reduced expression of fukutin related protein in mice results - brain
TRANSCRIPT
BRAINA JOURNAL OF NEUROLOGY
Reduced expression of fukutin related protein inmice results in a model for fukutin related proteinassociated muscular dystrophiesM. R. Ackroyd,1,* L. Skordis,1,* M. Kaluarachchi,1 J. Godwin,1 S. Prior,1 M. Fidanboylu,1
R. J. Piercy,1,2 F. Muntoni3 and S. C. Brown1
1 Department of Cellular and Molecular Neuroscience, Hammersmith Hospital, Imperial College, London, UK
2 Department of Veterinary Clinical Sciences, Royal Veterinary College, London, UK
3 Institute of Child Health, UCL, London, UK
�These authors contributed equally to this work.
Correspondence to: S. C. Brown,
Department of Cellular and Molecular Neuroscience,
Hammersmith Hospital, Imperial College, London, UK
E-mail: [email protected]
AbstractMutations in fukutin related protein (FKRP) are responsible for a common group of muscular dystrophies ranging from adult
onset limb girdle muscular dystrophies to severe congenital forms with associated structural brain involvement, including
Muscle Eye Brain disease. A common feature of these disorders is the variable reduction in the glycosylation of skeletal
muscle a-dystroglycan. In order to gain insight into the pathogenesis and clinical variability, we have generated two lines
of mice, the first containing a missense mutation and a neomycin cassette, FKRP-NeoTyr307Asn and the second containing the
FKRPTyr307Asn mutation alone. We have previously associated this missense mutation with a severe muscle–eye–brain pheno-
type in several families. Homozygote Fkrp-NeoTyr307Asn mice die soon after birth and show a reduction in the laminin-binding
epitope of a-dystroglycan in muscle, eye and brain, and have reduced levels of FKRP transcript. Homozygous FkrpTyr307Asn
mice showed no discernible phenotype up to 6 months of age, contrary to the severe clinical course observed in patients
with the same mutation. These results suggest the generation of a mouse model for FKRP related muscular dystrophy requires
a knock-down rather than a knock-in strategy in order to give rise to a disease phenotype.
Keywords: muscular dystrophy; fukutin related protein
Abbreviations: CMD = congenital muscular dystrophies; FKRP = fukutin related protein; ILM = inner limiting membrane;MEB = muscle eye brain disease; WWS = Walker Warburg syndrome
IntroductionThe congenital muscular dystrophies (CMD) are a genetically
heterogeneous group of autosomal recessive disorders, presenting
in infancy with muscle weakness, contractures and dystrophic
changes on skeletal muscle biopsy (Muntoni and Voit, 2004).
A number of forms are now known to be associated with
mutations in genes [POMT1, POMT2, POMGnt1, LARGE, fuku-
tin and fukutin related protein (FKRP)] encoding for proteins that
are either putative or determined glycosyltransferases lending sup-
port to the idea that the aberrant post-translational modification
of proteins may represent a new mechanism of pathogenesis in
the muscular dystrophies (Michele and Campbell, 2003; Muntoni
et al., 2004; Barresi and Campbell, 2006). One characteristic of
doi:10.1093/brain/awn335 Brain 2009: 132; 439–451 | 439
Received April 15, 2008. Revised October 6, 2008. Accepted November 14, 2008. Advance Access publication January 20, 2009
� The Author (2009). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved.
For Permissions, please email: [email protected]
Dow
nloaded from https://academ
ic.oup.com/brain/article/132/2/439/378060 by guest on 24 N
ovember 2021
the muscle of patients with mutations in these six putative
glycosyltransferase genes is a marked hypoglycosylation of
a-dystroglycan (Brown et al., 2004; Brockington et al., 2005;
van Reeuwijk et al., 2005) which has led to the suggestion of
dystroglycanopathies as a general term to describe these condi-
tions. a-Dystroglycan is a central component of the dystrophin
associated complex and is expressed in a number of different
tissues including the brain. Its abnormal glycosylation affects its
interaction with members of the extracellular matrix, including
laminin, perlecan, neurexin and agrin within the basement mem-
brane. This reduction in ligand binding within the basement mem-
brane is thought to underlie both the muscular dystrophy but also
the structural brain defects including cobblestone lissencephaly
(Michele et al., 2002, 2003).
Mutations in POMT1 (Beltran-Valero et al., 2002), POMT2 (van
Reeuwijk et al., 2005), POMGnT1 (Yoshida et al., 2001), LARGE
(Longman et al., 2003; van Reeuwijk et al., 2007) and Fukutin
(Toda, 1999) are typically associated with severe muscular dystro-
phy and structural brain defects, ranging from the fatal Walker
Warburg syndrome (WWS) to variants such as Muscle Eye Brain
disease (MEB) and Fukuyama CMD (FCMD). We originally identi-
fied mutations in the gene encoding for FKRP, and showed them
to be responsible for a variant of CMD (MDC1C) and for a
common form of relatively mild limb girdle muscular dystrophy
(LGMD2I) (Brockington et al., 2001a, b), two conditions without
any brain involvement. However, mutations in FKRP have recently
been identified in patients with severe structural eye and brain
involvement resembling WWS and MEB disease (Beltran-Valero
et al., 2004). More recently, we and others were able to signifi-
cantly expand the phenotypic spectrum associated with mutations
in POMT1, POMT2, fukutin and POMGnT1, to include patients
with minimal or no evidence of central nervous system involve-
ment and with a LGMD phenotype (Balci et al., 2005; Godfrey
et al., 2007; Yanagisawa et al., 2007; Clement et al., 2008). This
lends support to the hypothesis that the phenotype of patients
belonging to this group of disorders depends not so much on
the specific gene primarily affected (i.e. POMT1, POMT2,
POMGnT1, LARGE, FKRP or fukutin) but rather the severity of
the specific mutation and presumably its effect on the structure
and thus the function of the gene product (Godfrey et al., 2007).
In order to better understand the functional consequences of an
alteration in FKRP activity, we have now generated two lines
of mice: the first containing a point mutation FKRPTyr307Asn
and the second containing this missense mutation and a neomycin
cassette, FKRP-NeoTyr307Asn. This mutation in the homozygous
state has previously been associated with MEB in two separate
families (Beltran-Valero et al., 2004; Mercuri et al., 2006), and
more recently in other families of Swedish descent (J. Vissing,
personal communication) and was also identified at the hetero-
zygous state in combination with the Leu276Ile in a patient
with severe LGMD2I (Sveen et al., 2006), suggesting it behaves
as a ‘severe’ FKRP mutation in humans. Surprisingly, however,
mice homozygous for this mutation shows no discernable pheno-
type strongly suggesting that the insertion of missense mutations
into the mouse Fkrp gene may not perturb FKRP function as is the
case for human patients. However, mice with the mutation which
retain the neomycin selection cassette in intron 2 show a marked
depletion in FKRP transcript levels and died at or soon after birth
with a phenotype resembling MEB. The phenotype of these mice
demonstrate a role for FKRP activity in muscle, eye and brain and
suggests that a reduction in the amount of functionally active
FKRP may represent a mechanism of disease in FKRP related
disorders.
Material and methods
Gene targeting and generationof FKRPTyr307Asn miceTo generate FKRPTyr307Asn mice, genomic DNA from E14-1A murine
ES (embryonic stem) cells was used as a template to PCR amplify the
right and left hand arms of the Fkrp targeting construct. The right
hand arm of the construct was 3.5 kb in length and consisted of the
coding region exon 3, flanked by intronic sequences and the 30-UTR
respectively. The left hand arm consisted of �3 kb of intronic
sequences amplified from Fkrp intron 2. In order to allow ease
of cloning and sequencing, both the right and left hand arms were
initially cloned into separate kanamycin resistant TOPO vectors.
