB (Barboric et al., 2001), CIITA (Kanazawa et al.,

2000; Kanazawa and Peterlin, 2001), Myc (Eberhardy and Farnham, 2002; Kanazawa et

al., 2003), MyoD (Giacinti et al., 2006; Simone et al., 2002), the androgen receptor (Lee

and Chang, 2003; Lee et al., 2001), and the estrogen receptor (Wittmann et al., 2005).

However, it is not known if these proteins extract P-TEFb directly from the 7SK snRNP.

p65/RELA recruits P-TEFb to promoters, but its interaction may be mediated by binding

of acetylated p65/RELA to Brd4 (Huang et al., 2009; Sharma et al., 2007). CIITA binds

directly to CyclinT1 and recruits P-TEFb to stimulate major histocompatibility complex

class II transcription (Kanazawa and Peterlin, 2001). Myc is thought to bind directly to

CyclinT1, and this binding is required for myc transactivation of transcription (Eberhardy

and Farnham, 2002; Kanazawa et al., 2003). MyoD recruits P-TEFb to muscle specific

genes, but is specific for the CyclinT2a containing form of P-TEFb (Giacinti et al., 2006).

The androgen receptor recruits P-TEFb to sites of active transcription by binding directly

to CDK9 (Lee et al., 2001). Finally, the estrogen receptor competes with HEXIM1 for

binding to CyclinT1 and recruits CyclinT1 to estrogen receptor alpha target genes

(Wittmann et al., 2005). Although these proteins specifically recruit P-TEFb to their

66

target promoters, their transcriptional activity could only account for a small amount of

P-TEFb activity. A more general mechanism or recruitment factor must exist to bring P-

TEFb to active genes.

Post-translational modification is a widely used mechanism for regulating many

different protein complexes (Jenuwein and Allis, 2001). More recently, post-translational

modification of P-TEFb has been explored as a mechanism for its release from the 7SK

snRNP. The first indication that these modifications play a role in P-TEFb release came

out of the Zhou Lab that showed dephosphorylation of the T-loop of P-TEFb by PP1α

and PP2B results in its release from the 7SK snRNP (Chen et al., 2008). The Peterlin

Lab has revealed that activation of the PI3K/Akt pathway through treatment of cells with

HMBA results in the phosphorylation of HEXIM1, which leads to the global release of P-

TEFb in vivo (Contreras et al., 2007). Additionally, unpublished data in our lab

demonstrates that in vitro phosphorylation of HEXIM1 by PKC on Ser158 prevents

HEXIM1 from binding to RNA and also blocks the ability of HEXIM1 to bind P-TEFb to

inhibit its kinase activity. A recent analysis of active P-TEFb in the cell found that free

low molecular weight P-TEFb is acetylated, while P-TEFb bound to the 7SK snRNP is

not, and this acetylation can be added by P300 (Cho et al., 2009). The researchers

speculate that P-TEFb acetylation causes release from the 7SK snRNP. Although post-

translational modification of the 7SK snRNP does occur, its direct role in P-TEFb release

has not been tested.

One of the hallmarks of open active chromatin is acetylation of histone H3 and

histone H4 (Jenuwein and Allis, 2001). These marks are added by a number of different

histone acetyl transferases including P300. These marks result in the recruitment of

many different factors to open chromatin which aid in activating transcription. Of these

proteins, bromodomain-containing protein 4 (Brd4) recognizes and binds to acetyl-

lysines through its two bromodomains (Wu and Chiang, 2007). The bromodomain is a

highly conserved motif consisting of four α-helices linked to one another by two loops

67

that binds to acetyl-lysine on both histones and other proteins (Zeng and Zhou, 2002).

Brd4 has been shown to interact with many different chromatin and transcription related

proteins, and most importantly its C-terminal helical region binds directly to CyclinT1

(Bisgrove et al., 2007; Urano et al., 2008). Although on the surface this may appear to be

one of many factors that binds to P-TEFb, it was shown in the supplemental material of

the original characterization of the Brd4-P-TEFb interaction that most of the free P-TEFb

in the cell is associated with Brd4 (Jang et al., 2005). No other protein has been shown to

be associated with such a large quantity of free P-TEFb. The fact that Brd4 recognizes

and binds to active chromatin provides a tantalizing association that points to a general

mechanism for P-TEFb recruitment to transcriptionally relevant sites in the genome.

Unfortunately, viruses require transcription for survival too. At least four viral

proteins to date have been shown to recruit P-TEFb to their promoters through an

interaction with CyclinT1. These include EBV E2, HSV VP16, HTLV Tax and the most

studied interaction is that of HIV-1 Tat. Early work on the functional domains of Tat

showed that a cysteine rich region of Tat that binds to zinc is required for Tat

transactivation (Kuppuswamy et al., 1989; Ruben et al., 1989). It was originally thought

that this region was important for Tat dimerization, but it is now known that it is the P-

TEFb binding domain (Garber et al., 1998; Zhu et al., 1997). The ability of Tat to bind

to the TAR element through its basic RNA binding domain is also important for viral

replication, because loss of this region results in a significant reduction in HIV Tat

transactivation (Endo et al., 1989; Kuppuswamy et al., 1989). It is theorized that Tat

activates HIV viral genome replication by recruiting P-TEFb to the HIV LTR. Its role in

directly releasing P-TEFb and how mutations in Tat affect this release has not been

studied in detail. It has been shown that Tat can compete for HEXIM1 binding to P-

TEFb and that the cysteine rich P-TEFb binding region of Tat is required for this to occur

in vitro and in vivo (Barboric et al., 2007; Sedore et al., 2007), but it has not been shown

68

if Tat can extract P-TEFb directly from the 7SK snRNP, or if this release is mediated by

another protein.

Finally, the role that 7SK snRNA plays in the regulation of P-TEFb has not been

explored in detail. 7SK was originally described as a highly abundant small nuclear

RNA that forms a ribonucleoprotein particle of unknown function. It was thought that

7SK snRNA was involved in RNA splicing, and the structure of the RNA was

determined using chemical modifying agents and nuclease protection assays (Wassarman

and Steitz, 1991). Its discovery as a major structural component of a P-TEFb inhibitory

complex was novel (Nguyen et al., 2001; Yang et al., 2001), but its role in regulating P-

TEFb release was not determined. Further characterization of the regions required for P-

TEFb inhibition were performed and it was found that the 1-100 region of 7SK is bound

specifically by HEXIM1 and that the 3′ stem loop is bound to CyclinT1 (Egloff et al.,

2006; Michels et al., 2004). Additionally, HEXIM1 photo cross links specifically to U30

of 7SK further underscoring the importance of the 1-100 region in P-TEFb inhibition

(Belanger et al., 2009). However, it was not until the realization that the protein

components of the 7SK snRNP change after P-TEFb release that the RNA itself may play

a role in regulating P-TEFb (Krueger et al., 2008; Van Herreweghe et al., 2007). 7SK

was found to form multiple RNPs with hnRNPA1, A2/B1, R and Q along with RNA

Helicase A (Barrandon et al., 2007; Van Herreweghe et al., 2007). The authors of these

studies speculated that hnRNP proteins are important for releasing P-TEFb from the 7SK

snRNP by competing with HEXIM1 for 7SK binding. This is mediated by their binding

to a hairpin loop in the middle of 7SK, which when deleted prevents the release of

CyclinT1 from exogenously expressed RNAs (Van Herreweghe et al., 2007). It is odd

that HEXIM1 leaves the 7SK snRNP given the multiple long stretches of double stranded

RNA character in 7SK because HEXIM1 has been shown to be a promiscuous double

stranded RNA binding protein even in the absence of P-TEFb (Li et al., 2007). The

binding of hnRNP proteins to block the binding site of HEXIM1 is one possibility for

69

how HEXIM1 could be excluded from this complex; however, the other possibilities are

post-translational modification of HEXIM1 that prevent it from binding RNA or a

structural change in the RNA that removes the binding site.


Expression and Purification of Recombinant Proteins

HIV Tat mutants were obtained and cloned into pET21a (Novagene) E. coli

expression vectors with histidine tags. E. coli BL21 star (DE3) cells were transformed

with the pET21a clone, used to inoculate 2 liters of LB, gown to an OD of 0.5 and then

expression was induced with IPTG overnight at 18oC. Cells were harvested, washed,

and then lysed by sonication. Sonicated lysates were cleared by centrifugation at 200xg

in a Beckmann Ultracentrifuge for 45 minutes. Nickel resin (Invitrogen) was then added

to the cleared lysates and the protein was bound to the resin while rotating at 4oC for 1 hr.

The resin was washed and the protein was eluted by addition of imidizole to the nickel

resin. The elution was then cleared by centrifugation to remove any precipitated proteins

and loaded onto the FPLC. Both mutant Tat proteins are positively charged, so they were

purified by FPLC after binding to a Mono S column. The protein was then eluted over a

salt gradient and purity was assessed by silver stain.

Purification of the Brd4 proteins was similar, but because both proteins were

charge neutral, neither bound to Mono S or Mono Q. Flow throughs from the the FPLC

were dialyzed against PBS for 24 hr at 4oC to remove imidizole and detergents from the

protein buffers. Purity of the proteins was determined by silver stain.

DSIF and Gdown1 were expressed and purified previously for in vitro

transcription reactions and were available in the lab.

The catalytic domain of P300 and Myc were purchased from Active Motif, PKC

isolated from rat brain was purchased from Calbiochem, and PP1α was purchased from

New England Biolabs.

70

Release Assay

For the release assays, 2L of HeLa cells were cultured in spinner flasks. Cells

were washed and then lysed in lysis buffer (10 mM HEPES, 150 mM NaCl, 2 mM

MgCl2, 10 mM KCl, 0.5% NP-40, 0.5 mM EDTA, 1 mM DTT, 0.1% PMSF, and 1U/mL

Roche EDTA free complete protease inhibitor cocktail) for 10 minutes with intermittent

vortexing. Lysates were cleared in a Beckmann Ultracentrifuge at 200xg for 1 hr. After

centrifugation, the fat layer was discarded and the supernatant was saved and frozen in

aliquots at -80oC for later use. The M-270 Epoxy Dynabeads used in this assay were

prepared the night before. 2x108 (100 µL) beads were washed 2 times in PBS, then

rotated for 10 minutes at room temperature in PBS, and finally washed again in PBS.

Beads were then resuspended in 50 µg of affinity purified LARP7 antibody and 1 M

ammonium sulfate and incubated overnight (16 hr) at 37oC in a PCR tube. After

incubation, the beads were washed 4 times in PBS containing 0.5% BSA. After washing,

the beads were resuspended in 300 µl from one confluent T-150 of HeLa lysate and

incubated at 4oC for 2 hr in a PCR tube. After immunoprecipitation, the beads were

washed once in immunoprecipitation wash buffer (10 mM HEPES, 150 mM NaCl, 2 mM

MgCl2, 10 mM KCl, 0.1% NP-40, 0.5 mM EDTA, 1 mM DTT, 0.1% PMSF, and 1U/mL

Roche EDTA free complete protease inhibitor cocktail), resuspended in 200 µL wash

buffer, and then 1x107 (10 µL) beads were aliquotted into eppendorf tubes. At this

point, potential releasing agents were added to the beads. For the release control, 4 µg of

RNase A was added to one aliquot of beads. Beads were incubated for 15 minutes,

unless otherwise noted, with finger vortexing every 3 minutes to keep the beads

suspended during the release reactions. Reactions were then washed twice with wash

buffer (500 µL), and resuspended in 17 µL SDS loading buffer and resolved by 9% SDS-

PAGE.

