UMEÅ UNIVERSITY MEDICAL DISSERTATIONS NEW SERIES NO 1051 ISSN 0346-6612

ISBN: 91-7264-165-7

RECOMBINANT ANTIBODIES AND TUMOR TARGETING

Ali Sheikholvaezin

Departments of Immunology, Diagnostic Radiology and Radiation Physics

Umeå University, Sweden Umeå 2006

2

TABLE OF CONTENTS 2

ABBREVIATIONS……………………………………………………………………….…….4

Original papers…………………………………………………………………………………6

ABSTRACT .………………………………………………………………………………….7

INTRODUCTION………………………………………………………………………….…9

Basic principals of tumor targeting……….…………..………………………………………..9

Tumor antigens. ……………………….……………………………………………………...10

Placental alkaline phosphatase.……………………………………………………………….10

Cytokeratins.…………………………………………………………………………………..11

IMMUNOGLOBULINS AS TARGETING AGENTS…..…………….…………………….12

Recombinant antibodies……………………………….………………………………….…..14

scFv, scdsFv, [sc(Fv)2] and scFv-fusion proteins...…….……………………………..….…...15

Radionuclides in use at tumor targeting…………..…………………………………………..17

TREATMENT OF MALIGNANT DISEASES.…..………………………………………….19

Immunotherapy and radioimmunotherapy.…………..……………………………………….20

Therapeutical antibodies in use……………………………………………………………….22

Animal models and human tumor xenografts………...………………………………………24

AIMS …………………...……………………………………………………………………25

MATERIAL & METHODS………………………………………………………………...26

MONOCLONAL ANTIBODIES, PRODUCTION AND MOLECULAR STUDIES. ……...26

Antigens and antibodies in this thesis……………………………….………………………..26

Radiolabeling.…………….………………………………………….………………………..27

mRNA isolation, cDNA production and DNA amplification……………………………..….27

DNA purification, cloning and sequencing……………………………………………….….29

In vitro mutagenic modifications of scFvs………....…………………………………………29

Construction of scFv/scdsFv and [sc(Fv)2] recombinant antibodies....……………………….29

Expression and purification of recombinant antibodies……………………...……………….32

Protein quantification………...……………………………………………………………….33

SDS and native gel electrophoresis.………………………………….……………………….33

Immunoblotting of native and SDS exposed proteins.……………….……………………….33

ELISA.………………………………………………………………………………………...33

ANIMAL STUDIES.………………………………………………….………………………34

Human tumor xenografts...……………………………………………….....………………....34

3

Radioimmunolocalization experiments……………………………………………………….34

Radioimmunotherapy with intact antibodies.…………………………………………………35

Histological examination.…………………………………………………………………….36

Immunohistochemistry.……………………………………………………………………….36

Ki67 and M30 staining.……………………………………………………………………….36

In situ cell death detection-POD staining.………………………………………….…………37

Endoglin (CD105) staining…………………………………………………………..……….37

RESULTS.…………………………………………………………………………………....38

Paper I.………………………………………………………………………………………...38

Paper II…....………………………………………………………………………….……….38

Paper III…..…………………………………………………………………………..……….39

Paper IV.………………………………………………………………………………...…….40

DISCUSSION..……………………………………………………………………………….41

CONCLUSION……………………………………………………………………………....47

ACKNOWLEDGMENTS.………………………………..…………………………………49

REFERENCES.…………………………………………………………………………...…50

4

ABBREVIATIONS

Ab antibody

Ag antigen

APCs antigen-presenting cells

BCR B-cell receptor

CEA carcinoembryonic antigen

CD cluster of differentiation

CDR complementarity determining region

CH constant part of heavy chain

CK cytokeratin

CL constant part of light chain

F(ab’)2 bivalent antigen binding fragment of immunoglobulin

DISC death induced signalling complex

DNA deoxyribonucleic acid

dsFv disulphide stabilized variable fragment

ELISA enzyme linked immunosorbent assay

EGFR epidermal growth-factor receptor

ER endoplasmic reticulum

Fab monovalent antigen binding fragment of immunoglobulin

FADD fas-associated death domain

Fc crystalizable fragment of immunoglobulin

GM-CSF granulocyte/macrophage colony stimulating factor

Gy gray

HER2/neu human epidermal growth-factor receptor type 2

TNF-α tumor necrosis factor-alpha

Ig immunoglobulin

INF-α interferon-alpha

INF-β interferon-beta

INF-γ interferon-gamma

IL-2 interleukin-2

IPTG isopropyl-B-D-1-tiogalaktosid 211At astatine-211

5

212Bi bismuth-212 67Cu copper-67 123I iodine-123 125 I iodine-125 131 I iodine-131 111In indium-111 177Lu lutetium-177 188Re rhenium-186 99mTc techneticum-99m 90 Y yttrium-90

KA affinity constant

ka association rate constant

kd dissociation rate constant

KD equilibrium constant

kDa kiloDalton

mAb monoclonal antibody

MHC major histocompatibility complex

MW molecular weight

NHL non-Hodgkin’s lymphoma

o/n over night

pAb polyclonal antibody

PLAP placental alkaline phosphatase

PCR polymerase chain reaction

RT radiotherapy, room temperature

RID radioimmunodiagnostics

RIL radioimmunolocalization

RIT radioimmunotherapy

TAA tumor associated antigen

TRAIL tumor necrosis factor-related apoptosis-inducing ligand

VH variable part of heavy chain

VL variable part of light chain

6

ORIGINAL PAPERS

This thesis is based on the following papers:

1. Sheikholvaezin A, Sandström P, Eriksson D, Norgren N, Riklund K and Stigbrand T.

Optimizing the generation of recombinant single-chain antibodies against placental alkaline

phosphatase

Hybridoma 2006; 25: 181-92.

2. Sheikholvaezin A, Eriksson D, Riklund K, and Stigbrand T.

Construction and purification of a covalently linked divalent tandem scFv antibody against

placental alkaline phosphatase.

Hybridoma 2006; 25: 255-263.

3. Sheikholvaezin A, Eriksson D, Riklund K, Johansson L and Stigbrand T.

Tumor radioimmunolocalization in nude mice by use of antiplacental alkaline phosphatase

single chain antibodies/tandem monospecific single-chain antibodies.

Cancer Biotherapy & Radiopharmaeuticals 2006 (submitted).

4. Eriksson D, Joniani HM, Sheikholvaezin A, Lofroth PO, Johansson L, Riklund Ahlstrom K,

Stigbrand T.

Combined low dose radio-and radioimmunotherapy of experimental HeLa Hep-2 tumors.

Eur J Nucl Med Mol Imaging. 2003; 30: 895-906.

7

ABSTRACT

RECOMBINANT ANTIBODIES AND TUMOR TARGETING

Different antibody derived constructs are rapidly advancing as putative tools for treatment of

malignant diseases. Antibody engineering has added significant new technologies to modify

size, affinities, solubility, stability and biodistribution properties for immunoconjugates.

In the present thesis, the aim was to increase our knowledge on how new recombinant

antibodies could be tailored to optimize localization to experimental tumors in mice.

One hybridoma, producing the monoclonal antibody H7, against placental alkaline

phosphatase was used to provide CDR-containing regions for new recombinant constructs.

Both single-chain variable fragments (scFv) antibodies or divalent tandem monospecific scFv

[sc(Fv)2] antibodies with properties suitable for targeting were produced. By site directed

mutagenesis four selective sequence substitutions were made in the VL fragment and one in

the VH fragment of the antibody to improve solubility. To increase the stability of the

antibody an extra -S-S- bond was introduced between the VL fragment and the VH region to

create single-chain disulphide stabilized variable fragments (scdsFv) antibodies. Altogether

four different recombinant scFv/scdsFv antibody constructs were produced and compared in

terms of solubility, stability, affinity and production properties. The overall affinity could be

maintained at the same order of magnitude as the wild type antibody (KA >109 (M-1) as

determined by Biacore measurements. The antibodies could easily be expressed in the E.Coli

strain BL21 Origami B (DE3). The purified recombinant antibodies could be maintained

stable in concentrations up to 0.8 mg/ml.

Similarly a bivalent recombinant scFv antibody was generated from the same basic scFv, in

form of a divalent tandem single-chain antibody [sc(Fv)2] by introduction of a short linker

sequence between the two scFvs. The recombinant antibody was characterized by SDS-

PAGE, ELISA, Western blot and Biacore analyses and was found to retain a similar high

affinity as the original H7 antibody. All recombinant antibody derivates were subsequently

investigated for targeting ability in vivo. Nude mice, inoculated with HeLa Hep2 tumor cells

were exposed in vivo to the 125I-labelled recombinant constructs. All recombinant antibodies

were found to localize and display characteristic differences in retention time within the

tumor, tumor to non-tumor ratios and biodistribution properties. The tandem antibody, with a

8

molecular weight around 60 kDa, was found to be superior compared to the scFv/scdsFv and

intact antibodies in terms of discriminating properties at localization.

The immunotherapeutic potential of the intact antibodies was tested both alone with

radiolabeled antibody (radioimmunotherapy, RIT) and in combination with external

radiotherapy (RT). The combined effects of RT and RIT were found to cause significant

growth retardation of the tumor with dramatic changes in morphology within the tumors and

appearance of both necrosis and apoptosis. Increase in amount of connective tissue and cysts

and decrease in cell density were observed. These result support the notion that antibodies

have the potential of becoming significant tools in the arsenal of therapeutics for treatment of

malignancies.

9

INTRODUCTION

BASIC PRINCIPALS OF TUMOR TARGETING

To specifically target and affect tumor growth as far as to extinction of the tumor is the

ultimate goal in the management of tumor diseases. As early as 1906, Paul Ehrlich postulated

that the mammalian immune system was capable of recognizing cancer cells. He introduced

immunotherapy as a potential approach to targeting tumors in vivo. The use of antibodies for

this purpose was described as ’’magic bullets’’ and a novel principle was introduced [1].

Since then, several approaches have been developed to improve the localization of

radiolabeled ligands (mAbs and their fragments) to tumors, to reduce their uptake in normal

tissues, and to improve the tumor to non-tumor uptake ratios in order to deliver higher doses

of radionuclides for radioimmunolocalization and radioimmunotherapy [2].

Antibodies have excellent target-binding specificity, but are limited in clinical imaging

applications in vivo by intrinsic properties, in particular their comparatively long half-lives in

plasma (for murine IgG three to four days, and for human IgG 23 days) [3, 4].

During the last two decades recombinant engineering technology has been used to modify

antibodies in order to reach high binding avidity/affinity and specificity to a wide range of

target antigens and haptens. Such recombinant antibodies can specifically bind to very

diverged or overexpressed antigens on tumor cells and can be used as vehicles to deliver

radionuclides, drugs or toxins to tumor cells. Because of their small size, these targeting

molecules penetrate faster and deeper into tumor tissues and are cleared more rapidly from the

blood. They also have a reduced tumor retention time, which makes them more suitable for

radioimmunolocalization than radioimmunotherapy, compared to the parent IgG [3, 5].

Single-chain variable fragments (scFv) are the smallest fragments of an antibody molecule

which still retain full antigen binding properties. They can be labeled with a variety of

radioisotopes like 125I for imaging/ localization or 131I for therapy [6, 7].

The nuclides linked to the antibody or its derivatives enable localization or exert growth

inhibition or tumor cell killing. The radiation physics properties of some commonly used

nuclides are presented in Tables 1 and 2.

10

TUMOR ANTIGENS

The choice of target antigen plays a key role in determining the success of immunotherapy

and immunolocalization. To ensure specificity, an antigen should be expressed selectively by

the tumor cell. For successful targeting the antigen should also be expressed in high amounts

in the tumor cells, show stable and homogenous expression and preferably not be shed to the

circulation. It should furthermore be easily accessible by the monoclonal antibody [8]. After

antibody binding, the antigen may be shed from the cell surface, remain stable on the cellular

membrane, or undergo endocytosis. Whether an antigen sheds, modulates, or internalizes

influences the effectiviness of the administered antibody [8].

PLACENTAL ALKALINE PHOSPHATASE

Placental alkaline phosphatase (PLAP) is one of four members of the alkaline phosphatase

(Aps) enzyme family, which catalyzes the hydrolysis of phosphomonoesters with release of

inorganic phosphate and alcohol [9]. The specific biological functions of Aps are not fully

understood. Aps are dimeric, thermostable (65 °C) enzymes (128 kDa). They are abundant in

nature and are found in many cell types and in species ranging from bacteria to mammals.

Mammalian Aps consist of the tissue non-specific (TNAP), the intestinal (IAP), the placental

(PLAP) and the germ cell (GCAP) alkaline phosphatases [10].

The amino acid sequences for all four enzymes are known [11-15]. The crystal structure of

PLAP has been described by Le Du and co-workers [16].

During pregnancy, PLAP is normally expressed by the syncytiotrophoblasts from the 8th

week of gestation until partus, while during the first 8 weeks of gestation, tissue non-specific

AP (TNAP) is the only AP expressed by the placenta, but TNAP disappears after 12 weeks

[17].

PLAP is one of the first described oncofetal proteins and is presently used as a tumor marker

for seminomas [18-20]. 1968 Fishman et al. reported the presence of an AP with all the

characteristics of PLAP in the serum of a male patient with bronchogenic cancer [21]. Later,

PLAP was found in the serum of patients with several different types of tumors [22].

In healthy adults, trace amounts can be detected in tissues like testis, lung, liver and intestinal

mucosa [20]. PLAP has been used as a TAA for radioimmunotargeting [23]. The humanized

Ab Hu2PLAP was successfully used for imaging in two patients with PLAP-positive tumors

[24].

11

CYTOKERATINS

The cytoskeleton of eukaryotic cells is composed of three filament systems, i.e. microtubules,

microfilaments and intermediates filaments. Cytokeratines (CKs) or epithelial keratins, are

intermediate filaments (10-12 nm). The cytoskeleton, together with its associated proteins,

cooperate in several essential functions such as maintenance of cell shape, cell movement, cell

replication, apoptosis, cell differentiation and cell signaling. The two largest groups of

intermediate filaments are acidic and basic keratins [25]. Cytokeratins are the most abundant

proteins in many types of epithelial cells and their complex expression pattern is both tissue-

specific and differentiation-specific [26]. They are of special interest in connection with

malignant diseases, since most malignant tumors (70%) are derived from epithelia.

Currently, at least 20 different CKs can be distinguished [27]. The most abundant cytokeratins

in carcinomas are cytokeratin 8, 18 and 19 [26]. The abundance of these cytokeratins makes

them appropriate tumor marker antigens for radioimmunotargeting [28-34]. Due to their low

solubility they remain in the tumors in necrotic regions and can thus, despite their intracellular

expression, be used as target within the tumor. A number of useful antibodies have been

generated against different cytokeratins [35, 36].

12

IMMUNOGLOBULINS AS TARGETING AGENTS

Immunoglobulins which are produced by plasma cells, have both targeting (CDRs) and

effector functions. The later is mediated by the Fc part of the antibody (Fig. 1a). The scientific

exploration and use of antibodies for cancer immunotherapy and radioimmunotherapy

actually began already in the 1950s. The first therapeutic application of immunotherapy relied

on pAbs. In 1975 Köhler and Milstein developed the hybridoma technology for production of

mAbs mainly of rodent origin, with specificity against defined and preselected antigens [37].