Site-directed mutagenesis was used to introduce c.919 T4A
(Tyr307Asn) into the right hand arm. Both the right and left
hand arms were then sub-cloned into the final targeting vector,
a pBluescript II KS+ vector containing a neomycin cassette
(kindly provided by Dr Sue Shackleton, University of Leicester).
This vector contained an ampicillin resistant gene to aid in the
sub-cloning of the Fkrp arms. The neomycin cassette acted as
a positive selection marker and was placed within the region of
Fkrp homology, between two loxP sites. A negative selection
marker consisting of a Herpes simplex thymidine kinase (HSVtk)
cassette was inserted in the construct outside the region of Fkrp
homology.
Southern blot analysisGenomic DNA was extracted from G418-resistant ES cell clones.
To determine whether homologous recombination had occurred we
PCR amplified a 1000 bp probe which anneals to the endogenous
Fkrp mouse sequence 50 to the DNA sequences contained within the
original targeting vector (Fig. 1). DNA derived from each potentially
positive clone was digested with the restriction enzyme HindIII. When
homologous recombination has occurred, the probe identifies a 5-kb
band instead of 6.7-kb band as is the case for the endogenous mouse
sequence. The difference in size is due to an additional HindIII site
present in the targeting vector.
Generating and genotyping of miceOne homologous recombinant ES clone was microinjected into blas-
tocysts from 129J mice. The resulting male chimeras were then bred
with female C57BL6 mice to generate germ line-transmitted het-
erozygous mice. These mice were then crossed to generate mice
homozygous for the mutation and also the ‘neomycin’ cassette
FKRP-NeoTyr307Asn+/+. In order to remove the neomycin cassette
heterozygotes were crossed with b-actin Cre transgenic mice
(Lewandoski et al., 1997) to create mice homozygous for
FkrpTyr307Asn. In order to further test the pathogenesis of the
missense mutation, we also crossed FKRPTyr307Asn+/+ mice with
440 | Brain 2009: 132; 439–451 M. R. Ackroyd et al.
Dow
nloaded from https://academ
ic.oup.com/brain/article/132/2/439/378060 by guest on 24 N
ovember 2021
FKRPTyr307AsnNeo+/� mice to obtain FKRPTyr307Asn+/+/Neo+/� mice.
Statistical analysis was performed using GraftpadTM (Prism) software.
Offspring from these crosses were genotyped by PCR analysis using
mouse tail/ear DNA. gDNA was prepared from ear clips used for
identification, the tissue were digested in Direct PCR Lysis (Ear)
(Eurogentec) containing proteinase K (0.2 mg/ml) at 55�C overnight.
PCRs were performed with 3 ml gDNA template using G-C rich tem-
plate PCR kit (Roche diagnostics). Genotyping of affected newborns
together with controls was performed on gDNA prepared from
tail tissue. Tails (�0.50 cm) were digested in 500ml of SNET buffer
(1% SDS/400 mM NaCl/5 mM EDTA/20 mM Tris–HCl, pH 8.0) con-
taining proteinase K (0.2 mg/ml) at 55�C overnight. After extraction
with phenol/chloroform and isopropanol precipitation, samples were
washed with 70% ethanol and resuspended in 200ml ddH2O. The
gDNA used as a template for PCR using G-C rich template PCR kit
(Roche diagnostics). Genotyping was performed by PCR and sequen-
cing of the Fkrp gene was used to confirm the point mutation (c.919 T
4A). The following PCR primers used to amplify either the Neomycin
cassette (NeoRPF2:TTCTCCTCTTCCTCATCTCC; NeoRPR2:CCAAGCT
CTTCAGCAATTATC) or the Fkrp gene (LA1F:CCGAGTTTG
TGGCTCTAGT; LA1R: TAGATGGCCCAGATCTACGTC), respectively,
and sequencing was performed in both directions using primers
LA1R and LA2F (GTCTGGTGAGCTGGGAAG) on a 3730XL DNA
Analyser (Applied Biosystems) at the MRC DNA Core laboratory.
Homozygous wild-type, homozygous Tyr307Asn missense mutants
or heterozygous mice were clearly identified using the Vector NTi
advance10 software (Invitrogen).
RT-PCR analysisTissues of interest were dissected out and homogenized with liquid
nitrogen using a mortar and pestle and the lysate passed through a
QiaShredder� (Qiagen). The RNA was isolated from the homogenized
tissue using an RNeasy� kit (Qiagen) and eluted into 30 ml. About 1 mg
of RNA was reverse transcribed with Superscript� III for qRT-PCR kit
(Invitrogen). qRT-PCR was performed on a 7500 FAST Real-Time PCR
system (Applied Biosystems) using a FAM(tm) reporter dye system for
each reaction 0.8 ml of cDNA was used as template in a PCR mix
consisting of 1 ml of primer mix, 10 ml TaqMan Universal PCR
Mastermix (Applied Biosystems) and 8.2 ml H2O. The primers for the
gene expression assays were sourced commercially from Applied
Biosystems: Mm00557870_mL (FKRP) and Mm99999915_gL
(GAPDH) which served as an endogenous control. All reactions were
performed in triplicate.
ImmunohistochemistryMuscle and brain samples were frozen in isopentane cooled in liq-
uid nitrogen. Cryostat sections were incubated with antibodies
to a-dystroglycan (IIH6, Upstate Biotechnology), collagen XVIII
(gift from J. Couchman), GT-20, core peptide to a-dystroglycan
(goat polyclonal, a gift from K. Campbell), RC2 (Developmental
Studies Hybridoma Bank), NeuN (Chemicon), Ctip2 (Abcam), laminin
a2 (Alexis), b1 (Chemicon), g1 (Chemicon), MHCd (Novocastra) and
P6 (Sherratt et al., 1992). All primary antibodies were followed by
biotinylated anti-rat/rabbit/mouse as appropriate and streptavidin-
Alexa 488 or 594 (Molecular Probes) for 30 min. Nuclei were stained
with Hoechst 33342 (Sigma). All dilutions and washings were made in
phosphate buffered saline. Sections were mounted in aqueous
mountant and viewed with epifluorescence using a Leica Diaphot
microscope equipped with Leica HCX PL Fluotar objectives at
�10 (numerical aperture 0.3), �20 (numerical aperture 0.4) and
�40 (numerical aperture 0.75). Images were digitally captured with
CoolSnap HQTM (Photometrics) CCD monochrome camera using a
Metamorph 7� (Universal Imaging Inc.) imaging system. All images
were compiled using Photoshop CS (Adobe). Where direct compari-
sons have been made fluorescent images were captured with equal
exposure and have had equal scaling applied.
SDS–PAGE and western blottingMuscle proteins were extracted in sample buffer consisting of 75 mM
Tris–HCl, 1% SDS, 2-mercaptoethanol, plus a cocktail of protease
inhibitors (antipain, aprotinin and leupeptin). Soluble proteins were
resolved using a NuPageTM Pre-cast gel (4–12% Bis–Tris; Invitrogen)
and then transferred electrophoretically to nitrocellulose membrane
(Hybond-ECL, Amersham). Nitrocellulose strips were blocked in
10% BSA (Jackson) in KC buffer [20 mM Tris, 100 mM NaCl] with
IIH6 (upstate) antibody overnight at 4�C. After washing they were
incubated with HRP-anti-mouse IgM (Jackson) for 1 h at room tem-
perature. Membranes were visualized using chemiluminescence
(ECL+Plus, Amersham). Laminin overlay was performed as described
previously (Michele et al., 2002).
