received date : 08-sep-2015 revised date : 26-nov … toxins and microbial cell wall components lps...

Acc

epte

d A

rtic

le

This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/ina.12282

This article is protected by copyright. All rights reserved.

Received Date : 08-Sep-2015

Revised Date : 26-Nov-2015

Accepted Date : 18-Jan-2016

Article type : Original Article

Synergistic proinflammatory interactions of microbial toxins and

structural components characteristic to moisture-damaged buildings

Merja Korkalainen1*, Martin Täubel1, Jonne Naarala2, Pirkka Kirjavainen1, Arto Koistinen3,

Anne Hyvärinen1, Hannu Komulainen1, Matti Viluksela1,2

1National Institute for Health and Welfare, Department of Health Protection, P.O. Box 95,

70701 Kuopio, Finland

2Department of Environmental Science, University of Eastern Finland, P.O. Box 1627, 70211

Kuopio, Finland

3SIB Labs, University of Eastern Finland, P.O. Box 1627, 70211 Kuopio, Finland

* Corresponding author: Merja Korkalainen, P.O. Box 95, FIN-70701 Kuopio, Finland, email

[email protected], phone +358295246318

Running title: Synergistic interactions of microbial agents

Acc

epte

d A

rtic

le

This article is protected by copyright. All rights reserved.2

Abstract

Indoor exposure to microbes and their structural and metabolic compounds is notoriously

complex. In order to study proinflammatory interactions between the multiple microbial

agents, macrophages derived from human THP-1 monocytic cells were exposed to several

concentrations of microbial toxins alone (emodin, enniatin B, physcion, sterigmatocystin,

valinomycin) and in combination with microbial structural components (bacterial

lipopolysaccharide [LPS] or fungal β-glucan). While the expression of proinflammatory

cytokines TNFα and IL-1β to single toxins alone were modest, low-dose co-exposure with

structural components increased the responses of emodin, enniatin B and valinomycin

synergistically, both at the mRNA and protein level, as measured by RT-qPCR and ELISA

assay, respectively. Co-exposure of toxins and β-glucan resulted in consistent synergistically

increased expression of several inflammation-related genes, while some of the responses with

LPS were also inhibitory. Co-exposure of toxins with either β-glucan or LPS induced also

mitochondrial damage and autophagocytosis. The results demonstrate that microbial toxins

together with bacterial and fungal structural components characteristic to moisture-damaged

buildings can have drastic synergistic pro-inflammatory interactions at low exposure levels.

Key words: microbial toxins, LPS, β-glucan, proinflammatory cytokines, co-exposure,

synergistic interaction

Practical implications

In this study, we evaluated joint effects between indoor microbial toxins and structural

components of bacteria and fungi commonly found in moisture damaged buildings, using

human macrophages. We show here that microbial toxins can potentiate the inflammatory

effects of structural components at very low exposure levels drastically increasing the

Acc

epte

d A

rtic

le


severity of proinflammatory responses. Co-effects are accompanied by morphological

alterations indicative of mitochondrial damage and autophagy related activation pathways.

The synergistic nature of interactions may help in understanding the adverse health effects

observed in occupants of moisture-damaged buildings.

Introduction

Microbial toxins are secondary metabolites produced by fungi and bacteria with

known or assumed toxic effects on human or animal cellular systems. Both microbes and

their secondary metabolites are ubiquitously present in indoor environments. In moisture-

damaged spaces, their amounts and numbers appear to be increased (Kirjavainen et al. 2015;

Miller and McMullin 2014; Nevalainen et al. 2015; Peitzsch et al. 2012; Täubel et al. 2011;

Täubel and Hyvärinen 2015). Exposure to indoor dampness and moisture damage is

associated with airway and systemic inflammation, exacerbation and development of asthma,

various respiratory symptoms and repeating infections (Kanchongkittiphon et al., 2015;

Mendell et al., 2011; World Health Organization, 2009). While indoor dampness and mold

related microbial exposure is assumed to be a key factor in adverse health outcomes of

occupants, the causative components and the mechanisms are not known.

Microbial toxins are typically stable, non-volatile and highly bioactive compounds

that may, depending on their chemical structure, have cytotoxic, inflammatory,

immunosuppressive and carcinogenic effects (Bennett and Klich, 2003; Council for

Agricultural Science and Technology, 2003). They act via a variety of different mechanisms,

which are better understood for ingestion exposure, but largely unknown for chronic, low

level inhalation exposure scenarios. In moisture-damaged indoor environments, microbial

toxins do not occur as individual compounds, but are present with a variety of fungi and

bacteria, their spores, cell wall components and cell fragments together with allergenic

Acc

epte

d A

rtic

le


proteins and volatile organic compounds (Nevalainen et al., 2015). Toxicological interactions

between different microbial agents are likely (Huttunen et al., 2004; Murtoniemi et al., 2005;

Penttinen et al., 2005), but poorly characterized. Especially microbial cell wall components,

such as the fungal polysaccharide β-glucan and bacterial lipopolysaccharide (LPS), are

ubiquitous and potent inducers of inflammatory responses. Some synergistic interactions

between trichothecene mycotoxins and LPS have been shown in human macrophages

(Kankkunen et al., 2009; Kankkunen et al., 2014) and mouse nasal airways (Islam et al.,

2007).

The majority of indoor mycotoxin studies have so far focused on macrocyclic

trichothecenes, especially satratoxins following initial observations on their presence in

severely moisture- and mold-damaged buildings where occupants suffered from severe and

sometimes fatal health outcomes (Dearborn et al., 1999; Etzel et al., 1998; Flappan et al.,

1999; Jarvis et al., 1998; Johanning et al., 1996). Macrocyclic trichothecenes are not,

however, highly common in building materials or floor dust of moisture-damaged schools or

homes in Europe (Huttunen et al., 2015; Kirjavainen et al., 2015; Peitzsch et al., 2012; Täubel

et al., 2011). Based on recent studies that have targeted multiple microbial toxins rather than

a few selected compounds of primary toxicological interest, the variety of compounds with

potential health implications is impressive (Kirjavainen et al., 2015; Peitzsch et al., 2012;

Täubel et al., 2011). At present it is not well established, what is their potential for

toxicological interactions, and what is their relevance to occupant health.