71

Western Analysis

After transfer to nitrocellulose, the membranes were cut and incubated in 0.1%

tween PBS and 3% milk overnight at 4oC with the appropriate primary antibody.

Membranes were then washed 3 times in 0.1% tween PBS and incubated with

horseradish peroxidase-conjugated secondary antibody (Sigma). The membranes were

then treated with Super Signal Dura West Extended Duration Substrate (Pierce) and

imaged using a cooled charge-coupled camera (UVP).

The antibodies used for western analysis were: sheep anti-cyclin T1, rabbit anti-

CDK9 (sc-8338; Santa Cruz Biotechnology), affinity-purified sheep anti-HEXIM1 , and

affinity-purified sheep anti-LARP7.

Chemical Modification of 7SK RNA

For chemical modification of the 7SK snRNP, complexes were isolated similarly

to the release assay except New England Biolabs paramagnetic protein G beads were

used for the isolation. 400 µL of beads were bound to 50 µg of antibody overnight at

4oC, washed, and then split in half and incubated with 800 µL of HeLa lysate. After

immunoprecipitation, the beads were washed 4 times with 1 mL of wash buffer. The

isolated and washed complexes were then resuspended in 200 µL of CMCT modification

buffer which consisted of BMK buffer (80 mM potassium borate pH 8.1, 60 mM KCl, 2

mM MgCl2, and 3 µg/µl CMCT (Sigma)) and incubated at room temperature with

rotation for 15 minutes. The CMCT stock buffer was 42 mg/mL CMCT in BMK buffer.

CMCT modification reactions were then stopped by addition of 300 µL stop buffer (0.3M

sodium acetate, 0.2M PIPES pH 6.5, and 5 mM EDTA) and placed on ice for 3 minutes.

The 500 µL of CMCT modified beads were then transferred to 2 mL eppendorf tubes and

1 mL of trizol was added. To that, 200 µL of chloroform was added and then the tubes

were vortexed for 20 seconds. The emulsions were incubated for 3 minutes at room

temperature and then spun down at 14k rpm for 20 minutes at 4oC in a microcentrifuge.

72

After the spin, 1.1 mL of the aqueous phase was added to 900 µL of isopropanol, mixed

gently, and incubated at room temperature for 10 minutes to precipitate the RNA. The

RNA was then spun down at 14k rpm for 25 minutes, the supernatant was removed with

a pulled glass Pasteur pipette and then the RNA was washed with 300 µL of 80% EtOH.

Finally, the supernatant was again removed with a pulled glass Pasteur pipette, the

imperceptible pellets were air dried and then resuspended in 20 µL ddH2O. RNA content

was determined by 6% TBE urea acrylamide gel electrophoresis and samples were

normalized for 7SK RNA content.

In vitro Transcription of 7SK RNA

The 7SK RNA sequence was cloned into pCR2.1 (Invitrogen). This plasmid was

then used as a template in a PCR reaction to generate the 7SK sequence from a T7

promoter containing primer and a reverse primer. 1 µg of PCR product was then used in

an in vitro transcription reaction with recombinant T7 RNA polymerase (Stratagene)

according to the manufacturer’s instructions. Quality of the in vitro transcribed RNA was

determined by resolving the RNA on a 6% TBE urea acrylamide gel.

Hybridization and Primer Extension Reactions

To map the first 100 bases of 7SK and determine the structure of 7SK RNA,

HPLC purified antisense DNA primers were ordered from IDT (100-120R:

AGGGACGCACATGGAGCGGT, 70-90R: GGGGACACCCGCCTAGCCAG) and

radioactively end labeled with γ-p32 ATP using T4 PNK. For reverse transcription,

primers were hybridized to either 100 ng of in vitro transcribed 7SK RNA to generate the

Sanger sequencing ladder, or to 100 ng of the CMCT modified RNA extracted from in

vivo isolated RNP complexes. Reactions were hybridized to 200 femtomoles of

radiolabeled primer at 80oC for 10 minutes in hybridization buffer (40 mM HEPES pH

7.6, 5 mM boric acid, 100 mM KCl, 20 µg/mL BSA, and 0.5U RNaseOUT) and then at

42oC for 15 minutes in a thermal cycler. Extension was initiated by the addition of

73

extension buffer (50 mM Trizma Base pH 8.4, 9 mM MgCl2, 10 mM DTT, 20 µg/mL

BSA, 100 mM KCl, 1U AMV reverse transcriptase , and 0.5U RNaseOUT), and dNTP (1

Mm final concentration) or sequencing mix (2.5 mM dT,dG,dCTP, 1.9 mM dATP, and

0.6 mM ddATP final concentration). Primer extension was run for 1 hr in a thermal

cycler at a constant 42oC. 4 µg of RNase A was added to the reactions and incubated for

15 minutes at 42oC because the DNA and RNA form a very strong hybrid. Reactions

were then suspended in a total volume of 100 µL of H2O containing 20 µg of yeast tRNA

carrier. 100 µL of phenol:chloroform:isoamyl alcohol (25:24:1 v/v) was added and the

samples were vortexed for 15 seconds. The samples were spun down at full speed in a

microcentrifuge for 5 minutes at room temperature. 100 µL of the aqueous phase was

then combined with 4 µL 5M NaCl (to a final concentration of 200 mM) mixed, and then

200 µL of 100% EtOH was added on top to initiate nucleic acid precipitation. The

DNA/RNA was then precipitated at -20oC for 30 minutes. After incubation, the

DNA/RNA was spun down at full speed in a microcentrifuge for 15 minutes at 4oC. The

DNA/RNA pellet was washed with 80% EtOH, spun down at full speed for 5 minutes, air

dried, and resuspended in 8 µL urea loading buffer. Radiolabled DNA was resolved on a

10% TBE urea acrylamide gel, dried, exposed for 24 hr to a phosphoimager screen, and

then imaged with a Fuji-Film FLA 7000 phosphoimager

Results

Phosphorylation, Dephosphorylation, and Acetylation of

the 7SK snRNP does not Result in P-TEFb Release

The current body of literature strongly supports post-translational modification of

components of the 7SK snRNP as being responsible for P-TEFb release. These enzymes

were tested using an in vitro release assay to determine if they cause release directly.

Since LARP7 remains in complex with the 7SK snRNP regardless of the presence of P-

74

TEFb and HEXIM1 (Figure 5A, Chapter 1), it was used as a tag to pull out endogenous

7SK snRNP complexes.

Previous work done by Qintong Li showed that in vitro phosphorylation of

HEXIM1 by PKC prevented HEXIM1 from binding to RNA and inhibiting P-TEFb. To

determine if phosphorylation of the 7SK snRNP by PKC could be involved in disrupting

the association of HEXIM1 with 7SK and lead to the release of P-TEFb, increasing

amounts of PKC were added in vitro to 7SK snRNP complexes isolated from cells and

the loss of the CDK9 signal was tracked by western. As a positive control, RNase A was

added to one reaction to release CDK9 from the complex. Addition of PKC or ATP

alone had no effect on the association of CDK9 with the 7SK snRNP after 15 minutes of

incubation at room temperature. Similarly, addition of 0.02 ng, 0.2 ng, or 2 ng of PKC in

the presence of 1 mM ATP had no effect on the association of P-TEFb with the complex

indicating that phosphorylation of HEXIM1 and the 7SK snRNP by PKC has no direct

releasing effect (Figure 14A).

Dephosphorylation of P-TEFb by phosphatases has also been implicated in P-

TEFb release (Chen et al., 2008). To test this effect in vitro on isolated 7SK snRNP

complexes, 1, 3 or 10 units of manganese dependent PP1α was added to the complexes

and no effect on CDK9 release was observed after 15 minutes indicating that

dephosphorylation of this complex by PP1α alone was not sufficient for release (Figure

14B).

Acetylation of P-TEFb appears to be a hallmark of active P-TEFb and it was

suggested that acetylation of LYS404 leads to the release of P-TEFb from the 7SK

snRNP. It was also shown that P300 could cause the acetylation of P-TEFb on LYS404

in vitro (Cho et al., 2009). As a control, P300 catalytic domain enzyme alone was added

to one of the reactions with no observed effect on CDK9 release. Addition of 20 ng, 60

ng, or 200 ng of P300 in the presence of 50 µM acetyl-coenzyme A had no effect on

75

CDK9 release from the 7SK snRNP, indicating that acetylation by P300 has no direct

effect on the release of P-TEFb from this complex (Figure 14C).

DSIF, Gdown1, DRB and Flavopiridol do not Cause

P-TEFb Release Directly

P-TEFb plays a critical role in relieving stalled polymerases and regulating gene

expression. It was hypothesized that the negative elongation machinery may play a role

in regulating P-TEFb by stalling polymerases until the 7SK snRNP was recruited to

stalled regions where they could then interact with and extract active P-TEFb. To test

this, two factors known to cause polymerase poising were titrated in to isolated 7SK

snRNP complexes. Addition of 10 ng, 30 ng, 100 ng, 300 ng, 900 ng, or 1800 ng of

DSIF had no effect on P-TEFb release from the 7SK snRNP (Figure 15A). Similarly,

addition of 30 ng, 100 ng, 300 ng, or 900 ng of Gdown1 protein had no effect on release

(Figure 15B).

A number of transcription factors have been shown to bind to P-TEFb and recruit

it to target promoters. One of the most interesting of these proteins is Myc because it is

known to activate the expression of many different target genes as a result of specific

cellular signals. To determine if Myc can extract P-TEFb directly from the 7SK snRNP,

it was titrated into the release assay. 10 ng, 30 ng, 100 ng, or 300 ng of Myc was added

to the isolated 7SK snRNP complex with absolutely no effect on the association of P-

TEFb with the 7SK snRNP (Figure 15C). Myc does not extract P-TEFb directly from the

7SK snRNP and may rely on other proteins to mediate its interaction with P-TEFb, it

does not compete competitively with HEXIM1 for P-TEFb binding, or it requires DNA

binding to expose a P-TEFb binding domain.

Inhibition of P-TEFb with either DRB or flavopiridol results in its release from

the 7SK snRNP in vivo. Since these drugs are nucleotide analogs, it may be that these

drugs act directly to release P-TEFb from the 7SK snRNP by binding to the ATP binding

76

region of P-TEFb and altering its interaction with HEXIM1. The 7SK snRNP was

titrated with 12.5 µM, 25 µM, 50 µM, or 100 µM of DRB or 125 nM, 250 nM, 500 nM

or 1 mM of flavopiridol. Typically 50 µM of DRB or 500 nM of flavopiridol is used to

release and inhibit P-TEFb in cell culture. Titration of DRB into the 7SK snRNP had no

effect on the association of P-TEFb with the 7SK snRNP (Figure 15D). However,

flavopiridol may have had an effect on P-TEFb release, although the release did not show

a typical titration response. At 125 nM of flavopiridol, 50% of the CDK9 had left the

7SK snRNP, and a 10 fold increase in flavopiridol concentration resulted in a 70% loss of

P-TEFb (Figure 15D). Direct release of P-TEFb from the 7SK snRNP by flavopiridol

may be possible, but is obviously not how P-TEFb is released in vivo.

HIV Tat and Brd4 Can Release P-TEFb Directly from the

7SK snRNP

Recently, it has been shown that overexpression of Tat in vivo results in the

complete loss of P-TEFb from the 7SK snRNP (Sedore et al., 2007). This result is

interesting since HIV Tat is known to bind to and recruit P-TEFb to the HIV LTR (Zhu et

al., 1997); however, the ability of Tat to directly extract P-TEFb from the 7SK snRNP

has not been explored (Zhu et al., 1997). To test this, Tat was expressed and purified

from E. coli. Recombinant protein was then titrated in to the 7SK snRNP. Addition of

10 ng, 30 ng, 100 ng, or 300 ng of Tat for 15 minutes resulted in an obvious release of P-

TEFb from the 7SK snRNP (Figure 17A). The kinetics of Tat release was also analyzed

by addition of 100 ng of Tat and exposure of the 7SK snRNP to Tat for 3, 10, or 30

minutes. These results showed that as exposure time increased, so did CDK9 release

(Figure 17A).

