ELSEVIER Biochimica et Biophysica Acta 1260 (1995) 43-48

BB. Biochi~ie~a et Biophysica A~ta

Recombination of endogenous D 2 dopamine receptor gene with a metallothionein promoter in GH4C1 cells confers functional and

inducible D 2 response

St6phane Allard, Michel Labb6, Pierre Falardeau * Unitd de M£decine G~nktique et Mol~culaire, CHUL, and School of Pharmacy, La~'al UniL,ersity, Ste.-Foy, Quebec, Canada

Received 3 March 1994; revised 27 June 1994

Abstract

We have previously shown that expression of a functional endogenous D 2 short dopamine receptor is obtained in GH4C1 cells following transfection with a plasmid that confers resistance to neomycin (pRSVNeo) (Allard et al. (1993) Biochem. Biophys. Res. Commun. 193, 801-807). In order to better understand the mechanisms responsible for such a phenomenon, we cloned and sequenced the 5' region of the D 2 gene present in native GH4C1 cells as well as the cDNA of transfected cells. No homology with the published sequence of the rat D 2 dopamine receptor promoter was found; however, this region has perfect homology with the mouse metallothionein promoter. In cells expressing D 2 receptor, the promoter is fully functional and can regulate dopaminergic D 2 receptor mRNA levels and receptor expression in a dose-dependent manner in the presence of Zn 2+ or Cd 2+. The receptor level is raised from 500 to 3000 fmol/mg of protein in the presence of 100/zM of Zn 2+. These results suggest that in GH4C1 cells, a recombination between the mouse metallothionein promoter and the D2 dopamine receptor took place. This system provides us with a cell line expressing an endogenous dopamine D 2 receptor in which the level of expression can be easily modulated.

Keywords: Dopamine receptors; Metallothionein promoter; GH4C1 cells; Gene regulation; Recombination

I. Introduction

Release of prolactin (PRL) is regulated in lactotroph cells by activation of the pituitary dopamine D 2 receptor (D2R), which is coupled to an inhibitory G protein. Two distinct isoforms of this receptor are generated by an alternative splicing of pre-mRNA in the region that corre- sponds to the third intracellular loop of the receptor. Both isoforms of the receptor can inhibit cAMP formation [1]. Analysis of the promoter region of the rat D2R gene shows several features of 'housekeeping' genes, such as a lack of T A T A and CAAT boxes and rich G + C content, even though this promoter induces transcription in a tissue- specific manner [2]. Altough lactotrophs bear both iso- forms of the D 2 receptor, rat pituitary tumoral cells (GH4C1) are devoid of both short and long isoforms and do not respond to dopaminergic agonists [3].

Recently, we observed a surprising phenomenon. In

* Corresponding author. Fax: + 1 (418) 6542748. E-mail: falardo@adn.chul.uquebec.ca.

0167-4781/95/$09.50 © 1995 Elsevier Science B.V. All rights reserved SSDI 0167-4781(94)00176-6

fact, we demonstrated that it is possible to restore the response of DA agonists in GH4C1 cells following trans- fection of a plasmid that confers resistance to neomycin (pRSVNeo) [4]. In contrast to normal pituitary cells, where both isoforms of D 2 receptor are expressed, GH4C1 cells transfected with a vector containing SV40 promoter se- quences (pRSVNeo) specifically induces the expression of the short isoform of D 2 receptor. This induced receptor in GH4C1 cells is fully functional; thus, it negatively controls cAMP levels and the release of PRL. However, the mecha- nism responsible for this induction is not yet understood.

Because the major element in the regulation of gene expression is its promoter, we cloned and sequenced the D 2 receptor gene of native GH4C1 cells and its promoter and compared it with the normal rat gene. The observed differences in the 5' region of the receptor gene appeared to be homologous to the mouse metallothionein (MT-1) promoter gene. Knowing that these cells have already been used to create rat-mouse hybridomas, the mouse sequences found in GH4C1 ceils could result from a long-term contamination of the cell line with one of these hybrido- mas. Moreover, we demonstrated that the MT gene pro-

44 S. Allard et al. /Biochimica et Biophysica Acta 1260 (1995) 43-48

moter, which is relocated upstream from the D2R gene, efficiently regulates D2R mRNA as well as receptor levels.

Part of this work was presented at the 1993 meeting of the American Society for Neuroscience [22].