The objective of this study was to evaluate interactions between common indoor

microbial toxins and microbial cell wall components LPS and β-glucan. Our hypothesis was

that the structural components modulate the effects of toxins, or vice versa, on

proinflammatory responses, namely on the expression of proinflammatory cytokines TNFα

and IL-1β, which both play a central role in mold-induced adverse health effects (Kankkunen

Acc

epte

d A

rtic

le


et al., 2009; Pestka and Zhou, 2006). For this purpose, we studied the effects of five

structurally different microbial toxins on inflammatory response and cell morphology of

human macrophages in vitro. Macrophages were chosen as they are responsible for the first

line protection and triggering the inflammatory response through secretion of signalling

molecules. THP-1 cells used in this study have become one of most widely used cell line to

investigate immune responses. After differentiation to monocyte-derived macrophages, they

show similarities to those of peripheral blood mononuclear cells (Chanput et al., 2014). The

selected fungal toxins are commonly detected in dust samples of moisture damaged buildings

(Kirjavainen et al., 2015; Peitzsch et al., 2012; Täubel et al., 2011). Emodin, enniatin B,

sterigmatocystin and physcion are fungal mycotoxins, while valinomycin is predominantly

produced by Streptomycetes bacteria. Both valinomycin and enniatin B belong to

cyclohexadepsipeptide mycotoxins and function as ionophores by transporting monovalent

ions across the cellular membranes (Kamyar et al., 2004; Paananen et al., 2000; Tonshin et

al., 2010). Emodin and physcion are naturally occurring anthraquinones, produced not only

by fungi but also by some plants, and sterigmatocystin is a polyketide mycotoxin structurally

related to aflatoxin B1 (Nielsen, 2003).

Materials and methods

Chemicals

All microbial toxins were purchased from Sigma-Aldrich (≥90% pure) and were

dissolved in dimethyl sulfoxide (DMSO). Also LPS (lipopolysaccharides from Escherichia

coli 0111:B4) and, β-D-glucan hydrate (curdlan from Alcaligenes faecalis), were obtained

from Sigma-Aldrich. β-glucan was first diluted in 0.05 M NaOH to prepare a stock solution

of 10 mg/ml and after that serial dilutions were prepared in phosphate buffered saline (PBS).

Serial dilutions of LPS were prepared from a ready-made solution 1 mg/ml in cell culture

Acc

epte

d A

rtic

le


medium. Media, serum and other products for cell culturing were supplied by Gibco

(Invitrogen, Paisley, UK).

Cell culture and treatments

Human acute monocytic leukemia cells (THP-1) were purchased from American

Type Culture Collection and differentiated into macrophages with phorbol 12-myristate 13-

acetate (PMA, Sigma-Aldrich). The cells were grown in RPMI medium supplemented with

10% Fetal Bovine Serum, 2 mM L-glutamine, 0.05 mM 2-mercaptoethanol, 100 U/ml

penicillin and 100 µg/ml streptomycin at 37°C in a humidified atmosphere of 5% CO2 in air.

The cells were grown in suspension and the density was kept between 200 000 – 800 000

cells/ml by performing routine cell counts. The cells turned adherent after 48-hours

differentiation with 50 nM PMA.

For the gene expression and cytokine analysis, cells were plated on 6-well plates, 1.6

million cells per well. Differentiation was started by adding 50 nM PMA in the cell culture

medium and replacing the fresh PMA-medium on the next day. After 48 h, the differentiation

medium was replaced with exposure medium. Exposure medium contained single toxins,

combinations of toxins and β-glucan and/or LPS or DMSO vehicle only, so that the final

concentration of DMSO was only 0.1%. At the end of the exposure, medium was removed

and cells were harvested for gene expression analyses or cell morphology studies, or the

medium was stored for cytokine analyses.

Cell viability assay

For the proliferation test, cells were grown on 96-well plates. Cell proliferation was

determined by colorimetric assay using Cell Proliferation Reagent WST-1 (Roche,

Mannheim, Germany). First, medium was removed and WST-1 reagent added to wells. Cells

Acc

epte

d A

rtic

le


were incubated for 1 h. After shaking the cell plate for 1 min, the absorbance of the samples

was measured using a plate reader at 450 nm (EnSpire, Perkin Elmer, Waltham, MA, USA).

RT-qPCR

RNA was isolated from the pelleted cells and after determining its concentration,

purity and intergrity, generated into cDNA and used as a template for quantitative PCR as

described earlier (Koskela et al., 2012). The expression levels of proinflammatory cytokines

as well as reference gene GAPDH were analyzed using following primers: TNFα (NM-

000594), tgcccctccacccatgtgct and cagccccctctggggtctcc; IL-1β (NM-000576),

tcgccagtgaaatgatggct and ggtcggagattcgtagctgg; GAPDH (NM-002046)

cgcatcttcttttgcgtcgcca and ccacgacgtactcagcgccag together with Power SYBR Green PCR

Master Mix and Applied Biosystems 7000 Real-Time PCR System (Applied Biosystems,

Foster City, CA, USA) according to manufacturer’s protocol. Dissociation curves were run to

confirm the absence of non-specific amplification. Standard curves were generated using

isolated and purified PCR products produced with the same primers. Negative controls were

included in each run. The expression levels were related to mRNA concentrations of

housekeeping gene GAPDH to normalize the amount of cDNA in PCR reactions.

PCR arrays

RNA was isolated using RNeasy Mini Kit and RNAse free DNase (Qiagen, Hilden,

Germany). The concentration of RNA was determined using Nano Drop (Thermo Scientific,

Wilmington, DE, USA). 1 µg of RNA was generated into cDNA using RT2 First Strand Kit

(Qiagen). cDNA samples were mixed with RT2 qPCR Master Mix (Qiagen) and distributed

in every well on PCR array plate (Human Inflammatory Cytokines & Receptors by Qiagen).

This PCR Array profiled the expression of 84 key genes mediating inflammatory response,

Acc

epte

d A

rtic

le


such as chemokines, cytokines, and interleukins involved as well as their receptors. The array

also contained controls for RT reaction and PCR reaction as well as a genomic DNA control.

Applied Biosystems 7000 Real-Time PCR System was used to determine Ct-values of each

well according to the manufacturer’s protocol. The fold-changes in Ct-values were calculated

using SABiosciences’ web-based data analysis program

(www.SABiosciences.com/pcrarraydataanalysis.php).

