recruiting & retaining millennials · wewwe ’v’ve egoggoo t tt a aa feeww w ne ww tht inn...

6
The millennial generation (those born between approximately 1981 and 1996) is becoming the larg- est portion of our workforce. In fact, it is expected to be more than 50% by 2025! Hiring managers consistently say that understanding how to attract, motivate and retain our young professionals is one of their most significant challenges. So, if attracting and keeping millennials is a challenge now, what about seven years from now, when they’ll make up a majority of the workforce? An inability to recruit and retain this generation could be a roadblock to your organization’s growth, both now and/ or in the future. Come to this informative session to learn: The differences between all four generations in our workforce The value millennials bring to the workforce, and what matters to them Practical strategies to attract, motivate and retain millennials for your organization Cost for this seminar is $10, and includes a breakfast buffet from Morris Family Restaurant. Breakfast and lunch seminars are sponsored by PPL Electric Utilities. Thursday, August 23 • 8:30—10:30 a.m. LCBC Church • 2421 Columbia Blvd. (Rt. 11), Bloomsburg Register online at ColumbiaMontourChamber.com, or call Phyllis at 570- 784-2522 or email [email protected]. Present a Breakfast Seminar Recruiting & Retaining Millennials Featuring Tina Welch of Welch Performance Consulting

Upload: others

Post on 15-Aug-2020

1 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Recruiting & Retaining Millennials · WeWWe ’v’ve egoggoo t tt a aa feeww w ne ww tht inn gsggss p lannnn edd foro thihhi s ss yyeyearaar ,mommo o sstt sigiiggninnii caccaantnntllyly

The millennial generation (those born between approximately 1981 and 1996) is becoming the larg-est portion of our workforce. In fact, it is expected to be more than 50% by 2025! Hiring managers consistently say that understanding how to attract, motivate and retain our young professionals is one of their most significant challenges. So, if attracting and keeping millennials is a challenge now, what about seven years from now, when they’ll make up a majority of the workforce? An inability to recruit and retain this generation could be a roadblock to your organization’s growth, both now and/or in the future. Come to this informative session to learn: • The differences between all four generations in our workforce • The value millennials bring to the workforce, and what matters to them • Practical strategies to attract, motivate and retain millennials for your organization Cost for this seminar is $10, and includes a breakfast buffet from Morris Family Restaurant. Breakfast and lunch seminars are sponsored by PPL Electric Utilities.

Thursday, August 23 • 8:30—10:30 a.m. LCBC Church • 2421 Columbia Blvd. (Rt. 11), Bloomsburg

Register online at ColumbiaMontourChamber.com, or call Phyllis at 570-784-2522 or email [email protected].

Present a Breakfast Seminar

Recruiting & Retaining Millennials

Featuring Tina Welch of Welch Performance Consulting

Page 2: Recruiting & Retaining Millennials · WeWWe ’v’ve egoggoo t tt a aa feeww w ne ww tht inn gsggss p lannnn edd foro thihhi s ss yyeyearaar ,mommo o sstt sigiiggninnii caccaantnntllyly

The new ownership group, management and staff at Frosty Valley in-vite their fellow Chamber members to check out their newly-renovated resort as they host July’s Business After Hours. Frosty Valley recently completed renovations and opened up a new public restaurant, the Iron Fork, along with the Barn at Frosty Valley, a new wedding and ban-quet facility. Prior to the Business After Hours, there will be a ribbon cutting for the new facilities be-ginning at 4 p.m., which will lead directly into a late summer afternoon of networking and fun. Check out the Iron Fork and sample some of its tasty menu selections, enjoy some drinks, and take a tour of the facilities. A few prizes will also be on hand. Frosty Valley is located at 1301 Bloom Rd., Danville.

The Ronald McDonald House of Danville will host the first of two Business After Hours in August, which will occur in the middle of the “Share-A-Night, Giving the Gift of Togetherness” Week, which will focus on growing and raising money for this program, that helps RMHD contin-ue fulfilling its mission of providing shelter to families with sick children. Nearly 44% of RMHD’s monthly guests cannot afford the suggested dona-

tion, but no family is ever turned away. This program sponsors a family of a critically ill child. At-tendees will be able to learn RMHD’s other efforts, as well as learn about the numerous volunteer opportunities available, and meet the staff and volunteers. A full selection of hors d’oeuvres and non-alcoholic beverages will be available, and tours of RMHD’s newly-renovated guests rooms will be giv-en. RMHD is located at North Academy Ave. and Trembulak Way on the Geisinger campus.