It was immediately recognized that they had great potential as powerful and specific

therapeutic agents.

Murine, rabbit, or rat antibodies from animal immunized with the relevant antigen have been

used in several studies for treatment of malignancy. Unfortunately, patients often generate

antibodies to these foreign antigens referred to as HAMA (human antimouse antibodies) or

HARA (human antirat antibody or human antirabbit antibody). The induced host antibodies

have been shown to block the effectiviness of the therapy by prematurely clearing the

treatment antibody, limiting possibilities for future immunotherapy.

To overcome obstacles inherent in the first generation antibodies, DNA technology has been

used to construct hybrids composed of human antibody regions linked with a murine or

primate backbone [38]. These are referred to as chimeric, humanized or primatized antibodies,

depending on the exact antibody structure (Fig. 1a). A chimeric antibody is a human antibody

containing the variable region from a non-human source. A primatized antibody is a

composite antibody derived from primate variable regions and human constant regions, while

a humanized antibody is a human antibody grafted with non-human CDR-regions. These

antibodies have a reduced immunogenicity, have usually a faster blood-clearance than the

murine [39] and have been successful in activating immune effector functions, thereby

improving response rate in clinical trials. When these antibodies bind, the complement

cascade is activated, resulting in CDC (Complement-dependent cytotoxicity) and ADCC

(Antibody dependent cell-mediated cytotoxicity). The antibody binds to the antigen on the

surface of a target cell and is subsequently bound by Fc receptors on effector cells.

Monocytes, macrophages, natural killer (NK) cells, and granulocytes express Fc receptors and

can exert phagocytic or cytotoxic effects.

13

Fig. 1a. Different kinds of recombinant antibodies: The colours represent: black= toxin, gray

= mouse antibody fragments, light gray = human antibody fragments, stars = radionuclides.

14

RECOMBINANT ANTIBODIES

Today extensively large numbers of mAbs are available, all with characteristic properties,

which makes it possible to choose the most useful antibody for each new treatment situation.

Advances in the area of recombinant antibody technology have made possible the production

of antibodies to almost any antigen. However, murine mAbs (most often IgG) used in cancer

therapy are not devoid of problems. Some concerns associated with these mAbs have been

their: 1) low overall tumor uptake (slow diffusion of the antibodies from the blood into the

tumor), 2) slow clearance from blood because of their large size, and 3) their immunogenicity,

which shortens their efficiency during therapy and may cause immunity related side effects

[40]. Today different kinds of recombinant antibody constructs have been engineered in order

to reduce their immunogenicity, to increase their tumor-to non tumor ratios and to connect

them to cytotoxic agents for better therapeutic index.

Recombinant DNA technology has allowed various recombinant antibodies and antibody

fragments to be engineered (Fig. 1a and 1b). The approches include: F(ab’)2 fragment

obtained by pepsin digestion of an Ab [41, 42], Fab fragment obtained by papain digestion of

an Ab [42, 43], chimeric mAbs in which the terminal Fc domain of the antibody is replaced

by a toxin; heteroconjugate mAbs in which one half of the molecule is specific for a tumor

antigen and the other half is specific for a defined molecule on immune effector cells (Fig.

1a), minibodies i.e. different combinations of variable and constant regions [44],

monospecific covalently or spontaneously bound diabodies, constructed from homologous

scFv antibodies [3, 45], bispecific covalently or spontaneously bound diabodies, constructed

from heterogeneous scFv antibodies [3, 45, 46]; scFv/scdsFv antibodies composed of only the

VH and VL regions of an intact antibody with a peptide linker in between with or without an

extra disulphide bound [5, 39, 47-51]; and [sc(Fv)2], two covalently linked tandem scFv

antibodies [52, 53] (Fig. 1b). Since most of the xenotypic determinants are localized in the

constant regions, these recombinant antibodies are less immunogenic to man [54]. Perhaps the

greatest promise for recombinant antibodies is their use as fusion proteins, in which additional

effectors are engineered onto the molecule. These added structures can be toxins,

radionuclides, enzymes or DNA-binding domains. Therefore these molecules have the

potential to be anything from anti-cancer imaging agents to gene therapy vectors (Fig. 1 a).

Expression of recombinant antibodies is possible in a variety of organisms and expression

systems including human cells, yeast and baculovirus, but the most commonly used is E.coli,

as the bacteria grow rapidly and at high density on inexpensive substrates [51, 55, 56].

15

Fig. 1b. Different kinds of recombinant antibody fragments: The colours present: gray =

heavy chain, light gray = light chain

ScFvs, scdsFv, [sc(Fv)2] and scFv-fusion proteins

Single-chain variable fragments (scFvs) antibodies are the smallest fragments of an antibody

molecule (25-30 kDa) which still retain full antigen binding properties.

The first scFv molecules were developed independently by Huston et al. 1988 [57] and Bird et

al. 1988 [58]. Since then many scFv and scFv-fusion proteins have been made.

In these constructs, the VH and VL antigen binding domain are held together and stabilized by

a peptide linker that connect the carboxyl-terminus of VH or VL with the amino terminus of

the other domain. Various linker lengths have been designed to provide flexibility and

enhance solubility with the most used linker in use, a (Gly4-Ser)3 peptide [59, 60].

16

These molecules, derived from genes isolated from murine hybridoma cell lines, are capable

to specifically bind to their target antigens with affinities ranging up to those of their parent

mAb [61].

Because of their small size, these targeting molecules are cleared more rapidly from the

blood, penetrate faster and deeper into the tumor tissue, offer enhanced accumulation in target

tissues, display reduced immunogenic properties, but they also present a reduced tumor

retention time, which makes them more suitable for RIL than RIT [5].

The construction and production of such recombinant antibody fragments is not as simple as it

might seem. The solubility, stability and immunoreactivity of these fragments are properties

which require careful considerations and much work to deal with.

One major problem with the use of scFvs is their tendency to aggregate following

purification, particularly if they are derived from hybridoma cells [62]. This is due to

circumstances which include the presence of a disulfide bridge in the VH and VL domain,

exposed hydrophobic patches at the variable/constant domain interfaces, ionic strength, pH,

linker length and at last but not at least, the primary sequence, which is the most causative

factor which affects the aggregation tendency [63-66].

Furthermore, the extent of interconnection between the scFv (fragments) increases the risk for

aggregation. The stability of a particular scFv is dependent primarily on the nature and

strenght of the VH-VL interface interactions and the type of linker used [59, 67, 68]. Several

strategies have been developed to overcome the aggregation and instability problem of scFv

during expression and purification, including use of different detergents [65], design of inter-

domain disulphide bridges [69], use of different soluble tag-fusion proteins [70-72] or

expression hosts [73], removal, addition or substitution of some amino acids in the framework

region [69, 74]. Another obstacle associated with the use of scFvs is their short retention time

in the tumor. Due to the rapid clearance of these small 25-30 kDa proteins from the blood

pool (with a half-life ranging from less than 15 min and up to hours), the absolute amount of

scFv uptake by the tumor is limited [52, 75].

In order to prevent rapid clearance from blood and to increase the functional affinity and

retention time of the scFvs, multivalent monospecific scFv antibodies have been made [3, 76-

78]. Such an approach would have impact on their significance for imaging and therapeutic

applications.

Multivalent scFvs including monospecific tandem divalent scFv [sc(Fv)2] exhibit increased

functional affinity compared to the monovalent form [44, 79]. Consequently, multivalent

radiolabeled scFvs should display improved in vivo performance.

17

Recombinant antibodies can be used also as selective carriers for delivering toxins or

cytotoxic agents to the malignant cell population to induce growth arrest, cell death or

apoptosis [80]. Such fusion proteins, immunotoxins, can selectively bind to cell surface

receptors/antigens, block the binding site for growth factors, or kill cells by either catalytic

inhibition of protein synthesis or induction of apoptosis depending on the toxin moiety.

Radionuclides in use at tumor targeting

A radionuclide is an atom with an unstable nucleus, which emits different types of radiation.

In medicine, radionuclides are used for diagnostic and therapeutic purposes in treatment of

some diseases including malignancies [81].

The choice of the optimal radionuclide for radioimmunotargeting is not obvious. Some

biological parameters such as Ab kinetics, type and location of tumor, antigen properties, cost

and labeling-chemistry of radionuclide influences the choice and should be considered. There

are generally four types of radiation associated with radiation decay: α-particles, β-particles,

electromagnetic (γ-radiation, x-ray, and Auger), and neutron radiation. In general, γ-emitting

radionuclides are used for RIL, while α- or β-emitters are used for RIT. Each type of particle

emitted (α, β, Auger) has a different range, effective distance and relative biological

effectiveness [6].

Table 1. Potential radionuclides for imaging (RIL) with monoclonal antibodies or antibody fragments [6, 82, 83] . Abbreviations: α, alpha; β, beta; γ, gamma; d, day; hr, hour; keV, kilo electron volt; mm, millimetre; T1/2, half-life. Radionuclides Half-life (T1/2) Type of Emission Energy (keV) 123I 13.3 hr Auger, γ 159 125I 59.4 d Auger, γ 28 131I 8.02 d β, γ 248, 364, 637 111In 2.8 d β, γ 171, 245 99mTc 6 hr γ 141

18

Table 2. Potential radionuclides for therapy (RIT) with monoclonal antibodies or antibody fragments [6, 82, 83]. Abbreviations: α, alpha; β, beta; γ, gamma; d, day; E, energy; hr, hour; MeV, mega electron volt; mm, millimetre; T1/2, half-life. Radionuclides Half-life (T ½) Type of

Emission E (max) (MeV)

Mean Tissue Range (mm)

Imageable Emissions

131I 8.02 d β, γ 0.81 0.40 Yes 90Y 2.7 d β 2.3 2.76 No 186Re 3.8 d β, γ 2.1 0.92 Yes 67Cu 2.6 d β, γ 0.57 0.6 Yes 212Bi 1 hr α 6.09 0.04-0.1 Yes 211At 7.2 hr α 5.87 0.04-0.1 No Generally, α-emitters seem to be the best alternative when single cells or small tumor cluster

are to be treated. Commonly used radionuclide α-emitters for tumor targeting are 211At, 211Bi

and 213Bi. Alpha-emitters such as 212Bi possess a high linear energy transfer (LET) and short-

range emission (one cell length), cause a larger radiobiological effectiveness compared to low

LET photon- and β-emitters [84]. The major obstacles concerning the use of these α-emitters

are their poor availability at a reasonable cost and their physical half lives. The great benefit

of α-emitters is that only a small number of decays are needed to kill a targeted cell.

Auger-electron emitters (i.e. radioisotopes that decay by electron capture) deposits a

concentrated amount of energy into an extremely small volume, and are rather similar to the

α-emitters in their effects. These nuclides have a short range (e. g. 40-80 µm for 5-8 MeV α-

particles, and a mean range of 10 µm for Auger) and need to deposit their energy in the

nucleus, or in the near vicinity of the nucleus of the tumor cell, in order to be effective [85].

Beta-emitters on the other hand can, with their long-range emission (50 cell lengths), are

useful to treat solid tumors with a heterogenous target-antigen expression [85]. This is due to

the cross-fire effect, not all cells in a tumor need to be targeted in order to be killed.

Unfortunately, it also increases the non-specific toxicity to normal tissues. Beta-emitting

radionuclides can be classified into short (<200 µm), medium (>200 µm and <1 mm) or long

range (>1 mm) emitters. The medium-range emitter 131I, and the long range emitter 90Y, are

the most commonly used radionuclides for RIT. The first radionuclide used for RIT was 131I.

The advantages of 131I-RIT were that 131I was commercially available, dosimetry could be

performed following administration of trace doses of the radioimmunoconjugate, and most

nuclear medicine departments were familiar with its use [8].

However, since cancer patients very seldom have a metastatic disease with tumor cell clusters

of a uniform size, the optimal solution when choosing a radionuclide for targeted therapy

19

might be to have a mixture of radionuclides that emit particles of different ranges. It has been

shown that combined treatment of tumor-bearing rats with 90Y and 177Lu labeled somatostatin

analogues, resulted in better survival than when rat were treated with only one of these

radionuclides [86].

TREATMENT OF MALIGNANT DISEASES

Treating cancer is one of the most complex activities in medical care. Tumor therapy varies

with the type and stage of the disease and the overall condition of the patient. Different

approaches including surgery, radiation, hormonal or chemotherapy, either alone or in

combination, can be used. However, despite significant treatment results only modest

improvement in the mortality rates for some common tumors have been achieved.

Approximately half of all malignant tumors are difficult to treat successfully by conventional

methods due to metastatic spread [50]. A major drawback of radiation or chemotherapy is the

often unacceptable damage to normal tissues at doses required for eradicating cancer cells.

Furthermore, chemotherapeutic agents generally have not been effective in treating aggressive

solid tumors because of poor penetration into the tumor mass [87, 88]. In addition, after

surgical removal of solid tumors, metastatic cells often remain, which can be resistant to

conventional chemotherapy. Thus, new therapeutic approaches based on recent advances in

biotechnology have been actively sought. The use of mAbs and their fragments for targeting

and treating of carcinomas or hematologic malignancies is an evolving field, since the

antibodies can locate tumor cells in the body by recognizing targets more abundant on these

tumor cells than normal cells. A major ambition is to increase the therapeutic index of these

mAbs by improving their specificity and efficacy, reducing their immunogenicity, and to

optimize the load of cytotoxic agents, drugs, radionuclides, enzymes they carry.

20

Immunotherapy and radioimmunotherapy

Immunotherapy in clinical practice is a rather new concept, based on the hosts endogenous

immune system and it makes use of certain parts of the immune system to eradicate some

diseases, including cancer. This can be done by stimulating the immune system of the host to

be more efficient (active immunotherapy) or by using outside sources (passive

immunotherapy), such as artificially produced proteins within the immune system like

monoclonal antibodies which may cause cell lysis by mechanism like CDC and ADCC (Fig.

2).

Fig. 2. Possible mechanisms of action of therapeutic monoclonal antibodies:

a) targeting mAbs to the tumor can result in the destruction of the tumor cells by ADCC or

CDC. b) targeting cytokines or immunomodulatory molecules either by bispecific scFv or

antibody-ligand fusion proteins to the tumor can modulate the immune response against the

tumor. In addition, antibody-ligand fusion proteins can induce apoptosis to target cells as

well as bystander cells by, for example, presenting TNF-α. c) a more direct approach to kill

the targeted cell is the conjugation of cytotoxic drugs, toxins or radionuclides to the mAbs. d)

the antibody-directed enzyme prodrug therapy (ADEPT) approach specifically aims at

causing bystander effects by targeting enzymes to the tumor cell and delivering a prodrug that

is converted to a chemotherapeutic agents by the targeted enzyme [89-93].

21

Compared to other forms of cancer treatment, such as surgery, radiotherapy, chemotherapy, or

hormonal therapy, immunotherapy is still relatively new. Different types of

immunotherapeutic strategies include: cancer vaccines, monoclonal antibodies, and

nonspecific immunotherapeutic approaches and adjuvants which are available for specific

cancers. In general, immunotherapy, expected to be most effective when treating small

cancers, will probably be less effective for more advanced disease. Immunotherapy is

sometimes used alone, but it is most often used as an adjuvant to add to the effects of the main

therapy.

Monoclonal antibodies can be used naked (without any drug or radioactive material) or

conjugated ( to a drug or an immunochemically active peptide) (Fig. 2).