Cytokine ELISA

The secretion of TNFα and Il-1β into the cell culture medium was determined using

commercial kits Human TNFα and IL-1β DuoSet ELISA Development System combined

with Ancillary Reagent Kit (R&D Systems, Minneapolis, USA) according to the

manufacturer’s instructions.

Cell morphology studies

For the electron microscopic examination, the cells were firstly fixed with 2.5%

glutaraldehyde (Electron Microscopy Sciences) prepared in 0.1 M PBS for 2 h at RT.

Samples for scanning electron microscope (SEM) were dehydrated through ascending series

of ethanol: 50%, 60%, 70%, 80%, 90%, 94% and absolute ethanol followed by

hexamethyldisilane (HDMS). The coverslips were then air-dried and mounted on aluminum

stub, and coated with a thin layer of gold. Samples were examined and imaged with Zeiss

Sigma HD VP scanning electron microscope (Carl Zeiss Microscopy Ltd, Cambridge, UK).

After pre-fixation, the samples for transmission electron microscope (TEM) were postfixed

with 1% osmium tetroxide in 0.1 M PBS for 1h at RT and dehydrated through ascending

series of ethanol: 70%, 90%, 94% and absolute ethanol. The samples were then infiltrated in

epoxy resin for 2 h at RT, and polymerized for 24 h in 37°C followed by 48 h at 60°C. Thin

Acc

epte

d A

rtic

le


sections were cut using Ultracut UC ultramicrotome (Leica Microsystems, Wien, Austria)

and stained routinely with uranyl acetate and lead citrate. Samples were examined and

imaged with JEM-2100F transmission electron microscope operated at 200 kV (Jeol Ltd,

Tokyo, Japan).

Bench mark dose modelling, statistics and analysis of interactions

Dose responses were analyzed using the benchmark dose (BMD) method, PROAST

version 38.9 in R software (Slob, 2002). Based on the likelihood ratio test, the best fitted

models were selected among the exponential and the Hill model families. Benchmark doses

(critical effect dose) and their lower and upper 95%-confidence bounds were calculated at a

50% change in response compared with unexposed control.

Statistical analysis was performed by the ANOVA followed by the Least Significant

Difference test (IMB SPSS Statistics 22). In the case of nonhomogenous variances, the

Mann-Whitney U test was used. The limit of statistical significance was set at p < 0.05.

The interaction after co-exposure was considered synergistic, when the ratio of

measured co-response to the sum of individual responses to toxins and β-glucan or LPS was

more than 1. If this ratio was about 1, the interaction was additive, while ratios below 1 meant

antagonistic interaction.

Results

Comparison of cytotoxic and inflammatory responses

Since potencies and toxicity profiles of the selected microbial toxins were not

known, dose-responses and time trends were first determined separately for each toxin, LPS

and β-glucan. The strongest increase in mRNA expression of proinflammatory cytokines

TNFα and IL-1β was observed at 3 or 6 h for most toxins and at 3 h for both β-glucan and

Acc

epte

d A

rtic

le


LPS (data not shown). The following time points were selected for further studies: 3 h for

gene expression studies, 3 h and 24 h for cell viability assessment and 24 h for cell

morphology studies and analysis of TNFα and IL-1β production.

All toxins, except physcion, increased TNFα and IL-1β mRNA expression and

decreased cell viability. Half-maximal effective concentrations (EC50) for cytokine mRNA

responses and cell viability are shown in Table 1. Bacterial toxin valinomycin was the most

potent toxin for inflammatory and cytotoxic responses even at low nanomolar level, while the

other toxins caused responses at micromolar levels. With the exception of valinomycin,

toxins induced mRNA expressions at the lower concentrations than caused cytotoxicity. The

potency order for cytokine responses was valinomycin > enniatin B > sterigmatocystin >

emodin > physcion. The order for decreased cell viability was the same except that at 3 h

emodin was more potent than sterigmatocystin, which was cytotoxic only at 24 h. Physcion

did not cause significant cytokine or cell viability responses at any tested concentrations (0.5

– 100 μM).

Effects of toxin mixtures and structural components

For mimicking real-life exposure situations, the cells were exposed to mixtures of

toxins in different combinations alone and together with LPS and β-glucan (Fig.1). The used

proportions of emodin, enniatin B, physcion, sterigmatocystin and valinomycin were selected

to mimic real-life situations detected in indoor air (Kirjavainen, 2015; Peitzsch, 2012; and

unpublished data) and were 100, 5, 250, 5 and 0.1 (on molar basis), respectively. The

concentration of emodin was set to 10 μg/ml (= 37 μM) and the concentrations of other toxins

were set in relation to emodin: 0.5 μg/ml enniatin B (0.8 μM), 25 μg/ml physcion (88 μM),

0.5 μg/ml sterigmatocystin (1.5 μM), 0.01 μg/ml valinomycin (0.009 μM). LPS and β-glucan

were used at the lowest concentrations able to evoke the mRNA expression of TNFα and IL-

Acc

epte

d A

rtic

le


1β (5 ng/ml LPS and 100 ng/ml β-glucan). TNFα mRNA levels were only slightly increased

after exposure of cells to single toxins or mixtures of enniatin B + emodin, enniatin B +

emodin + physcion or enniatin B + emodin + sterigmatocystin suggesting that these toxins

have no additive interaction at the used concentrations. Addition of valinomycin to the

mixtures increased the response about 9-fold (Fig.1A). The expression of IL-1β, however,

was comparable regardless of composition of the toxin mixture (Fig.1B). Most remarkably,

simultaneous treatment of cells with β-glucan, LPS and toxin mixtures strongly elevated the

mRNA expression of TNFα. After 3 h co-treatment with toxin mixtures enniatin B + emodin,

enniatin B + emodin + physcion or enniatin B + emodin + sterigmatocystin and low

concentrations of β-glucan and LPS, the TNFα mRNA levels were clearly higher than the

sum of individual effects (ratios of measured co-responses to the sum of responses to

structural components and toxin mixtures were about 2.5) indicating a synergistic interaction

(Fig.1A). The presence of valinomycin in mixtures seemed to prevent the synergistic co-

responses in TNFα expression and even inhibit the IL-1β responses (Fig.1A-B). The

combined effects of the toxin mixtures enniatin B + emodin, enniatin B + emodin + physcion

or enniatin B + emodin + sterigmatocystin plus β-glucan and LPS on the IL-1β mRNA

expression were additive (Fig.1B). In addition, the IL-1β responses to all toxin mixtures were

at the same level as individual responses to emodin or valinomycin alone (Fig.1B).