The effect of the loss of the P-TEFb and RNA binding domains of Tat on P-TEFb

release was determined because Tat was able to release P-TEFb. Both the zinc binding

domain and basic RNA binding region of Tat are required for Tat transactivation in vivo.

77

The zinc binding region is known to be crucial for the interaction of Tat with P-TEFb,

and the RNA binding domain is thought to be critical for the recruitment of P-TEFb to

the HIV LTR. Of interest, the bulge sequence that Tat binds to in TAR (AUCUG) is

repeated 3 times in the first 100 bases of 7SK RNA (Figure 22). It was hypothesized that

in addition to the ability of Tat to bind to P-TEFb, a competition with HEXIM1 for

binding to 7SK may also be important for Tat mediated P-TEFb release.

To determine the effect of the loss of the P-TEFb binding region of Tat, a critical

cystiene, 22, in the zinc binding region was mutate to glycine (TatC22G) (Figure 17A).

To generate an RNA binding mutant, arginines 52 and 53 were mutated to alanine in the

basic RNA binding region (TatR52/53A)(Figure 16A). These mutants were then cloned

in to a pET21a expression vector with a C-terminal histidine tag and purified by FPLC.

TatR52/53A was highly expressed (14kD band) and fraction 37 was used for all of the

TatR52/53A experiments (Figure 16B). TatC22G, on the other hand, did not express as

well, but pure protein was obtained (Figure 16C, 14kD band, fractions 32, 33, 37, 38) and

a fraction containing relatively pure TatC22G was determined by western with an anti-

Tat antibody. Fraction 37 of TatC22G was used for further experimentation.

To test the effect of the loss of the RNA binding region of Tat on P-TEFb release,

TatR52/53A was titrated in to the 7SK snRNP. Addition of 10 ng, 30 ng, 100 ng, or 300

ng resulted in the loss of CDK9 from the 7SK snRNP, but less release than was caused by

wild type Tat was observed (Figure 17B). The same kinetic experiment as before was

performed and a similar, although slower loss of CDK9 was observed (Figure 17B).

These experiments hint that the RNA binding region may be important for release. It has

been shown previously that HIV Tat binds preferentially to 7SK RNA over TAR RNA in

an in vitro assay (Sedore et al., 2007). The effect of the addition of an RNA competitor

to the release assay was tested because this difference in affinity may be relevant to the

mechanism of action of Tat. This was done by pre-incubating 100 ng of Tat with

increasing equimolar amounts of HIV TAR (2 ng, 6 ng, or 18 ng) or 7SK RNA (10 ng, 30

78

ng, or 100 ng) for 15 minutes, then the 7SK snRNP was added to these reactions.

Interestingly, TAR RNA had absolutely no effect on the ability of Tat to release P-TEFb;

however, 7SK RNA inhibited it, again indicating that Tat binding to 7SK RNA may be

important for its ability to release P-TEFb (Figure 19A). To determine the effect of the

loss of the RNA binding domain on P-TEFb release, the same experiment was performed

except this time TatR52/53A was used. If the RNA binding domain was important, an

inhibition of release should be observed, similar to the inhibition seen in Figure 17B.

Unfortunately, there was no inhibition of P-TEFb release (Figure 19B). Tat binding to

7SK snRNA may play a minor synergistic role in P-TEFb release from the 7SK snRNP,

but it is not a major mechanism of action.

Finally, the role of the zinc binding domain of Tat in P-TEFb release was further

explored. Addition of 10 ng, 30 ng, 100 ng, or 300 ng or incubation of the 7SK snRNP

with 100 ng of TatC22G for 30 minutes had no effect on P-TEFb release indicating that

the zinc binding region is required for P-TEFb release (Figure 17C). Furthermore, since

the RNA binding region of Tat is still intact in this mutant, this experiment also shows

that the RNA binding region does not play a significant role in releasing P-TEFb from the

7SK snRNP. The wild-type Tat, Tat RNA binding mutant, and Tat P-TEFb binding

mutant titration and timecourse data is summarized and quantified from three

independent experiments in Figure 18.

The data presented so far show that HIV Tat is a potent factor that works to

release P-TEFb directly from the 7SK snRNP. It was hypothesized that an endogenous

cellular protein may possess the the ability to extract P-TEFb directly from the 7SK

snRNP because many viruses steal host machinery and mechanisms to their own benefit

and HIV is likely not an exception. Brd4 was screened as a potential P-TEFb release

factor because Brd4 is associated with the majority of free P-TEFb in the cell and has a

known P-TEFb binding domain. Helical region 3 of Brd4 has been shown to be critical

for P-TEFb binding (Bisgrove et al., 2007). Additionally, two independent labs have

79

shown that over expression of the C-terminal tail of Brd4 can inhibit Tat transactivation

of the HIV LTR (Bisgrove et al., 2007; Urano et al., 2008) and block Tat binding to P-

TEFb (Bisgrove et al., 2007). cDNAs encoding the C-terminal P-TEFb binding region

(1209-1362) and a P-TEFb binding mutant lacking helical region 3 (1209-1362 ∆1329-

1345) of Brd4 were obtained from the Verdin Lab (Figure 20A). Both proteins were

cloned in to pET21a with a C-terminal histidine tag and then expressed and purified from

E. coli (Figure 20B). Brd4 1209-1362 was then incubated with the 7SK snRNP. More

Brd4 protein was titrated in to the release reactions because Brd4 1209-1362 is twice as

big as Tat. Addition of 30 ng, 100 ng, 300 ng, or 900 ng of Brd4 resulted in the obvious

release of CDK9 from the 7SK snRNP (Figure 20C). Kinetic release of CDK9 with 200

ng of Brd4 was also observed implicating Brd4 as an endogenous P-TEFb release factor.

Finally, the Brd4 mutant lacking the C-terminal helical domain 3 of Brd4 was used in the

release assay and had no effect on Cdk9 release either by titration or time course (Figure

20D). The Brd4 release data was quantified from three independent experiments and a

summary of both the wild type and mutant Brd4 are summarized in Figure 21.

A Conformational Change Occurs in 7SK snRNA After

P-TEFb Release Preventing the Binding of HEXIM1

A review of the original characterization of the structure of 7SK revealed that

7SK may exist in more than one conformation in the cell. Wassarman and Steitz created

a best fit structure for 7SK, and placed uracils 28 and 30, and uracils 66 and 68, which

are in the important HEXIM binding 1-100 region, of 7SK in a double stranded hybrid

even though these bases showed sensitivity to the uracil modifying agent CMCT (Figure

22, Wassarman). CMCT should be able to bind to and modify any bases located in

accessible loops because CMCT is a small molecule that reacts specifically with N-3 of

uracil (Figure 23A). Since these bases were moderately sensitive, it was hypothesized

that more than one conformation of 7SK snRNA exists in the cell. Although the 7SK

80

snRNP inhibits the majority of P-TEFb, 10-20% of this complex is not associated with P-

TEFb (Figure 3, Chapter 2). This suggests that there are at least two 7SK snRNPs, one

with and the other without P-TEFb, which may stabilize different structures of 7SK.

To determine if different structures were computationally possible, the first 100

bases of 7SK snRNA were folded using the RNA/DNA folding program mFold (Zuker,

1989). The top two structures that came out of this screen had similar stabilities: one

looked identical to the structure described by Wassarman and Steitz (Figure 22,

Wassarman, ∆G -40.1) while the second folded completely differently, yet was slightly

more stable (Figure 22, mFold, dG -40.4). Interestingly, this second, more stable

structure places U28, U30, U66, and U68 in accessible loops and this would explain the

apparent inconsistencies observed in the Wasserman data. To test if this second structure

of 7SK RNA was physiologically relevant, the structure of 7SK RNA before and after P-

TEFb release by flavopiridol was determined by primer extension (Figure 23B). This

was done by scaling up the immunoprecipitation protocol used for the release assays to

obtain 400 ng of RNA for 7SK structure analysis. Two liters of HeLa cells were grown

in spinner flasks, split in half and treated with either DMSO carrier as a control or with

flavopiridol to release P-TEFb from the 7SK snRNP. Lysates were made, LARP7

immunoprecipitation was performed, isolated complexes were washed, and then the

complexes were treated with CMCT to record the structure of 7SK locked in the 7SK

snRNP. Modification of uracil by CMCT blocks reverse transcription beyond the

modification site and results in the production of an RNA sensitivity ladder (Figure 23B).

The RNA was isolated and then primer extension was performed using AMV reverse

transcriptase and a radiolabled DNA primer to the 100-120 region or to the 70-90 region.

The 70-90 primer was used to obtain more band separation in the 1-50 region to better

visualize CMCT sensitivity at U28 and U30. Release of P-TEFb from the 7SK snRNP by

flavopiridol treatment resulted in significant changes in the structure of 7SK (Figure 24).

U28, U30 (Figure 24, 70-90), U66, and U68 (Figure 24, 100-120) all became much more

81

sensitive to CMCT after P-TEFb release compared with the untreated control. These

results confirm that the mFold structure represents the structure of the P-TEFb free form

of 7SK RNA(Figure 24). Additionally, in the mFold structure, U40/U41, U53/U54, and

U76 remain in single stranded regions and their sensitivities do not change significantly

after P-TEFb release, further supporting the existence of a conformational switch in 7SK

after P-TEFb release (Figure 24).

To determine if this conformational change occurred after P-TEFb release by

other agents, lysates were again made except one was incubated with 10 µg/mL of Tat

during the LARP7 immunoprecipitation. Tat was used because it can extract P-TEFb

directly from the 7SK snRNP and because U28, U30, U66, and U68 all reside in AUCUG

repeats on 7SK (Figure 22). Originally, it was thought that Tat stabilization these loops

in the mFold structure could facilitate release of P-TEFb; however, the lack of a

significant inhibition of Tat release after removal of the RNA binding domain of Tat

eliminated this as a possible mechanism for P-TEFb release. Incubation of the lysate

with Tat during the immunoprecipitation caused the complete release of P-TEFb from the

7SK snRNP (Figure 25A). As was observed with flavopiridol release, U28, U30, U66,

and U68 all became more sensitive after P-TEFb left the complex (Figure 25B). The

results of these CMCT modification and primer extension experiments support the idea

that a conformational change occurs in the structure of 7SK RNA after P-TEFb leaves the

7SK snRNP. The 7SK structural change data is summarized in Figure 25C.

A change in 7SK structure could be significant for P-TEFb regulation and release.

It has been shown that HEXIM1 does not require P-TEFb to bind to 7SK RNA in vitro

(Sedore et al., 2007). This is puzzling because HEXIM1 completely leaves the 7SK

snRNP after P-TEFb release in vivo (Figure 3, Chapter 2). It makes sense that HEXIM1

leaves 7SK RNA after P-TEFb release, because if it stayed, it would be able to inhibit P-

TEFb again, making this system of kinase activation completely worthless. The cell must

possess a mechanism to block the binding of HEXIM1 to the 7SK snRNP to effect

82

transcription. This could occur by post-translational modifications of HEXIM that block

P-TEFb or RNA binding, the binding of hnRNP proteins to the HEXIM binding site, or a

gross change in the structure of the RNA that removes the HEXIM1 binding site.