Fig. 1 Targeting strategy. The right hand arm of the construct
was 3.5 kb in length and consisted of the coding region exon 3,
flanked by intronic sequences and the 30-UTR, respectively.
The left hand arm consisted of �3 kb of intronic sequences
amplified from Fkrp intron 2. Site-directed mutagenesis was
used to introduce Tyr307Asn into the right hand arm. The
floxed neomycin cassette acted as a positive selection marker
and was placed within the region of Fkrp homology. A nega-
tive selection marker consisting of a Herpes simplex thymidine
kinase (HSVtk) was inserted in the construct outside the region
of Fkrp homology. Probes were generated for Southern
blotting to identify targeted ES cell clones. To determine
whether homologous recombination had occurred we PCR
amplified a 1000-bp probe which anneals to the endogenous
Fkrp mouse sequence 50 to the DNA sequences contained
within our targeting vector. DNA derived from each potentially
positive clone was digested with the restriction enzyme HindIII.
When homologous recombination has occurred, the probe
identifies a 5-kb band instead of 6.7-kb band as is the case
for the endogenous mouse sequence. The difference in size
is due to an additional HindIII site present in the targeting
vector.
Mutations in FKRP associated muscular dystrophies Brain 2009: 132; 439–451 | 441
Dow
nloaded from https://academ
ic.oup.com/brain/article/132/2/439/378060 by guest on 24 N
ovember 2021
Distribution of nuclei in the cortexThree transverse sections selected from each of three Fkrp-NeoTyr307Asn
mice and three control littermates were analysed at birth. The distance
from the ventricular zone to the pial basement membrane was divided
into six equal regions. The number of nuclei was then counted within
each layer and expressed as a percentage of the total number of nuclei
across all layers.
Results
Generation of FKRP-NeoTyr307Asn
and FKRPTyr307Asn +/+ miceWe generated and analysed two lines of mice, one with a knock-
in mutation FKRPTyr307Asn+/+ previously associated with a MEB-like
condition in two homozygous patients, and the other FKRP-
NeoTyr307Asn which contained in addition to the knock-in mutation,
a Neo cassette in intron 2. In both lines the number of homozy-
gote mice born was �25%, consistent with there being no embry-
onic lethality. Details of the targeting strategy are shown in Fig. 1.
FKRP-NeoTyr307Asn mice were crossed with b-actin Cre transgenic
heterozygotes (Lewandoski and Martin, 1997) to remove the
floxed Neo cassette and produce FKRPTyr307Asn+/+. Genotyping
was performed by PCR and sequencing of the Fkrp gene.
FKRPTyr307Asn+/+ mice arephenotypically normalBody weights of FKRPTyr307Asn+/+ mice (9.4� 0.4 n = 6 female and
9.4� 0.3 n = 4 male) at 6 weeks of age were not significantly dif-
ferent from wild-type controls (9.0� 0.3 n = 8 female and 10.3� 0.6
n = 5 male). Muscle histology of the lower hindlimb at 4 weeks of
age was indistinguishable from controls, as was immunolabelling for
IIH6, an antibody directed against the laminin binding epitope of
glycosylated a-dystroglycan (Fig. 2) and laminin a2 (data not
shown), the former of which is severely deficient in dystroglycano-
pathy patients. Haematoxylin and eosin staining of frozen sections of
eyes removed from FKRPTyr307Asn+/+ mice showed the presence of a
normal retina, retinal pigmented epithelium, lens, optic nerve, cornea
and ciliary margin in both FKRPTyr307Asn+/+ and control littermates.
Gross anatomy of the brain and heart was also indistinguishable
from controls. To date these mice show no overt clinical pheno-
type and display normal feeding and exploratory behaviour up to
6 months of age. To further test the effect of the missense mutation
we also crossed FKRPTyr307Asn+/+ mice with FKRPTyr307AsnNeo+/�. The
resulting FKRPTyr307Asn+/+/Neo+/� mice were within the normal body
weight range at birth and were viable. Further analyses of the brain
histology of these mice showed them to be indistinguishable from
normal littermate controls.
A reduction in Fkrp transcript levels isassociated with perinatal lethalityMice homozygous for FKRP-NeoTyr307Asn die at or soon after birth.
Some mice died prior to feeding whereas others moved, breathed
independently and suckled. There was no evidence of either
kyphoscoliosis, joint contractures or microcephaly and their exter-
nal anatomy was comparable with that of control or heterozygote
littermates (Fig. 3A). Haematoxylin and eosin stained transverse
sections of the body indicated well-preserved intercostal, para-
spinal and diaphragm muscles. Tongue and cranial muscles were
also apparently normal (data not shown). Body weight at birth
was, on average, approximately one-third less than that of their
littermates (Table 1, P = 0.0001).
Quantitative real time PCR (qRT-PCR) of Fkrp in these mice
indicated that FKRP-NeoTyr307Asn homozygotes expressed only
�40% of the levels of Fkrp mRNA present in wild-type controls
(Fig. 3B). Western blotting showed a reduction in the band
identified by IIH6 in brain, skeletal muscle and heart of the
FKRP-NeoTyr307Asn homozygotes relative to wild-type littermates
(Fig. 3C). A laminin overlay confirmed that this was associated
with a reduction in laminin binding in the mutant relative to con-
trol skeletal muscle and brain (Fig. 3D).
FKRP-NeoTyr307Asn mice display areduced muscle mass andhypoglycosylation of a-dystroglycanAt the time of birth both fore and hindlimb muscles of the FKRP-
NeoTyr307Asn showed a reduction in fibre density relative to their
normal and heterozygote littermates irrespective of whether the ani-
mals were found dead or were euthanized (Fig. 4A). There was no
evidence of fibre necrosis or regeneration although there was a sig-
nificant increase in the percentage of fibres with central nuclei in
the tibialis anterior (TA) and extensor digitorum longus (EDL) in the
mutant homozygotes relative to controls (Table 1). Gomori
Trichrome staining showed that the apparent space in between the
fibres was due to oedema rather than excess connective tissue
(Fig. 4A). NADH staining and immunolabelling for developmental
myosin (MHC-d) showed a similar level of fibre type differentiation
in FKRP-NeoTyr307Asn and control mice (data not shown).
Immunolabelling for IIH6 and laminin a2 was reduced in all mus-
cles of the FKRP-NeoTyr307Asn homozygote mice relative to wild-type
controls (Fig. 4A). With respect to laminin a2 this reduction varied
depending on the individual muscle. The level of immunolabelling for
laminin b1 (data not shown) and g1 were similar in both mutant and
controls suggesting that another laminin a chain might compensate
for the absence of laminin a2. This has previously been demonstrated
in primary laminin a2 deficiency (Sewry et al., 1995). Perlecan immu-
nolabelling was also indistinguishable between FKRP-NeoTyr307Asn
and wild-type muscle indicating that the deposition of this protein
may be less dependent on a-dystroglycan glycosylation than laminin
a2. Collagen IV immunolabelling was used as a general marker for
the basement membrane preservation and showed no discernable
differences between FKRP-NeoTyr307Asn homozygotes and controls
(data not shown). Previous reports suggest that in patients
some FKRP mutations are associated with a disruption of compo-
nents of the dystrophin associated protein complex (DAPC)
(MacLeod et al., 2007) we therefore also immunostained
for dystrophin but found no significant difference between
FKRP-NeoTyr307Asn mice and control littermates (data not shown).
442 | Brain 2009: 132; 439–451 M. R. Ackroyd et al.
