real time rt pcr data analysis. broad and long term objective to characterize the expression of...
Post on 21-Dec-2015
213 views
TRANSCRIPT
![Page 1: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/1.jpg)
Real Time RT PCR Real Time RT PCR Data AnalysisData Analysis
![Page 2: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/2.jpg)
Broad and Long Term ObjectiveBroad and Long Term Objective
To characterize the expression of ribulose 1-5 bisphosphate To characterize the expression of ribulose 1-5 bisphosphate
carboxylase oxygenase and chlorophyll AB binding gene in carboxylase oxygenase and chlorophyll AB binding gene in Lycopersicon esculentumLycopersicon esculentum (Tomato) leaves subjected to either 48 or (Tomato) leaves subjected to either 48 or 72 hours in the dark as compared to the expression in leaves grown 72 hours in the dark as compared to the expression in leaves grown under normal 12 hr light/dark cycle and harvested at noon.under normal 12 hr light/dark cycle and harvested at noon.
![Page 3: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/3.jpg)
Research PlanResearch Plan
RNA Isolation leaf material grown in light and in the dark
RNA Electrophoresis and cDNA synthesis
RBCS3 and Cab-1b transcript quantitation
by real time PCR
Analysis of real time PCR data
![Page 4: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/4.jpg)
Today’s Laboratory ObjectivesToday’s Laboratory Objectives
1.1. To learn how to interpret real time PCR data.To learn how to interpret real time PCR data.
Melt Curve AnalysisMelt Curve Analysis
Analysis of Cycle ThresholdsAnalysis of Cycle Thresholds
Calculating Relative FCalculating Relative Fold Change using the 2ΔCt
method
2.2. To interpret real time RT PCR data and draw meaningful To interpret real time RT PCR data and draw meaningful conclusions: ie, determine the conclusions: ie, determine the relative quantitation of RBCS3
or Cab-1b transcript levels in light- vs. dark-grown tomato plants
![Page 5: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/5.jpg)
Plate Set UpPlate Set Up
A1Tiffany/ShinobuLight
A2 Light
A3Light
A4Dark
A5Dark
A6Dark
A7NT
A8NT
A9 Max/KittyLight
A10Light
A11Light
A12Dark
B1Jack/SeanLight
B2Light
B3Light
B4Dark
B5Dark
B6Dark
B7NT
B8NT
B9Dark
B10Dark
B11NT
B12NT
C1Robyn/Cricket
C2Light
C3Light
C4Dark
C5Dark
C6Dark
C7NT
C8NT
C9AshleyAdnan
C10Light
C11Light
C12Dark
D1Thao/TramLight
D2Light
D3Light
D4Dark
D5Dark
D6Dark
D7NT
D8NT
D9Dark
D10Dark
D11NT
D12NT
E1Sandy/Beads
E2Light
E3Light
E4Dark
E5Dark
E6Dark
E7NT
E8NT
E9EEKLight
E10Light
E11Light
E12Dark
F1OBE/Chris
F2Light
F3Light
F4Dark
F5Dark
F6Dark
F7NT
F8NT
F9Dark
F10Dark
F11NT
F12NT
G1Damon/Phoenix
G2Light
G3Light
G4Dark
G5Dark
G6Dark
G7NT
G8NT
G9 G10 G11 G12
H1CourtneyAmanda
H2Light
H3Light
H4Dark
H5Dark
H6Dark
H7Dark
H8NT
H9 H1024 D&P
H1124 D&P
H1224 D&P
![Page 6: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/6.jpg)
1 aaaaatgaaa aactcgtcag aaagaaaaag caaaagcaac aaaaaaattg caagtatttt 61 ttaaaaaaga aaaaaaaaac atatcttgtt tgtcagtatg ggaagtttga gataaggacg 121 agtgaggggt taaaattcag tggccattga ttttgtaatg ccaagaacca caaaatccaa 181 tggttaccat tcctgtaaga tgaggtttgc taactctttt tgtccgttag ataggaagcc 241 ttatcactat atatacaagg cgtcctaata acctcttagt aaccaattat ttcagcaatg 301 gcttcttcag taatgtcctc agcagctgtt gccacccgcg gcaatggtgc acaagctagc 361 atggttgcac ccttcactgg actcaagtcc accgcttctt tccctgtttc aaggaagcaa 421 aaccttgaca ttacctccat tgctagcaac ggtggaagag tcagttgcat gcaggtttgt 481 gtgtgtatat atatatacgt acaacaaaat tcattgacta taatgttata ctcgattagc 541 taatttaact atttataatt gtataggtgt ggccaccaat taacatgaag aagtacgaga 601 ctctgtcgta ccttcctgat ttgtccgacg agcaattgct cagcgaaatt gagtacctat 661 tgaaaaatgg atgggttcct tgcttggaat tcgagactga ggtcaacatc tatctcctct 721 gtttttaaaa tttactagct agtatgttga tatgtcgtgt taacagtgtt gtgggatatc 781 atgtgcagca cggatttgtg taccgtgaga accataagtc accaggatac tacgatggca 841 gatactggac catgtggaag ttgcccatgt tcgggtgcac tgatgcaacc caggtcttgg 901 ctgaggtgca ggaggcaaag aaggcttacc cacaggcatg ggtccgtatc atcggattcg 961 acaatgttcg tcaagtgcag tgcatcagtt tcatcgctta caagcccgaa ggatactaaa 1021 tgtgtatatg tcaacagtga gaaactgttc gcattttccg ttttgcttct ttctttctat 1081 tcaatgtatg ttgttggatt ccagttgaat ttattatgag aactaataat aatagtaata 1141 atcatttgtt tctttactaa tttgcatttt cacatatgat ttctggtgca tatcataatt 1201 ttcattccac caatattaat ttccccattc aagttactta tgaaatagaa atcctcttct 1261 ccgactactt tatttgtccg aaagtcttgt ggctgctata taacgcaaaa tggatagaga 1321 agattcatta ctaagccgat c