The Tat release experiments performed in Figure 14A actually provide clues to

which mechanism is at work here. If the release of HEXIM1 from 7SK was dependent

on hnRNP proteins or post-translational modifications of HEXIM1, it should not leave

the complex after Tat extraction of P-TEFb from washed in vivo isolated 7SK snRNP

complexes. If a conformational change in 7SK occurs after P-TEFb release, HEXIM1

should leave the complex along with P-TEFb. To determine what happens to HEXIM1

after Tat mediated release of P-TEFb in vitro, the membrane from the experiment

conducted in Figure 14A was re-probed for HEXIM1. Surprisingly, HEXIM1 was found

to leave the complex indicating that a change in RNA structure and not hnRNP proteins

or post-translational modifications of HEXIM are responsible for its loss from the 7SK

snRNP (Figure 25D).

Discussion

Regulating the release of P-TEFb from the 7SK snRNP is important for the

control of gene expression and cell viability. Although it is known that the majority of

P-TEFb in the cell is bound to and inhibited by the 7SK snRNP, it has not been

determined how the cell releases P-TEFb from this complex to promote transcription

elongation. The data presented in this chapter suggest that P-TEFb release from the 7SK

snRNP is not the direct result of post-translational modification. Proteins that bind

directly to P-TEFb are likely responsible for its release and recruitment of P-TEFb to

active chromatin. Although Myc, a known transcription activator, was not able to release

P-TEFb in this assay, both HIV Tat and Brd4 were. It was determined that the RNA

binding domain of Tat is not necessary or sufficient for release of P-TEFb from the 7SK

snRNP and this activity is wholly dependent on the interaction of the zinc binding region

83

of Tat. The RNA binding domain of Tat may be required for efficient transactivation, but

it is not required for Tat to release P-TEFb from the 7SK snRNP. Mimicking the

function of Tat, the C-terminal P-TEFb binding region of Brd4 was able to extract P-

TEFb from the 7SK snRNP demonstrating that it may play an important role in recruiting

P-TEFb to active chromatin. Finally, it was shown that a conformational change occurs

in 7SK snRNA after P-TEFb is released from the 7SK snRNP in vitro and in vivo. The

fact that HEXIM1 leaves the complex after in vitro release of P-TEFb by HIV Tat

indicates that a conformational change in 7SK is responsible for blocking HEXIM1 and

not post-translational modifications or competition with hnRNP proteins for 7SK

binding. The mechanisms involved in releasing P-TEFb from the 7SK snRNP that were

explored in this chapter are summarized in Figure 26.

Although these experiments were unable to show that post-translational

modification of the 7SK snRNP caused release of P-TEFb directly, post-translational

modification may be important for enhancing release efficiency or recognition of the

complex by extractors. For example, the Brd4 truncation used in this assay does not

contain either of the two bromodomains which bind to acetylated lysine. Acetylation of

P-TEFb by P300 could be important for the release of P-TEFb by serving as a Brd4

recognition mark. This would explain why free P-TEFb is acetylated while 7SK snRNP

bound P-TEFb is not.

Phosphorylation of the 7SK snRNP by PKC did not cause release of P-TEFb, but

phosphorylation of HEXIM may still play an important role in regulating P-TEFb. In

vitro assays have shown that HEXIM1 can bind to any RNA with double stranded

character to inhibit P-TEFb (Li et al., 2007). Even though HEXIM is released from the

7SK snRNP and its rebinding is blocked by a conformational change, it could still bind to

other small nuclear RNAs to inhibit P-TEFb. This has not been shown to occur

significantly in vivo, though HEXIM1 has been shown to associate with other small

RNAs (Li et al., 2007). One mechanism for preventing this from occurring would be to

84

modify the P-TEFb binding region of HEXIM. Phosphorylation of HEXIM1 by Akt

kinase was shown to occur on Ser268, Ser278, Thr270, and Thr276 which all reside in

the critical CyclinT1 binding pocket of HEXIM1. Although Akt kinase is a well

characterized cytoplasmic protein that gets anchored to the plasma membrane after

activation, there is a small body of literature indicating that the machinery of the

PI3K/Akt pathway functions in the nucleus (Ahn et al., 2004; Borgatti et al., 2000; Wang

and Brattain, 2006; Ye, 2005). Inhibition of P-TEFb after release from the 7SK snRNP

by HEXIM and an RNA other than 7SK may be a pedantic argument because P-TEFb

does not appear to ever really be “free.” It is either bound to HEXIM in the 7SK snRNP

or to Brd4 which competes competitively with HEXIM1 for binding to CyclinT1 and

wins.

The release of P-TEFb from the 7SK snRNP appears to be accomplished through

direct extraction by proteins that compete with HEXIM1 for binding to CyclinT1. In the

case of HIV, this results in the specific recruitment and tethering of P-TEFb to the HIV

promoter. Other recruiters of P-TEFb have been described for the activation of

transcription at cellular rather than viral sites of transcription. One of the more promising

candidates that was screened in the release assay was Myc which has been shown to

associate with P-TEFb, although these analyses were not highly robust (GST pulldown

and Co-immunoprecipitation) and do not prove the interaction of Myc with P-TEFb is

through direct contact (Eberhardy and Farnham, 2002; Gargano et al., 2007). The fact

that Myc cannot extract P-TEFb directly from the 7SK snRNP in the release assay

indicates that its interaction with P-TEFb does not compete with HEXIM for binding, it

requires DNA to cause a conformational change that allows P-TEFb binding, or that it is

associated with P-TEFb through another protein. A similar association has been

discovered to be involved with p65/RELA and Brd4, in which acetylation of p65/RELA

and association of Brd4 bound to P-TEFb is required for the expression of NF-κB target

genes (Huang et al., 2009).

85

How the RNA binding domain of Tat could function in P-TEFb release and Tat

transactivation is still a major unasnswered question. The RNA binding domain is

required for efficient transactivation in vivo (Kuppuswamy et al., 1989), but the fact that

its affinity for 7SK is greater than its affinity for TAR is puzzling (Sedore et al., 2007).

Further, the affinity of Tat for 7SK is completely unjustified from a P-TEFb release

perspective given that it cannot cause release on its own and loss of the RNA binding

domain does not diminish the ability of Tat to extract P-TEFb significantly. However,

the affinity experiments performed by Sedore et al. may not be accurate because naked in

vitro transcribed RNAs were used in these assays, not 7SK snRNPs, which could contain

proteins that mask Tat binding sites. Additionally, Tat binding to P-TEFb may increase

its affinity for TAR and provide a mechanism for Tat recruitment to TAR only after it has

bound to P-TEFb.

The extraction of P-TEFb from the 7SK snRNP by Brd4 provides a general

mechanism for recruitment of P-TEFb to active chromatin. Additionally, the recent

finding that human papillomavirus E2 protein inhibits viral oncogene expression by

blocking P-TEFb binding to the C-terminus of Brd4 underscores the importance of the

Brd4-PTEFb interaction in activating transcription (Yan et al., 2009). Finally, the effect

of Brd4 knockdown on the release of P-TEFb from the 7SK snRNP needs to be

completed to determine if this blocks P-TEFb release in vivo. The discovery of a general

mechanism for P-TEFb release that does not rely on post-translational modifications

would be highly significant.

The finding that a conformational change in 7SK occurs after P-TEFb release is

important for understanding how P-TEFb activity is regulated in the cell. The fact that

this conformational change results in the loss of HEXIM1 from the complex in the

absence of post-translational modifiers or large quantities of hnRNP proteins is

significant. The loss of HEXIM1 from this complex insures that the released P-TEFb is

able to localize to sites of transcription and promote RNAPII elongation. However, the

86

loss of HEXIM1 from the inhibitory complex poses another significant problem. If

HEXIM cannot rebind to the 7SK snRNP due to a conformational change in the RNA,

how is the complex reformed to inhibit P-TEFb after the transcription signal has passed?

This could occur through modifications to LARP7 or to the methyl cap of 7SK that alter

the ability of LARP7 to bind to 7SK and result in a switch back to the HEXIM accessible

RNA. Post-translational modifications commonly result in a reduced affinity of La for

RNAPIII transcripts (Bhattacharya et al., 2002; Chen et al., 2000; Fan et al., 1997; Sinha

et al., 1998). Finally, it is known that after P-TEFb and HEXIM leave in vivo that

hnRNP proteins along with an RNA helicase bind to the 7SK snRNP (Krueger et al.,

2008; Van Herreweghe et al., 2007). The hnRNP proteins may serve to protect 7SK and

stabilize the HEXIM unbound state, while the activity of the helicase may be regulated

and activated to convert 7SK back to the HEXIM accessible conformation.

A final mechanistic model is presented in Figure 27. To initiate transcription,

histones are aceylated and transcription factors are recruited to the promoter to initiate the

polymerase. Phosphorylation of the CTD by TFIIH results in the opening of the

transcription bubble and the first 30-50 bases of the transcript are transcribed until the

polymerase comes under the negative regulation of DSIF and NELF. Brd4 is recruited to

the acetylated lysines of both the histones and other transcription factors bound to the

promoter and waits until the 7SK snRNP comes close to the initiated promoter (Figure

27A). The C-terminus of Brd4 then binds to and extracts P-TEFb from the 7SK snRNP

and tethers it to the promoter region to phosphorylate the CTD of RNAPII on Ser2 and

also phosphorylate DSIF and NELF (Figure 27B). In the case of HIV Tat, Tat binds to

P-TEFb and extracts it from HEXIM (Figure 27C). Tat then recruits P-TEFb to the HIV

LTR by binding to the TAR element. P-TEFb then phosphorylates the CTD, DSIF, and

NELF (Figure 27D). These phosphorylation events lead to productive transcription

elongation. Since P-TEFb has left the 7SK snRNP, a structural change in the RNA

87

causes HEXIM to dissociate from the complex and the snRNP is then bound and

protected by the hnRNP proteins (Figure 27E).

88

Figure 14: Phosphorylation, dephosphorylation, and acetylation do not release P-TEFb

A) The 7SK snRNP was isolated from cell lysates, washed and then aliquoted. 4

µg or Rnase was added to one aliquot as a release control. Release was determined by

western analysis for CDK9. The loading control is LARP7. 2 ng of PKC alone was used

as an enzyme control. Since P-TEFb is a kinase, 1 mM ATP and 8 mM MgCl2 was

added alone as a control to show that the presence of ATP does not cause release. 0.02

ng, 0.2, and 2ng of PKC was titrated in to the release reaction. B) The same methods as

in A were used except 1U, 3U, or 10U of PP1α was titrated in to the release reaction. C)

Same as A except 200 ng of P300 alone was used as a control. 20 ng, 60 ng, or 200 ng of

P300 was titrated in to the reaction. IP – Immunoprecipitation control

90

Figure 15: Negative elongation factors, Myc, and ATP analogs do not cause release of P-TEFb

A) The same methods as in Figure 13 were used for these reactions. 10 ng, 30 ng,

100 ng, 300 ng, 900 ng, or 1800 ng of DSIF was titrated in to the reactions. B) 30 ng,

100 ng, 300 ng, or 900 ng of Gdown1 was added in to the release reactions. C) 10 ng, 30

ng, 100 ng, or 300 ng of Myc was titrated in to the release reactions. D) The release

reactions were titrated with 12.5 µM, 25 µM, 50 µM, or 100 µM of DRB or 125 nM, 250

nM, 500 nM or 1 mM of flavopiridol.

92

Figure 16: Schematic of mutants and expression in E. coli

A) A schematic of the mutants used. TatR52/53A has a mutation in its RNA

binding domain that prevents it from binding to RNA. TatC22G22G has a mutation in its

zinc binding domain that prevents it from binding P-TEFb. ZBD - zinc binding domain

(P-TEFb binding domain), RBD – RNA binding domain. B) TatR52/53A52/53A

expression in E. coli showing FPLC fractions. C) Same as B for Tat. FPLC and

silverstain by Jeff Cooper, cloning, expression, and purification by Brian Krueger.