2. Materials and methods

2.1. Culture and treatments

GH4C1 cells used for this study were derived from the rat MtT/W5 tumor. Cells were obtained from two differ- ent origins (Dr. A. Schonbrunn, Department of Pharmacol- ogy, University of Texas Medical School, Houston, TX and Dr. D. Moore, Department Molecular Biology, Mas- sachussets General Hospital, Boston, MA). Cells were grown as monolayer cultures in F10 medium (Gibco-BRL, Burlington, Canada) supplemented with 15% horse serum (Gibco-BRL) and 2.5% fetal calf serum (Gibco-BRL) un- der humidified atmosphere containing 5% CO 2. Medium was changed every 3 to 4 days. Transfection were done as previously described [4]. Essentially, 5 /xg of pRSVNeo plasmid was used for transfection of 2- 10 6 cells using the CaPO 4 method [5]. Two days after transfection, cells were selected with 0.8 m g /ml neomycin sulfate (G418, Gibco BRL, Grand Island, NY) for 1 week and with 0.6 mg/ml for two more weeks. Resistant clones were picked and used for the following experiments. Heavy-metal stimula- tion was done by adding ZnSO 4 or CdSO 4 at the appropri- ate concentration 16 h before harvesting.

2.2. Rapid amplification of cDNA ends (RACE)

Total RNA was prepared [6] and 1 /zg was used for reverse transcription with a gene-specific primer (5'-CAC- CTCCAGGTAGACAAC-3') as described by Frohman et al. [7]. Excess primer was removed using a Centricon 100 (Amicon, Beverly, MA) and then cDNA was poly(A)-tailed using a terminal deoxynucleotidyl-transferase (Gibco- BRL). Polymerase chain reaction (PCR) was performed using a (dT)17-adapter primer (5'-GACTCGAGATAT- CATCGATlv-3'), an adapter primer (5'-GACTCGAA- TATCATCGA-3') and a second gene-specific primer (5'- ACAGCCATGCACACC-3') as described by Frohman et al. [7].

2.3. Polymerase chain reaction (PCR)

ment, 5'-ACATGATGTCCACACGT-3' (primer 3) and 5'- TFCTTGCAGGAGGTGCA-3' (primer 4) for rat MT gene, 5'-ATTCTACGTGCCCT-FCAT-3' (primer 5) and 5'- CATGATAACGGTGCAGAG-3' (primer 6) for intron up- stream from exon 6 or 5 '-CTCTGCACCGTTAT- CATGAAGTCTAATGG-3' (primer 7) and 5'-ATTCT- TCTCTGGTTFGGC-3' (primer 8) for intron downstream from exon 6.

2.4. Northern blot

Twenty micrograms of total RNA was run on 1.5% agarose gel containing 7% formaldehyde, blotted onto nylon membrane, and UV cross-linked. Hybridization with a fragment probe was done in 50% formamide, 5 x SSPE, 200 /.~g/ml ssDNA, 5 ×Denhardt's, 0.1% SDS, 200 /xg/ml tRNA, 2 /~g/ml poly(A), and 4% dextran sulfate overnight at 42°C. After two washes at room temperature and two washes at 65°C with 0.1 × SSC, 0.1% SDS, blots were exposed for 24 h. The D e receptor mRNA is 2.9 kb long.

2.5. Densitometric analysis

Autoradiograms or UV-illuminated nylon membranes were analysed by measuring mean gray tone with a RAS image analysis system (Amersham, Oakville, Canada). Comparison of D2R mRNA levels with 18S rRNA was made on the same membrane.

2.6. Cloning and sequencing of PCR products

The PCR products were subcloned in pCR1000 or pCRII vector with TA cloning kit (Invitrogen, San Diego, CA), using the supplier's recommendations. Mini-prep DNAs were sequenced with Sanger dideoxynucleotide method [8] using Sequenase (U.S.B., Cleveland, OH).

2. 7. Binding assay

Binding experiments were done as previously described [4]. Incubations were run in triplicate in the presence of 0.5 nM [3H]spiperone (23.1 Ci/mmol, New England Nuclear, Boston, Massachussets) and 20 to 50 /~g protein in a final volume of 2.0 ml. Non specific binding was evaluated with 1 mM (+)butaclamol (RBI, Natick, MA). Protein concen- tration were estimated by the method of Bradford [9] using bovine serum albumin as standard.