AGAPE is celebrating its 10th anniversary this year, and it will welcome Chamber members to its facility in downtown Bloomsburg to showcase its remarkable growth over the last decade. Enjoy a tour of its facility and learn about its many programs, including its weekly community meals, adult clothing giveaways, cloth diaper program addiction support groups, as well as its annual events such as the Mission Mall and much more. Enjoy some finger food and drinks as you connect with other community members and also learn about the many volunteer opportunities at AGAPE, as well as its ongoing needs as it aims to stamp out poverty in our area. Please note the special time of this Business After Hours of 4-6 p.m. Attendees are welcome to stay after the event concludes to help serve its weekly community meal, which is provided to those in need each Wednesday from 5:30-7 p.m. AGAPE is located at 19 East 7th St., Bloomsburg.

Wednesday, Aug. 15 • 4:30—6:30 p.m. • Ronald McDonald House of Danville

Three summer networking

opportunities Wednesday, July 18 • 4:00—6:30 p.m. • Frosty Valley

Register for these events online, call Phyllis at 570-784-2522 or email [email protected].

Wednesday, Aug. 29 • 4—6 p.m. • AGAPE

Page 3: Recruiting & Retaining Millennials · WeWWe ’v’ve egoggoo t tt a aa feeww w ne ww tht inn gsggss p lannnn edd foro thihhi s ss yyeyearaar ,mommo o sstt sigiiggninnii caccaantnntllyly

Save the Date

Thursday, Dec. 135-8 p.m.

Annual Holiday Open HousePine Barn Inn

Sponsored by:

While the weather is anything but frightful (except the occasional thunderstorm) and the only delight-ful fi re in July is the outdoor, campfi re or patio variety, we’re already starting to make plans for this year’s Holiday Open House, when the weather outside is frightful and fi re inside so delightful.

We’ve got a few new things planned for this year, most signifi cantly a shuttle service, courtesy of Susquehanna Valley Limousine, which will hopefully mitigate any parking issues at the Pine Barn Inn.

Many more details to be announced in the coming months, but in the meantime, please save the date for Dec. 13.

Sponsorship and ticket information will be announced in early September.

Thanks to the following sponsors that have already committed to supporting this event as part of their all-inclusive membership packages:

Event SponsorGeisinger Bloomsburg Hospital

Hospitality SponsorM&T Bank

Red Reindeer SponsorsKey Partners

North Shore Railroad

Green Tree SponsorSusquehanna Valley Limousine

WWWWhWhWhWhWWhWWhWhWhWhWhWhWhilililililililliilee eeeeeeeee e e tthththththththhthttheee e e weweeeeeeeweeeeeeeeweeatatatatattatatatatatatatattheheheheheehehehehehehehehehhhhheehher r rrrrrrr isisisisissisisisisisisssssss aaaaaaaanynynynynyynyththththththththhththhtht iniiiiniiii ggg bubb t ffrffffff iiiighhhthth fffuff llll ll ((((((e(((excxccxcxcepeepeppepepepepepptttttttttt tt hhhhthhhththththththththththththththtttttt eeeeeee eeeeeeeeeee ocococococococccocoocccccccocco cacacacacacaccacacaacacaccccccc siisiisisiisisisiisisisisisisisionononononnonoonononononnonon lllallalalalaalaaaalalalaalalaaa tttttttttttthhuhhhuhuhhhuhuhuhuh ndnddndndndnnndnderererererererstststststsstororrorororororm)m)m)m)m)m)m)m) aaaaaaandndndndddddddndddnd tttttttttttthehheheheheheeeheheheehe ooooooooooooooonlnlnlnlnlnlnlnlnnllnnlyyyyy y yyyyyyy dededededdedeededdedelilillllllilll ghghghhhhhhhhhhhhhhht-tt-t-tttt---tfufufufffffffffulllll fififi fi rereree iin n JuuuJullylyyyl iiisssssssssss ththhhhtttt eee ououuuuoutdtddddtdtdttddooooooooooooooooooo rrr,r,rrr, cccccccccamammmmmammamamamampfipfipfipfifififififipppfippfippfipfipfirrrrrree e ororororororor ppppppppppatattatatatatataaattioiioiioioiooiioioioooooo vvvvvvvvvvvvvvvararararrarararararrrrarrieieieieieieieieieieiieiieieeieeetyyyyyyytyyytytytyyyytyyttytyyytytttttytyyyyyy,,,,,,,,,,,, wwewewwwewewewewewewewewwwwewwewewwwwweewewww ’rrrrrrrrrrrrrrrrre eeeeeeeeeeeeee alalalalalalalalalalaaalaalaala rerererererererererrereereeer adadadadaaddadaadadadadda y yy yy y yyyyy stsststststststs ararararararartitititit ngngngngggggg ttoo maaamamamamakekkkkkkkkkekekekke pppppppppplalalalaaaansnsnsnsssnsn ffffffffffffororororororr ttttttttttthihihhhhihihhhhh sssssssyeyearar’s’ss HHHHHHololololoo iiidii ayayayyyaayyayyyyyyy OOOOOOOOOOOOOOOOOOOppppepepepppp nnnnnnnnnnnnnnnn HoHoHoHHoHoHHoH usssssssse,eeeeeeeeee,e wwwwwwwwwwwwhehhheheheheheheheehehhh nnnnnnnn nnn ththththhhhhhhthththththththtthhe eee eee wewewewewewewweweweweweatatatatatttttatatatataata hehhehehhehehhhhehhhh rrrr r ouuouoououououooououuououuooooutsstststtstsststsst idiiidididiiididiiiiddididdeeee eeeeee isissssssssssssssssi fffffffffffffririrrrririiighghghghghghhghghghhhtftftftftftftftftftfttftftfffttttftftfffuluuulululuuuul aaaaaaaaandnddndnnnd fififirrrrrre e e ee e e iinininnnnininninsisisisisisiss dededededed sssooo dededeededdedededeelilililil ghhghhghghghhggggggggggg tftffftftftftfft ullllull..