Conjugated antibodies compared to unconjugated generally cause more side effects which

include: fever, chills, headache, nausea, vomiting, rashes, joint and muscle ache [94, 95].

Radioimmunotherapy is an approach to treat cancer combining a monoclonal antibody

directed against a specific antigen with a radionuclide, which circulates in the body until it

locates and binds to its target. The use of radiolabeled antibodies as a potential cancer

treatment was first explored in the 1950s by Pressman and Keighley, but the feasibility of

combining a mAb with a nuclide in order to deliver a therapeutic dose of radiation to a tumor

cell was intensified with a start in the 1980s. Radioimmunotherapy may be a therapeutic

option for patients who failed earlier chemotherapeutic treatment. With radioimmunotherapy

there are fewer side effects compared to most high dose chemotherapy treatments.

Furthermore, the radionuclide coupled to the carrier molecule can irradiate not only the

targeted tumor cell but also untargeted neighbouring tumor cells, an effect called the “cross-

fire effect”, and there is no evidence of cells developing resistance against radiation effects,

which can occur in the case of toxin therapy [96]. Radioimmunotherapy is designed to target

specific tumor cells. Chemotherapy, on the other hand, destroy any rapidly dividing cell,

which often also include non-tumor cells. Radiotherapy is usually delivered over a shorter

period of time than chemotherapy. In contrast, radioimmunotherapy is usually delivered over

a shorter (one to three weeks) period of treatment. Most often, patients receive

radioimmunotherapy as out-patients, meaning that the patient may leave the hospital after

receiving the treatment. The therapy can take hours to be completed, but it may take months

for the tumor cells to die and tumors to shrink. As with every type of cancer treatment,

radioimmunotherapy is associated with some side effects. The most common side effect of

radioimmunotherapy is a reduction in blood cells counts caused by the radiation of the bone

marrow, fever, chills and aches.

22

THERAPEUTICAL ANTIBODIES IN USE

Significant advances have now been made in the use of monoclonal antibodies for the

treatment of carcinomas (Table 3). Two therapy procedures for solid tumors are currently in

use, edrocolomab (Panorex), approved in Europé in 1994, and trastuzumab (Herceptin),

approved in the United State in 1998, for treatment of Dukes C colon cancer and metastatic

breast cancer, respectively. Edroclomab (17-1A antibody) is a murine immunoglobulin

(IgG2a) monoclonal antibody that preferentially recognize the cell surface glycoprotein 17-

1A. Trastuzumab is approved for use in patients with metastatic breast cancer. It is a

genetically engineered anti-HER2 monoclonal antibody which inhibits proliferation in vitro of

tumor cells overexpressing HER2 protein and specifically targets the HER2 oncoprotein.

Another two unconjugated approved antibodies in use are, Rituximab, approved in 1997, and

Bevacizumab approved 2004 by the FDA. Rituximab is a human-mouse chimeric monoclonal

anti-CD20 antigen antibody directed against malignant B-cell, while Bevacizumab is an anti-

vascular endothelial growth factor antibody directed against colorectal and lung cancer (Table

3). Two approved radionuclide conjugated antibodies for therapy of hematologic malignancy

in use are Tositumonomab (Bexxar, IgG2a) and Ibritumomab (Zevalin, IgG1), reactive with

CD20.

Table 3. Examples of mAbs, tumor antigens and radionuclides used for radioimmunotherapy

(1, 2) [82, 83], immunotherapy (3) [97], (4, 5) [98-108], (6) [109, 110] and immunotoxin

therapy (7, 8) [107, 108].

Antibody Antibody form Radionuclide, Toxin

Antigen Disease Clinical trails, Approval

1) Tositumonomab (Bexxar)

murine IgG2a 131I CD20 NHL FDA approved

2) Ibritumomab (Zevalin)

murine IgG1 90Y CD20 NHL FDA approved

3) Bevacizumab (Avastin)

chimeric human/ murine IgG1

- VEGF Colorectal, lung cancer

FDA approved

4) Rituximab (Rituxan)

chimeric human/ murine IgG1

- CD20 NHL FDA approved

5) Trastzumab (Herceptin)

human IgG1 - HER2 Mammary FDA Approved

6) Edrecolomab (Panorex)

chimeric human/murine IgG2a

- 17-1A Colon/rectal Cancer

Approved in Europe

7) Anti-My9-bR (Myelotarg)

human IgG1 Blocked ricin (plant)

CD33 AML FDA Approved

8) Anti-Tac(Fv)- PE38

IgG1-chimeric PE38 (bacteria) CD25 B, T cell lymphoma

Phase II

23

Abbrevation: AML, acute myelogenous leukemia; NHL, non-Hodgkins’s lymphoma; VEGF, vascular endothelial growth factor; HER2, human epidermal growth factor receptor 2; FDA, food and drug administration; PE, pseudomonas exotoxin; CD, cluster of differentiation.

Since a large number of tumor cells are resistant to complement-mediated lysis, and since the

immune system may not recognize tumor cells as foreign, the anti tumor effect may be weak.

Tumor-specific monoclonal antibodies can be conjugated to a lethal toxin (7, 8, Table 3) or a

radionuclide to form an immunoconjugate capable of killing tumor cells (Table 3).

Immunotoxins have recently been tested successfully in patients with malignant diseases, and

have been considered as a new clinical method for cancer therapy compared to the traditional

methods i.e. surgery, radiotherapy and chemotherapy [111]. Many different types of

immunotoxins have been constructed. Some of these have excellent activity in vitro in animal

models and several are being evaluated in clinical trials. The use of chimeric, humanized or

antibody fragments linked to human proteins with toxic properties would circumvent many

problems encountered with the classical immunotoxins [112].

24

ANIMAL MODELS AND HUMAN TUMOR XENOGRAFTS

Laboratory animals are usually utilized in model systems of human diseases, i.e. they are used

to study in vivo pharmacokinetics of various compounds prior to clinical trials. The most

commonly used animals for the study of radioimmunotargeting are mice, rats or guinea pigs.

[50]. Mouse models of human cancer are valuable tools for cancer research and have

consistently been used to qualify new anticancer drugs for investigations at human clinical

trials. The most used models include transplantable murine tumors grown in syngeneic hosts

and xenografts of human tumors grown in immunodeficient mice [113]. The main drawback

of xenografts is that the genetics and histology of the tumors are frequently not representative

of the corresponding human tumor and, thus far, these models have not been as predictive of

therapeutic success as one would expect [114].

Animal models might help in our understanding of the requirements for cell killing by

antibody mediated mechanisms, providing that data is interpreted cautiously. However,

selection of an in vivo model system for the investigation of the biology of tumors and their

response to the array of therapeutic strategies employed clinically, is a complex process.

There is substantial diversity in animal systems used in translational research in radiation

oncology. Traditionally, the scientists have used model tumors on murine hosts because of the

availability of in-bred lines, ease of obtaining tumor systems, relatively low cost, easily

scored endpoints, rapid tumor growth; and wide acceptability in the scientific community

[115].

However, man and animals differ in many aspects which make the use of animals as

experimental models insecure [116]. The major differences between animal models and

patients are related to body volume and antibody distribution, the concentration of antibody in

vivo, the extent of tumor load and tumor cell diversity. Since most of the antibodies are

murine, they generally have no cross reactivity with normal mouse tissues, but this can be

seen when they are used in humans [117]. However, some of these obstacles in human can be

hampered by designing recombinant antibodies

25

AIMS

1. To create some anti PLAP scFv antibodies for radioimmunolocalization of HeLa Hep-2 cancer cells expressing PLAP.

2. To improve solubility and affinity of the scFv:s by making in vitro mutagenically

modified scFv:s or divalent tandem scFv antibodies.

3. To evaluate the ability of these scFv antibodies at in vivo tumor

radioimmunolocalization.

4. To combine RT and RIT using intact radiolabelled antibodies against PLAP and

cytokeratins to cause synergistic growth retardation in vivo of HeLa Hep-2 cells.

26

MATERIAL & METHODS

MONOCLONAL ANTIBODIES, PRODUCTION AND MOLECULAR STUDIES

mAbs are identical because they are derived from one single growing dividing parent cell.

mAbs which specifically bind to a derived antigen can be used to detect, localize, isolate or

even in vivo eliminate that substance. mAbs are important tools in biochemistry, molecular

biology and medicine (immunotherapy, radioimmunotherapy, immunotoxin therapy). 1975,

Köhler & Milstein developed techniques (Hybridoma technology) for producing mAbs,

making it possible to produce large quantities of identical antibodies directed against defined

antigens.

[37].

In order to generate a hybridoma clone producing a specific mAb to a single antigen, mice are

repetively immunized with antigen. When a significant polyclonal antibody response is

reached in the host, cells from the spleen can be fused with ’’immortal’’ mouse myeloma cells

and cultured in a selective medium in which only hybrids, but not myeloma cells, survive.

Spleen cells die spontaneously in culture media after some days. The cells are cultured on a

96-well plate and all wells containing growing hybridoma cells are tested for antibody

specificity. Cells in positive wells are cloned. A hybridoma clone constitues a group of cells,

in which all cells are identical and produce the same antibody. The selected hybridomas can

now be frozen and stored for long periods and can be used for production of monoclonal

antibodies. The mAbs (H7 and TS1) used in this thesis have been produced with this

technique.

ANTIGENS AND ANTIBODIES IN THIS THESIS

Two intact mAbs have been used in this study. The first one is TS1 (IgG1aK) raised against

CK8 antigen (32 kDa) [118]. This Mab has been used in several experimental investigations

for RIL and RIT [23, 29-31, 33, 34, 119], and binds exclusively to CK8 antigen expressed

intracellular, but deposited extracellularly in necrotic regions of the HeLa Hep-2 tumor cells.

The second Mab is H7 (IgG2ak) raised against PLAP antigen (128 kDa) [120] expressed

ectopically on the HeLa Hep-2 cancer cells. This MAb has also proven useful at RIL and RIT

in a number of experimental and clinical studies [23, 33, 119, 121-123]. The affinity constant

(KA) for H7-PLAP interaction has been determined to 6.7 x 109 M-1 [123] which makes it

useful for radioimmunotargeting and therapy. The anti PLAP hybridoma H7 was furthermore

used to generate the different recombinant single-chain antibodies as earlier described.

27

RADIOLABELING

The radionuclide 125I is most commonly used nuclide for producing radiolabeled compounds

for tumor localization experiments although 123I or 131I can also be used. Specific iodination

methods include Chloramine-T, Bolton Hunter, Iodogen and Iodo-bead methods [124]. In this

study, the purified recombinant antibodies were labeled with 125I using the chloramine-T

method [124]. Free iodine was removed on a Sephadex G 50 (pharmacia, Uppsala, Sweden)

column. Radiolabeled antibody fractions tested by a Geiger counter were pooled together, and

were used for tumor targeting in mice carrying the HeLa Hep-2 tumor.

mRNA ISOLATION, cDNA PRODUCTION AND DNA AMPLIFICATION

mRNA was extracted and purified from 40 x 106 hybridoma cells producing H7, using a

FastTrack 2.0 kit (Invitrogen, USA) and cDNA was reverse transcribed by oligo-dT priming

using a cDNA synthesis kit (RNA PCR Kit, Perkin Elmer, UAS). The cDNA was utilized as a

template in the PCR cycles. Amplification of the murine k light chain DNA was performed

using the primers VK1FOR and VK1BACK. The murine heavy chain DNA was amplified

using the VH1FOR primer and the VH1BACK primer [125] (Table 4). PCR amplification

was carried out in a total volume of 50 µl containing 5-50 ng cDNA, 25 pmol of each primer,

500 µM dNTPs, 5 µl of 10 x PCR buffer, 1.5 mM MgCl2 and 5 unit of AmpliTaq DNA

polymerase (Perkin Elmer, USA). The mixture was subjected to 40 cycles of 1 min at 94 °C, 1

min at 60 °C and 2 min at 72 °C in a Programmable Thermal Controller (PTC-100, MJ

Research Inc; USA).

28

Table 4 Primers used for generation of the scFv (sc-1 and sc-3 link for VL; sc-2 and sc-4 link for VH), incorporation of restriction site for reamplification and cloning of scFv into expression vectors (sc-1.1= NcoI; sc-2.2=EcoRI) and prolonging the linker region to (20 amino acids = 1, 2; to 25 amino acids = 3, 4; to 30 amino acids = 5, 6), and scdsFv (scd-7, 8 for VL and scd-9, 10 for VH). VK1FOR (5’- GTTAGATCTCCAGCTTGGTCCC 3’) VK1BACK (5’- GACATTCAGCTGACCCAGTCTCCA 3’)

VH1FOR (5’- TGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG 3’) VH1BACK (5’- AGGT(GC)(AC)A(AG)CTGCAG(GC)AGTC(AT)GG 3’)

sc-1: 5´-gg GATATACAGCTGACCCAGTCTCCA sc-3 link: 5´-ACT ACC GCC TCC TCC GCT GCC TCC ACC ACC TTT GAT CTC

CAG CTT GGT C 3’ sc-2: 5´- ggTCAGGAGCTTACTGTGACCGTGGTC sc-4 link: 5´-GGT GGT GGA GGC AGC GGA GGA GGC GGT AGT GAG GTG CAA

CTG CAG C 3’ sc-1.1: 5´-ggCCATGGATATACAGCTGACCCAGTCTCCA 3’ sc-2.2: 5´-ccGAATTCTCAGGAGCTTACTGTGACCGTGGTC 3’ 1) 5´-GA GGC GGT AGT GGC GGC GGC GGC TCC GGT GGT GGT GGT TCT

GAG GTG CAA CTG 2) 5´-CAG TTG CAC CTC AGA ACC ACC ACC ACC GGA GCC GCC GCC GCC

ACT ACC GCC TC 3) 5´-GGT GGT GGT GGT TCT GGC GGA GGG GGG AGC GAG GTG CAA CTG

CAG 4) 5´-CTG CAG TTG CAC CTC GCT CCC CCC TCC GCC AGA ACC ACC ACC

ACC 5) 5´-GGC GGA GGG GGG AGC GGT GGG GGA GGT TCC GAG GTG CAA CTG

CAG 6) 5´-CTG CAG TTG CAC CTC GGA ACC TCC CCC ACC GCT CCC CCC TCC

GCC scd-7: 5’ GTGGACGTTCGGTTGCGGGACCAAGCTG 3’ scd-8: 5’ CAGCTTGGTCCCGCAACCGAACGTCCAC 3’

scd-9: 5’ GAGGCCTGGACAATGCCTTGAGTGGATTG 3’ scd-10: 5’ CAATCCACTCAAGGCATTGTCCAGGCCTC 3’

29

DNA PURIFICATION, CLONING AND SEQUENCING

The PCR products were gel purified with a PCR purification kit (Wizard PCR Preps,

Promega, USA), cloned into a T-vector [126] and sequenced with a Cy5 AutoRead

sequencing kit (Pharmacia Biotech, Uppsala, Sweden) on an ALFexpress DNA sequencer

(Pharmacia Biotech , Umeå, Sweden). Five clones of each fragment were sequenced to

ascertain the absence of artefacts arising from PCR amplification.