Genomic DNA was prepared [8] and 1 ~g used for PCR (100 ml final volume, 1.5 mM MgC12, 0.2 mM each dNTPs, 1 × Taq buffer (Promega, Madison, Wisconsin), 2 U Taq DNA polymerase (Promega) in a DNA thermal cycler for 30 cycles (94°C/1 min, 50°C/1 min and 72°C/2 min) with two gene-specific primers: 5'-TTCAAGCCA- TATGGCGCC-3' (primer 1) and 5'-ACATGATGTTC- CACACGT-3' (primer 2) for mMT-1 X D2R rearrange-

3. Results

3.1. Mouse metallothionein sequences in the D2R gene of GH4C1 cells

Sequence for D 2 receptor gene was obtained from both native and pRSVNeo-transfected GH4C1 cells. Sequencing

S. Allard et al. /Biochimica et Biophysica Acta 1260 (1995) 43-48 45

of the 5' end of the D2R mRNA present in transfected- GH4C1 cells generated by RACE, revealed an important disparity with the already published sequence of the rat D2R mRNA [10] (Fig. 1B). In fact, a similarity search with the 5' sequence of the transcript obtained showed a perfect homology with a transcribed region of the mouse metal- lothionein gene 37 bp downstream from the CAP site. Amplification of a genomic fragment of native GH4C1 DNA using primer 1, localized at - 318 bp upstream from the MT open reading frame (ORF), and primer 2, localized at + 33 bp downstream from the D 2 starting codon, yielded a 412 bp fragment. Sequencing of this fragment showed that the complete promoter region of the mouse MT-1 gene is present upstream from the D 2 receptor gene (Fig. 1A). The D2R gene is devoid of its own promoter region, which has been replaced by the complete promoter region of the mouse MT-1 gene. All the known cis-acting ele- ments of the mouse MT-1 gene and all except 5 bp of its 5' non-coding region are present 127 bp from the initiation codon for D2R (Fig. 1A). At the juncture of the D2R and MT genes, nine extra base pairs that show no homology with either gene are inserted (Fig. 1B). Sequences obtained from both genomic DNA and cDNA were identical sug- gesting the presence of only one gene.

To verify the integrity of the rat MT promoter and gene in these cells, the rat MT gene was amplified by PCR using a promoter-specific primer and gene-specific primer (primers 3 and 4). Fig. 2 shows the expected 881 bp

M 1 2 3

1 3 5 3 -

1 0 7 8 -

8 7 2 - - 8 8 1

Fig. 2. Integrity of rat MT promoter and gene. Ethidium bromide-stained agarose gel shows PCR product of intact rat MT promoter and gene. PCR was performed using PRIMER 3 and PRIMER 4 on genomic DNA and yielded the expected 881 bp product. M, ~hx HaeIII digest DNA marker. 1, negative PCR control (without DNA); 2, GH4C1 cells genomic DNA; 3, Rat liver genomic DNA.

product of the intact rat MT promoter and gene in GH4C1 cells compare to rat liver.

3.2. Expression olD 2 receptor is regulated by heaL,y-metal ions

The MT gene promoter located upstream from the D2R gene contains all the metal-responsive elements (MRE) required for heavy-metal ion regulation [11] and is able to modulate transcription of the D2R mRNA. Northern blot analysis shows that Zn 2÷ modulates D2R mRNA levels in a dose-dependent manner in GH4C1 cells transfected with pRSVNeo (Fig. 3). When Northern blots were quantified and normalized against 18S rRNA, a 60-fold increase compared with the basal level in D2R mRNA occurred in

A Spl E D C MLTF F B A TATA

Ap2 SplA SplB iCapsite SplC Ap2

Cap site

I I ° "F mMT-1

~Xf Spl D Ap2 . _

gone

/ ~ ~ i ~ ~ D2R gene Intron I

Spl E D C MLTF F B A TATA SplD Ap2 I ~ i , i AL. , m m= I ~ , ~ '10RF mMT-txD2R I I I ~ I I I 11' recombinedgene

Intron 1

B ORF

• . . AGCTCCAGCTTCACCAGATCTCGGA~TGGACCC... mMT-I gone

llrillllllllllllllIl[Jl •.. A G C T C C A G C T T C A C C A G A T ~ ~ G G C T G C C G G A G G G G C G G C C G . . . mMT-IxD2R