WeWWeWWeWWWeWWe’v’v’ve e e e googogoggogoogg t tt t a aaaa a a fefefefeefefewwwwwwww ww nenenenenenenenenewwwwwwww ththththththththththtt inininnnnninnnnnnngsgsgsggsgggggsggsgsgsgsggsssgssggggggsggs ppppppppppppplalalalalalalalalalalalalalannnnnnnnnnnnnnnnnnnn edededededededededededddded ffffffororororororo ttttthihihihihihihhihihis ss ss s s yyyyyeyeyeeeyeeyeyyyyyy araraaaar,, momommomoomoomomoossstststtstst sssssssssssssssigigigigigigiigiigigigigigigigigigigggigiggigigigigignininiiinininininininininininininininnnininififififififi fifififififififififififififififififififififi cacacccacacacaacacacacacacacacaaaacacaantntntntntntntntntntnnnnnnnnnnntlllllllyylyllllylyly aaaaaa ssssshhuhuhuhuhuttttttttttleleleleeleeeeeeeleeeeeeelelee sssssssssssssssseeereererereeererererrerviviiiviivivivivivivicececececececee,,,,,,, cococooocoouuuururrruuruuu teteteeeeeeeeeet syyyyyyyy ooooff f f ffffSSSSSuS sqqqqqqquueueuuehahannnnnn a VaVVVaVaValllllllllllll eyeyeyey LLLLLLLLLLLLLLimimimimmmimiimimimimimmimimmmimmouuouusisisiisisssiineeenenenee, whwhwhhwhwwhwhww icicciciciccichhhhhhhhh h wiwiwiwiwiwwwwwiwiwwwiwiwiwwiwiwiilllllllllllllllllllllllllllllllllll hhhhhhhhhhhhhhhopopoppopppopoopopopopopppoopopoopefefefefefefefeffffefefefeefefefefeffefululululululllululululullululululullylylylylylylylylllyllyylylylyyylyy mmmmmmmmmmmmmmmmitititititttititittigigiggigiggggigggigggigigigggiggigigggggatatatatatatataatatatataa eeeeee e anananannaannanananyy yyyyyyy y y papapapapappapapapappppapapapapp rkrkrkrkkrkkrkrkrkrkrkrkrkkrrkrkininininininiinininininnnnngggggggggg iisisiisisisiisissisisssusususuusususususussssssusss esessesesesseseess aaaaaaaaattttttt t t thththththththththttheeee e e ee PPiPiPiPiPiPP nenenee BBaBBBBBBB rnnnnnnrnnnnnn IInnnnnnnnnnnnnnn.