Interactions after co-treatment with single toxins and structural components

Next, human macrophages were exposed to individual toxins alone or in

combination with β-glucan or LPS to characterize their specific interactions. The

concentrations of toxins were selected so that they evoke proinflammatory response, but are

not highly cytotoxic to cells. The cell viabilities (% of control) after 3 h treatment with

selected concentrations were as follows: 40 μM emodin 80.3 ± 2.1 (n=4), 5 μM enniatin B

Acc

epte

d A

rtic

le


85.0 ± 2.8 (n=5), 20 μM sterigmatocystin 101.6 ± 3.7 (n=2) and 5 nM valinomycin 63.1 ± 1.3

(n=4). After 24 h treatment, the cell viabilities were 73.5 ± 1.5, 94.1 ± 1.5, 71.7 ± 1.8 and

83.6 ± 1.9, respectively. LPS and β-glucan were used at low concentrations in order to avoid

masking the effects of toxins, since especially LPS has high potency to stimulate the

production of proinflammatory cytokines. The selected concentrations, 5 ng/ml LPS and 100

ng/ml β-glucan, were not cytotoxic to cells, since the cell viabilities after 3 or 24 h treatments

were between 99.7 – 121%.

Synergistic interactions in the expression of TNFα and IL-1β were observed after

simultaneous treatment of cells with emodin, enniatin B and valinomycin together with LPS

or β-glucan (Fig.2). The interaction after co–exposure to sterigmatocystin and β-glucan or

LPS was additive (Fig.2A-D). For the combinations of emodin, enniatin B and valinomycin

plus LPS or β-glucan, the synergistic interactions in protein secretion of both cytokines

(Fig.2A,B) were notably higher than in the corresponding mRNA expressions (Fig.2C,D).

The strongest synergistic interaction was observed after simultaneous treatment of enniatin B

and LPS; the calculated ratios of measured co-response to the sum of individual responses

were over 8 for the production of both TNFα and IL-1β (Fig.2A,B). The calculated ratios also

revealed that the co-treatment with toxins and β-glucan caused somewhat stronger synergistic

effects in TNFα responses than toxins and LPS (Fig.2A,C). At the mRNA level of IL-1β, the

co-effects of these toxins and β-glucan or LPS were only slightly increased, but very high at

the protein level (Fig.2B,D).

Effects of co-exposure on cell morphology

TEM revealed increased mitochondrial damage after simultaneously 24-h co-

exposure to toxins and structural components (Fig.3) in almost every sample. Mitochondrial

swelling and fracture of cristae were especially evident after co-exposure of cells to

Acc

epte

d A

rtic

le


valinomycin and β-glucan or LPS, but not so obvious in cells treated with valinomycin alone.

Mild mitochondrial damage was also seen after exposure to β-glucan or LPS alone in some

samples. Another common consequence of co-exposure was induction of autophagocytosis.

The increased number of autophagosomes was observed in particular after exposure to LPS

together with enniatin B, valinomycin (Fig.3) or sterigmatocystin. Sterigmatocystin alone

caused also disruption of cell and nuclear membranes in about half of the treated cells (data

not shown). Co-treatment of cells with enniatin B, sterigmatocystin or valinomycin together

with β-glucan or LPS caused more damage to organelles than emodin together with β-glucan

or LPS (data not shown).

Vacuolization was very common in all treated cells, but it was observed also in cells

treated with vehicle only (0.1 % DMSO) as compared to untreated control cells. Cytoplasmic

vacuoles differed in size and state of condensation among different treatments (Fig.3).

In SEM, enniatin B revealed a lot of vacuolization, which was stronger after co-

treatment with β-glucan and LPS. Ample vacuolization was also seen after combined

exposure to valinomycin and β-glucan, and some after co-treatment with LPS (data not

shown). Overall, electron microscopy revealed that co-exposure to toxins with β-glucan or

LPS clearly increased the severity of damage.

Effects of co-exposure on inflammatory-related genes

In the PCR array, emodin (40 μM), enniatin B (5 μM) and valinomycin (5 nM) alone

evoked slight up- or downregulations of inflammatory response associated genes (encoding

e.g. chemokines, cytokines and interleukins, as well as their receptors). Even a very low

concentration of LPS (5 ng/ml) strongly increased the expression of several genes. The

magnitude of fold changes after treatment of cells with low concentration of β-glucan (100

ng/ml) was on average between the effects of toxins and LPS.

Acc

epte

d A

rtic

le


When the combined response of toxin and LPS was divided by the effect of LPS

alone, the overall trend was that emodin and enniatin B seemed to inhibit the effects of LPS

(Fig.4). When taking into account only over two-fold changes in this ratio, emodin, enniatin

B and valinomycin inhibited the expression of 12, 24 and 10 genes, respectively. The

strongest inhibitory effects on LPS-induced inflammatory responses of individual genes were

seen after emodin exposure (Figure S1). On the contrary, toxins largely potentiated the

effects of β-glucan. Simultaneous exposure to β-glucan and emodin, enniatin B or

valinomycin synergistically increased the expression of 28, 34 and 36 genes, respectively,

over two-fold of the effects caused by β-glucan alone (Fig.4).

Discussion

We show here that microbial toxins abundant in moisture-damaged indoor

environments can act synergistically in co-exposures with bacterial and fungal structural

components, drastically increasing the severity of proinflammatory responses in human

macrophages. These synergistic effects are apparent already at concentrations where the

toxins alone show only slight or modest effects. It is also noteworthy that this synergistic

interaction is seen at very low concentrations of LPS and β-glucan. In addition, simultaneous

co-exposure to toxins and structural components caused more morphological changes than

individual exposures alone. This synergistic nature of interactions may help in understanding

the adverse health effects observed in occupants of moisture damaged buildings, where

exposure situations are characterized by complex mixtures of individual microbial and

chemical agents, and the levels of individual exposing agents are often not sufficiently high

to explain the health complaints.