RubisCO Small Subunit accession #X05986
Coding Sequence
![Page 7: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/7.jpg)
RubisCO Primer SetsRubisCO Primer Sets
Start Length Tm %G+C Seq
Primer Set A
Left Primer 276 20 60.69 45 AAATGGATGGGTTCCTTGCT
Right Primer 422 20 59.58 50 AAGACCTGGGTTGCATCAGT
Product Size: 147
Primer Set B:
Left Primer 216 22 59.87 50 GTCGTACCTTCCTGATTTGTCC
Right Primer 375 20 59.96 55 GGTCCAGTATCTGCCATCGT
Product Size: 160
![Page 8: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/8.jpg)
Chlorophyll A/B Binding Protein (CAB-1b) Accession # M14443 Chlorophyll A/B Binding Protein (CAB-1b) Accession # M14443 Coding Sequence Coding Sequence
1 atgaagaagt tgatggatta tagattgcca agtgtgctac acatgggatc ttgataccca1 atgaagaagt tgatggatta tagattgcca agtgtgctac acatgggatc ttgataccca 61 atgagatcat acatatagat atcacttgat aagatgattc tctctctttt ctcctatata 61 atgagatcat acatatagat atcacttgat aagatgattc tctctctttt ctcctatata
121 121 ttctcaaccc caactaactt catcttcatc acccatcaaa cacttaattc ttctctt acccatcaaa cacttaattc ttctcttaaa 181 ataaacacaa atggcagctg ctacaatggc tctttcttcc ccttcatttg ctggacaggc 181 ataaacacaa atggcagctg ctacaatggc tctttcttcc ccttcatttg ctggacaggc 241 agtc241 agtcaaactc tcaccatctg cctcagaaat ttctggaaat ggaaggatca ctatgagaaa gaaat ttctggaaat ggaaggatca ctatgagaaa 301 ggctgttgcc aagtccgccc catctagcag cccatggtat ggccctgacc gtgttaagta 301 ggctgttgcc aagtccgccc catctagcag cccatggtat ggccctgacc gtgttaagta 361 cttgggccca ttctctggtg agtccccaag ctacttgacc ggtgaa361 cttgggccca ttctctggtg agtccccaag ctacttgacc ggtgaatttc ctggtgatta 421 421 cgggtgggat accgctggac tttcagcaga ccctgaaact tttgccaaga accgtgaact ggat accgctggac tttcagcaga ccctgaaact tttgccaaga accgtgaact 481 tgaagtgatc cactgcagat gggctatgct tggtgctctt ggatgtgtct tccctgagct 481 tgaagtgatc cactgcagat gggctatgct tggtgctctt ggatgtgtct tccctgagct 541 cttggcccgt aatggtgtca agttcggtga ggctgtgtgg ttcaaggccg gatcccagat 541 cttggcccgt aatggtgtca agttcggtga ggctgtgtgg ttcaaggccg gatcccagat 601 cttcagtgaa ggtggacttg actacttggg caacccaagc ttggtccatg cacaaagcat 601 cttcagtgaa ggtggacttg actacttggg caacccaagc ttggtccatg cacaaagcat 661 cttggccatc tgggcttgcc aagttgtgtt gatgggagct gttgagggtt accgtattgc 661 cttggccatc tgggcttgcc aagttgtgtt gatgggagct gttgagggtt accgtattgc 721 tggtggacct cttggtgagg ttgtcgaccc actctaccct ggtggcagct tcgacccatt 721 tggtggacct cttggtgagg ttgtcgaccc actctaccct ggtggcagct tcgacccatt 781 aggccttgct gaagacccag aggcatttgc tgagctcaag gtaaaggaga tcaagaacgg 781 aggccttgct gaagacccag aggcatttgc tgagctcaag gtaaaggaga tcaagaacgg 841 tagacttgct atgttctcta tgtttggatt ctttgttcaa gctattgtca ccggaaaggg 841 tagacttgct atgttctcta tgtttggatt ctttgttcaa gctattgtca ccggaaaggg 901 tccattggag aaccttgctg atcaccttgc agaccccgta aacaacaatg cctgggcttt 901 tccattggag aaccttgctg atcaccttgc agaccccgta aacaacaatg cctgggcttt 961 cgccacaaac tttgtccccg gaaaatgact ctaaacgtct caagtcttgg tcgtttgatg961 cgccacaaac tttgtccccg gaaaatgact ctaaacgtct caagtcttgg tcgtttgatg
1021 acagtgtaaa gatgtagtgt gctacctgac aatataatga aattttgttt gtgtttgaat1021 acagtgtaaa gatgtagtgt gctacctgac aatataatga aattttgttt gtgtttgaat 1081 ggcttttctg tactgagttt cattttccca agtcaactca taaatcaagc actaacaatg1081 ggcttttctg tactgagttt cattttccca agtcaactca taaatcaagc actaacaatg 1141 atacaacaaa atgacccctc acatatgagt aataactaga aaaactgcaa tgctatgttg1141 atacaacaaa atgacccctc acatatgagt aataactaga aaaactgcaa tgctatgttg 1201 taaggttgaa cttgaatttt caactagagc agtttattta atttaatgaa ttc1201 taaggttgaa cttgaatttt caactagagc agtttattta atttaatgaa ttc