MaMaMaMaMMMaMaMaaannnnnnynynnn morore e deeeeettttatatattttattattataaiiiiillllliliiiiiiiiii s s totototootoootoooo bbbbbbbbbbbbbbbbbbbeee ee e eeeee eeeeee aananaaaaaanananaanaananaaaaa nnnnnononooonnonnnnonoonnon unuununununuuuuuuuuuunu cececcececcceecececeeccecccececeeeeddddd ddddddd dddddddddddddddd d ininininininiininninininnnnnnnnniniinnn tttttttttttttttttttthehehehehehehehehhhhehehehehehehhhhehehhh ccccccccccccccccomomoomomoomommomomomomomminininnnnnnnnnnninnninninininnninningggggg gg g ggg g g ggggg momomomomomomomommomomomommmomoommmmmm ntntntntnntnnntntnntntthshshshsshhshshhshhss,,,,,,,,, bubububb tt ttt inininn tthehehhhhehe mmmmmmmmeaeaeaea tttttttttnttntntntntntntntntntntimimimiimimimimimimiimiimiiiimiimimiiiimimeeeeeeeee,e,e,ee pppppppppppppppppleelelelelelelleelleel asasasaa e e e e e eee sssssasasasasasassaasssas vvvvevvvvvvvv ttttttttheheheheeheheheheheheheeeeeee dddddddddddddddddddddddddddata efofofofofofooofofofoofforrrrrrrr rrrr Dec........ 113.3.

SSSpSppoooononnnnnononnnonsssssoooooosss rsrsrrsrsrrssrsrsrssshihihihhihihihihihihihihipppppppppppppp aaaannnnnnnnna ddddddd d tiickcckckckckckckckckckkckkkettt iiiiiiinfnnfffnfffoorrmaamamaaaamaaamaaaatititititititititiititttititt ononooooo wwwwwwwwwwiiiilililiiiiilillll bbebe aaaaaaaaaaaaaannnnououncn ed in early y y y y y y y y yy SeSSeSeSeSeSeSSeSeSSeSeSeSeSeSeSeptptptptptptptptttptptptptptppttptptptptemememememmememeeememeeeeeeemmmeme beber.r.

TTTTTTTTTThThThThhThThTThThTThThThTThThTTTTThhTTTT aaaaannnnnnnnaaanaannanaanana kskskkskskssssssskskskkkk ttttttttttttttttooo oooo o ooooooo thtththhhththhhhhhhthe eeeeeee fofffofofofofofofofoffooofofofofoofoofoooofoolllllllllllllllllllllllllllllllllllllllloowooooowowowowowowowowwoooooowwowooowwowiiininiininniiinniniinng gggg gg g ssspspspspppspspppsppssppssponononononnnnnnonnnonnnonsssssossssosososoosoosoosssooosos rsrrrsrsrsrrsrsrrsrsrrrsr tttttttttttttttttttthhhahhahhhhhahhhahhhhhahahhhhhahhaahahahhhhhhh ttttttttttttt hahahhahhhhhhhhahhahahahahahahahahahahhhhhhhhhahhhahhhahahahahahahhahahahhahahhhaveveveveveveveveeeveeevvvve aaaaaaaaaaallllrlrllrlrlrrlreaeeeaeaaaaeeeaaeaeaeaeaaaaaaaadydydydydydydydydyddddydydydyyddddddddydydyydydyyyy ccccccccccccomomomomomomomomommommmmomomomomomomomooommmommooo mimimmmimmmmimimmimimimmimmimimmmmmiimmmmmmmmmm tttttttttttttttttttttttttttttttttttedededededededededededeededeedeededd ttttttttttooooooo o o ooo oooo oooooo ooooooooo sususuuuuuuususuusususususuuusuusuuusuuuuuusuususuussssussusssusuuss ppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppporoororrorooorrorooorooorrrrorrorooro tititititiiiitiiiitiititititititiiitiingngnnngngngngngngngngnngngngggngngngnggngggngngg ttttttttttttttttttttttttttttthhihihihihihhihihihhhihihihihihihihhihihihihhihihihihihiihhiihihhhhihhh ssssssssssssssssss evevevevevevevevevevevevevveevevevvevvevveneneenenenenenenenenennneneenene tttt ttttt t tttt asasasasasasasasasssaasasasaaaaaaa ppppppppppppppppaaraarararrarararrrrrrrarraararrra tttttttttttttttttt tttttt ofoooofofoooooooo tthehehehehhheheirrirrrri aaalalaaa l-ll-iininnnnnnniinnninnnnclclclclclclc usususssususu iiiiiiviviviiviiiviviviviviviivi eeee memmememmememmemmemememememememeememmmemmemembbbbbbbbmmmmmmmmmmm ererererrrrrrrershshshhhshshshshshshshshshshipipipipippppppppppipppppppppppppipippippppppp ppppppppppppppppppppppppppacaccacacaccccckakakakaakaakakakaaaakaakaaaaaaaaaaaaaagggggegeggeggegegegegegeggggeggggggggggggggggg s:s:s:s:s:s:s::::s::::ss