Acc

epte

d A

rtic

le


The fungal toxins used in this study (emodin, enniatin B, physcion, and

sterigmatocystin) represent compounds abundantly present in moisture-damaged indoor

environments, some of them at high prevalence, such as emodin, enniatin B or physcion

(Kirjavainen et al., 2015; Peitzsch et al., 2012; Täubel et al., 2011). While some of these

compounds (emodin, physcion) are not exclusively produced by filamentous fungi but also

by some plants or might not be produced by species that are part of what are considered

traditionally building fungi (enniatins), we have observed associations of these compounds

with moisture damage and indoor dampness in those studies listed and some further, yet

unpublished work. We consciously chose to base our selection of model toxins on actual

measurement data from partly extensive indoor sample materials, using analytical

methodology targeting a large variety of different fungal and bacterial secondary metabolites,

rather than restricting to the ‘classic’ indoor mycotoxins, such as macrocyclic trichothecenes,

sterigmatocystin and some Penicillium metabolites only. Co-occurrence of fungal metabolites

with bacterial toxins has been shown (Täubel et al., 2011), which is why valinomycin was

included here. It is evident, however, that toxic microbial compounds also occur in buildings

without moisture problems (Kirjavainen et al., 2015; Peitzsch et al., 2012), meaning that

microbial toxins indoors is not a phenomenon of ‘moldy buildings’ only. There are very little

data on cellular and health effects of these toxins since the vast majority of earlier studies

have concentrated on satratoxins and other macrocyclic trichothecenes that are potent

immunomodulators, but not highly prevalent in many European climates (Kirjavainen et al.,

2015; Peitzsch et al, 2012). Dose-response modelling of the cytokine and cell viability a data

revealed that the ionophore toxins valinomycin and enniatin B are more potent than the others

in almost all measured endpoints.

After detailed dose-response studies, we ended up using low concentrations of LPS

(5 ng/ml) and β-glucan (100 ng/ml) in order to avoid masking the effects of toxins in

Acc

epte

d A

rtic

le


interaction studies. Selected concentrations were sufficient to evoke a mild proinflammatory

response alone, but high enough to accomplish strong synergistic interactions in co-exposures

with toxins. In many previous in vitro studies, much higher LPS concentrations have been

used, typically 100 or 1000 ng/ml. In these studies, co-exposure to mycotoxins and LPS

either reduced the cytokine production (at 100 ng/ml) (Johannessen et al., 2009) or in most

studies increased it, sometimes synergistically (Gammelsrud, 2012; Islam and Pestka, 2006;

Kankkunen et al., 2009; Kankkunen et al., 2014; Zhou et al., 1999). The immune responses to

LPS can vary between species (Munford, 2010) and depend on the dose (Morris and Li,

2012).

We observed that the combinations of four fungal toxins at proportions mimicking

real-life exposure situations showed no enhanced effects on the TNFα or IL-1β mRNA levels,

but the presence of bacterial toxin valinomycin in the toxin mixture synergistically increased

the TNFα mRNA expression. Addition of LPS and β-glucan to these mixtures further

amplified the TNFα mRNA response. Interestingly, this synergistic joint effect was not

observed in the IL-1β expression, but the co-effect was mostly additive or even inhibitory. In

many earlier studies, additive or synergistic interaction induced by mycotoxin mixtures in

contaminated foodstuff (Alassane-Kpembi et al., 2013; Prosperini et al., 2014; Ruiz et al.,

2011; Wan et al., 2013) or by indoor relevant moulds (Mueller et al., 2013; Wan et al., 2013)

has also been described. The molecular mechanisms of studied toxins or toxicological

interactions were not explored in this study, but will be addressed in further investigations.

Co-exposure of human macrophages to enniatin B, emodin or valinomycin and

either β-glucan or LPS resulted in synergistic interactions in TNFα or IL-1β responses both at

the mRNA and protein level. Toxins together with β-glucan caused somewhat stronger

synergistic proinflammatory response than together with LPS. To our knowledge, co-effects

of toxins together with low concentrations of β-glucan and LPS have not been earlier

Acc

epte

d A

rtic

le


compared. When considering larger group of inflammatory related genes, combinations of

emodin, enniatin B and valinomycin together with β-glucan mainly potentiated the

expression of inflammatory-related genes, while emodin and enniatin B together with LPS

inhibited the expression of many of these genes. These observations suggest that structural

components and toxins together may have complex, even contrasting effects on immune

system depending on the combinations of exposing agents and their concentrations, and

therefore the consequences of total exposure are difficult to predict.

Our results show that interactions of toxins and structural components can cause

morphological changes in cells that are more severe than effects of individual agents alone.

These changes occurred at the same exposure levels as the synergistic effects on

proinflammatory responses. Co-exposure to toxins and structural components induced

mitochondrial damage and autophagocytosis. Swollen and distorted mitochondria have been

reported earlier in human NK cells exposed to valinomycin at 100 ng/ml (Paananen et al.,

2000). In our study, similar mitochondrial damage was induced by almost 20-fold lower

concentration of valinomycin only after co-exposure with either β-glucan or LPS. In mouse

RAW267.4 macrophages, 10 μM enniatin B caused increased vacuolization suggesting

induction of autophagy (Gammelsrud et al., 2012). We observed increased number of

vacuoles at 5 μM enniatin B, while induced autophagocytosis was more clearly detectable

after co-exposure with LPS. In general, autophagocytosis is a mechanism involving

degradation of unnecessary or dysfunctional cellular components, while mitochondrial

damage is more harmful since it directly affects cellular energy metabolism and cell activity.

Microbial toxins are non-volatile, but are associated and do get airborne with spores

or other particulate. Concentrations of toxins within spore’s immediate microenvironment

could be extremely high (Carey et al., 2012) and structural components are simultaneously

present, making local adverse effects on the site of impaction, e.g. lung cells, plausible

Acc

epte

d A

rtic

le


(Behm et al., 2012; Carey et al., 2012). Inhalation exposure to microbial agents is likely to be

toxicologically more significant than the other relevant routes of exposure. It has been shown

in mice that trichothecene mycotoxin T-2 is more toxic through inhalation than by ingestion

(Creasia et al., 1987). Only a few epidemiological studies with partly conflicting outcome

have investigated the association between inhaled toxins and health effects. An association

between mycotoxin load in school dust and nasal symptoms has been observed in Finnish

teachers (Zock et al., 2014). In contrast, a protective trend of a mycotoxin on respiratory

symptoms have been reported in school children in Malaysia (Cai et al., 2011) and no

association between asthma development and moisture-damage linked individual toxins in

homes of Finnish children (Kirjavainen et al., 2015). These results together with our findings

highlight the complexity of this phenomenon.