I I I I l ' l [ I I I I I I I l l l l l l l l recombined gene • . . GCGGCCCCGGACGGCTGCCGGAGGGGCGGCCG... D2R gene

I I Spl D

Fig. l. Structure of the recombination between mMT-I and D2R genes in GH4C1 cells. (A) Schematic representation of the mMT-1 and D2R recombination. The location of the rearrangement is indicated with an X. Thin line represents mMT-1 gone; thick line represents DeR gene; solid motifs represent the mMT-1 regulatory sequences including metal responsive elements (MREs, A-F); open motifs represent D2R regulatory sequences (Ap2, SplA-D) such as described by Minowa et al. [2]; stippled box represents the nine extra bases. (B) Sequence alignment of mMT-1 and D2R intact genes with the recombined mMT-1 × D2R gene. The location of the mMT-I open reading frame (ORF) and the DeR SplD site is indicated. Stippled box represents the nine extra bases.

46 S. Allard et al. / Biochimica et Biophysica Acta 1260 (1995) 43-48

B

A r o D 2 mRNA (2.9 kb)

C

m 1 8 S rRNA

75

8-

50 ==

C

25 --~ o

U_

0 o 25 50 75 lOO

Zn2*concentration (pM)

Fig. 3. D2R mRNA level after a 16 h incubation with various doses of ZnSO 4 on pRSVNeo stably transformed GH4C1 cells. (A) Northern blot of total RNA (20 /~g) prepared from these Zn 2+ exposed transformants was hybridized with a D2R specific fragment probe. (B) 18S rRNA was used to monitor the amount of RNA loaded in each lane. (C) DER mRNA/18S rRNA ratio was used to determine DER mRNA increase in Zn 2+ treated cells. Results are expressed in fold of increase over basal level.

response to 100 /zM Zn e÷. Moreover, heavy metals, in- cluding Zn 2÷ and Cd 2÷, regulate expression of D 2 recep- tor protein in a dose-dependent manner (Fig. 4). Cd 2÷ is more efficient than Zn 2÷ in stimulating expression of D2R. The basal level of the receptor is 528 + 33 fmol /mg protein and increases up to 5362_ 2477 fmol /mg of

• Zn 2+

6 D .

"6 E -6 E 4

>

~5

0 o ~'s s'o ¢s ~;o

Divalent ion concentrations (~M)

Fig. 4. D 2 binding level in pRSVNco transfected cells after a 16 h incubation with ZnSO 4 ( • ) or CdSO 4 ( r , ) at indicated concentrations. Specific binding was determined with 0.5 nM [3H]spiperone, and non specific binding was determined with 1 /xM (+)butaclamol. Results are the means + S.E. of two independent experiments done in triplicate.

protein and 3098 _ 664 fmol /mg protein in the presence of 50 /xM of C d S O 4 and 100 /xM of Z n S O 4 , respectively. Higher doses, such as 100 /xM of CdSO 4 or 200 /xM of ZnSO4, are lethal. Heavy metals alone are not sufficient to induce the expression of the D2R or its mRNA in native GH4C1 cells (data not shown).

3.3. Donor and acceptor splicing sequences of the D2R gene in GH4C1 cells are intact

In contrast to pituitary and other tissues where D2R always exists in both isoforms, GH4C1 cells express only the short isoform. To verify whether a mutation in the splicing sites was involved in this specificity of expression, we cloned by PCR (using primers 5-8) both introns surrounding exon 6 of the D2R gene in GH4C1 cells. After sequencing of the donor and acceptor sites for exon 6, no mutation or deletion was observed within 20 bp of these sites (data not shown).

4. Discussion

We have previously shown that expression of a fully functional dopamine D 2 receptor is induced in GH4C1 cells following transfection with pRSVNeo vector. All clones resistant to neomycin express D 2 receptor which normally regulates cAMP levels and PRL release such as in normal pituitary cells [4]. In the present study, we show that in GH4C1 cells, the D2R gene is no longer regulated by its own promoter, but rather by the mouse MT-1 promoter. Sequences of the 5' flanking region of the D2R gene did not reveal the expected promoter sequence as reported by Minowa et al. [2]. Instead, the 5' flanking region of the mouse MT-1 gene was found upstream from the DeR gene. This observation strongly suggests that a recombination between these two genes took place in GH4C1 cells at a position - 1 2 7 bp upstream from the ORF of the D2R gene and includes sequences for the entire D2R transcript. The D2R sequences found in these cells appeared intact. In fact, no discrepancy was found in the sequences of the eDNA for DeR [4]. These results are in accordance with the previous observation that the ex- pressed receptor is fully functional in its coupling to G protein and inhibition of cAMP levels and PRL secretion [4].