94

Figure 17: HIV Tat and an RNA binding deficient Tat release P-TEFb directly from the 7SK snRNP

A) Reactions were performed using the same methods as in Figure 13. 10 ng, 30

ng, 300 ng of Tat was titrated in to the reaction or 100 ng of Tat and the reaction was

incubated for 3, 10, or 30 minutes at room temperature. B) Same as in A except

TatR52/53A, the RNA binding deficient mutant of Tat was used. C) Same as in A except

the P-TEFb binding deficient mutant of Tat was used.

96

Figure 18: Summary and quantification of Tat release data

Tat release was quantified from three independent experiments for wild type Tat

(Tat) and the RNA binding mutant (Tat R52/53A). Two independent experiments were

done to calculate the mean for the P-TEFb binding mutant of Tat (Tat C22G). All error

bars represent standard error. The y-axis is a measure of percent of Cdk9 left in the

complex. Wild-type Tat – Blue, TatR52/53A RNA binding mutant Tat – Red, TatC22G

P-TEFb binding mutant - Green

98

Figure 19: The RNA binding domain of Tat is not required for P-TEFb release

A) For these experiments, a TAR or 7SK RNA competition was set up. As a

control to set the basal level of Tat release, Tat was added to one reaction without an

RNA competitor. 100 ng of Tat was pre-incubated for 15 minutes with 2 ng, 6 ng, or 18

ng of TAR or 10 ng, 30 ng, or 100 ng of 7SK. The 7SK snRNP was then added back and

CDK9 release was determined. B) Same as in A except TatR52/53A, the RNA binding

mutant of Tat, was used.

100

Figure 20: Brd4 can extract P-TEFb directly from the 7SK snRNP

A) A schematic of the mutants used. Brd4 1209-1362 contains only the helical

regions required for P-TEFb binding, Brd4 1209-1362 ∆1329-1345 is missing helical

region 3 which is required for P-TEFb binding. BD1 – Bromodomain 1, BD2 –

Bromodomain 2, ET – Extraterminal domain, H1 – Helical domain 1, H2 - Helical

domain 2, H3- Helical domain 3. B) E. coli expression of recombinant protein showing

the purity of the flowthrough fractions used. A contaminating band can be seen in the

Brd4 mutant and this is most likely an E. coli protein and not full length Brd4. M –

Marker, 1 - Brd4 1209-1362, 2 - Brd4 1209-1362 ∆1329-1345. FPLC purification and

Silver stain by Jeff Cooper. C) Brd4 was titrated in to the release reaction at 30, 100, 300

or 900ng for 15 minutes or the reactions contained 200ng of Brd4 for 3, 10, or 30

minutes. D) Same as in C except the Brd4 mutant missing helical domain 3 was used for

the reactions.

102

Figure 21: Summary and quantification of the Brd4 release data

Brd4 release was quantified from three independent experiments. Two

independent experiments were done to calculate the mean for the Brd4 helical domain 3

mutant (Brd4M). All error bars represent standard error. The y-axis is a measure of

percent of Cdk9 left in the complex. Brd4 – Purple, Brd4M - Blue

104

Figure 22: Schematic of TAR and 7SK RNA secondary structure

HIV-1 TAR RNA stem loop, 35-61 of TAR RNA covering the Tat binding bulge

(AUCUG) and the CyclinT1 binding loop (CUGGG). mFold predicted, Predicted

structure of the 1-100 region of 7SK. Wassarman, Structure of the 1-100 region of 7SK

RNA described by Wassarman and Steitz (Wassarman and Steitz, 1991). The Uracil

residues in 7SK RNA are marked, orange dashed circles highlight AUCUG regions and

blue dashed circles highlight CUGGG or CUGCG regions of RNA.

106

Figure 23: CMCT modification and primer extension

A) CMCT covalently modifies N-3 of uracil. B) Radioactively labeled primers

are hybridized with CMCT modified RNA for primer extension by reverse transcriptase.

CMCT modification (denoted by asterisks) prevents further extension of the primer by

reverse transcriptase. The extension ladder is then visualized on 12% acrylanide gels.

108

Figure 24: Release of P-TEFb by flavopiridol causes a conformational change in 7SK

Primer extension over the 1-70 region (70-90 primer) and the 1-100 region (100-

120 primer) are shown along with a sequencing ladder showing the position of uracil in

the RNA. The mFold and Wassarman (Wassarman and Steitz, 1991) structures are

included for a comparison of sensitivities. Green asterisk marks U28 and U30 on both

structures and the extension scans, the red asterisk marks U66 and U68.

110

Figure 25: Tat release of P-TEFb from the 7SK snRNP causes a conformational change in 7SK and results in HEXIM release from the complex

A) Western analysis of Tat release from the 7SK snRNP after co-incubation of

Tat and immunoprecipitation media. LARP7 and CDK9 were analyzed by western. I –

Input, C – Control, T – Tat treated, Bound – Bound to the beads, FT – Flow through from

the beads. B) Primer extension analysis of the 1-70 (70-90 primer) and the 1-100 (100-

120 primer) regions of 7SK RNA structure. Asterisks are the same as in Figure 21 to

refer back to the structures. C) Graphical summary of the 7SK structural change data.

Bases with single stranded character are boxed in black. Bases bound in double stranded

character are unboxed. Uracils of interest are highlighted with structural change

information. Asterisk – change in character, minus – No change in character. D) Re-

analysis of the Tat release analysis performed in Figure 13A to determine HEXIM1

release.

112

Figure 26: Model of P-TEFb release from the 7SK snRNP

A model of factors and modifications that may be important for P-TEFb release

from the 7SK snRNP. These include decay of 7SK snRNA or changes to its structure,

competition or extraction of P-TEFb by specific factors such as HIV Tat and Brd4, Post-

translational modifications to P-TEFb or HEXIM. P-TEFb can be acetylated on lysine

404 by P300, but this does not lead to release directly in the in vitro assay (Cho et al.,

2009). P-TEFb can undergo dephosphorylation of its T-Loop at Threonine 186 by PP1α

(Chen et al., 2008). Phosphorylation of HEXIM has been shown to occur by Akt in the

P-TEFb binding domain of HEXIM at Threonine 270 and at Serine 278. The RNA

binding region of HEXIM can also be phosphorylated in vitro by PKC preventing the

binding to 7SK RNA and preventing the inhibition of P-TEFb (unpublished data).

114

Figure 27: Model of P-TEFb release by Brd4 and Tat

A) Histones are aceylated and transcription factors are recruited to the promoter

to initiate the polymerase. Phosphorylation of the CTD by TFIIH results in the opening

of the transcription bubble and the first 30-50 bases of the transcript are transcribed until

the polymerase comes under the negative regulation of DSIF and NELF. Brd4 is

recruited to acetylated lysines and waits until the 7SK snRNP comes close to the initiated

promoter. B) The C-terminus of Brd4 binds to and extracts P-TEFb from the 7SK snRNP

and tethers it to the promoter region to phosphorylate the CTD of RNAPII on Ser2 and

also phosphorylate DSIF and NELF. C) In the case of HIV Tat, Tat binds to P-TEFb and

extracts it from HEXIM. D) Tat recruits P-TEFb to the HIV LTR by binding to the TAR

element. This results in CTD, DSIF, and NELF phosphorylation. E) These

phosphorylation events lead to productive transcription elongation. Since P-TEFb has

left the 7SK snRNP, a structural change in the RNA forces HEXIM out of the complex

and the snRNP is then bound and protected by the hnRNP proteins.

116

CHAPTER 5

SUMMARY AND FUTURE DIRECTIONS

Proper expression of the genetic information is critical for normal cell function

and survival. This is highlighted exquisitely in cancer where the checks and balances that

are normally in place to ensure proper gene expression are lost and lead to unregulated

growth and proliferation. Tight control of gene expression is also required during

development where specific genetic programs are activated to produce specialized cells

and tissues. The role of transcription regulation of gene expression has been studied for

nearly half of a century; however, the majority of these studies have focused on

transcription initiation because it was believed that the regulation of polymerase loading

was the limiting step in gene expression. The discovery that polymerase complexes poise

or pause after initiation has been studied for 20 years, but many in the transcription field

believed that this pausing was a special case at specific genes or an artifact of in vitro

transcription assays. Recently, it was shown that 80% of actively transcribe genes have

paused polymerases just downstream of their promoters (Guenther et al., 2007; Muse et

al., 2007; Zeitlinger et al., 2007). Regulation of transcription elongation has since been

accepted as an important control point for gene expression. The protein responsible for

releasing the polymerase from this paused state is P-TEFb.

Poised polymerases are thought to exist to provide the cell with the ability to

rapidly respond to stress or environmental changes that require differential gene

expression. P-TEFb is a potent activator of transcription and its activity in the cell is

regulated by its sequestration in the 7SK snRNP. How P-TEFb release from this

complex is regulated has been the topic of intense research, but few questions have been

answered. The focus of the research presented in this thesis was to determine how P-

TEFb releases from the 7SK snRNP. In Chapter 2, the discovery and function of the 7SK

stability protein, LARP7, was discussed. In Chapter 3, the conservation of the 7SK

117

snRNP and its function in Drosophila melanogaster was characterized. Finally, Chapter

4 explored how both viral and cellular factors exploit P-TEFb to promote gene

expression.

LARP7 Stabilizes 7SK snRNA in Human Cells

In human cells P-TEFb is inhibited by the 7SK snRNP. LARP7 was found to be

an important stability factor that binds to and protects the RNA component of the RNP

from degradation. This is highlighted by the fact that loss of LARP7 through RNAi

knock down resulted in a significant reduction in the total amount of 7SK RNA in the

cell. Loss of LARP7 also caused a small but significant increase in the amount of free P-

TEFb ultimately resulting in the activation of a compensatory mechanism to reduce the

total amount of P-TEFb in the cell. Glycerol gradient sedimentation analysis and co-

immunoprecipitations showed that LARP7 is bound to 7SK in the snRNP regardless of

the presence of P-TEFb or HEXIM.

In the future, it would be interesting to determine how modifications to LARP7 or

7SK affect the association of LARP7 with the complex. Although LARP7 associates

with a mature RNP, its association with the RNP may be regulated. The association of

La protein with RNAPIII transcripts is regulated by post-translational modifications or

post-transcriptional modifications to its target RNAs. It would not be surprising if the

association of LARP7 with 7SK was similarly regulated. This could be done by

determining the 5′ and 3′ characteristics of 7SK RNA that are required for LARP7

association. The post-translational modification state of LARP7 before and after P-TEFb

release could also be examined to determine if specific residues are modified to promote

P-TEFb binding or release from the complex. This could easily be done by isolating the

7SK snRNP and submitting preparations for mass spectrometry analysis of LARP7.

118

Conservation and Regulation of P-TEFb by the 7SK snRNP

in Drosophila

The existence and function of P-TEFb through Drosophila was known, but it was

not known whether P-TEFb was regulated similarly in Drosophila or relied on a more

primitive control mechanism. A bioinformatic screen showed that Drosophila appeared

to possess homologues of HEXIM and LARP7. The function of these proteins was then

determined by glycerol gradient analysis and co-immunprecipitations which showed that

dHEXIM, dLARP7, and the CyclinT component of P-TEFb co-sediment with one

another in an Rnase sensitive complex and that all co-immunoprecipitate with one

another. The discovery of the RNA component of the complex was confirmed and it was

shown that all three proteins are capable of associating with the RNA in vivo.