IN VITRO MUTAGENIC MODIFICATIONS OF scFvs

Almost all clones carrying the nucleotide sequences encoding VL and VH of the murine

IgG2a antibody (H7) suffered from some deletion mutations, insertion mutations, substitution

mutations or inserted stop codons when compared to the original sequence. The identified

mutations (Table 5) were corrected one by one by designing primers containing the amino

acids of interest for the region of interest by Quick Change Site-directed Mutagenesis Kit

(Stratagene, Germany).

Table 5 Initially identified and exchanged deviations in the scFv compared to the original H7 sequence. -In the VL fragment these amino acids were exchanged: P→I at position amino acid number 2 from N-terminal A→T -------------------------------------68 ------------------ G→S--------------------------------------76 ------------------

-In the VH fragment these amino acids were exchanged: Stop codon→ K at position number 38 from the N-terminal Deletion →G ----------------------------------- 44 ---------- S → T ----------------------------------- 71 ----------- S → T ----------------------------------- 78 ----------- Insertion → P -----------------------------------107 ---------- Deletion → T -----------------------------------110 ---------- Deletion → T,V,S,S -----------------------------118-121 ----

CONSTRUCTION OF scFv/scdsFv AND [sc(Fv)2] RECOMBINANT ANTIBODIES

In order to create a scFv composed of both the VL and VH regions of H7, different lengths of

the linker between the VL and VH fragments were generated and tested. This was performed

by incorporation of (Gly4 Ser1) amino acids (aa) between the two fragments, using PCR and

the Quick ChangeTM Site-directed Mutagenesis Kit. Initially (Gly4Ser1)2 was incorporated in

30

the end of VL and the complementary sequence of it into the begining of VH, using primers sc-

1/sc-3 link for VL and sc-2/sc-4 link for VH (Table 4), and the PCR program as previously

described. These fragments were then run on the gel and purified, followed by ligation. For

ligation, 1.5 µl of each VL/VH fragment was mixed with 5 µl of 10 x PCR buffer, 5 µl PCR

buffer, 5 µl of MgCl2 25 mM and 29 µl autoclavated H2O, heated to 80 ºC for 10 min and

then cooled down to RT gradually to perform ligation of the linker region.

This ligation was stabilized with the addition of 1 µl of each dNTP and 1 µl Tag DNA

polymerase and two temperature steps: step 1 60 ºC 1 min; step 2 72 ºC 1 min. Then the

scFv construct was amplified by addition of 1.5 µl sc-1 primer (50 pmol/ µl), 1.5 µl sc-2

primer (50 pmol/ µl) and 30 PCR cycles composed of: step 1 92 ºC 1 min, step 2 60 ºC 1

min and step 3 72 ºC 1 min.

Appropriate restriction sites (NcoI in the beginning of VL and EcoRI in the end of VH)

were incorporated using sc-1.1 and sc-2.2 primers respectively ( Table 4) which made it

possible to clone the amplified and purified scFv into the PET-20b(+) expression vector for

sequencing and expression (Table 4). For this purpose, the amplified PCR fragments were run

on an 1% agarose electrophoresis grade gel, Cat No 15510-027 (Invitrogen, Sweden). The

scFv fragments were cut and separated from non desired band and purified with a GFX PCR

DNA and Gel Band Purification Kit (Amersham Bioscience, Uppsala, Sweden).

The fragments were cut with NcoI/EcoRI o/n at 37 ºC, run on an agarose gel and purified

with the GFX PCR kit following incorporation into the PET-20b (+) vector.

The linker region of this scFv construct was then prolonged by incorporation of 5-10

(Gly4Ser1) each time using the primers 1, 2, 3, 4, 5, 6 in (Table 4) and the Quick ChangeTM

Site-directed Mutagenesis Kit. Since the number and type of amino acids in the linker peptide

fragment can influence the properties of the scFv, a scFv composed of 25 respectively 30

amino acids consisting of (Gly4Ser1) was created, in which the glycine residues would confer

flexibility to the construct and the serines would provide some solubility.

The linker can be critical for the affinity, extent of multimerization, conformational stability,

proteolytic stability and refolding kinetics of scFv. These new modified constructs were

expressed as performed in the expression procedure.

To increase the solubility, stability, activity and final scFv yield, we changed some selected

amino acids in the VL and some in the VH numbered according to Chowdhury et al [74], one

by one, by designing primers Sigma-genosys containing the amino acid of interest for the

region of interest by Quick ChangeTM Site-directed Mutagenesis Kit (Stratagene, Germany).

31

On the VL fragment the following substitutions were performed: at position, 12 T → S, at

position 40, Q → P, at position70, Q → D, and at position 85, S was exchanged to T. On the

VH fragment at position 9, S was exchanged to A.

To circumvent the instability and aggregation problems associated with scFvs, we also

constructed a single chain disulfide stabilized (scdsFv) antibody by incorporation of an extra

cysteine residue in the frame work region of each variable region of an already existing scFv

using primers scd-7, -8, -9, -10 (Table 4), to make an extra disulfide bridge on specific

positions according to Bowden GA et al [127].

One cysteine in position 100 on the VL fragment and one in position 44 on the VH region

from the N-terminal were inserted. The proposed improvement in stability of these scdsFv is

due to their reduced tendency to aggregate compared to scFv, since the extra interchain

disulfide bridge holds the two fragments more tightly, thereby preventing aggregation [128].

In order to prevent rapid clearance from the blood and, to increase the affinity and retention

time of scFv within the tumor, we connected two identical scFvs of the same kind together by

a (Gly4Ser1)3 amino acids as linker in between. (Gly4Ser1)3 was incorporated in the end of VH

region of one scFv, (Gly4Ser1)1 /time with a BamH1 site incorporated in the last step in the end

of linker, using the PET-20b(+) vector carrying the scFv fragment, primers (Table 6) and the

Quick ChangeTM Site-directed Mutagenesis Kit for performance. A BamH1 site was

incorporated in the beginning of VL region of another scFv of the same type (Table 6). These

scFv constructs were then ligated in the same vector, were cut from the vectors and gel

purified. These new [sc(Fv)2] constructs were then incorporated into the PET-32a vector and

Origami B (DE3) for expression.

32

Table 6 Primers used for construction of the [sc(Fv)2]. Primers 1 and 2; 3 and 4; 5 and 6 were

used for linker construction in the C-terminus of VH of one scFv. Primers 7 and 8 were used

to insert a BamH1 site in the N-terminus of VL of another scFv to be able to connect these two

scFvs to one [sc(Fv)2].

1) 5’ cacagtaagctccggaggaggaggaagcgaattcgagctccg 3’

2) 5’ cggagctcgaattcgcttcctcctcctccggagcttactgtg 3’

3) 5’ ggaggaggaagcggggggggggggtcggaattcgagctccg 3’

4) 5’ cggagctcgaattccgaccccccccccccgcttcctcctcc 3’

5) 5’ gggggggggtcgggaggcgggggatccgaattcgagctccg 3’

6) 5’ cggagctcgaattcggatcccccgcctcccgaccccccccc 3’

7) 5’cggaattaattcggatccgatatacagctgacc 3’

8) 5’ggtcagctgtatatcggatccgaattaattccg 3’

EXPRESSION AND PURIFICATION OF RECOMBINANT ANTIBODIES The Origami B (DE3) strain carrying the PET-32A vector harbouring the recombinant

antibody genes were grown untill OD600 = 0.7-0.8 at RT with agitation and were induced for 3

hrs using 0.2 mM IPTG. The cell pellet was collected by centrifugation at 7000-8000 rmp

using Beckman centrifuge, and dissolved in lysing buffer containing 0.2 M NaCl, 50 mM

Tris-HCl, 10 mM imidazole, 6 mM Chaps, 0.2 mg/ml lysozyme pH 8, followed by sonication.

The lysate was centrifuged at 16000 rpm for 20 min and the proteins were purified from

E.coli contaminants using Ni-NTA resins capturing His-tagged proteins. The captured protein

was washed by the lysis buffer described above (5 x gel volume) to remove contaminants and

were eluted using the lysis buffer containing 0.3 M imidazole. The eluate was dialysed in PBS

pH 7.4 o/n to remove detergents and imidazole. The dialysed fraction was further purified

using PD-10 columns for buffer exchange (50 mM Na-Acetate pH 5.5 ) and Cat-ion SP

Sepharose fast flow for purification. Almost pure fractions (after washing with 50 mM Na-

Acetate pH 5.5, 5 x gel volume) were eluted using 50 mM Na-phosphate, pH 6 and were

pooled together and the fusion-tag protein (TrxA-His tag) was cut away using AcTEV

protease o/n at 30 °C. The mixture was then run on a Ni-NTA resin again to remove the

fusion-tag protein and the TEV protease.

Pure fractions of the desired recombinant scFvs/scdsFv, [sc(Fv)2] were eluted using 50 mM

Na-phosphate pH 6 (scFv/scdsFv) and 50 mM Na-phosphate pH 6 + 40 mM imidazole

([sc(Fv)2]), were pooled together, dialysed against PBS pH 7.4 and were concentrated using

33

an ultrafiltration membrane (10,000, NMWL, amicon, Millipore) to a final concentration of

0.5-0.8 mg/ml.

PROTEIN QUANTIFICATION

Concentrated pure recombinant antibodies were measured using BCA Protein Assay Kit

(PIERCE, USA).

SDS AND NATIVE GEL ELECTROPHORESIS

Ten microgram of each purifed recombinant scFv protein was run on a 10 % SDS and native

polyacrylamide electrophoresis to confirm the purity and solubility of the target proteins. The

electrophoresis was performed for 45 min at 200 V for SDS and 3.5 hr at 180 V for the native

gel. The protein bands were visualized by Commasie Brilliant Blue colour staining and

destaining solution.

IMMUNOBLOTTING OF NATIVE AND SDS EXPOSED PROTEINS

After electrophoresis, the proteins were transfered onto sequi-Blot PVDF membrane (Biorad,

Sweden) for 1.5 h at 100 V. The structural integrity of the target proteins were detected by a

anti-Fab specific mouse antibody developed in goat as primary antibody (M-6898, Sigma,

Sweden) and rabbit HRP conjugated anti-goat antibody as secondary antibody (P0449,

DakoCytomation, Denmark). The protein bands were visualised by incubating the membrane

in dark with a developing solution 15-30 min.This solution was composed of 30 mg HRP

(HRP color developing reagent, catalog:1706534, Biorad, Sweden), 30 µl H2O2, 10 ml cold

methanol and 50 ml of 500 mM NaCl pH 7.4.

ELISA

ELISAs were performed by coating microtiter wells with native purified PLAP (1 µg/ml, 100

µl/well) for 3 hrs at RT. Non-specific/free sites in the wells were blocked using 1 % bovine

serum albumin (Sigma, Sweden) in PBS (300 µl/well). 1 µg/ml (100 µl/well) of each protein

construct was incubated in these wells for 1 hr. The protein complex was detected using a

goat anti-Fab specific mouse antibody as primary antibody,100 µl/well (M-6898, Sigma,

Sweden) and rabbit HRP conjugated anti-goat antibody as secondary antibody, 100 µl/well

(P0449, DakoCytomation, Denmark). The wells were washed after each step by (1% NaCl,

0.05% Tween-20). The protein complexes were visualised by using a developing solution,

34

100 µl/well in the dark for 10-30 min. This solution was composed of 1 OPD (1,2

phenylendiamine dihydrokloride)tablet (Dako, Denmark), 5 ml autoclavated H2O, and 3 µl

H2O2.

ANIMAL STUDIES

To better understand the in vivo processing and tumor targeting by the developed radiolabeled

recombinant scFv antibodies, we used twenty female nude mice (Balb/C nu/nu,

Bomholtgaard, Denmark) aged 8-10 weeks. They were inoculated subcutaneously with 5 x

106 HeLa Hep-2 cells near the right hind leg. The mice were randomly divided into six groups

with three animals in each group and two animals as negative controls. The animals were kept

in an isolated room in cages with filtertops to isolate them from airborne pathogens at a

temperature of 25 °C with a 12 hours light and 12 hours dark cycle.

Animals with tumors visible after 2 weeks were used 4-8 weeks after the initial injection

when the tumor diameters were 8-12 mm. The animals had free access to drinking water

containing 10 mM NaHCO3 supplemented with 1 mg KI/L in order to block thyroid uptake of

free iodine.

The animal were anaesthetized by a mixture (1:1:2) of Dormicum (Roche, Midazolam),

Hypnorm (Janssen Pharmaceutica) and steril water, administered intraperitoneally, before the

injection of 125I radiolabled recombinant antibodies.

HUMAN TUMOR XENOGRAFTS

The HeLa Hep-2 is a human adherent cell line originated from a solid tumor epidermoid

larynx carcinoma. It is an easily handled cell line which resists temperature, nutritional, and

enviromental changes without loss of viability. This cell line express membrane bound PLAP

and intracellular cytokeratins 8, 18 and 19. The HeLa Hep-2 cells were cultured in RPMI

1640 medium (Gibco, Scotland), containing 5 % (v/v fetal calf serum and 1 % (v/v)

penicillin-streptomycin. The animals were inoculated subcutanously near the right hind leg

with approximately 5 x 106 HeLa Hep- 2 cells.

RADIOIMMUNOLOCALIZATION EXPERIMENTS

The distribution of radioactivity by recombinant antibodies in the mice was acquired with a

scintillation camera (Porta camera, General Electric, Milwaukee, US) connected to an

computerized evaluation system (Exeleris, General Electric, Milwaukee, US). Constant

35

geometric conditions were obtained by using a holder, keeping the aneasthetized mouse at a

distance of 9 cm from a pinhole collimator. The mice were anesthetized intraperitoneally

prior to scintigraphy using 30-40 µl of a 1:1:2 cocktail of Dormicum (Roche, Midazolam 5

mg/ml, Schweiz) Hypnorm (Janssen Pharmacia, Belgium, Fluanisone 10 mg/ml and Fentanyl

citrate 0.315 mg/ml) and sterile water. The study period was 47 days in total and each animal

was subjected to consecutive radioimmunoscintigraphic measurements. Image data were

acquired during different time intervals for several days to visualize the retention and

clearance of the radioactivity from tumor and non-tumor tissue.

The evaluation of animal and tumor uptake of the labeled tracer was calculated from ROI:s

(regions of interest) in the scintigraphies. The tumor: non-tumor ratio was calculated by

division of counts from the tumor with a contralateral reference region of the same size. The

whole body activity was set to a ROI determined with a threshold of 3%.

RADIOIMMUNOTHERAPY WITH INTACT ANTIBODIES

Female nude mice (Balb/C nu Bomholtgaard, Denmark) 5-8 week old were inoculated with 2

x 106 HeLa Hep-2 cells subcutanously on the back in order to examine the effects of radiation,

radioimmunotherapy and a combination of these modalities on HeLa Hep-2 tumors,. These

cells had been cultured in DMEM (Invitrogen AB, Lidingö, Sweden) contaning 1% (v/v)

penicillin, streptomycin, 1% (v/v) L-glutamine and 5% (v/v) fetal calf serum. Two weeks

after inoculation of tumor cells, when the tumor diameter was approximately 12 mm and the

mean tumor volume 415 mm3 , the mice were given water supplemented with potassium

iodide (Lugol’s solution; 10 mM NaHCO3 supplemented with 1 mg KI/ml) in order to block

thyroid uptake of free iodine upon treatment. Totally 70 mice were used and divided into

groups of three to eight animal with tumors in each group. Seven different treatment groups

and one untreated control group was used. Tumor growth retardation was studied treating the

mice with only RT, only RIT ( 131I-TS1+ 131I-H7) and a combination of RT +RIT. In the

group obtaining RT alone, totally 15 Gy were applied in three consecutive administration, 5

Gy/day, with a dose rate of 1.7 Gy/min. The mAbs in the different therapy groups were

administered as 100 µg of the 131I-H7, 100 µg of the 131I-TS1 or 50 µg of the 131I-H7 + 50 µg

of the 131I-TS1. In the therapeutic investigation, the animals were injected with 20 MBq of 131I-labelled mAb antibody, which is below the maximal tolerated dose.