Dow
nloaded from https://academ
ic.oup.com/brain/article/132/2/439/378060 by guest on 24 N
ovember 2021
The inner limiting membrane of the eyeis perturbed in FKRP-NeoTyr307Asn miceWhilst the eyes of the FKRP-NeoTyr307Asn homozygote mice were
often smaller, this appeared to be a reflection of the reduction in
overall body size rather than a disproportionate reduction in the
size of the eye. Retinal folding in frozen sections of the eye is
known to be a common artefact, however, this change was mar-
ginally more pronounced in eyes from the FKRP-NeoTyr307Asn
homozygote mice. The most striking difference between
Fig. 2 Haematoxylin and eosin staining of transverse frozen sections of diaphragm (A and B), heart (C and D) and gastrocnemius (E and F)
of a wild-type control (A, C and E) and a FKRPTyr307Asn homozygote (B, D and F) mouse. Immunolabelling of a-dystroglycan (IIH6) at the
boundary of the soleus and gastrocnemius in a wild-type control (G) and FKRPTyr307Asn (H) mouse. Whilst the two muscles showed different
intensities of immunolabelling with the highest level apparent in the soleus, this was not different between the two genotypes.
Mutations in FKRP associated muscular dystrophies Brain 2009: 132; 439–451 | 443
Dow
nloaded from https://academ
ic.oup.com/brain/article/132/2/439/378060 by guest on 24 N
ovember 2021
FKRP-NeoTyr307Asn homozygote and wild-type eyes was the pres-
ence of ectopic nuclei, outside the inner limiting membrane (ILM),
within the vitreous body of the mutant but not controls (Fig. 5).
Immunostaining for laminin g1 and perlecan (markers of the base-
ment membrane) clearly indicate that the ILM is disrupted in the
FKRPNeoTyr307Asn eye, although it was present in the vasculature
(Fig. 5H and N, respectively). Both these markers were present in
the eyes of age-matched controls (Fig. 5G and M, respectively).
Immunostaining for laminin a1, b1 collagen IV and collagen XVIII
further support these observations (data not shown).
Interestingly no staining was detected for laminin a2 in
either the FKRPNeoTyr307Asn or controls (data not shown) and
similarly, only punctate IIH6 immunostaining was evident in
control retinas that was absent in FKRP-NeoTyr307Asn homo-
zygotes. These data contrast with immunostaining with GT-20
(an antibody to the core protein of a-dystroglycan) that clearly
showed the presence of a-dystroglycan in the ILM of controls
and a reduction in FKRP-NeoTyr307Asn homozygotes indicating
that in specific locations such as the eye. FKRP levels facili-
tate a-dystroglycan binding to a laminin chain other than a2.
This interaction appears to be independent of the IIH6 epitope
and is disrupted when FKRP levels are reduced. Antibodies to
perlecan, collagens IV and XVIII also identify the ILM associated
vasculature which appeared not to be significantly different
between FKRP-NeoTyr307Asn homozygotes and controls (data not
shown).
Alterations in the pial basementmembrane of FKRP-NeoTyr307Asn areassociated with a marked disturbancein neuronal migrationCoronal sections of the brain of FKRP-NeoTyr307Asn mice stained
with haematoxylin and eosin showed a clear disruption of the
neuronal layering of the cerebral cortex and partial fusion of the
intrahemispheric fissue (Fig. 6A–D). Immunolabelling showed a
marked reduction in both IIH6 (Fig. 6A, E and F) and laminin a2
(Fig. 6A, G and H) at the pial basement membrane, whilst the
distribution of laminin g1 (Fig. 6A, K and L), perlecan (Fig. 6A,
I and J) and collagen IV (data not shown) was highly disorganized
and more diffuse compared with controls. The degree to which
this basement membrane was disorganized varied between indi-
vidual mutants. Radial migration is generally guided by the radial
glia cells (identified using the RC2 antibody) which form the scaf-
fold along which neurons migrate. RC2 staining indicated that the
radial glia cell population in the FKRP-NeoTyr307Asn homozygotes
00.5
11.5
22.5
33.5
44.5
5
A
B
C
D
Rel
ativ
e q
uan
tifi
cati
on
Wild Type (n = 4) Het (n = 2) FKRPKD (n = 6)
Fig. 3 (A) External anatomy of two FKRP-NeoTyr 307Asn mice
(A and B) and a wild-type control (C). (B) RT-PCR analysis to
show the relative expression of FKRP in mutant and hetero-
zygote littermates. (C) Western blot of extracts of brain
(lanes 1 and 4), skeletal muscle (lanes 2 and 5) and heart
(lanes 3 and 6) from wild-type mice (lanes 1–3) and FKRP-
NeoTyr307Asn mice (lanes 4–6) immunolabelled with IIH6. The
glycosylation of a-dystroglycan can be seen to be reduced in all
three tissues in the mutant relative to wild-type. (D) Laminin
overlay on extracts from skeletal muscle (lanes 1 and 2) and
brain (lanes 3 and 4) from FKRP-NeoTyr307Asn mice (lanes 2
and 4) and age-matched wild-type controls (lanes 1 and 3).
A reduced laminin binding affinity is observed in both the
skeletal muscle and brain of the FKRP-NeoTyr307Asn mice.
444 | Brain 2009: 132; 439–451 M. R. Ackroyd et al.
Dow
nloaded from https://academ
ic.oup.com/brain/article/132/2/439/378060 by guest on 24 N
ovember 2021
was highly disorganized and the radial glial endfeet fail to from a
glial limitans at the pial surface thus resulting in a disruption of the
glial scaffold (Fig. 6A, I and J). There was also a marked alteration
in the density and distribution of nuclei at different levels through-
out the cortex, and a reduction in the total number of nuclei
(Fig. 6B).
Nuclei counts performed on haematoxylin and eosin stained
sections illustrated that there were �48% fewer nuclei present
in the region of the cortex closest to pia surface in the FKRP-
NeoTyr307Asn relative to age-matched controls (Fig. 6B: A–C).
Immunolabelling with the neuronal marker NeuN, which identifies
a population of post mitotic neurons confirmed that many of these
misplaced nuclei were of neuronal origin (Fig. 6A: M and N). This
result was further investigated with immunostaining for Ctip2, a
transcription factor expressed in layer five neurons, cells labelled
with this antibody clearly demonstrate that this population of neu-
rons has mislocalized (Fig. 6A: O and P). Overall these data indi-
cate that the FKRP-NeoTyr307Asn homozygote mice display
a defective basement membrane that results in a disruption of
both radial glia and neurons.
Fig. 4 Haematoxylin and eosin stained transverse sections of the soleus (A and B) and gastrocnemius (C and D) of FKRP-NeoTyr307Asn
(A and C) and control (B and D) littermates showing the reduction in fibre density in the mutant relative to controls. Sequential sections
of each muscle stained with Gomori Trichrome (E–F) show that the interstitial space apparent in the mutant is not connective tissue
but oedema. Immunolabelling for IIH6 (I and J), laminin a2 (K and L) of the plantaris showed the IIH6 epitope to be virtually absent
and the level of laminin a2 significantly reduced in the FKRP-NeoTyr307Asn muscle relative to controls. (Scale bars = A–H = 10 mm,
I–N = 50mm).