Additionally, work by a previous graduate student on this project showed that dHEXIM,

dLARP7, and CyclinT mimic their human counterparts with respect to their response

after transcription inhibition: dLAPR7 stays associated with the d7SK snRNP while

dHEXIM and CyclinT leave the complex. Characterization of this complex was an

important first step before Drosophila could be used as a model to study P-TEFb

regulation during development.

The necessity of P-TEFb and the 7SK snRNP during development is currently

being studied by our collaborators in the Matera Lab at UNC. It is assumed that P-TEFb

is an important factor in regulating embryonic development because it relieves stalled

polymerases and promotes the majority of RNAPII transcription elongation,. Its

requirement in terminal differentiation of muscle tissue and heart development has been

studied in mice, but its role in embryonic development has not been characterized. The

preliminary data from flies indicate that P-TEFb and the 7SK snRNP are present,

although differentially expressed during embryonic, larval, and adult development.

Studies characterizing the effect of complete loss of this complex will shed light on the

importance of P-TEFb during proper embryonic development.

119

Regulated Release of P-TEFb from the 7SK snRNP for

Viral and Cellular Gain

P-TEFb regulation of stalled polymerases has been studied in detail; however, the

mechanisms regulating its release from the 7SK snRNP have remained elusive. It has

been known since 1997 that P-TEFb is the cellular kinase required for HIV Tat

transactivation. It was later discovered that Tat accomplishes this by binding directly to

P-TEFb and recruiting it to the HIV LTR. How Tat extracts P-TEFb from the 7SK

snRNP was not known. The data presented here show that Tat is able to extract P-TEFb

directly from the 7SK snRNP. The role of the zinc binding and RNA binding domains of

Tat were further characterized and it was shown that Tat extraction of P-TEFb is

dependent on the zinc binding region and not the RNA binding region. Like many viral

proteins, the cell has at least one protein that can mimic the actions of Tat. The

bromodomain protein Brd4 contains a P-TEFb binding domain that can also bind to P-

TEFb and extract it directly from the 7SK snRNP. Although post-translational

modifications of P-TEFb and HEXIM were thought to be important for the release of P-

TEFb from the 7SK snRNP, none of these modifications were able to do so directly.

Finally, the release of P-TEFb is followed by the concomitant release of HEXIM1 due to

a conformational change of 7SK snRNA that prevents HEXIM1 binding to ensure that

released P-TEFb arrives at its target to activate transcription.

The future directions for this research are numerous. The role of the RNA

binding domain of Tat is still not clear. It is known to bind to TAR RNA, but has greater

affinity for 7SK snRNA. The physiological relevance of this in the pathogenesis of HIV

infection needs to be explored further. Does the affinity of Tat for 7SK change after Tat

binds to P-TEFb? Do the Tat binding sites in 7SK serve any function, or is Tat binding

to 7SK a non-functional evolutionary artifact? The presence of 3 Tat binding sequences

in the first 100 bases of 7SK is not likely to be a coincidence and the conservation of

120

these AUCUG repeats through Drosophila only further underscores their likely

importance in 7SK snRNP regulation of P-TEFb.

Although an endogenous protein capable of releasing P-TEFb from the 7SK

snRNP was discovered, its role in this process was not conclusively confirmed in vivo.

Knockdown of Brd4 followed by P-TEFb release signal such as flavopiridol treatment

must be conducted to determine if the loss of Brd4 prevents the rapid global release of P-

TEFb from the 7SK snRNP. Though a mechanism for release has been discovered, more

questions are raised about how P-TEFb is recruited back to the 7SK snRNP after the need

for upregulation of transcription subsides. The mechanisms regulating P-TEFb release

from Brd4 and chromatin should be explored.

The conformational change in 7SK RNA that results in the release of HEXIM1

from the 7SK snRNP is very interesting. The role that the hnRNPs or the RNA helicase

play in facilitating the maintenance or reversal of this change needs to be followed up on.

Additionally, how post-translational modifications of P-TEFb and HEXIM actually

regulate transcription should be determined. Are these modifications required for the

recruitment of P-TEFb to transcriptionally active sites, or are they only a result of P-

TEFb being in close proximity to non-specific enzymes.

121

REFERENCES

Ahn JY, Rong R, Liu X, Ye K (2004). PIKE/nuclear PI 3-kinase signaling mediates the antiapoptotic actions of NGF in the nucleus. EMBO J 23: 3995-4006. Alvi AJ, Austen B, Weston VJ, Fegan C, MacCallum D, Gianella-Borradori A et al (2005). A novel CDK inhibitor, CYC202 (R-roscovitine), overcomes the defect in p53-dependent apoptosis in B-CLL by down-regulation of genes involved in transcription regulation and survival. Blood 105: 4484-91. Ansari A, Hampsey M (2005). A role for the CPF 3'-end processing machinery in RNAP II-dependent gene looping. Genes Dev 19: 2969-78. Bagella L, MacLachlan TK, Buono RJ, Pisano MM, Giordano A, De Luca A (1998). Cloning of murine CDK9/PITALRE and its tissue-specific expression in development. J Cell Physiol 177: 206-13. Barboric M, Lenasi T, Chen H, Johansen EB, Guo S, Peterlin BM (2009). 7SK snRNP/P-TEFb couples transcription elongation with alternative splicing and is essential for vertebrate development. Proc Natl Acad Sci U S A 106: 7798-803. Barboric M, Nissen RM, Kanazawa S, Jabrane-Ferrat N, Peterlin BM (2001). NF-kappaB binds P-TEFb to stimulate transcriptional elongation by RNA polymerase II. Mol Cell 8: 327-37. Barboric M, Yik JH, Czudnochowski N, Yang Z, Chen R, Contreras X et al (2007). Tat competes with HEXIM1 to increase the active pool of P-TEFb for HIV-1 transcription. Nucleic Acids Res 35: 2003-12. Bark-Jones SJ, Webb HM, West MJ (2006). EBV EBNA 2 stimulates CDK9-dependent transcription and RNA polymerase II phosphorylation on serine 5. Oncogene 25: 1775-85. Barrandon C, Bonnet F, Nguyen VT, Labas V, Bensaude O (2007). The transcription-dependent dissociation of P-TEFb-HEXIM1-7SK RNA relies upon formation of hnRNP-7SK RNA complexes. Mol Cell Biol 27: 6996-7006. Belanger F, Baigude H, Rana TM (2009). U30 of 7SK RNA forms a specific photo-cross-link with Hexim1 in the context of both a minimal RNA-binding site and a fully reconstituted 7SK/Hexim1/P-TEFb ribonucleoprotein complex. J Mol Biol 386: 1094-107. Bentley D (1999). Coupling RNA polymerase II transcription with pre-mRNA processing. Curr Opin Cell Biol 11: 347-51. Bhattacharya R, Perumal K, Sinha K, Maraia R, Reddy R (2002). Methylphosphate cap structure in small RNAs reduces the affinity of RNAs to La protein. Gene Expr 10: 243-53. Biewenga P, Buist MR, Moerland PD, Ver Loren van Themaat E, van Kampen AH, ten Kate FJ et al (2008). Gene expression in early stage cervical cancer. Gynecol Oncol 108: 520-6.

122

Bisgrove DA, Mahmoudi T, Henklein P, Verdin E (2007). Conserved P-TEFb-interacting domain of BRD4 inhibits HIV transcription. Proc Natl Acad Sci U S A 104: 13690-5. Boelens WC, Palacios I, Mattaj IW (1995). Nuclear retention of RNA as a mechanism for localization. Rna 1: 273-83. Borgatti P, Martelli AM, Bellacosa A, Casto R, Massari L, Capitani S et al (2000). Translocation of Akt/PKB to the nucleus of osteoblast-like MC3T3-E1 cells exposed to proliferative growth factors. FEBS Lett 477: 27-32. Brasier AR (2008). Expanding role of cyclin dependent kinases in cytokine inducible gene expression. Cell Cycle 7: 2661-6. Byers SA, Price JP, Cooper JJ, Li Q, Price DH (2005). HEXIM2, a HEXIM1-related protein, regulates positive transcription elongation factor b through association with 7SK. J Biol Chem 280: 16360-7. Chen R, Liu M, Li H, Xue Y, Ramey WN, He N et al (2008). PP2B and PP1alpha cooperatively disrupt 7SK snRNP to release P-TEFb for transcription in response to Ca2+ signaling. Genes Dev 22: 1356-68. Chen R, Yang Z, Zhou Q (2004). Phosphorylated positive transcription elongation factor b (P-TEFb) is tagged for inhibition through association with 7SK snRNA. J Biol Chem 279: 4153-60. Chen Y, Sinha K, Perumal K, Reddy R (2000). Effect of 3' terminal adenylic acid residue on the uridylation of human small RNAs in vitro and in frog oocytes. RNA 6: 1277-88. Cheng B, Price DH (2007). Properties of RNA polymerase II elongation complexes before and after the P-TEFb-mediated transition into productive elongation. J Biol Chem 282: 21901-12. Chiu YL, Cao H, Jacque JM, Stevenson M, Rana TM (2004). Inhibition of human immunodeficiency virus type 1 replication by RNA interference directed against human transcription elongation factor P-TEFb (CDK9/CyclinT1). J Virol 78: 2517-29. Cho S, Schroeder S, Kaehlcke K, Kwon HS, Pedal A, Herker E et al (2009). Acetylation of cyclin T1 regulates the equilibrium between active and inactive P-TEFb in cells. EMBO J 28: 1407-17. Chodosh LA, Fire A, Samuels M, Sharp PA (1989). 5,6-Dichloro-1-beta-D-ribofuranosylbenzimidazole inhibits transcription elongation by RNA polymerase II in vitro. J Biol Chem 264: 2250-7. Comai L, Tanese N, Tjian R (1992). The TATA-binding protein and associated factors are integral components of the RNA polymerase I transcription factor, SL1. Cell 68: 965-76. Conaway RC, Conaway JW (1993). General initiation factors for RNA polymerase II. Annu Rev Biochem 62: 161-90. Consortium CSaA (2005). Initial sequence of the chimpanzee genome and comparison with the human genome. Nature 437: 69-87.