In the combined therapy group, the mice first got RT as the RT group and one week later RIT

in addition as the RIT group. The evaluation of tumor retardation growth started 22 days after

treatment the mice with RT and lasted until day 70 after which no difference was observed.

36

HISTOLOGICAL EXAMINATIONS

Fresh HeLa Hep-2 solid tumor samples were removed and frozen in isopentane precooled in

liquid nitrogen from four selected groups of animals i.e. control group and groups treated with

only RT, only RIT (131I-H7 + 131I-TS1) and a combined RT+RIT therapy and were

investigated by combinations of histochemical and immunohistochemical stainings. The

investigation was performed 22 days following initiation of the treatment in order to identify

differences in terms of biological and morphological changes between the different treatment

modalities. Seven-µm-thick cryosections were stained with haematoxylin-eosin and examined

by light microscopy using software from Leica (Leica Qwin). The percentage of viable tumor

tissue, connective tissue and necrotic regions was calculated and determined.

IMMUNOHISTOCHEMISTRY

Seven-µm-thick cryosections from the solid tumor samples were obtained from samples

frozen in isopentane, precooled in liquid nitrogen and the sections were stained as follows:

Ki67 AND M30 STAINING

The tumor cryosections were fixed in aceton for 5 min at –20 ºC, then air-dried for 15 min

and incubated in PBS containing 0.2% bovine serum albumin (BSA) and 0.05% saponin for

45 min. The DAKO ARK (animal research kit)-peroxide (DAKO A/S, Copenhagen,

Danmark) was applied and performed according to the manufacturer. The peroxidase activity

in the tumor section was blocked for 5 min with “peroxidase block solution” supplied with the

kit. The cryosections were then incubated with a mixture of primary mAb [mouse anti human

Ki67 antigen (DAKO A/S, Copenhagen, Denmark) or M30 CytoDEATH mouse mAb (Roche

Diagnostics GmbH, Mannheim, Germany)], a modified biotinylated anti-mouse

imunoglobulin and a blocking agent. This mixture was then premixed to reduce the reactivity

of the secondary antibody to endogenous immunoglobulins, which could be present in the

tissue. After that streptavidin-peroxidase was applied to the specimens for 15 min, followed

by a 5-min incubation with 3,3’-diaminobenzidine (DAB) and H2O2 . In the end, the sections

were counterstained with methyl green for identification of proliferating tumor cells (Ki 67)

and apoptotic cells by (M30).

37

IN SITU CELL DEATH DETECTION-POD STAINING

The cryosections were fixed in 4% paraformaldehyde for 30 min at room temperature,

blocked in 0.1 M glycine for 10 min, followed by incubation in PBS (0.2% BSA and 0.1%

saponin) for 1 h. TUNEL (TdT-mediated dUTP nick end labelling) reagents were added to the

sections and incubated for 1 hr in 37 ºC in a humified chamber. The endogenous peroxidase

activity in the tumor sections were blocked by incubation for 15 min in methanol + 1% (v/v)

H2O2 . The sections were incubated with TUNEL POD converter in a humidified chamber for

30 min at 37 ºC . Sections were then developed with 0.05% DAB and 0.03% H2O2 in 0.05%

M Tris HCl buffer (pH 7.6) and counterstained with methyl green to detect apoptotic cells

(TUNEL).

ENDOGLIN (CD105) STAINING

The tumor cryosections were fixed for 5 min in acetone at –20 ºC and were air dried for 20

min at room temperature. The endogenous peroxidase activity was blocked for 5 min with the

blocking solution supplied with the ARK kit, followed by incubation for 1 hr with PBS +

BSA (0.2%) + saponin (0.1%). A mixture of primary antibody [rat anti-mouse Endoglin (BD

Biosciences, Erembodegem, Belgium)] and secondary antibody [biotin-conjugated F(ab’)2

goat anti-rat antibody (Jackson Immuno Research Laboratories Inc; West Grove, pa; USA)]

was blocked with mouse serum for 5 min and then added to the sections, which were

incubated for 15 min. After that, streptavidin-horseradish peroxidase from the ARK kit was

added for 15 min and the sections were developed for 5 min with DAB. In the end, the

sections were counterstained with methyl green to visualize the disturbed organisation of

vasculature and connective tissue.

38

Results

Paper I

Optimizing the generation of recombinant single-chain antibodies against placental

alkaline phosphatase

Ali Sheikholvaezin, Per Sandström, David Eriksson, Niklas Norgren, Katrine Riklund and

Torgny Stigbrand1. Hybridoma 2006; 25 (4): 181-92.

Totally, four soluble- stable-, and active scFv/scdsFv antibody constructs based on CDR

regions of the intact IgG2a (H7) anti-PLAP, with different linker lengths (25 aa, 30 aa) were

created. SDS/native western blot and Elisa analyses could confirm the structural integrity,

solubility and affinity of the developed antibodies for their target PLAP. All these constructs

presented similar stability up to 52 °C. In order to improve the properties of the antibodies

several exchanges of the amino acids were performed by in vitro mutagenesis. Both

deviations from the original published sequence (generated during PCR amplification) as well

as crucial substitutions affecting solubility were corrected/introduced in order to refine the

properties of the scFvs.

By use of Biacore real time surface plasmon resonance all four antibodies were demonstrated

to retain high affinities, ( KA for H7 = 6.7 x 109 M-1, KA for scFv 30 aa = 1.1 x 109 M-1, KA

for scFv 25 aa = 2 x 109 M-1, KA for scdsFv 30 aa = 1.1 x 109 M-1, KA for scdsFv 25 aa = 1.9 x

109 M-1). The scFv composed of 30 aa appeared to be the best construct at least in terms of

synthesis capacity. Up to 5 mg/L soluble, stable and active scFv 30 aa could be obtained from

1 L E.coli culture.

Paper II

Construction and purification of a covalently linked divalent tandem scFv antibody

against placental alkaline phosphatase

Ali Sheikholvaezin, David Eriksson, Katrine Riklund, and Torgny Stigbrand. Hybridoma,

2006; 25 (5): 255-263.

Based on a scFv 30 aa linker anti-PLAP antibody, a tandem monospecific divalent scFv

[sc(Fv)2] antibody with 15 aa linker in between the two scFvs, was created. This divalent

39

construct showed higher activity, functional affinity and almost the same stability (up to 52

°C) compared to the scFv/scdsFv antibodies for its target PLAP.

This divalent scFv [sc(Fv)2] should be more usable and have more advantages compared to

the monovalent one at least in terms of therapy, since it is divalent and larger, which increases

its bindings affinity and retention time within the tumor.

SDS/native western blot and Elisa analyses could confirm the presence, structural integrity,

solubility and affinity of the developed [sc(Fv)2] antibody for its target PLAP.

By use of Biacore real time surface plasmon resonance the [sc(Fv)2] antibody was

demonstrated to retain high affinitiy, ( KA for H7 = 6.7 x 109 M-1, KA for [sc(Fv)2] = 1.2 x 109

M-1, and KA for scFv 30 aa = 1.1 x 109 M-1). However, the total yield of [sc(Fv)2] decresead

compared to scFv from 5 to 2 mg/L, which could depend on aggregation during protein

synthesis or the purification procedure.

Paper III

Tumor radioimmunolocalization in nude mice by use of antiplacental alkaline

phosphatase single-chain antibodies/tandem monospecific single-chain antibodies

Ali Sheikholvaezin, David Eriksson, Katrine Riklund, Lennart Johansson3, and Torgny

Stigbrand1. Cancer Biotherapy & Radiopharmaceuticals, 2006 (submitted).

In vivo scintigrafic evaluation of the tumor localization properties indicated that all four

scFv/scdsFv antibodies, the tandem monospecific divalent [sc(Fv)2] antibody and the intact

H7 localized to the tumors. The tandem antibody displayed convincing tumour localization

properties with a rapid excretion pattern comparable to the scFv:s, but with a longer retention

time in the tumour and higher tumour:non tumour ratio (25-30) at 47 hours. For the tandem

antibody more than 50% of the remaining activity in the mouse was present in the tumour

between 1-2 days after injection.

While the intact H7 antibody could be visualized several weeks after injection, the scFv

antibodies demonstrated fast clearence (hours) and low retention time.

The tandem divalent [sc(Fv)2] antibody was superior to all scFv antibodies due to higher

localization, accumulation and slower clearance, however, still with higher clearance than H7.

40

Paper IV

Combined low dose radio- and radioimmunotherapy of experimental HeL Hep 2 tumors

David Eriksson, Homa Mirzaie Joniani, Ali Sheikholvaezin, Per-Olov Löfroth, Lennart

Johansson, Katrine Riklund Åhlström, Torgny Stigbrand. European Journal of Nuclear

Medicine and Molecular Imaging Vol. 30, No. 6, June 2003.

In an experimental study the effects of radiotherapy (RT) and radioimmunotherapy (RIT)

were investigated separately and in combination. Nude mice were transplanted with HeLa

Hep 2 cells and were given 3 x 5 Gy external RT or 12-20 MBq 131I labeled antibody with

specificity against placental alkaline phosphatase or cytokeratin 8. The growth of the tumors

were followed for 70 days and the tumours were investigated with regard to morphology,

proliferation (Ki 67), apoptosis (M30 and TUNEL). Significant growth retardation of the

tumor, and an increase in the amount of connective tissue and systs, as well as a decrease in

cell density could be observed both for RT, RIT and RT + RIT. The morphology of the

tumour after 22 days was drastically changed in the groups treated with RIT and the study

indicates that both necrosis and apoptosis may be involved in the process causing this

efficient therapy.

41

DISCUSSION

Conventional cancer therapy such as surgery, radiation-, hormonal- or chemotherapy is only

curative in a limited fraction of the patients depending on type and stage of cancer, patients’

age etc. Moreover, normal tissue may be damaged during treatment. The occurrence of side

effects not only reduces quality of life for the patient, it also puts a limit to the dose of for

example radiation or chemotherapeutic agents that can be given. Thus the maximum tolerable

dose may not be sufficiently high to kill all cancer cells. There is therefore a need for

complementary treatment modalities.

During the last two decades different attempts have been made to boost the patients own anti-

tumor response, the basic assumption being that the patient mount an immune response but

that it is too weak to completely eliminate the cancer cells. Some reasons for lack of an

efficient anti-tumor response are that tumors adopt various evasive strategies such as

antigenic modulation, down regulation of MHC class I antigens and presence of blocking

antibodies. In the latter case antibodies are presumably masking the tumor-associated antigen

from cytotoxic T cells (CTL). Boosting the patients’ own anti-tumor response may be

achieved by enhancing the antigen presenting activity of dendritic cells and other APCs,

manipulation of co-stimulatory signals or by cytokine therapy. In the former case one

approach has been to expand the dendritic cell population from peripheral blood by incubation

with a mixture of cytokines (GM-CSF, TNF-α and IL-4) followed by pulsing with tumor

fragments. The antigen pulsed expanded cell population is then introduced into the patient,

presumably activating tumor specific helper T cells and cytotoxic T cell precursors (CTL-P).

Introduction of co-stimulatory molecules in tumor cells is another interesting approach. Here

tumor cells have been transfected with the gene coding for the B7 ligand (interacting with

CD28 on T cells) allowing CTL-P to differentiate into CTL. This approach has been

successfully used in a mouse melanoma model. With the aim of augmenting the immune

response to the tumor cancer patients have been injected with a number of cytokines, either

alone or in combinations, including IFN-α, β, γ, IL-2, IL-4, IL-6, IL-12, GM-CSF and TNF.

Occasional encouraging results have been achieved, but overall this approach seems not to be

viable probably due to the complexity of the cytokine network. With the exception of the

remarkable success achieved by vaccination against cervical cancer (see below) these

immunological approaches although promising, are not developed enough for routine clinical

use. Human papilloma virus (HPV) is implicated in practically all cases of cervical cancer of

women and a few HPV serotypes dominate, including HPV16 and HPV18. In independent

42

studies involving large groups of women it was shown that vaccination with two different

types of HPV constructs protected the women from developing cervical intraepithelial

neoplasia (CIN) an early stage of cervical cancer [129, 130].

An approach to cancer therapy that has met with success for some types of tumors, notably

haematological tumors, is the use of mAbs against tumor specific (for example idiotypic

determinants on BCR of B cell lymphomas) or tumor-associated antigens. Several such

antibodies have been approved for clinical use. New therapeutic approaches are continuously

presented. A major problem is, however, the treatment of large solid tumors. Here the

problem is accessibility of the mAb to the deeper parts of the tumor. Another, since long time

well recognized problem in the therapeutic use of mouse mAbs, is the development of an

antibody response to the injected mouse mAb, the so-called HAMA. This problem has

stimulated the development of chimeric antibodies, which are partly human and therefore less

immunogenic. The occurrence of HAMA and the poor penetration of intact antibodies are the

two main reasons for embarking on the road of developing different small size constructs of

the antibodies, which should have reduced immunogenicity and greater tumor penetrating

ability but still retain affinity and specificity for the antigen. Recombinant antibody

technologies offer many opportunities to tailor antibodies to improved targeting properties,

including overall uptake, tumour penetration, accretion time, retention time as well as

improved interaction with immune effector cells [131-135]. Furthermore recombinant

technology can be employed to develop fusion proteins, consisting of antibody fragments

connected to anticancer agents including granzyme B, TNF-α and TRAIL [136-139].

As targets in this study we have used a membrane bound ectopically expressed antigen,

PLAP, present at high levels on HeLa Hep-2 cancer cells, and a cytoplasmatically expressed

antigen cytokeratin 8, deposited outside the cells in necrotic regions of this tumor. HeLa Hep-

2 is a human cervix adenocarcinoma cell line. Two mAbs, H7 (IgG2a) anti-PLAP and TS1

(IgG1a) anti-cytokeratin, raised in the laboratory and used in previous RIL- and RIT- studies

[23, 29-31, 33, 34, 119] were utilized.

In an effort to tailor and veneer antibodies for RIL and RIT, a total of five recombinant

antibodies, all based on the H7 anti-PLAP mAb were constructed. In paper I, 2 scFv:s (linker

lengths 25 and 30 amino acids) and 2 scdsFv:s (also linker lenghts 25 and 30 amino acids)

were constructed, since the linker length/type as well as the extra insertion of a disulphide

bridge between the VL and VH fragments could affect the stability, solubility as well as

43

affinity of the constructs. The proposed improvement in stability of these scdsFv is due to

their reduced tendency to aggregate compared to scFv, since the extra interchain disulfide

bridge holds the two fragments more tightly, thereby preventing aggregation [128]. These

alterations in primary structure in our hand, however did neither improve stability nor

solubility. Furthermore, lower yield of purified product was obtained and also, the

immunochemical detection of the construct was hampered by lower or absent reactivity with

anti Fab specific antibodies. The scFv consisting of 30 amino acids as linker appeared to be

the best one of all these recombinant constructs in terms of synthesis capacity. Up to 5 mg per

liter soluble, stable and active protein could be purified from E. coli cultures, which is high. In

an effort to further increase the solubility, stability, activity and final scFv yield, we changed

some selected amino acids in the VL and some in the VH numbered according to Chowdhury

et al [74]. On the VL fragment the following substitutions were performed: at position, 12 T

→ S, at position 40, Q → P, at position70, Q → D, and at position 85, S was exchanged to T.