Table 1 Summary of body weight, fibre size and central nucleation in FKRPNeoY307N, heterozygote and wild-typelittermates
Genotype Body weight (g) Fibre size (km2) Percentage of fibres with centrally located nuclei
EDL Soleus TA EDL Soleus TA
HomozygoteFKRPNeoY307N
1.14� 0.03 a,b
(n = 36)68.4� 6.2(n = 4)
96.6�3.9(n = 4)
75.3� 8.8(n = 4)
15.6� 3.7c
(n = 4)20.9� 5.6(n = 4)
14.7� 2.6b,c
(n = 4)
HeterozygoteFKRPNeoY307N
1.35� 0.09(n = 9)
ND ND ND 7.9� 1.6(n = 3)
9.7� 1.5(n = 3)
6.7� 0.5(n = 3)
Wild-type 1.52� 0.08(n = 18)
78.5� 5.0(n = 3)
118.0� 18.7(n = 3)
98.7� 15.6(n = 3)
5.2� 0.6(n = 4)
9.5� 1.8(n = 4)
5.8� 0.3(n = 4)
Statistical significance was calculated using either a one-way analysis of variance or t-test.a Significantly different to wild-type (P50.0001).b Significantly different to heterozygote (P50.05).c Significantly different to wild-type (P50.05)
Mutations in FKRP associated muscular dystrophies Brain 2009: 132; 439–451 | 445
Dow
nloaded from https://academ
ic.oup.com/brain/article/132/2/439/378060 by guest on 24 N
ovember 2021
Patients with FKRP mutations and brain involvement show evi-
dence of alterations in cerebellar development and work in
Largemyd mice shows that the tangential migration of a subgroup
of hindbrain neurons may be disrupted (Qu et al., 2006). In the
mouse, granule cells originate from the rhombic lip at around
E13-14, subsequently undergo an inward radial migration along
Bergmann glia fibres to the internal granular layer, which peaks
between P5 and P13. A role for a-dystroglycan in this process is
strongly suggested by the phenotype of the Largemyd mouse where
significant numbers of granule neurons are delayed in their migra-
tion due to either a physical disruption of the glial scaffolding
and/or altered neuronal–glial guide interactions (Qu et al., 2006).
Whilst a large part of cerebellar development takes place post-
natally in the mouse we were nonetheless able to examine the base-
ment membrane. At P0 the labelling with either IIH6 or GT-20 in
control mice, was present at only very low levels but was completely
absent in FKRP-NeoTyr307Asn. Laminin a2, g1 and perlecan labelling
was more diffuse in the FKRP-NeoTyr307Asn relative to controls
confirming that as with the pial-glial limitans this basement
membrane is markedly disrupted in the FKRP-NeoTyr307Asn mice.
The consequences of this on the external granule layer were not
apparent at this stage although immunolabelling for RC2, which
identifies the Bergmann glia, showed some disorganization in the
mutant relative to controls (data not shown).
DiscussionIn order to investigate the role of FKRP we have now generated
and analysed two lines of mice, the first of which carries a Fkrp
knock-in mutation (Fkrpc.919T4A) that results in a Tyr307Asn
missense mutation and the second which carries both the
Tyr307Asn mutation and a neomycin cassette in intron 2. The
homozygous inheritance of the Tyr307Asn mutation is associated
with a severe MEB phenotype in the human (Beltran-Valero et al.,
2004; Mercuri et al., 2006). However, mice homozygous for
this mutation have no apparent phenotype suggesting that
this mutation alters FKRP function in the human but not
the mouse despite the high level of sequence homology (94%)
between these two species (NP_077277.1) (NP_775606.1)
Fig. 5 Structural defects in the FKRP-NeoTyr307Asn eye. Control eyes (A, C, E, G, I, K and M) are present in each case in contrast to the
FKRP-NeoTyr307Asn eyes (B, D, F, H, J, L and N). Haematoxylin and eosin (A–D) illustrate abnormal layering of the retina in the FKRP-
NeoTyr307Asn compared with controls. Hoechst 33342 staining (E and F) indicates that ganglion cell layer (GCL) is disturbed and
ganglion cell nuclei are present in the vitreous body (VB) of the eye of the FKRP-NeoTyr307Asn mice. Immunostaining with laminin g1
(red: G and H), indicate that inner limiting membrane (ILM, arrow heads) is perturbed in the FKRP-NeoTyr307Asn mice, despite the
basement membrane surrounding the vasculature (asterisk) remaining in tact. Immunostaining with the GT20 antibody against core
dystroglycan (red, I and J) indicates that dystroglycan expression at the ILM is significantly reduced in the FKRP-NeoTyr307Asn mice
compared with controls. Interestingly however, the hypoglycosylated epitope of dystroglycan, IIH6 (red: K and L) was not present at
the ILM in either the FKRP-NeoTyr307Asn or the control eye. Double labelling with RC2 (red) and Perlecan (green) (M–N0) further
illustrate that the ILM is perturbed in the FKRP-NeoTyr307Asn mouse eye with the RC2 staining indicating that the Muller glia are
disorganized in the affected eyes of the affected mice. Scale bars represent: 200 mm (A and B) or 50 mm (C–N).
446 | Brain 2009: 132; 439–451 M. R. Ackroyd et al.
Dow
nloaded from https://academ
ic.oup.com/brain/article/132/2/439/378060 by guest on 24 N
ovember 2021
0
200
400
600
800
1000
1200
Region 1 Region 2 Region 3Controls (n = 3) FkrpKD (n = 4)
Distribution of nuclei in the P0 cortex
0
50
100
150
200
250
Zone 1 Zone 2 Zone 3 Zone 4 Zone 5 Zone 6
FKRP KD (n = 4 litters) Controls (n = 3 litters)
Nu
mb
er o
f n
ucl
eiN
um
ber
of
nu
clei
Average number of nuclei betweenthe ventricular zone and the pia surface
A
B
Fig. 6 (A) Brain abnormalities in the FKRP-NeoTyr307Asn. Haematoxylin and eosin stained cyrosections of FKRP-NeoTyr307Asn (A and C)
and control mice (B and D) illustrating fusion of the intrahemispheric fissure (arrows) and aberrant layering of the cerebral cortex
as a result of reduced FKRP expression. Immunohistochemistry indicates a reduction in IIH6 (red: E and F) and laminin a2 staining
(red: G and H) at the pial basement membrane (arrowheads) between the FKRP-NeoTyr307Asn (E, G, I and K) and control mice (F, H,
J and L). Furthermore, immunostaining for basement membrane markers perlecan (green: I and J) and laminin g1 (red: K and L)
indicate a disruption of the pial basement membrane (arrowheads). RC2 staining, an intermediate filament protein that serves as a
marker for the radial glia, (red: I and J) demonstrates that the radial glia are disorganized in the FKRP-NeoTyr307Asn mice in comparison
to controls and their endfeet do not appear to be correctly attached at the pial surface. Immunostaining with NeuN (red: M and N)
and Ctip2 (green: O and P) clearly show that neurons and in particular layer V neurons mislocalize in the cerebral cortex of the FKRP-
NeoTyr307Asn mice. The position (or absence) of the basement membrane at interhemispheric fissue (I, J and M–P) is indicated with
chevrons. Scale bars represent: 200mm (A and B), 50 mm (C–H) or 100mm (I–P) (B) Nuclei counts performed on Haematoxylin and
eosin stained sections of three different regions in the cortex showing that there were less nuclei present in those layers closest to pial
surface in the FKRP-NeoTyr307Asn relative to age-matched controls.
Mutations in FKRP associated muscular dystrophies Brain 2009: 132; 439–451 | 447
Dow
nloaded from https://academ
ic.oup.com/brain/article/132/2/439/378060 by guest on 24 N
ovember 2021
(www.epasy.org/tools/sim-prot.html). Despite these findings,
FKRP is clearly necessary for the mouse as a reduction in the
level of expression induced by inclusion of a neomycin cassette
in intron 2 clearly results in a severe phenotype. This suggests that
the introduction of other missense mutations into the mouse Fkrp
gene may not give rise to a phenotype. Whilst surprising these
findings are not without precedent; mice carrying a Arg142Cys
Notch 3 knock-in mutation do not develop a CADASIL-like phe-
notype despite the fact that human and mouse Notch 3 proteins
display 91% identity at the primary structural level (Lundkvist
et al., 2005). Similarly the introduction of a missense mutation
in the a-sarcoglycan gene, which in human patients is associated
A B
C D
E F
G H
Fig. 7 Cerebellum. 10 mm cerebella cryosections of FKRP-NeoTyr307Asn mice (A, C, E and G) and wild-type controls (B, D, F and H)
immunostained with GT20 (dystroglycan core) (A and B), Laminin a2 (C and D), Laminin g1 (E and F) and perlecan (G and H)
antibodies. A reduction in the staining was observed in each case. Scale bars are 25 mm (A and B) or 50 mm (C–H).