In lactotrophs and every other tissue, both isoforms of the D 2 receptor are expressed in various relative propor- tions [1]. In contrast, in GH4C1 cells, only the short isoform is found. Although we showed that sequences for 5' donor and 3' acceptor sites of alternatively spliced exon 6 are intact in these cells, this finding is not sufficient to ascertain normal regulation of alternative splicing. A gen- eral view of splicing envisages interactions between trans-acting factors, such as the snRPNs (small nuclear ribonucleoproteins), with the template and with each other

S. Allard et al. /Biochimica et Biophysica Acta 1260 (1995) 43-48 47

to create a molecular architecture within which the splicing process can occur [12]. Moreover, variations in the relative proportion of D 2 short /D 2 long transcript in different tissues suggest that tissue-specific factors control not only gene transcription, but also alternative splicing of pre- mRNA. For example, some cell lines, such as MMQ cells (a 7315a rat pituitary tumor-derived cell line) and SHSY- 5Y neuroblastoma cells, have been reported to express specifically only the long spliced variant of D2R [13,14]. Because both isoforms of D2R are normally present in pituitary cells, pRSVNeo-transfected GH4C1 cells provide us with a good model to determine which regulatory element of the alternative splicing mechanism is deficient, giving rise only to the short isoform.

The metallothionein gene is inducible by a variety of factors, including heavy metals (Cd 2 +, Zn 2 ÷), glucocorti- coid hormones (see review: [15]), and phorbol esters, such as tetradecanoyl phorbol-acetate (TPA) [16]. Transcription of the MT gene is regulated by a complex array of cis-acting promoter and enhancer elements. The mouse MT-1 promoter has already been characterized and con- tains AP-1 [16] and Sp-1 [17] binding sites and short DNA motifs, so-called MREs, that are essential to metal ion-de- pendent induction of the gene. At least six MREs, named MRE-A through -F, have been characterized in the mouse MT-1 promoter [11]. Here we demonstrated that the se- quence flanking D2R gene includes the MT promoter from at least bp - 3 1 8 from the ORF to bp - 6 . Thus, the recombined mMT-1 × DeR gene contains all the known regulatory sequences of the MT promoter. The fusion point between both genes allows complete integrity of both the MT promoter and the D2R transcript. In fact, 50 mM of Cd 2÷ raised D e receptor binding to a level 5-times higher than did 50 mM of Zn 2÷. This ability of Cd 2+ and Zn 2÷ to stimulate D 2 receptor binding levels is in accordance with the response of mMT-1 promoter to these cations. Fine mapping of mMT-1 promoter by Culotta et al. [18] showed that Cd 2÷ is more potent than Zn 2÷ in stimulating mMT-1 promoter activity.

It is expected that other factors, such as TPA, would also regulate D 2 R expression in these cells. In fact, it has been shown that AP-I binding sites present in the MT promoter region act as a TPA-inducible enhancer element [16]. This cis-acting element is also found in other TPA- inducible promoters, such as collagenase and SV40.

Transfected plasmid (pRSVNeo) seems to be responsi- ble for the induction of the D2R in GH4C1 cells. Looking at the composition of the plasmid, it appears that SV40 sequences could be involved in the mechanism controlling the on-off of the promoter. In fact, regulatory elements of the MT gene are capable of competing with the enhancer element of SV40 (and vice versa) for a common cellular target [19]. A similar model could be suggested for a cis-acting negative regulatory element (so-called silencer) that could share specificity for the MT gene and SV40. Silencer elements are thought to repress gene expression

directly by binding cell-specific negative factors [20]. Such a common silencer could compete for a unique regulatory factor present in GH4C1 cells, which could explain why transfection of the vector containing regulatory sequences of SV40 (pRSVNeo) would initiate expression of D2R in GH4C1 cells.