On the VH fragment at position 9, S was exchanged to A. Substitutions in the VL appeared to

have a slight impact on the solubility/stability of scFv, wherease the substitution in the VH

appeared to have a larger importance as observed in terms of solubility.

Using Biacore measurements we were able to show that that recombinant antibodies had

similar affinities, KA = 1-2 x 109 M-1 as compared with intact H7, KA = 6.7 x 109 M-1. The

reason for the slight loss of affinity is not completely known although interfering of the linker

region with binding site and monovalency has been postulated [140] but judging from other

studies this is not unexpected and actually somewhat less than in other studies [141, 142].

scFv:s might be the optimal tool for RIL, as they localize rapidly to the tumor, penetrate fast

and are cleared rapidly from the circulation. However, within the tumor even high affinity

monovalent interactions have been shown to provide fast dissociation rates and poor retention

times at the target site.

For many applications including RIT, it is therefore desirable to engineer multivalent antibody

derivates with higher functional affinity (avidity) and slower dissociation rates from the

target. To increase the therapeutical potential of our recombinant antibodies, a tandem

monospecific divalent scFv [sc(Fv)2] antibody was constructed (paper II). This recombinant

divalent monospecific antibody [sc(Fv)2] presented similar affinity KA =1.2 x 109 M-1 as for

scFv, KA = 1-2 x 109 M-1, and as compared to the intact one, KA= 6.7 x 109 M-1. Higher

valency of scFv, i.e. trivalent tandem monospecific scFv [sc(Fv)3] generated an almost

44

insoluble protein, which could depend on hydrophobic interactions, which may cause

precipitation and gradually aggregation of the protein.

In paper III all recombinant constructs were evaluated for radioimmunolocalization

efficiency. The scintigraphic properties of the antibodies did confirm both significant

localization to the tumor and charactaristic differences in behaviour of the antibodies.

The tandem antibody, despite its dimeric nature, demonstrated similar rapid excretion as the

small scFv, probably because both antibodies display size below the renal threshold for

excretion. The size of an ideal targeting agent could be discussed. An increase in size has

been shown to slow down excretion and increase the accumulation within the tumor, as for

example with minibodies [133]. Such modifications could improve RIT procedures, but for

RIL the rapid excreation is an advantage. The tandem antibody was superior in this

investigation due to higher tumor uptake and longer retention time, which reflects the added

valency of this antibody.

BIOLOGICAL EFFECTS OF RADIOIMMUNOTHERAPY

Most studies on the radiobiology of radiation therapy are based on data from cells or tissues

exposed to external-beam radiotherapy. This therapy is delivered as high dose (approximately

50-70 Gy for solid tumors), high dose-rate (approximately 60 Gy/h) radiation. The biological

effects and mechanisms by which this type of radiation exerts damages to exposed cells have

been attributed to either direct or indirect ionization of cellular components. Especially the

DNA within the nucleus has been considered to be an important target as several types of

DNA lesions appear by such radiation, including single and double strand breaks. The cell

responds to this damage by activating cell cycle checkpoints to prevent genetic mutations and

chromosomal rearrangements from being inherited to the daughter cell. If DNA damage is

detected, these checkpoints will prevent progression through the cell cycle, which adds extra

time for the cell to repair the DNA. If the damage is too severe, execution pathways will be

activated, which cause cell death.

The use of treatment modalities that employ low-dose-rate radiation (radioimmunotherapy

and brachytherapy) is increasing as widely used, curative or adjuvant cancer therapies. An

important question that arises is to what degree the knowledge obtained from high-dose-rate

radiotherapy studies of radiobiology is relevant for low-dose-rate based therapies. Lately

several new responses that manifest themselves following cellular exposure to low-dose, low-

dose-rate radiation and for which there is no direct correlation between cell killing and DNA

45

damage have been recognized. These responses include low-dose radiation hypersensitivity,

radiation induced bystander effects, and the inverse dose-rate effect and it has been postulated

that these responses might be underlying mechanisms for the measurable efficacy of relatively

low tumor doses achieved with low-dose rate RIT treatment [143-146].

Cell death has been described to occur directly or indirectly following exposure to ionizing

radiation. Cell death mechanisms induced by such radiation include necrosis, rapid or delayed

apoptosis, depending on the genetic background of the exposed cells and also the character,

dose and dose-rate of the radiation [144, 147, 148]. Apoptosis has been shown to be a very

important killing mechanism following radioimmunotherapy of lymphomas [149-151],

whereas it plays a less important role in solid tumors, which tend to be relatively resistant to

apoptosis. A number of studies including our own also suggest that some tumor cells may be

more susceptible to low-dose, low-dose-rate-radiation induced apoptosis [149, 152-154]

which implies that this might be an important cell death mechanism involved in the

pronounced tumor growth inhibition we have observed in HeLa Hep2 tumors following

radioimmunotherapy.

In paper IV, an evaluation of the additive effects combining radioimmunotherapy, using 131I

labeled anti-cytokeratin and anti-PLAP antibodies, with conventional radiotherapy was

performed. Each treatment modality (RT, RIT, RT + RIT) exerted tumor growth retardation

when the tumor volumes were followed for 70 days, with the most pronounced effects

obtained in the treatment group receiving the combination of RT and RIT.

Treatment related histological alterations were also studied in tumors from all treatment

groups and revealed drastic effects in the combination treatment group. Following (RT + RIT)

treatment the intratumoral structure was chaotic with a drastic drop in cell density and

increased amounts of connective tissue and cysts. Furthermore morphology of cells in this

treatment group showed a marked deviation from cells in control tumors. An increased

frequency of giant cells and polymorphism in both cytoplasmatic and nuclear size and shape

was observed. Apoptotic cells could be detected in all groups including the control group.

However, in the treatment groups, cells positively stained for apoptosis often showed

cytoplasmatic swelling and an obvious enlargement of the nuclei. Parallel occurrence of

morphological characteristics of necrosis (cellular swelling) and molecular biological features

of apoptosis (M30, TUNEL) can be defined as mitotic catastrophes. A mitotic catastrophe is a

cell death occurring days after exposure to radiation and is a consequence of abnormal mitosis

46

leading to the formation of giant cells with multiple nuclei and/or micronuclei which

sometimes is followed by a delayed type of apoptosis [155-158]. We have earlier reported that

HeLa Hep2 cells exposed to low-dose, low-dose-rate radiation dies in a delayed type of

apoptosis that is initiated approximately three days following treatment and culminates after

one week [153, 154].

Furthermore, in an in vitro study from our group (data not published) we have shown that

ionizing radiation induces centrosome amplification and multipolar mitotic spindles, which

finally yields cells with a number of nuclear abnormalities including one or several

micronuclei, multiple nuclei as well as abnormally shaped multilobulated nuclei, phenomen

which probably is a consequence of cytokinesis failure. This study as well as the observations

from paper IV shows that mitotic catastrophes followed by delayed apoptosis might be

responsible for the significant tumor growth retardation obtained following

radioimmunotherapy of solid HeLa Hep2 tumors.

47

CONCLUSION

• Totally, four soluble-, stable- and active scFv/scdsFv antibody constructs based on the

monoclonal mouse IgG2A (H7) antibody directed against PLAP were created.

• A combination of four aa substitutions in the light chain and one in the heavy chain plus a

prolonged linker increased their solubility and stability. Incorporation of an extra disulphide

bridge between the VL and VH on the other hand did improve neither stability nor solubility,

but resulted in less final amount of yield.

• The affinity of the new antibodies could be maintained almost in the same order of

magnitude (1-2 x 109 M-1) as the original one (H7, 6.7 x 109 M-1).

• The scFv consisting of 30 aa as linker was shown to be the best one in terms of solubility

and synthesis capacity.

• An unique divalent monospecific tandem scFv protein [sc(Fv)2] based on scFv anti-PLAP

was generated which showed slightly higher affinity than the monovalent one. • The [sc(Fv)2] antibody was more sensitive to high temperatures and displayed lower

solubility than the scFv, but was possible to obtain in significant amounts in soluble form.

• Totally, four scFv/scdsFv antibody constructs, one divalent monospecific [sc(Fv)2] and the

intact H7 anti-PLAP were labeled with 125I and tested in nude mice for tumor

immunolocalization. • In vivo scintigrafic evaluation indicated that all antibodies localized to the tumors. • While the intact H7 antibody was visualized several weeks after injection, the scFv

antibodies demonstrated fast detection and clearence (hours).

• The [sc(Fv)2] antibody was superior to all scFv/scdsFv antibodies due to higher

accumulation and slower clearance. • [sc(Fv)2] antibody may have higher potential for practical applications including

immunodiagnosis and therapy due to their size and retention times.

48

• Combination treatment (RT+RIT) causes significant growth retardation in experimental

Hela Hep2 tumours. • Upon (RT+RIT) treatment the intra-tumoral structure is chaotic with a drastic drop in cell

density and increased amounts of connective tissue, cysts.

• By specific staining for morphology (haematoxylin-eosin), Ki67 (proliferation), M30

(apoptosis), TUNEL (apoptosis) and endoglin (vascularisation) it could be concluded that

low dose, low dose rate may induce apoptosis at experimental radioimmunotherapy.

49

ACKNOWLEDGEMENTS

There are a number of honoured people and good freinds whom I would like to express my

sincere gratitude to:

My supervisor Prof. Torgny Stigbrand for giving me the opportunity to conduct research and

the helpful and positive attitude and support. You are not only a brilliant supervisor but also a

patient, reliable and good friend.

My co-supervisor Prof. Katrine Åhlström Riklund for collaborative work with the

scintigraphies.

Prof. Sten Hammarström the head of Immunology department and his wife Prof. Marie-

Louise Hammarström.

Associated professors: Lucia Mincheva-Nilsson, Lennart Johansson, Christina Lejon,

Niklas Arnberg, Ya-Fang Mei, Guang-qian Zhou, Ivor Tittawella, Leif Karlsson, Sun Wai and

her husband Prof. Bernt Eric Uhlin, Prof. Niklas Strömberg, and Prof. Lee Ching NG.

Doctors: Per Sandström, David Eriksson, Niklas Norgren, Vladimir Baranov, Lars

Frängsmyr, Martin Gunnarsson, Anders Ullen, Amanda Johansson, Göte Forsberg, Anders

Olofsson , Per Stenberg and Kjell Eneslätt.

PhD students: Gangwei Ou, Mia Sundström, Lisbeth Ärlestig, Lina Ohlsson and therese

Olsson.

Technical staff: Ann Israelsson, Marianne Sjöstedt, Birgitta Sjöberg, Elisabeth

Granström and Ann-Sofie Hortlund.

Secretary of the department: Lena Hallström-Nylen.

Other good friends at and outside of the department of Immunology: Maria Andersson, Berith

Nilsson and particularly Amanuel Haili.

My family and relatives particularly my nephews Sajad-, Ehsan- and niece Nazanin

Ghezelghani who have supported me from distance.

May God reward all these kind people.

The project in this thesis were supported by Cancerfonden lions foundation in Umeå, Medical

faculty Umeå University and the County of Västerbotten.

50

REFERENCES

1. Ehrlich P. Collected studies on immunity., 1906.

2. Buchsbaum D: Experimental tumor targeting with radiolabeled ligands. Cancer

1997;80:2371-7.

3. Kortt AA, Dolezal O, Power BE and Hudson PJ: Dimeric and trimeric antibodies: high

avidity scFvs for cancer targeting. Biomol Eng 2001;18:95-108.

4. Koppe MJ, Postema EJ, Aarts F, Oyen WJ, Bleichrodt RP and Boerman OC:

Antibody-guided radiation therapy of cancer. Cancer Metastasis Rev 2005;24:539-67.

5. Yokota T, Milenic DE, Whitlow M and Schlom J: Rapid tumor penetration of a

single-chain Fv and comparison with other immunoglobulin forms. Cancer Res

1992;52:3402-8.

6. Volkert WA, Goeckeler WF, Ehrhardt GJ and Ketring AR: Therapeutic radionuclides:

production and decay property considerations. J Nucl Med 1991;32:174-85.

7. Brady L WD, Markoe A, Koprowski H and Miyamoto C.: Monoclonal antibodies in

the diagnosis and treatment of cancer. In: Radiobiology in radiotherapy. Ed, Bleehen

N, Springer-Verlag, Dorchester 1988:233-242.

8. White CA, Weaver RL and Grillo-Lopez AJ: Antibody-targeted immunotherapy for

treatment of malignancy. Annu Rev Med 2001;52:125-45.

9. Millan J. Mamalian alkaline phosphatases, from biology to applications in medicine

and biotechnology., 2006.

10. McComb, R.B., Bowers GN and Posen S. Alkaline phosphatase, 1979.

11. Henthorn PS, Raducha M, Kadesch T, Weiss MJ and Harris H: Sequence and

characterization of the human intestinal alkaline phosphatase gene. J Biol Chem

1988;263:12011-9.

12. Berger J, Garattini E, Hua JC and Udenfriend S: Cloning and sequencing of human

intestinal alkaline phosphatase cDNA. Proc Natl Acad Sci U S A 1987;84:695-8.

13. Kam W, Clauser E, Kim YS, Kan YW and Rutter WJ: Cloning, sequencing, and

chromosomal localization of human term placental alkaline phosphatase cDNA. Proc

Natl Acad Sci U S A 1985;82:8715-9.

14. Millan JL: Molecular cloning and sequence analysis of human placental alkaline

phosphatase. J Biol Chem 1986;261:3112-5.

51

15. Millan JL and Manes T: Seminoma-derived Nagao isozyme is encoded by a germ-cell

alkaline phosphatase gene. Proc Natl Acad Sci U S A 1988;85:3024-8.

16. Le Du MH, Stigbrand T, Taussig MJ, Menez A and Stura EA: Crystal structure of

alkaline phosphatase from human placenta at 1.8 A resolution. Implication for a

substrate specificity. J Biol Chem 2001;276:9158-65.

17. Okamoto T, Seo H, Mano H, Furuhashi M, Goto S, Tomoda Y and Matsui N:

Expression of human placenta alkaline phosphatase in placenta during pregnancy.

Placenta 1990;11:319-27.

18. Lange PH, Millan JL, Stigbrand T, Vessella RL, Ruoslahti E and Fishman WH:

Placental alkaline phosphatase as a tumor marker for seminoma. Cancer Res

1982;42:3244-7.

19. Wahren B, Hinkula J, Stigbrand T, Jeppsson A, Andersson L, Esposti PL, Edsmyr F

and Millan JL: Phenotypes of placental-type alkaline phosphatase in seminoma sera as

defined by monoclonal antibodies. Int J Cancer 1986;37:595-600.

20. Hirano K, Domar UM, Yamamoto H, Brehmer-Andersson EE, Wahren BE and

Stigbrand T: Levels of alkaline phosphatase isozymes in human seminoma tissue.

Cancer Res 1987;47:2543-6.