448 | Brain 2009: 132; 439–451 M. R. Ackroyd et al.
Dow
nloaded from https://academ
ic.oup.com/brain/article/132/2/439/378060 by guest on 24 N
ovember 2021
with a muscular dystrophy, fails to give rise to this phenotype
when introduced into the mouse genome strongly suggesting
the existence of important species specific quality control pro-
cesses (Kobuke et al., 2008) and the effect of the mutation on
protein folding in the two species.
FKRP-NeoTyr307Asn homozygote mice display a muscle eye brain
phenotype and a quantitative reduction in Fkrp expression which
in homozygotes is �40% of the levels observed in normal control
littermates. Since mice homozygous for the Tyr307Asn mutation
have Fkrp transcript levels comparable with controls and do not
display a disease phenotype, these observations strongly suggest
that this reduction is playing the pathogenic role. The generation
of a hypomorph allele due to the intronic inclusion of a neomycin
resistance cassette has previously been reported for other genes
such as Fgf8 and N-myc and has proved to be particularly useful
when a null is embryonic lethal (Meyers et al., 1998; Nagy et al.,
1998). Indeed homozygosity for Fkrp null alleles has never been
observed in the human and since a 60% reduction of Fkrp tran-
script levels is lethal in the perinatal period, it would seem likely
that a total absence of Fkrp is embryonic lethal in both species.
This observation is of particular significance since it indirectly sug-
gests that the generation of a knock-out for Fkrp might not be a
useful strategy and that the phenotype induced by other ‘milder’
missense mutations such as the Leu276Ile might not produce any
discernable phenotype in this species.
We noted a reduction in muscle mass in both fore and hindlimb
muscles of the FKRP-NeoTyr307Asn mice relative to controls but no
evidence of necrosis or fibrosis, which is similar to previous reports
in the POMGnT1 null mice which were evaluated up to 2 days
after birth (Liu et al., 2006). However, unlike the FKRP-
NeoTyr307Asn homozygotes their lifespan is variable and the
muscle of those which survive to adulthood displays a marked
variability in fibre size and an increase in the incidence of central
myonuclei (Liu et al., 2006). LARGEmyd mice are also smaller at
birth than their littermates (J. Hewitt, personal communication)
and display an age-dependent progressive muscle pathology char-
acterized by necrosis and regeneration, central nuclei and prolifer-
ation of endomysial connective and fatty tissue although there is
no data on the morphology of their muscle at birth (Holzfeind
et al., 2002). On the basis of our findings and those reported
for the POMGnT1 mouse it would seem that the dystrophic phe-
notype develops after birth which is similar to dystrophin deficient
mdx mice which show no morphological abnormalities at birth but
go on to develop a dystrophic phenotype at 4–6 weeks of age.
Nonetheless these observations suggest that an early reduction
in muscle mass may be a significant component of the disease in
dystroglycanopathy patients. Indeed in the tibialis anterior and
extensor digitorum longus there was a reduction in fibre size
and number suggesting that myoblast proliferation and/or fusion
has been perturbed. Interestingly a recent in vitro study of satellite
cells derived from a POMGnT1 null mouse was shown to display a
defect in satellite cell proliferation but not fusion (Miyagoe-Suzuki
et al., 2007). A role for dystroglycan in satellite cell function has
also previously been suggested by the relatively mild phenotype
and efficient muscle regeneration of mice with a skeletal mus-
cle fibre specific loss of dystroglycan (MCK-DG-null) which
retain dystroglycan expression in the satellite cell population
(Cohn et al., 2002; Cohn, 2005). However, the relevance of
these latter observations to our own remains to be proven
particularly since the MCK-DG-null mice are devoid of dystrogly-
can (both a and b) rather than the laminin binding epitope of
a-dystroglycan as in our model.
There was a marked reduction in immunolabelling for IIH6 and
laminin a2 in the FKRP-NeoTyr307Asn mice relative to controls,
which demonstrates a muscle phenotype in these mice at postna-
tal day 0 despite the absence of any obvious dystrophic process.
This reduction in IIH6 and laminin a2 is similar to skeletal muscle
biopsies from patients with FKRP mutations, the absence of dys-
trophy in our model is most likely due to their early developmental
stage.
WWS and MEB are both associated with cobblestone (type II)
lissencephaly (Dobyns et al., 1989)—the pathological correlate of
which is neuronal over-migration during neocortex lamination
secondary to defects in the formation or maintenance of the pial
glial limitans (Yamamoto et al., 2004). Our finding that a reduc-
tion in IIH6 immunolabelling at the pial basement membrane of
the FKRP-NeoTyr307Asn mice was associated with the presence of
cells protruding into the sub-arachnoid space and a more diffuse
labelling with other basement membrane markers such as laminin
g1 and perlecan clearly show that the proper glycosylation of
a-dystroglycan is essential for maintaining the integrity of the
pial basement membrane. In the absence of an intact basement
membrane at the pial surface the endfeet of the radial glia fail to
form the glial limitans, which is necessary to anchor the radial glia
scaffold. A similar finding has been reported by Halfter in the
retina where the Mullar glia irreversibly retract after disruption
of the ILM resulting in apoptosis of the retinal ganglion cells
(Halfter et al., 2005). In our model the result of the disrupted
radial scaffold is a mislocalization of the neurons, in particular
the later migrating neurons, within the cerebral cortex.
Our model bears many similarities with others including those
with a targeted deletion of brain dystroglycan (Moore et al.,
2002), integrin b1 (Graus-Porta et al., 2001) and the nidogen
binding site of laminin g1 (Halfter et al., 2002) all of which, in
common with our model, show a disruption in the glial scaffold
as a secondary consequence of defects in the pial-glial limitans.
Interestingly, the fukutin chimeras were reported to show only
localized disorganization of glia contrary to the widespread disrup-
tion that we observed in our mice. Whilst these differences might
relate to the presence of normal cells in fukutin chimeras, more
recent work in the cerebellar cortex of the POMGnT1 null mouse
has noted that alterations in the Bergmann glial scaffold were
prominent where there were localized breaches in the pial base-
ment membrane (Li et al., 2008). Our observations, therefore,
imply that in the FKRP-NeoTyr307Asn mouse there is a more wide-
spread disturbance of the basement membrane rather than the
localized disruption observed in the other models.
MRI studies of patients with FKRP mutations illustrate both the
heterogeneity in the spectrum of brain changes but also a hierar-
chy of severity, with the cerebellum appearing to be the most
vulnerable structure (Mercuri et al., 2006). The Largemyd mutation
is known to affect tangentially migrating neurons just beneath the
pial surface (Qu et al., 2006). Whilst we observed no irregularities
in the external granule cell layer we did note a marked disruption
Mutations in FKRP associated muscular dystrophies Brain 2009: 132; 439–451 | 449
Dow
nloaded from https://academ
ic.oup.com/brain/article/132/2/439/378060 by guest on 24 N
ovember 2021
in the RC2 labelled cells and a significant alteration in the conti-
nuity of the cerebellar basement membrane as indicated by lami-
nin a2, g1 and perlecan immunolabelling. We detected only very
low levels of a-dystroglycan using either GT-20 or IIH6 in control
cerebellum labelling which was absent in the FKRP-NeoTyr307Asn
mice. This suggests, as was seen with the ILM of the eye, that
epitopes other than IIH6 mediate binding to the extracellular
matrix in this part of the brain. The finding that RC2 labelling
was disturbed demonstrates the functional relevance of these
findings to further cerebellar development (Fig. 7).