123

Contreras X, Barboric M, Lenasi T, Peterlin BM (2007). HMBA releases P-TEFb from HEXIM1 and 7SK snRNA via PI3K/Akt and activates HIV transcription. PLoS Pathog 3: 1459-69. Copeland CC, Marz M, Rose D, Hertel J, Brindley PJ, Bermudez-Santana C et al (2009). Homology-based annotation of non-coding RNAs in the genomes of Schistosoma mansoni and Schistosoma japonicum. BMC Genomics 10: 464. Cormack BP, Struhl K (1992). The TATA-binding protein is required for transcription by all three nuclear RNA polymerases in yeast cells. Cell 69: 685-96. Cottone G, Baldi A, Palescandolo E, Manente L, Penta R, Paggi MG et al (2006). Pkn is a novel partner of cyclin T2a in muscle differentiation. J Cell Physiol 207: 232-7. Darst SA, Edwards AM, Kubalek EW, Kornberg RD (1991). Three-dimensional structure of yeast RNA polymerase II at 16 A resolution. Cell 66: 121-8. Dey A, Chao SH, Lane DP (2007). HEXIM1 and the control of transcription elongation: from cancer and inflammation to AIDS and cardiac hypertrophy. Cell Cycle 6: 1856-63. Dingwall C, Ernberg I, Gait MJ, Green SM, Heaphy S, Karn J et al (1990). HIV-1 tat protein stimulates transcription by binding to a U-rich bulge in the stem of the TAR RNA structure. EMBO J 9: 4145-53. Dingwall C, Ernberg I, Gait MJ, Green SM, Heaphy S, Karn J et al (1989). Human immunodeficiency virus 1 tat protein binds trans-activation-responsive region (TAR) RNA in vitro. Proc Natl Acad Sci U S A 86: 6925-9. Eberhardy SR, Farnham PJ (2002). Myc recruits P-TEFb to mediate the final step in the transcriptional activation of the cad promoter. J Biol Chem 277: 40156-62. Egloff S, Van Herreweghe E, Kiss T (2006). Regulation of polymerase II transcription by 7SK snRNA: two distinct RNA elements direct P-TEFb and HEXIM1 binding. Mol Cell Biol 26: 630-42. Endo S, Kubota S, Siomi H, Adachi A, Oroszlan S, Maki M et al (1989). A region of basic amino-acid cluster in HIV-1 Tat protein is essential for trans-acting activity and nucleolar localization. Virus Genes 3: 99-110. Fairley JA, Kantidakis T, Kenneth NS, Intine RV, Maraia RJ, White RJ (2005). Human La is found at RNA polymerase III-transcribed genes in vivo. Proc Natl Acad Sci U S A 102: 18350-5. Falco GD, Neri LM, Falco MD, Bellan C, Yu Z, Luca AD et al (2002). Cdk9, a member of the cdc2-like family of kinases, binds to gp130, the receptor of the IL-6 family of cytokines. Oncogene 21: 7464-70. Fan H, Goodier JL, Chamberlain JR, Engelke DR, Maraia RJ (1998). 5' processing of tRNA precursors can Be modulated by the human La antigen phosphoprotein. Mol Cell Biol 18: 3201-11. Fan H, Sakulich AL, Goodier JL, Zhang X, Qin J, Maraia RJ (1997). Phosphorylation of the human La antigen on serine 366 can regulate recycling of RNA polymerase III transcription complexes. Cell 88: 707-15.

124

Frankel AD (1992). Activation of HIV transcription by Tat. Curr Opin Genet Dev 2: 293-8. Gao N, Kramer L, Rahmani M, Dent P, Grant S (2006). The three-substituted indolinone cyclin-dependent kinase 2 inhibitor 3-[1-(3H-imidazol-4-yl)-meth-(Z)-ylidene]-5-methoxy-1,3-dihydro-indol-2-on e (SU9516) kills human leukemia cells via down-regulation of Mcl-1 through a transcriptional mechanism. Mol Pharmacol 70: 645-55. Garber ME, Wei P, KewalRamani VN, Mayall TP, Herrmann CH, Rice AP et al (1998). The interaction between HIV-1 Tat and human cyclin T1 requires zinc and a critical cysteine residue that is not conserved in the murine CycT1 protein. Genes Dev 12: 3512-27. Gargano B, Amente S, Majello B, Lania L (2007). P-TEFb is a crucial co-factor for Myc transactivation. Cell Cycle 6: 2031-7. Garriga J, Bhattacharya S, Calbo J, Marshall RM, Truongcao M, Haines DS et al (2003). CDK9 is constitutively expressed throughout the cell cycle, and its steady-state expression is independent of SKP2. Mol Cell Biol 23: 5165-73. Giacinti C, Bagella L, Puri PL, Giordano A, Simone C (2006). MyoD recruits the cdk9/cyclin T2 complex on myogenic-genes regulatory regions. J Cell Physiol 206: 807-13. Goodier JL, Fan H, Maraia RJ (1997). A carboxy-terminal basic region controls RNA polymerase III transcription factor activity of human La protein. Mol Cell Biol 17: 5823-32. Grimm C, Lund E, Dahlberg JE (1997). In vivo selection of RNAs that localize in the nucleus. Embo J 16: 793-806. Gruber AR, Kilgus C, Mosig A, Hofacker IL, Hennig W, Stadler PF (2008a). Arthropod 7SK RNA. Mol Biol Evol 25: 1923-30. Gruber AR, Koper-Emde D, Marz M, Tafer H, Bernhart S, Obernosterer G et al (2008b). Invertebrate 7SK snRNAs. J Mol Evol 66: 107-15. Guenther MG, Levine SS, Boyer LA, Jaenisch R, Young RA (2007). A chromatin landmark and transcription initiation at most promoters in human cells. Cell 130: 77-88. Guo S, Yamaguchi Y, Schilbach S, Wada T, Lee J, Goddard A et al (2000). A regulator of transcriptional elongation controls vertebrate neuronal development. Nature 408: 366-9. He N, Jahchan NS, Hong E, Li Q, Bayfield MA, Maraia RJ et al (2008). A La-related protein modulates 7SK snRNP integrity to suppress P-TEFb-dependent transcriptional elongation and tumorigenesis. Mol Cell 29: 588-99. He N, Pezda AC, Zhou Q (2006). Modulation of a P-TEFb functional equilibrium for the global control of cell growth and differentiation. Mol Cell Biol 26: 7068-76.

125

Hou T, Ray S, Brasier AR (2007). The functional role of an interleukin 6-inducible CDK9.STAT3 complex in human gamma-fibrinogen gene expression. J Biol Chem 282: 37091-102. Huang B, Yang XD, Zhou MM, Ozato K, Chen LF (2009). Brd4 coactivates transcriptional activation of NF-kappaB via specific binding to acetylated RelA. Mol Cell Biol 29: 1375-87. Huang F, Wagner M, Siddiqui MA (2002). Structure, expression, and functional characterization of the mouse CLP-1 gene. Gene 292: 245-59. Huang F, Wagner M, Siddiqui MA (2004). Ablation of the CLP-1 gene leads to down-regulation of the HAND1 gene and abnormality of the left ventricle of the heart and fetal death. Mech Dev 121: 559-72. Intine RV, Sakulich AL, Koduru SB, Huang Y, Pierstorff E, Goodier JL et al (2000). Control of transfer RNA maturation by phosphorylation of the human La antigen on serine 366. Mol Cell 6: 339-48. Jang MK, Mochizuki K, Zhou M, Jeong HS, Brady JN, Ozato K (2005). The bromodomain protein Brd4 is a positive regulatory component of P-TEFb and stimulates RNA polymerase II-dependent transcription. Mol Cell 19: 523-34. Jenuwein T, Allis CD (2001). Translating the histone code. Science 293: 1074-80. Jeronimo C, Forget D, Bouchard A, Li Q, Chua G, Poitras C et al (2007). Systematic analysis of the protein interaction network for the human transcription machinery reveals the identity of the 7SK capping enzyme. Mol Cell 27: 262-74. Jiang Y, Liu M, Spencer CA, Price DH (2004). Involvement of transcription termination factor 2 in mitotic repression of transcription elongation. Mol Cell 14: 375-85. Kanazawa S, Okamoto T, Peterlin BM (2000). Tat competes with CIITA for the binding to P-TEFb and blocks the expression of MHC class II genes in HIV infection. Immunity 12: 61-70. Kanazawa S, Peterlin BM (2001). Combinations of dominant-negative class II transactivator, p300 or CDK9 proteins block the expression of MHC II genes. Int Immunol 13: 951-8. Kanazawa S, Soucek L, Evan G, Okamoto T, Peterlin BM (2003). c-Myc recruits P-TEFb for transcription, cellular proliferation and apoptosis. Oncogene 22: 5707-11. Kawauchi J, Mischo H, Braglia P, Rondon A, Proudfoot NJ (2008). Budding yeast RNA polymerases I and II employ parallel mechanisms of transcriptional termination. Genes Dev 22: 1082-92. Kiernan RE, Emiliani S, Nakayama K, Castro A, Labbe JC, Lorca T et al (2001). Interaction between cyclin T1 and SCF(SKP2) targets CDK9 for ubiquitination and degradation by the proteasome. Mol Cell Biol 21: 7956-70. Killeen M, Coulombe B, Greenblatt J (1992). Recombinant TBP, transcription factor IIB, and RAP30 are sufficient for promoter recognition by mammalian RNA polymerase II. J Biol Chem 267: 9463-6.

126

Krueger BJ, Jeronimo C, Roy BB, Bouchard A, Barrandon C, Byers SA et al (2008). LARP7 is a stable component of the 7SK snRNP while P-TEFb, HEXIM1 and hnRNP A1 are reversibly associated. Nucleic Acids Res 36: 2219-29. Kuppuswamy M, Subramanian T, Srinivasan A, Chinnadurai G (1989). Multiple functional domains of Tat, the trans-activator of HIV-1, defined by mutational analysis. Nucleic Acids Res 17: 3551-61. Kurosu T, Peterlin BM (2004). VP16 and ubiquitin; binding of P-TEFb via its activation domain and ubiquitin facilitates elongation of transcription of target genes. Curr Biol 14: 1112-6. Kusuhara M, Nagasaki,K., Kimura,K., Maass,N., Manabe,T., Ishikawa,S., Aikawa,M., Miyazaki,K. and Yamaguchi,K. (1999). Cloning of hexamethylene-bis-acetamide-inducible transcript, HEXIM1, in human vascular smooth muscle cells. Biomed. Res. 20: 273-279. Laspia MF, Rice AP, Mathews MB (1989). HIV-1 Tat protein increases transcriptional initiation and stabilizes elongation. Cell 59: 283-92. Lee DK, Chang C (2003). Molecular communication between androgen receptor and general transcription machinery. J Steroid Biochem Mol Biol 84: 41-9. Lee DK, Duan HO, Chang C (2001). Androgen receptor interacts with the positive elongation factor P-TEFb and enhances the efficiency of transcriptional elongation. J Biol Chem 276: 9978-84. Li Q, Cooper JJ, Altwerger GH, Feldkamp MD, Shea MA, Price DH (2007). HEXIM1 is a promiscuous double-stranded RNA-binding protein and interacts with RNAs in addition to 7SK in cultured cells. Nucleic Acids Res 35: 2503-12. Maraia RJ, Intine RV (2001). Recognition of nascent RNA by the human La antigen: conserved and divergent features of structure and function. Mol Cell Biol 21: 367-79. Marshall NF, Price DH (1995). Purification of P-TEFb, a transcription factor required for the transition into productive elongation. J Biol Chem 270: 12335-8. Marshall RM, Grana X (2006). Mechanisms controlling CDK9 activity. Front Biosci 11: 2598-613. Marz M, Donath A, Verstraete N, Nguyen VT, Stadler PF, Bensaude O (2009a). Evolution of 7SK RNA and its protein partners in metazoa. Mol Biol Evol 26: 2821-30. Marz M, Donath A, Verstraete N, Nguyen VT, Stadler PF, Bensaude O (2009b). Evolution of 7SK RNA and its Protein Partners in Metazoa. Mol Biol Evol. Meredith GD, Chang WH, Li Y, Bushnell DA, Darst SA, Kornberg RD (1996). The C-terminal domain revealed in the structure of RNA polymerase II. J Mol Biol 258: 413-9. Michels AA, Fraldi A, Li Q, Adamson TE, Bonnet F, Nguyen VT et al (2004). Binding of the 7SK snRNA turns the HEXIM1 protein into a P-TEFb (CDK9/cyclin T) inhibitor. EMBO J 23: 2608-19.