A major question concerning the data presented in this paper is how a mouse gene happened to be found in a rat cell line. To eliminate the possibility of contamination, cells were obtained from two different sources. In both cases, the laboratory carried the cell lines for at least 10 years, and the recombined mMT-1 × D2R gene was found in both cases. The GH4C1 cells have been used to create rat-mouse hybridoma cells lines [21]. Possibly the original strain of GH4C1 had been in contact with such hybrid cells. Other questions arise from these results. What is the protein or factor that shares a common DNA-binding site with MT gene and SV40? What is the negative regulatory element shared by these two genes? Our results help us to understand how and why in GH4C1 cells we can induce expression of D 2 dopamine receptor following transfection of a completely different gene. The exact mechanism involved in such phenomenon remains uncertain, and the involvement of SV40 in this process remains to be fully characterized.

Acknowledgements

The authors thank Drs. Marc-l~douard Mirault, Carl Srguin, and Sylvain Gurrin for helpful discussion and Ronald Maheux for densitometric analysis. This work was supported by a grant from the Medical Research Council of Canada. S.A. holds a studentship from MRC and P.F. holds a scholarship from FRQS.

References

[1] Falardeau, P. (1993) in Dopamine receptor function and pharmacol- ogy (Niznick, H.B., ed.), Vol. 1, pp. 323-342, Marcel Dekker, New York.

[2] Minowa, %, Minowa, M.T. and Mouradian, M.M. (1992) Biochem- istry 31, 8389-8396.

[3] Day, R.N. and Hinkle, P.M. (1988) Endocrinology 122, 2165-2173. [4] Allard, S., Lapointe, S. and Falardeau, P. (1993) Biochem. Biophys.

Rcs. Commun. 193, 801-807. [5] Cullen, B.R. (1987) In Guide to molecular cloning techniques

(Berger S.L. and Kimmel A.R., eds.), pp. 684-7(14, Academic Press, New York.

[6] Chomczynski, P. and Sacchi, N. (1987) Anal. Biochem. 162, 156- 159.

[7] Frohman, M.A., Dush, M.K. and Martin, G.R. (1988) Proc. Natl. Acad. Sci. USA 85, 8998-9002.

[8] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor.

[9] Bradford, M.M. (1976) Anal. Biochem. 72, 248-254. [10] Bunzow, J.R., Van Tol, H.H.M., Grandy, D.K., Albert, P.R., Salon,

48 S. Allard et al. / Biochimica et Biophysica Acta 1260 (1995) 43-48

J., Christie, M., Machida, C.A., Neve, K.A. and Civelli, O. (1988) Nature 336, 783-787.

[11] Mueller, P.R., Salser, S.J. and Wold, B. (1988) Genes Dev. 2, 412-427.

[12] Guthrie, C. and Patterson, B. (1988) Annu. Rev. Genet. 22, 387-419. [13] Ventra, C., Florio, T., Grimaldi, M., Talia, S. and Schettini, G.

(1992) Soc. Neurosci. Abstr. 18, 660. [14] Farooqui, S.M. and Prasad, C. (1992) Soc. Neurosci. Abstr. 18, 660. [15] Hamer, D. (1986) Annu. Rev. Biochem. 55, 913-951. [16] Angel, P., Imagawa, M., Chiu, R., Stein, B., Imbra, R.J., Rahmas-

doff, H.J., Jonat, C., Herrlich, P. and Karin, M. (1987) Cell 49, 729-739.

[17] Andersen, R.D., Taplitz, S.J., Wong, S., Bristol, G., Larkin, B. and Herschmann, H.R. (1987) Mol. Cell Biol. 7, 3574-3587.

[18] Culotta, V.C. and Hamer, D.H. (1989) Mol. Cell. Biol. 9, 1376. [19] Scholer, H., Haslinger, A., Hegvy, A., Holtgreve, H. and Karin, M.

(1986) Science 232, 76-80. [20] Berg, P.A., Williams, D.M., Quian, R.L., Cohen, R.B., Cao, S.X.,

Mittelman, M. and Schechter, A.N. (1989) Nucleic Acids Res. 17, 8833-8852.

[21] Sonnenschein, C., Richardson, U.I. and Tashjian, A.H.Jr. (1971) Exp. Cell Res. 69, 336-344.

[22] AUard, S. and Falardeau, P. (1993) Soc. Neurosci. Abstr. 19, 428.