Eye abnormalities are associated with the more severely affected
secondary dystroglycanopathy disorders such as WWS and MEB
where patients have displayed cataract and opacity of the crystal-
line lens and other posterior chamber defects. The ILM is a base-
ment membrane which effectively separates the retina from the
vitreous body (Candiello et al., 2007) and contains proteins such
as perlecan, collagen IV, laminin-1, nidogen, agrin and collagen
XVIII. Its mechanical strength together with that of the basement
membranes of the ocular vasculature are known to be essential for
normal eye development (Halfter et al., 2005; Candiello et al.,
2007). Enzymatic disruption of the ILM in the chick retina has
been shown to induce irreversible reaction of the glial endfeet
(Halfter et al., 2005). We observed a marked disorganization
of the ILM in the newborn FKRP-NeoTyr307Asn mice which
was associated with an invasion of cells into the vitreous.
Interestingly, whilst dystroglycan was present in the ILM of
controls as detected with the antibody (GT20) this basement
membrane did not label with IIH6. The goat polyclonal GT-20
was raised against the entire dystroglycan glycoprotein complex
and purified against a hypoglycosylated full-length a-dystroglycan
human fusion protein expressed in HEK-293 cells. This antibody
recognizes a form of a-dystroglycan that migrates as a 120 kDa
band on Western blot (Michele et al., 2002). As reported by
others, laminin a2 is not present in the ILM. Several different
dystroglycan isoforms have previously been reported in the adult
rat eye, including that identified by IIH6 which contrasts with the
observed absence of IIH6 staining in the FKRP-NeoTyr307Asn neo-
natal retina (Moukhles et al., 2000). The observations presented in
this article focus on the neonatal mouse eye and it is unclear at
this juncture whether the presence or absence of the IIH6 epitope
at the ILM is a developmental, species or strain specific difference.
Our observations are therefore particularly relevant since they
show for the first time that a disruption of the basement mem-
brane in these mice may be caused by the absence of an epitope
distinct from that identified by IIH6, and a ligand other than lami-
nin a2.
Fukutin chimera mice show various eye anomalies such as lens
opacification, disorganization of the retinal laminar and also retinal
detachment and misfolding (Takeda et al., 2003). The POMGnT1
null mice and the Largemyd mice also have an eye phenotype
including thinner inner and outer neuroblastic layers (Liu et al.,
2006). Despite the disruption in the ILM in FKRP-NeoTyr307Asn
mice, we noted no marked alteration in the thickness of the neu-
roblastic layers suggesting that such changes are most likely man-
ifested during postnatal growth of the retina.
In conclusion, we have demonstrated that it is a reduction in
Fkrp transcript levels that give rise to structural eye, brain and
muscle abnormalities rather than the presence of missense muta-
tions—at least with respect to the mutation (FkrpTyr307Asn) that we
have introduced. Given that our mutation gives rise to a severe
muscle eye brain disease in the homozygous condition it seems
highly likely that other missense mutations associated with milder
phenotypes will also fail to give rise to a phenotype in the mouse.
In summary, this mouse represents a unique model in which to
investigate future therapeutic options in the dystroglycanopathies.
AcknowledgementsWe gratefully acknowledge the support from the Medical
Research Council (UK), Muscular Dystrophy Campaign (UK),
Association Francaise contres les Myopathies (AFM) and
Muscular Dystrophy Association (USA).
ReferencesBalci B, Uyanik G, Dincer P, Gross C, Willer T, Talim B, et al. An auto-
somal recessive limb girdle muscular dystrophy (LGMD2) with mild
mental retardation is allelic to Walker-Warburg syndrome (WWS)
caused by a mutation in the POMT1 gene. Neuromuscul Disord
2005; 15: 271–5.Barresi R, Campbell KP. Dystroglycan: from biosynthesis to pathogenesis
of human disease. J Cell Sci 2006; 119 (Pt 2): 199–207.
Beltran-Valero DB, Currier S, Steinbrecher A, Celli J, van Beusekom E,
van der ZB, et al. Mutations in the O-mannosyltransferase
gene POMT1 give rise to the severe neuronal migration disorder
Walker-Warburg syndrome. Am J Hum Genet 2002; 71: 1033–43.
Beltran-Valero DB, Voit T, Longman C, Steinbrecher A, Straub V,
Yuva Y, et al. Mutations in the FKRP gene can cause muscle-eye-
brain disease and Walker-Warburg syndrome. J Med Genet 2004;
41: e61.
Brockington M, Blake DJ, Prandini P, Brown SC, Torelli S, Benson MA,
et al. Mutations in the fukutin-related protein gene (FKRP) cause a
form of congenital muscular dystrophy with secondary laminin
alpha2 deficiency and abnormal glycosylation of alpha-dystroglycan.
Am J Hum Genet 2001; 69: 1198–209.
Brockington M, Torelli S, Prandini P, Boito C, Dolatshad NF, Longman C,
et al. Localization and functional analysis of the LARGE family of
glycosyltransferases: significance for muscular dystrophy. Hum Mol
Genet 2005; 14: 657–65.
Brockington M, Yuva Y, Prandini P, Brown SC, Torelli S, Benson MA,
et al. Mutations in the fukutin-related protein gene (FKRP) identify
limb girdle muscular dystrophy 2I as a milder allelic variant of
congenital muscular dystrophy MDC1C. Hum Mol Genet 2001; 10:
2851–9.Brown SC, Torelli S, Brockington M, Yuva Y, Jimenez C, Feng L, et al.
Abnormalities in alpha-dystroglycan expression in MDC1C and
LGMD2I muscular dystrophies. Am J Pathol 2004; 164: 727–37.
Candiello J, Balasubramani M, Schreiber EM, Cole GJ, Mayer U,
Halfter W, et al. Biomechanical properties of native basement
membranes. FEBS J 2007; 274: 2897–908.
Clement EM, Godfrey C, Tan J, Brockington M, Torelli S, Feng L, et al.
Mild POMGnT1 mutations underlie a novel limb-girdle muscular
dystrophy variant. Arch Neurol 2008; 65: 137–41.
Cohn RD. Dystroglycan: important player in skeletal muscle and beyond.
Neuromuscul Disord 2005; 15: 207–17.
Cohn RD, Henry MD, Michele DE, Barresi R, Saito F, Moore SA, et al.
Disruption of DAG1 in differentiated skeletal muscle reveals a role for
dystroglycan in muscle regeneration. Cell 2002; 110: 639–48.
450 | Brain 2009: 132; 439–451 M. R. Ackroyd et al.
Dow
nloaded from https://academ
ic.oup.com/brain/article/132/2/439/378060 by guest on 24 N
ovember 2021
Dobyns WB, Pagon RA, Armstrong D, Curry CJ, Greenberg F, Grix A,
et al. Diagnostic criteria for Walker-Warburg syndrome. Am J Med
Genet 1989; 32: 195–210.Godfrey C, Clement E, Mein R, Brockington M, Smith J, Talim B, et al.
Refining genotype phenotype correlations in muscular dystrophies with
defective glycosylation of dystroglycan. Brain 2007; 130: 2725–35.Graus-Porta D, Blaess S, Senften M, Littlewood-Evans A, Damsky C,
Huang Z, et al. Beta1-class integrins regulate the development of
laminae and folia in the cerebral and cerebellar cortex. Neuron
2001; 31: 367–79.