Conclusions

Microbial toxins potentiated the low-dose proinflammatory effects of the key

structural components of bacteria and fungi in human macrophages. These interactions in

proinflammatory cytokine responses were synergistic both at the mRNA and protein level

and accompanied by morphological alterations indicative of mitochondrial damage and

autophagy related activation pathways. Toxins together with the fungal cell component β-

glucan induced synergistic effects also on the expression of many other inflammatory related

genes, while interactions with the bacterial cell wall component LPS, were mostly inhibitory.

Therefore, an inflammatory response induced by complex exposures to multiple different

microbial agents are potentially significant and cannot be predicted based on data on one

individual component alone. The research on causative agents should be focused more on

mixtures since this is the most common scenario.

Acc

epte

d A

rtic

le


Acknowledgments

We thank Arja Moilanen for excellent technical assistance.

Supporting Information

Additional Supporting Information may be found in the online version of this article:

Figure S1. Fold regulations in inflammation-related genes after co-exposure of THP-1 cells

to emodin (40 μM), enniatin B (5 μM) or valinomycin (5 nM) and β-glucan (100 ng/ml) or

LPS (5 ng/ml) for 3 h. The change in gene transcription caused by co-exposure to toxin and

structural component was divided by the effects of structural component alone (e.g. [Emo +

LPS]/LPS). Only genes showing ≥2-fold changes are shown.

References

Alassane-Kpembi, I., Kolf-Clauw, M., Gauthier, T., Abrami, R., Abiola, F.A.,

Oswald, I.P. and Puel, O. (2013) New insights into mycotoxin mixtures: the toxicity of low

doses of Type B trichothecenes on intestinal epithelial cells is synergistic, Toxicol. Appl.

Pharmacol., 272, 191-198.

Behm, C., Follmann, W. and Degen, G.H. (2012) Cytotoxic potency of mycotoxins

in cultures of V79 lung fibroblast cells, J. Toxicol. Environ. Health A, 75, 1226-1231.

Bennett, J.W. and Klich, M. (2003) Mycotoxins, Clin. Microbiol. Rev., 16, 497-516.

Cai, G.H., Hashim, J.H., Hashim, Z., Ali, F., Bloom, E., Larsson, L., Lampa, E. and

Norback, D. (2011) Fungal DNA, allergens, mycotoxins and associations with asthmatic

symptoms among pupils in schools from Johor Bahru, Malaysia, Pediatr. Allergy Immunol.,

22, 290-297.

Acc

epte

d A

rtic

le


Carey, S.A., Plopper, C.G., Hyde, D.M., Islam, Z., Pestka, J.J. and Harkema, J.R.

(2012) Satratoxin-G from the black mold Stachybotrys chartarum induces rhinitis and

apoptosis of olfactory sensory neurons in the nasal airways of rhesus monkeys, Toxicol.

Pathol., 40, 887-898.

Chanput, W., Mes, J.J. and Wichers, H.J. (2014) THP-1 cell line: an in vitro cell

model for immune modulation approach, Int. Immunopharmacol., 23, 37-45.

Council for Agricultural Science and Technology (CAST). (2003) Mycotoxins: Risk

in plant, animal, and human systems. Ames, Iowa, USA, Task force report 139, 13-15.

Creasia, D.A., Thurman, J.D., Jones, L.J.,3rd, Nealley, M.L., York, C.G.,

Wannemacher, R.W.,Jr and Bunner, D.L. (1987) Acute inhalation toxicity of T-2 mycotoxin

in mice, Fundam. Appl. Toxicol., 8, 230-235.

Dearborn, D.G., Yike, I., Sorenson, W.G., Miller, M.J. and Etzel, R.A. (1999)

Overview of investigations into pulmonary hemorrhage among infants in Cleveland, Ohio,

Environ. Health Perspect., 107, 495-499.

Etzel, R.A., Montana, E., Sorenson, W.G., Kullman, G.J., Allan, T.M., Dearborn,

D.G., Olson, D.R., Jarvis, B.B. and Miller, J.D. (1998) Acute pulmonary hemorrhage in

infants associated with exposure to Stachybotrys atra and other fungi, Arch. Pediatr. Adolesc.

Med., 152, 757-762.

Flappan, S.M., Portnoy, J., Jones, P. and Barnes, C. (1999) Infant pulmonary

hemorrhage in a suburban home with water damage and mold (Stachybotrys atra), Environ.

Health Perspect., 107, 927-930.

Gammelsrud, A., Solhaug, A., Dendele, B., Sandberg, W.J., Ivanova, L., Kocbach

Bolling, A., Lagadic-Gossmann, D., Refsnes, M., Becher, R., Eriksen, G. and Holme, J.A.

(2012) Enniatin B-induced cell death and inflammatory responses in RAW 267.4 murine

macrophages, Toxicol. Appl. Pharmacol., 261, 74-87.

Acc

epte

d A

rtic

le


Huttunen, K., Pelkonen, J., Nielsen, K.F., Nuutinen, U., Jussila, J. and Hirvonen,

M.-R. (2004) Synergistic interaction in simultaneous exposure to Streptomyces californicus

and Stachybotrys chartarum, Environ. Health Perspect., 112, 659-665.

Huttunen, K., Tirkkonen, J., Täubel, M., Krop, E., Mikkonen, S., Pekkanen, J.,

Heederik, D., Zock, J.P., Hyvärinen, A. and Hirvonen, M.-R. (2015) Inflammatory potential

in relation to the microbial content of settled dust samples collected from moisture-damaged

and reference schools: results of HITEA study, Indoor Air (in press).

Islam, Z., Amuzie, C.J., Harkema, J.R. and Pestka, J.J. (2007) Neurotoxicity and

inflammation in the nasal airways of mice exposed to the macrocyclic trichothecene

mycotoxin roridin a: kinetics and potentiation by bacterial lipopolysaccharide coexposure,

Toxicol. Sci., 98, 526-541.