127

Michels AA, Nguyen VT, Fraldi A, Labas V, Edwards M, Bonnet F et al (2003). MAQ1 and 7SK RNA interact with CDK9/cyclin T complexes in a transcription-dependent manner. Mol Cell Biol 23: 4859-69. Mori Y, Sato F, Selaru FM, Olaru A, Perry K, Kimos MC et al (2002). Instabilotyping reveals unique mutational spectra in microsatellite-unstable gastric cancers. Cancer Res 62: 3641-5. Muse GW, Gilchrist DA, Nechaev S, Shah R, Parker JS, Grissom SF et al (2007). RNA polymerase is poised for activation across the genome. Nat Genet 39: 1507-11. Neugebauer KM (2002). On the importance of being co-transcriptional. J Cell Sci 115: 3865-71. Nguyen VT, Kiss T, Michels AA, Bensaude O (2001). 7SK small nuclear RNA binds to and inhibits the activity of CDK9/cyclin T complexes. Nature 414: 322-5. O'Sullivan JM, Tan-Wong SM, Morillon A, Lee B, Coles J, Mellor J et al (2004). Gene loops juxtapose promoters and terminators in yeast. Nat Genet 36: 1014-8. Ohndorf UM, Steegborn C, Knijff R, Sondermann P (2001). Contributions of the individual domains in human La protein to its RNA 3'-end binding activity. J Biol Chem 276: 27188-96. Pannone BK, Xue D, Wolin SL (1998). A role for the yeast La protein in U6 snRNP assembly: evidence that the La protein is a molecular chaperone for RNA polymerase III transcripts. Embo J 17: 7442-53. Pei Y, Shuman S (2003). Characterization of the Schizosaccharomyces pombe Cdk9/Pch1 protein kinase: Spt5 phosphorylation, autophosphorylation, and mutational analysis. J Biol Chem 278: 43346-56. Perkins KJ, Lusic M, Mitar I, Giacca M, Proudfoot NJ (2008). Transcription-dependent gene looping of the HIV-1 provirus is dictated by recognition of pre-mRNA processing signals. Mol Cell 29: 56-68. Peterlin BM, Price DH (2006). Controlling the elongation phase of transcription with P-TEFb. Mol Cell 23: 297-305. Ping YH, Rana TM (2001). DSIF and NELF interact with RNA polymerase II elongation complex and HIV-1 Tat stimulates P-TEFb-mediated phosphorylation of RNA polymerase II and DSIF during transcription elongation. J Biol Chem 276: 12951-8. Rasmussen EB, Lis JT (1993). In vivo transcriptional pausing and cap formation on three Drosophila heat shock genes. Proc Natl Acad Sci U S A 90: 7923-7. Reddy R, Henning D, Tan E, Busch H (1983). Identification of a La protein binding site in a RNA polymerase III transcript (4.5 I RNA). J Biol Chem 258: 8352-6. Renner DB, Yamaguchi Y, Wada T, Handa H, Price DH (2001). A highly purified RNA polymerase II elongation control system. J Biol Chem 276: 42601-9.

128

Rinke J, Steitz JA (1982). Precursor molecules of both human 5S ribosomal RNA and transfer RNAs are bound by a cellular protein reactive with anti-La lupus antibodies. Cell 29: 149-59. Rinke J, Steitz JA (1985). Association of the lupus antigen La with a subset of U6 snRNA molecules. Nucleic Acids Res 13: 2617-29. Rockx DA, Mason R, van Hoffen A, Barton MC, Citterio E, Bregman DB et al (2000). UV-induced inhibition of transcription involves repression of transcription initiation and phosphorylation of RNA polymerase II. Proc Natl Acad Sci U S A 97: 10503-8. Roeder RG (1996). Nuclear RNA polymerases: role of general initiation factors and cofactors in eukaryotic transcription. Methods Enzymol 273: 165-71. Romano G, Giordano A (2008). Role of the cyclin-dependent kinase 9-related pathway in mammalian gene expression and human diseases. Cell Cycle 7: 3664-8. Rosenblatt JD, Cann AJ, Slamon DJ, Smalberg IS, Shah NP, Fujii J et al (1988). HTLV-II transactivation is regulated by the overlapping tax/rex nonstructural genes. Science 240: 916-9. Ruben S, Perkins A, Purcell R, Joung K, Sia R, Burghoff R et al (1989). Structural and functional characterization of human immunodeficiency virus tat protein. J Virol 63: 1-8. Saito A, Pietromonaco S, Loo AK, Farquhar MG (1994). Complete cloning and sequencing of rat gp330/"megalin," a distinctive member of the low density lipoprotein receptor gene family. Proc Natl Acad Sci U S A 91: 9725-9. Sano M, Abdellatif M, Oh H, Xie M, Bagella L, Giordano A et al (2002). Activation and function of cyclin T-Cdk9 (positive transcription elongation factor-b) in cardiac muscle-cell hypertrophy. Nat Med 8: 1310-7. Sano M, Schneider MD (2004). Cyclin-dependent kinase-9: an RNAPII kinase at the nexus of cardiac growth and death cascades. Circ Res 95: 867-76. Sano M, Wang SC, Shirai M, Scaglia F, Xie M, Sakai S et al (2004). Activation of cardiac Cdk9 represses PGC-1 and confers a predisposition to heart failure. EMBO J 23: 3559-69. Sedore SC, Byers SA, Biglione S, Price JP, Maury WJ, Price DH (2007). Manipulation of P-TEFb control machinery by HIV: recruitment of P-TEFb from the large form by Tat and binding of HEXIM1 to TAR. Nucleic Acids Res 35: 4347-58. Shan B, Zhuo Y, Chin D, Morris CA, Morris GF, Lasky JA (2005). Cyclin-dependent kinase 9 is required for tumor necrosis factor-alpha-stimulated matrix metalloproteinase-9 expression in human lung adenocarcinoma cells. J Biol Chem 280: 1103-11. Shapiro GI (2006). Cyclin-dependent kinase pathways as targets for cancer treatment. J Clin Oncol 24: 1770-83. Sharma M, George AA, Singh BN, Sahoo NC, Rao KV (2007). Regulation of transcript elongation through cooperative and ordered recruitment of cofactors. J Biol Chem 282: 20887-96.

129

Simone C, Stiegler P, Bagella L, Pucci B, Bellan C, De Falco G et al (2002). Activation of MyoD-dependent transcription by cdk9/cyclin T2. Oncogene 21: 4137-48. Simons FH, Broers FJ, Van Venrooij WJ, Pruijn GJ (1996). Characterization of cis-acting signals for nuclear import and retention of the La (SS-B) autoantigen. Exp Cell Res 224: 224-36. Sinha KM, Gu J, Chen Y, Reddy R (1998). Adenylation of small RNAs in human cells. Development of a cell-free system for accurate adenylation on the 3'-end of human signal recognition particle RNA. J Biol Chem 273: 6853-9. Stefano JE (1984). Purified lupus antigen La recognizes an oligouridylate stretch common to the 3' termini of RNA polymerase III transcripts. Cell 36: 145-54. Szutorisz H, Dillon N, Tora L (2005). The role of enhancers as centres for general transcription factor recruitment. Trends Biochem Sci 30: 593-9. Urano E, Kariya Y, Futahashi Y, Ichikawa R, Hamatake M, Fukazawa H et al (2008). Identification of the P-TEFb complex-interacting domain of Brd4 as an inhibitor of HIV-1 replication by functional cDNA library screening in MT-4 cells. FEBS Lett 582: 4053-8. Van Herreweghe E, Egloff S, Goiffon I, Jady BE, Froment C, Monsarrat B et al (2007). Dynamic remodelling of human 7SK snRNP controls the nuclear level of active P-TEFb. EMBO J 26: 3570-80. Wada T, Takagi T, Yamaguchi Y, Ferdous A, Imai T, Hirose S et al (1998a). DSIF, a novel transcription elongation factor that regulates RNA polymerase II processivity, is composed of human Spt4 and Spt5 homologs. Genes Dev 12: 343-56. Wada T, Takagi T, Yamaguchi Y, Watanabe D, Handa H (1998b). Evidence that P-TEFb alleviates the negative effect of DSIF on RNA polymerase II-dependent transcription in vitro. EMBO J 17: 7395-403. Wang R, Brattain MG (2006). AKT can be activated in the nucleus. Cell Signal 18: 1722-31. Wassarman DA, Steitz JA (1991). Structural analyses of the 7SK ribonucleoprotein (RNP), the most abundant human small RNP of unknown function. Mol Cell Biol 11: 3432-45. Wittmann BM, Fujinaga K, Deng H, Ogba N, Montano MM (2005). The breast cell growth inhibitor, estrogen down regulated gene 1, modulates a novel functional interaction between estrogen receptor alpha and transcriptional elongation factor cyclin T1. Oncogene 24: 5576-88. Wolin SL, Cedervall T (2002). The La protein. Annu Rev Biochem 71: 375-403. Wood A, Shilatifard A (2006). Bur1/Bur2 and the Ctk complex in yeast: the split personality of mammalian P-TEFb. Cell Cycle 5: 1066-8. Woychik NA, Hampsey M (2002). The RNA polymerase II machinery: structure illuminates function. Cell 108: 453-63.

130

Wu SY, Chiang CM (2007). The double bromodomain-containing chromatin adaptor Brd4 and transcriptional regulation. J Biol Chem 282: 13141-5. Xue D, Rubinson DA, Pannone BK, Yoo CJ, Wolin SL (2000). U snRNP assembly in yeast involves the La protein. Embo J 19: 1650-60. Yamaguchi Y, Takagi T, Wada T, Yano K, Furuya A, Sugimoto S et al (1999). NELF, a multisubunit complex containing RD, cooperates with DSIF to repress RNA polymerase II elongation. Cell 97: 41-51. Yan J, Li Q, Lievens S, Tavernier J, You J (2009). Abrogation of the Brd4-P-TEFb Positive Transcription Complex by the Papillomavirus E2 protein Contributes to the Viral Oncogene Repression. J Virol. Yang Z, Yik JH, Chen R, He N, Jang MK, Ozato K et al (2005). Recruitment of P-TEFb for stimulation of transcriptional elongation by the bromodomain protein Brd4. Mol Cell 19: 535-45. Yang Z, Zhu Q, Luo K, Zhou Q (2001). The 7SK small nuclear RNA inhibits the CDK9/cyclin T1 kinase to control transcription. Nature 414: 317-22. Ye K (2005). PIKE/nuclear PI 3-kinase signaling in preventing programmed cell death. J Cell Biochem 96: 463-72. Yik JH, Chen R, Nishimura R, Jennings JL, Link AJ, Zhou Q (2003). Inhibition of P-TEFb (CDK9/Cyclin T) kinase and RNA polymerase II transcription by the coordinated actions of HEXIM1 and 7SK snRNA. Mol Cell 12: 971-82. Yik JH, Chen R, Pezda AC, Zhou Q (2005). Compensatory contributions of HEXIM1 and HEXIM2 in maintaining the balance of active and inactive positive transcription elongation factor b complexes for control of transcription. J Biol Chem 280: 16368-76. Zeitlinger J, Stark A, Kellis M, Hong JW, Nechaev S, Adelman K et al (2007). RNA polymerase stalling at developmental control genes in the Drosophila melanogaster embryo. Nat Genet 39: 1512-6. Zeng L, Zhou MM (2002). Bromodomain: an acetyl-lysine binding domain. FEBS Lett 513: 124-8. Zhou M, Lu H, Park H, Wilson-Chiru J, Linton R, Brady JN (2006). Tax interacts with P-TEFb in a novel manner to stimulate human T-lymphotropic virus type 1 transcription. J Virol 80: 4781-91. Zhu Y, Pe'ery T, Peng J, Ramanathan Y, Marshall N, Marshall T et al (1997). Transcription elongation factor P-TEFb is required for HIV-1 tat transactivation in vitro. Genes Dev 11: 2622-32. Zorio DA, Bentley DL (2004). The link between mRNA processing and transcription: communication works both ways. Exp Cell Res 296: 91-7. Zuker M (1989). On finding all suboptimal foldings of an RNA molecule. Science 244: 48-52.

regulated release of p-tefb from the 7sk snrnp

Documents