Halfter W, Dong S, Schurer B, Ring C, Cole GJ, Eller A. Embryonic
synthesis of the inner limiting membrane and vitreous body.
Invest Ophthalmol Vis Sci 2005; 46: 2202–9.
Halfter W, Dong S, Yip YP, Willem M, Mayer U. A critical function of
the pial basement membrane in cortical histogenesis. J Neurosci 2002;
22: 6029–40.
Holzfeind PJ, Grewal PK, Reitsamer HA, Kechvar J, Lassmann H,
Hoeger H, et al. Skeletal, cardiac and tongue muscle pathology, defec-
tive retinal transmission, and neuronal migration defects in the
Large(myd) mouse defines a natural model for glycosylation-deficient
muscle - eye - brain disorders. Hum Mol Genet 2002; 11: 2673–87.Kobuke K, Piccolo F, Garringer KW, Moore SA, Sweezer E, Yang B, et al.
A common disease-associated missense mutation in alpha-sarcoglycan
fails to cause muscular dystrophy in mice. Hum Mol Genet 2008; 17:
1201–13.
Lewandoski M, Martin GR. Cre-mediated chromosome loss in mice. Nat
Genet 1997; 17: 223–5.
Li X, Zhang P, Yang Y, Xiong Y, Qi Y, Hu H. Differentiation and devel-
opmental origin of cerebellar granule neuron ectopia in protein
O-mannose UDP-N-acetylglucosaminyl transferase 1 knockout mice.
Neuroscience 2008; 152: 391–406.
Liu J, Ball SL, Yang Y, Mei P, Zhang L, Shi H, et al. A genetic model
for muscle-eye-brain disease in mice lacking protein O-mannose
1,2-N-acetylglucosaminyltransferase (POMGnT1). Mech Dev 2006;
123: 228–40.Longman C, Brockington M, Torelli S, Jimenez-Mallebrera C, Kennedy C,
Khalil N, et al. Mutations in the human LARGE gene cause MDC1D, a
novel form of congenital muscular dystrophy with severe mental
retardation and abnormal glycosylation of alpha-dystroglycan. Hum
Mol Genet 2003; 12: 2853–61.
Lundkvist J, Zhu S, Hansson EM, Schweinhardt P, Miao Q, Beatus P,
et al. Mice carrying a R142C Notch 3 knock-in mutation do not
develop a CADASIL-like phenotype. Genesis 2005; 41: 13–22.
MacLeod H, Pytel P, Wollmann R, Chelmicka-Schorr E, Silver K,
Anderson RB, et al. A novel FKRP mutation in congenital muscular
dystrophy disrupts the dystrophin glycoprotein complex.
Neuromuscul Disord 2007; 17: 285–9.
Mercuri E, Topaloglu H, Brockington M, Berardinelli A, Pichiecchio A,
Santorelli F, et al. Spectrum of brain changes in patients with conge-
nital muscular dystrophy and FKRP gene mutations. Arch Neurol 2006;
63: 251–7.
Meyers EN, Lewandoski M, Martin GR. An Fgf8 mutant allelic series
generated by Cre- and Flp-mediated recombination. Nat Genet
1998; 18: 136–41.Michele DE, Barresi R, Kanagawa M, Saito F, Cohn RD, Satz JS, et al.
Post-translational disruption of dystroglycan-ligand interactions in con-
genital muscular dystrophies. Nature 2002; 418: 417–22.
Michele DE, Campbell KP. Dystrophin-glycoprotein complex: post-trans-lational processing and dystroglycan function. J Biol Chem 2003; 278:
15457–60.
Miyagoe-Suzuki Y, Miyamoto K, Saito F, Matsumura K, Manya H,
Endo T, et al. POMGnT1-null myoblasts poorly proliferate in vitro.Neuromuscul Disord 2007; 17: 873.
Moore SA, Saito F, Chen J, Michele DE, Henry MD, Messing A, et al.
Deletion of brain dystroglycan recapitulates aspects of congenital mus-
cular dystrophy. Nature 2002; 418: 422–5.Moukhles H, Roque R, Carbonetto S. alpha-dystroglycan isoforms are
differentially distributed in adult rat retina. J Comp Neurol 2000;
420: 182–94.Muntoni F, Brockington M, Torelli S, Brown SC. Defective glycosylation
in congenital muscular dystrophies. Curr Opin Neurol 2004; 17:
205–9.
Muntoni F, Voit T. The congenital muscular dystrophies in 2004: a cen-tury of exciting progress. Neuromuscul Disord 2004; 14: 635–49.
Nagy A, Moens C, Ivanyi E, Pawling J, Gertsenstein M,
Hadjantonakis AK, et al. Dissecting the role of N-myc in development
using a single targeting vector to generate a series of alleles. Curr Biol1998; 8: 661–4.
Qu Q, Crandall JE, Luo T, McCaffery PJ, Smith FI. Defects in tangential
neuronal migration of pontine nuclei neurons in the Largemyd mouse
are associated with stalled migration in the ventrolateral hindbrain. EurJ Neurosci 2006; 23: 2877–86.
Sewry CA, Philpot J, Mahony D, Wilson LA, Muntoni F, Dubowitz V.
Expression of laminin subunits in congenital muscular dystrophy.Neuromuscul Disord 1995; 5: 307–16.
Sherratt TG, Vulliamy T, Strong PN. Evolutionary conservation of the
dystrophin central rod domain. Biochem J 1992; 287 (Pt 3): 755–9.
Sveen ML, Schwartz M, Vissing J. High prevalence and phenotype-genotype correlations of limb girdle muscular dystrophy type 2I in
Denmark. Ann Neurol 2006; 59: 808–15.
Takeda S, Kondo M, Sasaki J, Kurahashi H, Kano H, Arai K, et al.
Fukutin is required for maintenance of muscle integrity, cortical histio-genesis and normal eye development. Hum Mol Genet 2003; 12:
1449–59.
Toda T. [Fukutin, a novel protein product responsible for Fukuyama-typecongenital muscular dystrophy]. Seikagaku 1999; 71: 55–61.
van Reeuwijk J, Grewal PK, Salih MA, Beltran-Valero de BD,
McLaughlan JM, Michielse CB, et al. Intragenic deletion in the
LARGE gene causes Walker-Warburg syndrome. Hum Genet 2007;121: 685–90.
van Reeuwijk J, Janssen M, van den Elzen C, Beltran-Valero de BD,
Sabatelli P, Merlini L, et al. POMT2 mutations cause alpha-
dystroglycan hypoglycosylation and Walker-Warburg syndrome.J Med Genet 2005; 42: 907–12.
Yamamoto T, Kato Y, Karita M, Kawaguchi M, Shibata N, Kobayashi M.
Expression of genes related to muscular dystrophy with lissencephaly.
Pediatr Neurol 2004; 31: 183–90.Yanagisawa A, Bouchet C, Van den Bergh PY, Cuisset JM, Viollet L,
Leturcq F, et al. New POMT2 mutations causing congenital muscular
dystrophy: identification of a founder mutation. Neurology 2007; 69:1254–60.
Yoshida A, Kobayashi K, Manya H, Taniguchi K, Kano H, Mizuno M,
et al. Muscular dystrophy and neuronal migration disorder caused by
mutations in a glycosyltransferase, POMGnT1. Dev Cell 2001; 1:717–24.
Mutations in FKRP associated muscular dystrophies Brain 2009: 132; 439–451 | 451
Dow
nloaded from https://academ
ic.oup.com/brain/article/132/2/439/378060 by guest on 24 N
ovember 2021