Islam, Z. and Pestka, J.J. (2006) LPS priming potentiates and prolongs

proinflammatory cytokine response to the trichothecene deoxynivalenol in the mouse,

Toxicol. Appl. Pharmacol., 211, 53-63.

Jarvis, B.B., Sorenson, W.G., Hintikka, E.L., Nikulin, M., Zhou, Y., Jiang, J., Wang,

S., Hinkley, S., Etzel, R.A. and Dearborn, D. (1998) Study of toxin production by isolates of

Stachybotrys chartarum and Memnoniella echinata isolated during a study of pulmonary

hemosiderosis in infants, Appl. Environ. Microbiol., 64, 3620-3625.

Johannessen, L., Lovik, M., Lydersen, S. and Nilsen, A.M. (2009) Combined cell

wall polysaccharide, mycotoxin and bacterial lipopolysaccharide exposure and inflammatory

cytokine responses, APMIS, 117, 507-517.

Johanning, E., Biagini, R., Hull, D., Morey, P., Jarvis, B. and Landsbergis, P. (1996)

Health and immunology study following exposure to toxigenic fungi (Stachybotrys

chartarum) in a water-damaged office environment, Int. Arch. Occup. Environ. Health, 68,

207-218.

Acc

epte

d A

rtic

le


Kamyar, M., Rawnduzi, P., Studenik, C.R., Kouri, K. and Lemmens-Gruber, R.

(2004) Investigation of the electrophysiological properties of enniatins, Arch. Biochem.

Biophys., 429, 215-223.

Kanchongkittiphon, W., Mendell, M.J., Gaffin, J.M., Wang, G. and Phipatanakul,

W. (2015) Indoor environmental exposures and exacerbation of asthma: an update to the

2000 review by the institute of medicine, Environ. Health Perspect., 123, 6-20.

Kankkunen, P., Rintahaka, J., Aalto, A., Leino, M., Majuri, M.L., Alenius, H.,

Wolff, H. and Matikainen, S. (2009) Trichothecene mycotoxins activate inflammatory

response in human macrophages, J. Immunol., 182, 6418-6425.

Kankkunen, P., Välimäki, E., Rintahaka, J., Palomäki, J., Nyman, T., Alenius, H.,

Wolff, H. and Matikainen, S. (2014) Trichothecene mycotoxins activate NLRP3

inflammasome through a P2X7 receptor and Src tyrosine kinase dependent pathway, Hum.

Immunol., 75, 134-140.

Kirjavainen, P.V., Täubel, M., Karvonen, A.M., Sulyok, M., Tiittanen, P., Krska, R.,

Hyvärinen, A. and Pekkanen, J. (2015) Microbial secondary metabolites in homes in

association with moisture damage and asthma, Indoor Air (in press).

Koskela, A., Viluksela, M., Keinänen, M., Tuukkanen, J. and Korkalainen, M.

(2012) Synergistic effects of tributyltin and 2,3,7,8-tetrachlorodibenzo-p-dioxin on

differentiating osteoblasts and osteoclasts, Toxicol. Appl. Pharmacol., 263, 210-217.

Mendell, M.J., Mirer, A.G., Cheung, K., Tong, M. and Douwes, J. (2011)

Respiratory and allergic health effects of dampness, mold, and dampness-related agents: a

review of the epidemiologic evidence, Environ. Health Perspect., 119, 748-756.

Miller, J.D. and McMullin, D.R. (2014) Fungal secondary metabolites as harmful

indoor air contaminants: 10 years on, Appl. Microbiol. Biotechnol., 98, 9953-9966.

Acc

epte

d A

rtic

le


Morris, M. and Li, L. (2012) Molecular mechanisms and pathological consequences

of endotoxin tolerance and priming, Arch. Immunol. Ther. Exp., 60, 13-18.

Mueller, A., Schlink, U., Wichmann, G., Bauer, M., Graebsch, C., Schüürmann, G.

and Herbarth, O. (2013) Individual and combined effects of mycotoxins from typical indoor

moulds, Toxicol. In Vitro, 27, 1970-1978.

Munford, R.S. (2010) Murine responses to endotoxin: another dirty little secret? J.

Infect. Dis., 201, 175-177.

Murtoniemi, T., Penttinen, P., Nevalainen, A. and Hirvonen, M-.R. (2005) Effects of

microbial cocultivation on inflammatory and cytotoxic potential of spores, Inhal. Toxicol.,

17, 681-693.

Nevalainen, A., Täubel, M. and Hyvärinen, A. (2015) Indoor fungi: companions and

contaminants, Indoor Air, 25, 125-156.

Nielsen, K.F. (2003) Mycotoxin production by indoor molds, Fungal Genet. Biol.,

39, 103-117.

Paananen, A., Mikkola, R., Sareneva, T., Matikainen, S., Andersson, M., Julkunen,

I., Salkinoja-Salonen, M.S. and Timonen, T. (2000) Inhibition of human NK cell function by

valinomycin, a toxin from Streptomyces griseus in indoor air, Infect. Immun., 68, 165-169.

Peitzsch, M., Sulyok, M., Täubel, M., Vishwanath, V., Krop, E., Borras-Santos, A.,

Hyvärinen, A., Nevalainen, A., Krska, R. and Larsson, L. (2012) Microbial secondary

metabolites in school buildings inspected for moisture damage in Finland, The Netherlands

and Spain, J. Environ. Monit., 14, 2044-2053.

Penttinen, P., Huttunen, K., Pelkonen, J. and Hirvonen, M.-R. (2005) The

proportions of Streptomyces californicus and Stachybotrys chartarum in simultaneous

exposure affect inflammatory responses in mouse RAW264.7 macrophages, Inhal. Toxicol.,

17, 79-85.

Acc

epte

d A

rtic

le


Pestka, J. and Zhou, H.R. (2006) Toll-like receptor priming sensitizes macrophages

to proinflammatory cytokine gene induction by deoxynivalenol and other toxicants, Toxicol.

Sci., 92, 445-455.

Prosperini, A., Font, G. and Ruiz, M.J. (2014) Interaction effects of Fusarium

enniatins (A, A1, B and B1) combinations on in vitro cytotoxicity of Caco-2 cells, Toxicol. In

Vitro, 28, 88-94.

Ruiz, M.J., Macakova, P., Juan-Garcia, A. and Font, G. (2011) Cytotoxic effects of

mycotoxin combinations in mammalian kidney cells, Food Chem. Toxicol., 49, 2718-2724.