21. Fishman WH, Inglis NI, Stolbach LL and Krant MJ: A serum alkaline phosphatase

isoenzyme of human neoplastic cell origin. Cancer Res 1968;28:150-4.

22. Dass S and Bagshawe KD: A sensitive, specific radioimmunoassay for placental

alkaline phosphatase. Prog Clin Biol Res 1984;166:49-58.

23. Riklund K, Ullen A, Makiya R, Sundstrom B, Thornell LE and Stigbrand T:

Radioimmunotherapy of HeLa cell tumors in nude mice by a combination of I 131-

labeled monoclonal antibodies against placental alkaline phosphatase and cytokeratin.

Tumor targeting 1995;1:239-244.

24. Kosmas C, Kalofonos HP, Hird V and Epenetos AA: Monoclonal antibody targeting

of ovarian carcinoma. Oncology 1998;55:435-46.

25. Ramaekers FC and Bosman FT: The cytoskeleton and disease. J Pathol 2004;204:351-

4.

26. Guinlan RA, Schiller DL, Hatzfeld M, Achtstatter T, Moll R, Jorcano JL, Magin TM

and Franke WW: Pattern of expression and organization of cytokeratin intermediate

filaments. Ann NY Acad Sci 1985;455:282-306.

27. Klymkowsky MW: Intermediate filaments: new proteins, some answers, more

questions. Curr Opin Cell Biol 1995;7:46-54.

52

28. Johansson A, Sandstrom P, Ullen A, Erlandsson A, Sundstrom B, Ahlstrom KR,

Johansson L, Hietala SO and Stigbrand T: Stability and immunoreactivity of the

monoclonal anticytokeratin antibody TS1 after different degrees of iodination. Acta

Oncol 1999;38:329-34.

29. Rossi Norrlund R, Ullen A, Sandstrom P, Holback D, Johansson L, Stigbrand T,

Hietala SO and Riklund Ahlstrom K: Experimental radioimmunotargeting combining

nonlabeled, iodine-125-labeled, and anti-idiotypic anticytokeratin monoclonal

antibodies: a dosimetric evaluation. Cancer 1997;80:2689-98.

30. Rossi Norrlund R, Ullen A, Sandstrom P, Holback D, Johansson L, Stigbrand T,

Hietala SO and Riklund Ahlstrom K: Dosimetry of fractionated experimental

radioimmunotargeting with idiotypic and anti-idiotypic anticytokeratin antibodies.

Cancer 1997;80:2681-8.

31. Ullen A, Sandstrom P, Rossi Norrlund R, Rathsman S, Johansson L, Riklund

Ahlstrom K, Hietala SO and Stigbrand T: Dosimetry of fractionated administration of

125I-labeled antibody at experimental radioimmunotargeting. Cancer 1997;80:2510-8.

32. Ullen A, Sandstrom P, Ahlstrom KR, Sundstrom B, Nilsson B, Arlestig L and

Stigbrand T: Use of anticytokeratin monoclonal anti-idiotypic antibodies to improve

tumor:nontumor ratio in experimental radioimmunolocalization. Cancer Res

1995;55:5868s-5873s.

33. Riklund KE, Makiya R, Sundstrom B, Back O, Henriksson R, Hietala SO and

Stigbrand T: Inhibition of growth of HeLa cell tumours in nude mice by 125I-labeled

anticytokeratin and antiPLAP monoclonal antibodies. Anticancer Res 1991;11:555-60.

34. Sundstrom B, Johansson B, Hietala SO and Stigbrand T: Radio-immunolocalization in

nude mice using anticytokeratin monoclonal antibodies. Tumour Biol 1990;11:158-66.

35. Nap M, van Wel T, Andres C, Bellanger L, Bodenmuller H, Bonfrer H, Brundell J,

Einarsson R, Erlandsson A, Johansson A, Leca JF, Meier T, Seguin P, Sjodin A,

Stigbrand T, Sundstrom BE, van Dalen A, Wiebelhaus E, Wiklund B and Hilgers J:

Immunohistochemical profiles of 30 monoclonal antibodies against cytokeratins 8, 18

and 19. Second report of the TD5 workshop. Tumour Biol 2001;22:4-10.

36. Stigbrand T, Andres C, Bellanger L, Bishr Omary M, Bodenmuller H, Bonfrer H,

Brundell J, Einarsson R, Erlandsson A, Johansson A, Leca JF, Levi M, Meier T, Nap

M, Nustad K, Seguin P, Sjodin A, Sundstrom B, van Dalen A, Wiebelhaus E, Wiklund

B, Arlestig L and Hilgers J: Epitope specificity of 30 monoclonal antibodies against

cytokeratin antigens: the ISOBM TD5-1 Workshop. Tumour Biol 1998;19:132-52.

53

37. Kohler G and Milstein C: Continuous cultures of fused cells secreting antibody of

predefined specificity. Nature 1975;256:495-7.

38. Newman R, Alberts J, Anderson D, Carner K, Heard C, Norton F, Raab R, Reff M,

Shuey S and Hanna N: "Primatization" of recombinant antibodies for immunotherapy

of human diseases: a macaque/human chimeric antibody against human CD4.

Biotechnology (N Y) 1992;10:1455-60.

39. Maloney DG and Press OW: Newer treatments for non-Hodgkin's lymphoma:

monoclonal antibodies. Oncology (Williston Park) 1998;12:63-76.

40. Illidge TM and Brock S: Radioimmunotherapy of cancer: using monoclonal antibodies

to target radiotherapy. Curr Pharm Des 2000;6:1399-418.

41. Maloney DG, Levy R and Campbell MJ: Monoclonal antibody therapy. In: Mandelson

J, Israel MA, Liotta LA eds. The molecular basis of cancer. W.B. Saunders Company,

London 1995.

42. Sundaram S and Yaramush DM. Monoclonal antibodies and their engineered

fragments., 2000.

43. Begent RH, Verhaar MJ, Chester KA, Casey JL, Green AJ, Napier MP, Hope-Stone

LD, Cushen N, Keep PA, Johnson CJ, Hawkins RE, Hilson AJ and Robson L: Clinical

evidence of efficient tumor targeting based on single-chain Fv antibody selected from

a combinatorial library. Nat Med 1996;2:979-84.

44. Hu S, Shively L, Raubitschek A, Sherman M, Williams LE, Wong JY, Shively JE and

Wu AM: Minibody: A novel engineered anti-carcinoembryonic antigen antibody

fragment (single-chain Fv-CH3) which exhibits rapid, high-level targeting of

xenografts. Cancer Res 1996;56:3055-61.

45. FitzGerald K, Holliger P and Winter G: Improved tumour targeting by disulphide

stabilized diabodies expressed in Pichia pastoris. Protein Eng 1997;10:1221-5.

46. Kontermann RE, Wing MG and Winter G: Complement recruitment using bispecific

diabodies. Nat Biotechnol 1997;15:629-31.

47. Kobayashi H, Han ES, Kim IS, Le N, Rajagopal V, Kreitman RJ, Pastan I, Paik CH

and Carrasquillo JA: Similarities in the biodistribution of iodine-labeled anti-Tac

single-chain disulfide-stabilized Fv fragment and anti-Tac disulfide-stabilized Fv

fragment. Nucl Med Biol 1998;25:387-93.

48. Kabat EA, Wu TT, Perry HM, Gottesman KS and Foeller C. Sequences of proteins of

immunological interest. 5th ed. U.S. Dept. of Health and Human Services, Public

Health Service, National institues of Health. NIH publication. No. 91-3242, 1991.

54

49. Brinkmann U, Reiter Y, Jung SH, Lee B and Pastan I: A recombinant immunotoxin

containing a disulfide-stabilized Fv fragment. Proc Natl Acad Sci U S A

1993;90:7538-42.

50. Potamianos S, Varvarigou AD and Archimandritis SC: Radioimmunoscintigraphy and

radioimmunotherapy in cancer: principles and application. Anticancer Res

2000;20:925-48.

51. Skerra A and Pluckthun A: Assembly of a functional immunoglobulin Fv fragment in

Escherichia coli. Science 1988;240:1038-41.

52. Beresford GW, Pavlinkova G, Booth BJ, Batra SK and Colcher D: Binding

characteristics and tumor targeting of a covalently linked divalent CC49 single-chain

antibody. Int J Cancer 1999;81:911-7.

53. Goel A, Baranowska-Kortylewicz J, Hinrichs SH, Wisecarver J, Pavlinkova G,

Augustine S, Colcher D, Booth BJ and Batra SK: 99mTc-labeled divalent and

tetravalent CC49 single-chain Fv's: novel imaging agents for rapid in vivo localization

of human colon carcinoma. J Nucl Med 2001;42:1519-27.

54. Morrison SL: In vitro antibodies: strategies for production and application. Annu Rev

Immunol 1992;10:239-65.

55. Pluckthun A and Skerra A: Expression of functional antibody Fv and Fab fragments in

Escherichia coli. Methods Enzymol 1989;178:497-515.

56. Winter G: Synthetic human antibodies and a strategy for protein engineering. FEBS

Lett 1998;430:92-4.

57. Huston JS, Levinson D, Mudgett-Hunter M, Tai MS, Novotny J, Margolies MN,

Ridge RJ, Bruccoleri RE, Haber E, Crea R and et al.: Protein engineering of antibody

binding sites: recovery of specific activity in an anti-digoxin single-chain Fv analogue

produced in Escherichia coli. Proc Natl Acad Sci U S A 1988;85:5879-83.

58. Bird RE, Hardman KD, Jacobson JW, Johnson S, Kaufman BM, Lee SM, Lee T, Pope

SH, Riordan GS and Whitlow M: Single-chain antigen-binding proteins. Science

1988;242:423-6.

59. Huston JS, Mudgett-Hunter M, Tai MS, McCartney J, Warren F, Haber E and

Oppermann H: Protein engineering of single-chain Fv analogs and fusion proteins.

Methods Enzymol 1991;203:46-88.

60. Whitlow M aFD: Single-chain Fv proteins and their fusion proteins. Methods: A

companion to Methods Enzymol. 1991;2:97-105.

55

61. Adams GP and Schier R: Generating improved single-chain Fv molecules for tumor

targeting. J Immunol Methods 1999;231:249-60.

62. Kipriyanov SM, Moldenhauer G and Little M: High level production of soluble single

chain antibodies in small-scale Escherichia coli cultures. J Immunol Methods

1997;200:69-77.

63. Ramm K, Gehrig P and Pluckthun A: Removal of the conserved disulfide bridges

from the scFv fragment of an antibody: effects on folding kinetics and aggregation. J

Mol Biol 1999;290:535-46.

64. Nieba L, Honegger A, Krebber C and Pluckthun A: Disrupting the hydrophobic

patches at the antibody variable/constant domain interface: improved in vivo folding

and physical characterization of an engineered scFv fragment. Protein Eng

1997;10:435-44.

65. Arndt KM, Muller KM and Pluckthun A: Factors influencing the dimer to monomer

transition of an antibody single-chain Fv fragment. Biochemistry 1998;37:12918-26.

66. Pluckthun A, Krebber A, Krebber C, Horn O, Knuper O, Wenderoth R, Nieba L,

Proba K and Riesenberg D: Producing antibodies in Escherichia coil: from PCR to

fermentation. In Antibody engineering, McCfferty J, Hoogenboom HR and Chiswell

DJ (Eds). IRL Press, Oxford. 1996:203-252.

67. Whitlow M and Filpula D: Single-chain Fv proteins and their fusion proteins.

Methods: A companion to Methods Enzymol. 1991;2:97-105.

68. Raag R and Whitlow M: Single-chain Fvs. FASEB J 1995;9:73-80.

69. Brinkmann U, Di Carlo A, Vasmatzis G, Kurochkina N, Beers R, Lee B and Pastan I:

Stabilization of a recombinant Fv fragment by base-loop interconnection and V(H)-

V(L) permutation. J Mol Biol 1997;268:107-17.

70. Smith DB and Johnson KS: Single-step purification of polypeptides expressed in

Escherichia coli as fusions with glutathione S-transferase. Gene 1988;67:31-40.

71. Butt TR, Jonnalagadda S, Monia BP, Sternberg EJ, Marsh JA, Stadel JM, Ecker DJ

and Crooke ST: Ubiquitin fusion augments the yield of cloned gene products in

Escherichia coli. Proc Natl Acad Sci U S A 1989;86:2540-4.

72. LaVallie ER, DiBlasio EA, Kovacic S, Grant KL, Schendel PF and McCoy JM: A

thioredoxin gene fusion expression system that circumvents inclusion body formation

in the E. coli cytoplasm. Biotechnology (N Y) 1993;11:187-93.

73. Baneyx F: Recombinant protein expression in Escherichia coli. Curr Opin Biotechnol

1999;10:411-21.

56

74. Chowdhury PS, Vasmatzis G, Beers R, Lee B and Pastan I: Improved stability and

yield of a Fv-toxin fusion protein by computer design and protein engineering of the

Fv. J Mol Biol 1998;281:917-28.

75. Pavlinkova G, Beresford GW, Booth BJ, Batra SK and Colcher D: Pharmacokinetics

and biodistribution of engineered single-chain antibody constructs of MAb CC49 in

colon carcinoma xenografts. J Nucl Med 1999;40:1536-46.

76. Holliger P, Prospero T and Winter G: "Diabodies": small bivalent and bispecific

antibody fragments. Proc Natl Acad Sci U S A 1993;90:6444-8.

77. Adams GP, McCartney JE, Tai MS, Oppermann H, Huston JS, Stafford WF, 3rd,

Bookman MA, Fand I, Houston LL and Weiner LM: Highly specific in vivo tumor

targeting by monovalent and divalent forms of 741F8 anti-c-erbB-2 single-chain Fv.

Cancer Res 1993;53:4026-34.

78. Huston JS, Adams GP, McCartney JE, Tai MS, Hudziak RM, Oppermann H, Stafford

WF, Liu S, Fand I and Apell G: Tumor targeting in a murine tumor xenograft model

with the (sFv')2 divalent form of anti-c-erbB-2 single-chain Fv. Cell Biophys 1994;24-

25:267-78.

79. Kortt AA, Lah M, Oddie GW, Gruen CL, Burns JE, Pearce LA, Atwell JL, McCoy

AJ, Howlett GJ, Metzger DW, Webster RG and Hudson PJ: Single-chain Fv fragments

of anti-neuraminidase antibody NC10 containing five- and ten-residue linkers form

dimers and with zero-residue linker a trimer. Protein Eng 1997;10:423-33.

80. Maloney DG, Donovan K and Hamblin TJ: Antibody therapy for treatment of multiple

myeloma. Semin Hematol 1999;36:30-3.

81. Carlsson J, Forssell Aronsson E, Hietala S, Stigbrand T and Tennvall J: Tumour

therapy with radionuclides: assessment of progress and problems. Radiother Oncol

2003;66:107-17.

82. Milenic DE and Brechbiel MW: Targeting of radio-isotopes for cancer therapy.

Cancer Biol Ther 2004;3:361-70.

83. Srivastava S and Dadachova E: Recent advances in radionuclide therapy. Semin Nucl

Med 2001;31:330-41.

84. Hall E: Radiobiology for the radiologist. J. B. Lippincott Co, Philadelphia 1993;4th

edition:1-478.

85. Buchsbaum D and Wessels B: Radiolabeled antibody tumor dosimetry. In: Cancer

therapy with radiolabeled antibodies. Goldenberg D, ED, CRC Press, Boca-Raton, FL

1995:21-31.