EvEvEvEvvenennnnnnnt tt SSSSSSSpSpSpSpSpSSpSSpSSppSSSpSpSpppononoonononononnnono sosososososoosooooosooooooorrrrrrrrrrrrGeGeGGeGeGeGeGeeeeGGGeGGGeeeisisininnnnnnnnnnnngegegegeger r BlBlllllloooooooooooooooooooomsmsmsmsmmmmsmmsmmm bububububuububub rgrgrgrgrgrgrgrggg HHHHHHHHHHHoosososoososoosoososoosososoosso ppppipipippippipipppppippipipp tatatatatatatatatatatataatataalllllll

HoHHoHoHoHoHoHoHoHHHHoHoHoHoHoHoHHoHHHH spspspspspsspspspspsppspssssspsppiititiiititititalalalallalalaaalaaaalitititiittty y y y SpSpSpSpSpSppSpSpononononononononnnnnnsssososoosooss rrrrrrrM&M&M&M&M&&MMM&M&M&T T TTTTT BaBaBBaBanknknknknkkkkkkk

RReReReReeeeeeeeeeeed dddd dddd ReRReReReReReReRReeReRRReininininininininininnininininininninnnnndedededededeededeeeeeeeeeeereeeeeee SSSSSSSSpoooooooooooonsnsnsnsnssnsnsnsn oroorrrorrorororssssssssssssKeKeKeKeKKKKK y y yyyyyyy PaPaPaPaaPaPaPaPaPaPaaaaPaartnenenennnnn rs

NoNoNoNoortrttrtrtrtrtrtrrthhhhhh hhh ShShhhhhhhhhhhhhhhhhhorororororrororrororororrore e RaRRRRRRRRRR ilroooooooooooooooooadadadadadadadadadadadddd

GGrGrrGGGrGrGrGrGrGGrGrGrrGrreeeeeeeeeeeeeeeeeeeeeeeeeeeeeee nnnnnnnnnnnnn TrTrTrTrTrTrrTrTrTrTrTrTrTrTrTrrTTTrTrTrTrTrTTrTrTrTTTTTTrTrTrTrTTTrrrTrreeeeeeeeeeeeeeeeeeeeeeeeeeeeee SSSSSSSSSSpopopopopopopopopoppopopoooopp nsnsnsnsnsnsnsnsnsnsnsnsnsnnssssnsnsn orororororororororororoooooooSuSuS sqsqsqueeueeueueueueueeueehahhahahahahahahaahahaahahhahahahhaahhhahh nnnnnnnnnnnnnnnnnnnnnnnnnnnnn a a a aaaaaaa VaVaVVaVaVaVaVaVaVaVaVaVaVaVaVaVaVaVaVaVaaVaVaVVVaalllllllllllllllllllllllllllll eyeyeyeyeeeeeee LLLLLLLLLLLLLLLLLiiimimiimiimimimimiimimimimimimmmmmmououououuuuuouuouooououuouuooouusineeeeeeeee

Page 4: Recruiting & Retaining Millennials · WeWWe ’v’ve egoggoo t tt a aa feeww w ne ww tht inn gsggss p lannnn edd foro thihhi s ss yyeyearaar ,mommo o sstt sigiiggninnii caccaantnntllyly

Wednesday, July 18 4—6:30 p.m.

Frosty Valley Country Club

The new own-ership group, management and staff of Frosty Val-ley Country Club invite Chamber mem-bers to check out its newly renovated resort as it hosts a mid-summer late afternoon of networking and fun. Come see the new public restaurant, the Iron Fork, the new clubhouse banquet room and the Barn at Frosty Valley, which are all available for weddings, as well as corporate and other special events. Food and drinks from the Iron Fork and giveaways will also be availa-ble. The afternoon starts with a ribbon cut-ting at 4 p.m., followed by the After Hours.