Slob, W. (2002) Dose-response modeling of continuous endpoints, Toxicol. Sci., 66,

298-312.

Täubel, M. and Hyvärinen, A. (2015) Occurrence of Mycotoxins in Indoor

Environments, Environmental Mycology in Public Health: Fungi and Mycotoxins Risk

Assessment and Management. Academic Press, 291-316.

Täubel, M., Sulyok, M., Vishwanath, V., Bloom, E., Turunen, M., Järvi, K.,

Kauhanen, E., Krska, R., Hyvärinen, A., Larsson, L. and Nevalainen, A. (2011) Co-

occurrence of toxic bacterial and fungal secondary metabolites in moisture-damaged indoor

environments, Indoor Air, 21, 368-375.

Tonshin, A.A., Teplova, V.V., Andersson, M.A. and Salkinoja-Salonen, M.S. (2010)

The Fusarium mycotoxins enniatins and beauvericin cause mitochondrial dysfunction by

affecting the mitochondrial volume regulation, oxidative phosphorylation and ion

homeostasis, Toxicology, 276, 49-57.

Wan, L.M., Woo, C.J., Turner, P.C., Wan, J.M. and El-Nezami, H. (2013) Individual

and combined effects of Fusarium toxins on the mRNA expression of pro-inflammatory

cytokines in swine jejunal epithelial cells, Toxicol. Lett., 220, 238-246.

Acc

epte

d A

rtic

le


World Health Organization. (2009) WHO Guidelines for Indoor Air Quality:

Dampness and Mould, Copenhagen, WHO Regional Office for Europe.

Zhou, H.R., Harkema, J.R., Yan, D. and Pestka, J.J. (1999) Amplified

proinflammatory cytokine expression and toxicity in mice coexposed to lipopolysaccharide

and the trichothecene vomitoxin (deoxynivalenol), J. Toxicol. Environ. Health A, 57, 115-

136.

Zock, J.P., Borras-Santos, A., Jacobs, J., Täubel, M., Espinosa, A., Haverinen-

Shaughnessy, U., Peitsch, M., Sulyok, M., Hyvärinen, A. (2014) Dampness and microbial

secondary metabolites in schools and respiratory symptoms in teachers. In: European

Respiratory Society Annual Conference, Munich, Abstract 2161.

Figure legends

Fig.1. TNFα (A) and IL-1β (B) mRNA responses after treatment of macrophages derived

from THP-1 monocytic cells with mixtures of toxins consisting of 10 μg/ml emodin (Emo),

0.5 μg/ml enniatin B (EnB), 25 μg/ml physcion (Phy), 0.5 μg/ml sterigmatocystin (Ste) and

0.01 μg/ml valinomycin (Val) alone and together with structural components 5 ng/ml LPS

and 100 ng/ml β-glucan (β-glu) for 3 h. Columns represent mean ± SE of 3 replicates from

one representative experiments out of two independent experiment. Statistically significant

differences (p<0.05) are indicated by a, b or c: a, different from medium control; b, different

from β-glucan+LPS; and c, different from the same toxin mixture without β-glucan+LPS.

Fig.2. The production of TNFα (A) and IL-1β (B) protein and the mRNA expression of

TNFα (C) and IL-1β (D) in macrophages derived from THP-1 monocytic cells. Cells were

exposed to emodin, enniatin B or valinomycin (at concentrations of 40 μM, 5 μM and 5 nM,

respectively) and structural components (=SC) β-glucan (100 ng/ml) or LPS (5 ng/ml) alone

and in combinations. TNFα and IL-1β mRNA expression was measured after 3 h and protein

Acc

epte

d A

rtic

le


secretion after 24 h exposure. Columns represent mean ± SE of 3 replicates from 3-7 (mRNA

expression) or 2 (protein secretion; one experiment with sterigmatocystin) independent

experiments.

Fig.3. TEM images after 24 h treatment of macrophages derived from THP-1 cells with

toxins enniatin B (5 μM) and valinomycin (5 nM) alone and simultaneously with structural

components β-glucan (100 ng/ml) or LPS (5 ng/ml). Cells were also treated with structural

components and DMSO vehicle (0.1 %) (upper panel). Examples of damaged mitochondria

are indicated with yellow arrows, autophagosomes with green and condensed vacuoles with

blue arrows. Scale bar is 2 μm.

Fig.4. Interactions in inflammation-related genes after co-exposure of THP-1 cells to emodin

(40 μM), enniatin B (5 μM) or valinomycin (5 nM) and β-glucan (100 ng/ml) or LPS (5

ng/ml) for 3 h. The change in gene transcription caused by co-exposure to toxin and structural

component was divided by the effects of structural component alone (e.g. (Emo + LPS)/LPS).

Only ≥2-fold changes are shown. Red color indicates upregulation (addition/synergism),

green downregulation (inhibition) and grey no interaction (< 2-fold change).

Acc

epte

d A

rtic

le


Table 1: Half-maximal effective concentrations of toxins (EC50) and 95% confidence

intervals for cytokine mRNA responses and cell viability. Dose-responses for cytokine

expression after 3 h exposure and for cell viability after 3 and 24 h exposure were modelled

by PROAST using exponential and Hill model families.

Endpoint EC50 (95% confidence intervals) in μM

Emodin Enniatin B Sterigmatocystin Valinomycin

TNFα mRNA 42.9

(41.5 - 73.5)

2.4

(1.4 - 3.4)

10.3

(9.4 - 12.0)

0.037

(0.025 – 0.079)

IL-1β mRNA 15.1

(13.5 - 16.7)

1.8

(1.0 - 2.5)

11.5

(10.6 - 13.9)

0.006

(0.005 – 0.007)

Cell viability,

3 h

82.0

(77.6 - 87.7)

19.9

(17.4 - 23.1)

NA

0.006

(0.006 – 0.007)

Cell viability,

24 h

79.3

(69.6 - 91.3)

26.4

(13.7 - 74.0)

57.5

(41.1 - 95.7)

0.009

(0.007 – 0.010)

Acc

epte

d A

rtic

le


NA= not applicable (no dose response)

Acc

epte

d A

rtic

le


received date : 08-sep-2015 revised date : 26-nov … toxins and microbial cell wall components lps...

Documents