57

86. De Jong M BHF, Breeman W A, Krenning E P.: Comparison of tumor response after

radionuclide therapy using somatostatin analogues radiolabelled with various

radionuclides. Eur Nucl Med 2003;30.

87. Jain RK: Barriers to drug delivery in solid tumors. Sci Am 1994;271:58-65.

88. Jain RK: Delivery of molecular medicine to solid tumors. Science 1996;271:1079-80.

89. Schrama D, Reisfeld RA and Becker JC: Antibody targeted drugs as cancer

therapeutics. Nat Rev Drug Discov 2006;5:147-59.

90. Milenic DE, Brady ED and Brechbiel MW: Antibody-targeted radiation cancer

therapy. Nat Rev Drug Discov 2004;3:488-99.

91. Wu AM and Senter PD: Arming antibodies: prospects and challenges for

immunoconjugates. Nat Biotechnol 2005;23:1137-46.

92. Carter P: Improving the efficacy of antibody-based cancer therapies. Nat Rev Cancer

2001;1:118-29.

93. Kim JA: Targeted therapies for the treatment of cancer. Am J Surg 2003;186:264-8.

94. Souhami ea. Oxford textbook of oncology 2nd edition, Oxford university press.,

2002.

95. Price and Sikora A. Treatment of cancer 4th edition., 2002.

96. Multani PS and Grossbard ML: Monoclonal antibody-based therapies for hematologic

malignancies. J Clin Oncol 1998;16:3691-710.

97. Adams GP and Weiner LM: Monoclonal antibody therapy of cancer. Nat Biotechnol

2005;23:1147-57.

98. Reff ME, Carner K, Chambers KS, Chinn PC, Leonard JE, Raab R, Newman RA,

Hanna N and Anderson DR: Depletion of B cells in vivo by a chimeric mouse human

monoclonal antibody to CD20. Blood 1994;83:435-45.

99. Piro L WC, Grillo-Lopez A and et al.:: Rituxan (rituximab, IDEC-C2B8): interim

analysis of a phase II study of once weekly times 8 dosing in patients with relapsed

low-grade or follicular non-Hodgkin' s lymphoma. Blood 1997;90, 510a.

100. Davis T WC, Grillo-Lopez A et al.: Rituximab: first report of a phase II (PII) trial in

NHL patients (pts) with bulky disease. Blood 1998;92:414a.

101. Czuczman M G-LA, White C et al.: Rituximab/CHOP chemoimmunotherapy in

patients (pst) with low grade lymphoma (LG/F NHL): progression free survival (PFS)

after three years (median) follow up. Blood 1999;94: 10 (Suppl. 1, part 2, Abstr.).

102. Czuczman MS: CHOP plus rituximab chemoimmunotherapy of indolent B-cell

lymphoma. Semin Oncol 1999;26:88-96.

58

103. Hudziak RM, Lewis GD, Winget M, Fendly BM, Shepard HM and Ullrich A:

p185HER2 monoclonal antibody has antiproliferative effects in vitro and sensitizes

human breast tumor cells to tumor necrosis factor. Mol Cell Biol 1989;9:1165-72.

104. Slamon DJ, Clark GM, Wong SG, Levin WJ, Ullrich A and McGuire WL: Human

breast cancer: correlation of relapse and survival with amplification of the HER-2/neu

oncogene. Science 1987;235:177-82.

105. Carter P, Presta L, Gorman CM, Ridgway JB, Henner D, Wong WL, Rowland AM,

Kotts C, Carver ME and Shepard HM: Humanization of an anti-p185HER2 antibody

for human cancer therapy. Proc Natl Acad Sci U S A 1992;89:4285-9.

106. Breedveld FC: Therapeutic monoclonal antibodies. Lancet 2000;355:735-40.

107. Ludwig DL, Pereira DS, Zhu Z, Hicklin DJ and Bohlen P: Monoclonal antibody

therapeutics and apoptosis. Oncogene 2003;22:9097-106.

108. Kreitman RJ, Wilson WH, Robbins D, Margulies I, Stetler-Stevenson M, Waldmann

TA and Pastan I: Responses in refractory hairy cell leukemia to a recombinant

immunotoxin. Blood 1999;94:3340-8.

109. Steplewski Z, Lubeck MD and Koprowski H: Human macrophages armed with

murine immunoglobulin G2a antibodies to tumors destroy human cancer cells. Science

1983;221:865-7.

110. Riethmuller G, Holz E, Schlimok G, Schmiegel W, Raab R, Hoffken K, Gruber R,

Funke I, Pichlmaier H, Hirche H, Buggisch P, Witte J and Pichlmayr R: Monoclonal

antibody therapy for resected Dukes' C colorectal cancer: seven-year outcome of a

multicenter randomized trial. J Clin Oncol 1998;16:1788-94.

111. Kreitman R: Immunotoxins in cancer therapy. Curr Opin Immunol 1999;11:570-8.

112. Hoogenboom HR, Volckaert G and Raus JC: Construction and expression of

antibody-tumor necrosis factor fusion proteins. Mol Immunol 1991;28:1027-37.

113. Sausville EA and Burger AM: Contributions of human tumor xenografts to anticancer

drug development. Cancer Res 2006;66:3351-4, discussion 3354.

114. Becher OJ and Holland EC: Genetically engineered models have advantages over

xenografts for preclinical studies. Cancer Res 2006;66:3355-8, discussion 3358-9.

115. Taghian AG and Suit HD: Animal systems for translational research in radiation

oncology. Acta Oncol 1999;38:829-38.

116. Johansson A: Improving radiopimmunotargeting. Umeå university, Medical

dissertations. Umeå University, Umeå, Sweden. 2000.

59

117. Wahl RL: Experimental radioimmunotherapy. A brief overview. Cancer 1994;73:989-

92.

118. Sundstrom BE, Nathrath WB and Stigbrand T: Diversity in immunoreactivity of

tumor-derived cytokeratin monoclonal antibodies. J Histochem Cytochem

1989;37:1845-54.

119. Riklund KE, Makiya RA, Sundstrom BE, Thornell LE and Stigbrand TI: Experimental

radioimmunotherapy of HeLa tumours in nude mice with 131I-labeled monoclonal

antibodies. Anticancer Res 1990;10:379-84.

120. Millan JL and Stigbrand T: Antigenic determinants of human placental and testicular

placental-like alkaline phosphatases as mapped by monoclonal antibodies. Eur J

Biochem 1983;136:1-7.

121. Stigbrand T, Hietala SO, Johansson B, Makiya R, Riklund K and Ekelund L: Tumour

radioimmunolocalization in nude mice by use of antiplacental alkaline phosphatase

monoclonal antibodies. Tumour Biol 1989;10:243-51.

122. Riklund KE, Edbom G, Makiya R, Johansson B, Gerdes U, Hietala SO, Ekelund L,

Stigbrand T and Stendahl U: Radioimmunoscintigraphy of gynecologic tumors with

131I-labeled anti-PLAP monoclonal antibodies. Acta Radiol 1991;32:375-80.

123. Ullen A, Nilsson B, Ahlstrom KR, Makiya R and Stigbrand T: In vivo and in vitro

interactions between idiotypic and antiidiotypic monoclonal antibodies against

placental alkaline phosphatase. J Immunol Methods 1995;183:155-65.

124. Greenwood FC, Hunter WM and Glover JS: The preparation of I-131-Labelled human

growth hormone of high specific radioactivity. Biochem J 1963;89:114-23.

125. Orlandi R, Gussow DH, Jones PT and Winter G: Cloning immunoglobulin variable

domains for expression by the polymerase chain reaction. Proc Natl Acad Sci U S A

1989;86:3833-7.

126. Marchuk D, Drumm M, Saulino A and Collins FS: Construction of T-vectors, a rapid

and general system for direct cloning of unmodified PCR products. Nucleic Acids Res

1991;19:1154.

127. Bowden GA and Georgiou G: Folding and aggregation of beta-lactamase in the

periplasmic space of Escherichia coli. J Biol Chem 1990;265:16760-6.

128. Reiter Y, Brinkmann U, Lee B and Pastan I: Engineering antibody Fv fragments for

cancer detection and therapy: disulfide-stabilized Fv fragments. Nat Biotechnol

1996;14:1239-45.

60

129. Harper DM, Franco EL, Wheeler CM, Moscicki AB, Romanowski B, Roteli-Martins

CM, Jenkins D, Schuind A, Costa Clemens SA and Dubin G: Sustained efficacy up to

4.5 years of a bivalent L1 virus-like particle vaccine against human papillomavirus

types 16 and 18: follow-up from a randomised control trial. Lancet 2006;367:1247-55.

130. Kuehn BM: CDC panel backs routine HPV vaccination. Jama 2006;296:640-1.

131. Lazar GA, Dang W, Karki S, Vafa O, Peng JS, Hyun L, Chan C, Chung HS, Eivazi A,

Yoder SC, Vielmetter J, Carmichael DF, Hayes RJ and Dahiyat BI: Engineered

antibody Fc variants with enhanced effector function. Proc Natl Acad Sci U S A

2006;103:4005-10.

132. Adams GP, Tai MS, McCartney JE, Marks JD, Stafford WF, 3rd, Houston LL, Huston

JS and Weiner LM: Avidity-mediated enhancement of in vivo tumor targeting by

single-chain Fv dimers. Clin Cancer Res 2006;12:1599-605.

133. Holliger P and Hudson PJ: Engineered antibody fragments and the rise of single

domains. Nat Biotechnol 2005;23:1126-36.

134. Souriau C and Hudson PJ: Recombinant antibodies for cancer diagnosis and therapy.

Expert Opin Biol Ther 2003;3:305-18.

135. Stockwin LH and Holmes S: Antibodies as therapeutic agents: vive la renaissance!

Expert Opin Biol Ther 2003;3:1133-52.

136. Liu Y, Zhang W, Cheung LH, Niu T, Wu Q, Li C, Van Pelt CS and Rosenblum MG:

The antimelanoma immunocytokine scFvMEL/TNF shows reduced toxicity and

potent antitumor activity against human tumor xenografts. Neoplasia 2006;8:384-93.

137. Liu Y, Zhang W, Niu T, Cheung LH, Munshi A, Meyn RE, Jr. and Rosenblum MG:

Targeted apoptosis activation with GrB/scFvMEL modulates melanoma growth,

metastatic spread, chemosensitivity, and radiosensitivity. Neoplasia 2006;8:125-35.

138. Bremer E, Samplonius DF, Peipp M, van Genne L, Kroesen BJ, Fey GH, Gramatzki

M, de Leij LF and Helfrich W: Target cell-restricted apoptosis induction of acute

leukemic T cells by a recombinant tumor necrosis factor-related apoptosis-inducing

ligand fusion protein with specificity for human CD7. Cancer Res 2005;65:3380-8.

139. Bremer E, Samplonius DF, van Genne L, Dijkstra MH, Kroesen BJ, de Leij LF and

Helfrich W: Simultaneous inhibition of epidermal growth factor receptor (EGFR)

signaling and enhanced activation of tumor necrosis factor-related apoptosis-inducing

ligand (TRAIL) receptor-mediated apoptosis induction by an scFv:sTRAIL fusion

protein with specificity for human EGFR. J Biol Chem 2005;280:10025-33.

61

140. Reiter Y and Pastan I: Recombinant Fv immunotoxins and Fv fragments as novel

agents for cancer therapy and diagnosis. Trends Biotechnol 1998;16:513-20.

141. Goel A, Beresford GW, Colcher D, Pavlinkova G, Booth BJ, Baranowska-

Kortylewicz J and Batra SK: Divalent forms of CC49 single-chain antibody constructs

in Pichia pastoris: expression, purification, and characterization. J Biochem (Tokyo)

2000;127:829-36.

142. Nguyen H, Hay J, Gallinger S, Sandhu J and Hozumi N: Isolation of human single

chain antibodies (scFv) against human TNF-alpha from human peripheral blood

lymphocyte-SCID mice. Hum Antibodies 2002;11:65-72.

143. Hernandez MC and Knox SJ: Radiobiology of radioimmunotherapy: targeting CD20

B-cell antigen in non-Hodgkin's lymphoma. Int J Radiat Oncol Biol Phys

2004;59:1274-87.

144. Prise KM, Schettino G, Folkard M and Held KD: New insights on cell death from

radiation exposure. Lancet Oncol 2005;6:520-8.

145. Mothersill C and Seymour CB: Radiation-induced bystander effects and the DNA

paradigm: an "out of field" perspective. Mutat Res 2006;597:5-10.

146. Wright EG and Coates PJ: Untargeted effects of ionizing radiation: implications for

radiation pathology. Mutat Res 2006;597:119-32.

147. Szumiel I: Ionizing radiation-induced cell death. Int J Radiat Biol 1994;66:329-41.

148. Jonathan EC, Bernhard EJ and McKenna WG: How does radiation kill cells? Curr

Opin Chem Biol 1999;3:77-83.

149. Macklis RM, Beresford BA and Humm JL: Radiobiologic studies of low-dose-rate

90Y-lymphoma therapy. Cancer 1994;73:966-73.

150. Rupnow BA, Murtha AD, Alarcon RM, Giaccia AJ and Knox SJ: Direct evidence that

apoptosis enhances tumor responses to fractionated radiotherapy. Cancer Res

1998;58:1779-84.

151. Kroger LA, DeNardo GL, Gumerlock PH, Xiong CY, Winthrop MD, Shi XB, Mack

PC, Leshchinsky T and DeNardo SJ: Apoptosis-related gene and protein expression in

human lymphoma xenografts (Raji) after low dose rate radiation using 67Cu-2IT-

BAT-Lym-1 radioimmunotherapy. Cancer Biother Radiopharm 2001;16:213-25.

152. Knox SJ, Levy R, Miller RA, Uhland W, Schiele J, Ruehl W, Finston R, Day-Lollini P

and Goris ML: Determinants of the antitumor effect of radiolabeled monoclonal

antibodies. Cancer Res 1990;50:4935-40.

62

153. Mirzaie-Joniani H, Eriksson D, Johansson A, Lofroth PO, Johansson L, Ahlstrom KR

and Stigbrand T: Apoptosis in HeLa Hep2 cells is induced by low-dose, low-dose-rate

radiation. Radiat Res 2002;158:634-40.

154. Mirzaie-Joniani H, Eriksson D, Sheikholvaezin A, Johansson A, Lofroth PO,

Johansson L and Stigbrand T: Apoptosis induced by low-dose and low-dose-rate

radiation. Cancer 2002;94:1210-4.

155. Jin Z and El-Deiry WS: Overview of cell death signaling pathways. Cancer Biol Ther

2005;4:139-63.

156. Abend M: Reasons to reconsider the significance of apoptosis for cancer therapy. Int J

Radiat Biol 2003;79:927-41.

157. Castedo M, Perfettini JL, Roumier T, Andreau K, Medema R and Kroemer G: Cell

death by mitotic catastrophe: a molecular definition. Oncogene 2004;23:2825-37.

158. Castedo M, Perfettini JL, Roumier T, Valent A, Raslova H, Yakushijin K, Horne D,

Feunteun J, Lenoir G, Medema R, Vainchenker W and Kroemer G: Mitotic

catastrophe constitutes a special case of apoptosis whose suppression entails

aneuploidy. Oncogene 2004;23:4362-70.