Wednesday, Aug. 15 4:30—6:30 p.m.

Ronald McDonald House of Danville

The Ronald McDon-ald House of Dan-ville invites its fellow Chamber members to its House during the middle of “Giving the Gift of Togetherness” Week, which will focus

on growing and raising money for this pro-gram that helps RMHD continue fulfilling its mission of providing shelter to families with sick children. This program sponsors a family of a critically ill child. Attendees will also be able to learn RMHD’s other efforts, as well as learn about the numerous volun-teer opportunities available, and meet the staff and volunteers. A full selection of hors d’oeuvres and non-alcoholic beverages will be available, and tours of RMHD’s newly-renovated guests rooms will be given.

Wednesday, Aug. 29 4—6 p.m.

AGAPE

Celebrate AGAPE's 10-year anniversary as

it showcases its growth

over the last decade to its fellow Chamber members. Enjoy a tour of its Bloomsburg facility and learn about its many programs, including its weekly community meals, adult clothing giveaways, cloth diaper pro-gram, addiction support groups and more. Enjoy some finger food and drinks and also find out about the many volunteer opportu-nities at AGAPE. Attendees are also wel-come to stay after the event concludes and volunteer to help serve its weekly commu-nity meal, which is provided to those in need each Wednesday.

Wednesday, Sept. 19 4—6:30 p.m.

Quality Inn Bloomsburg

The former Econo Lodge is now a Quality Inn, and its new ownership group invites Chamber members to check out its newly-renovated facility. Enjoy a tour of the re-modeled hotel, which includes an expanded lobby and breakfast area, a new fitness cen-ter, as well as completely renovated rooms that consist of new furniture, wallpaper, carpets and fully remodeled bathrooms. Enjoy some food and drink, including some tasty appetizers from next door neighbor Quaker Steak & Lube, and also have the chance to win some door prizes. The after-noon starts with a ribbon cutting at 4 p.m., followed by the After Hours.

Wednesday, Oct. 10 4:30—6:30 p.m.

Geisinger Bloomsburg Hospital

Join the administration and staff at Geisinger Bloomsburg Hospital as they host the first of two Business After Hours in October in the main lobby of the hospital. Hospital leadership will be in at-tendance to answer any questions as well as provide updates on the latest programs and initiatives of both the Geisinger

system and Geisinger Bloomsburg Hospi-tal. Hors d’oeuvres and refreshments will be provided and there will also be some small prizes to be given out.

Wednesday, Oct. 24 4:30—6:30 p.m.

Camp Victory

Before it winteriz-es its facilities for the upcoming cold season, Camp

Victory - a special camp for special kids - will welcome Chamber members to its spa-cious and beautiful campground. Enjoy the peaceful and tranquil atmosphere at Camp Victory after a busy day at work as you meet the staff, take in some refreshments and learn about Camp Victory, which annu-ally hosts more than 30 camps for various groups of kids, mainly with special medical needs, and since its opening in 1994, has hosted nearly 30,000 overnight campers and staff. Also learn about the various op-portunities to get involved and volunteer at Camp Victory's many camps or in other ways.

Wednesday, Nov. 14 4:30—6:30 p.m.

Central Susquehanna Community Founcation

The Central Susquehanna Communi-ty Foundation will host the final Business After Hours of 2018 at its Berwick head-quarters. Meet or reconnect with the CSCF staff, learn about their ongoing work to improve our community as well as their latest initiatives and priorities and how they go about fulfilling their mission of enhancing the quality of life in the Central Susquehanna Valley. If you’re a local non-profit, learn about ways your organization can collaborate with CSCF for the better-ment of our community. Food and drinks will be available.

2018 Master Business After Hours Schedule

Mid-Year Update * All dates, times and locations are subject to change

For more information or to register, visit columbiamontourchamber.com, or call Phyllis at 570-784-2522 or email [email protected].

Page 5: Recruiting & Retaining Millennials · WeWWe ’v’ve egoggoo t tt a aa feeww w ne ww tht inn gsggss p lannnn edd foro thihhi s ss yyeyearaar ,mommo o sstt sigiiggninnii caccaantnntllyly
Page 6: Recruiting & Retaining Millennials · WeWWe ’v’ve egoggoo t tt a aa feeww w ne ww tht inn gsggss p lannnn edd foro thihhi s ss yyeyearaar ,mommo o sstt sigiiggninnii caccaantnntllyly