![Page 9: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/9.jpg)
Chlorophyll A/B Binding Protein Chlorophyll A/B Binding Protein Primer SetPrimer Set
Start Length Tm %G+C Seq
Primer Set A
Left Primer 55 21 59.86 47.62 AAACTCTCAACCATCTGCCTCA
Right Primer 236 20 60.74 50 CACCCGTAATCACCAGGA
Product Size: 147
![Page 10: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/10.jpg)
Real Time RT PCR Cycling Real Time RT PCR Cycling ParametersParameters
Polymerase activationPolymerase activation 95° C 95° C 10 min10 min40 cycles40 cyclesDenaturationDenaturation 95° C 95° C 60 sec60 secPrimer AnnealingPrimer Annealing 60° C 60° C 30 sec30 secExtensionExtension 7272˚ C˚ C 45 sec45 sec
Melt CurvesMelt CurvesDenaturationDenaturation 95° C 95° C 1 min1 minRenaturationRenaturation 55° C 55° C 1 min1 minDenaturationDenaturation Ramp 0.5° C every 10 secRamp 0.5° C every 10 sec
![Page 11: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/11.jpg)
Defining Parameters ofDefining Parameters ofReal Time RT PCRReal Time RT PCR
Cycle Threshold: Cycle # when product fluoresence exceeds that of background
Fold Change: 2ΔCt
Melt Curve: fluorescence plotted as a function of temperature as thermal cycler heats through dissociate temperature of product
![Page 12: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/12.jpg)
Data Analysis Work FlowData Analysis Work Flow
Extract Amp Plots, Melt Curve and Raw Data using ICycler SoftwareExtract Amp Plots, Melt Curve and Raw Data using ICycler Software
Excel Data Analysis
Examine Data OPD File containing Data OutputNTCMelt CurveAmp Plots
Data Presentation and Interpretation
![Page 13: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/13.jpg)
NTC ControlsNTC Controls
NTC’s- Negative Control Rxn with Primers but without TemplateNTC’s- Negative Control Rxn with Primers but without Template Examine Amp Plots to determine whether or not you have any amplification Examine Amp Plots to determine whether or not you have any amplification
products.products. The presence of an amplication product is indicative of contaminationThe presence of an amplication product is indicative of contamination Sources of contamination: water, primers, SYBR Green Master Mix, Pipets, etcSources of contamination: water, primers, SYBR Green Master Mix, Pipets, etc
![Page 14: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/14.jpg)
Melt Curve Analysis Melt Curve Analysis
Melt Curve used to Assess Specificity of RxnMelt Curve used to Assess Specificity of Rxn Do you have a single amplification peak or multiple amplification Do you have a single amplification peak or multiple amplification
peaks?peaks? Single Peak= Single ProductSingle Peak= Single Product Multiple Peaks= Multiple ProductsMultiple Peaks= Multiple Products What is the peak melt temperature and how does this correlate with the What is the peak melt temperature and how does this correlate with the
expected melt peak temperature?expected melt peak temperature? To further verify that you have amplified correct product can sequence To further verify that you have amplified correct product can sequence
amplification productamplification product
![Page 15: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/15.jpg)
Output data: Melt curveOutput data: Melt curve**
Relative fluorescence units
Gradual temperature-dependent fluorescencequenching
Rapid decrease in fluorescence caused by denaturation of dsDNA (PCR product)
Negative first derivative offluorescence/temperature
Melt peak (85.5º C)
![Page 16: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/16.jpg)
Identification of multiple PCR Identification of multiple PCR products using a melt curveproducts using a melt curve
product 2(Tm 86.9º C)
Under identical solvent conditions, Tm is determined by G/C content and length of dsDNA
primer dimer(Tm 77.0º C) product 1
(Tm 85.5º C)
![Page 17: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/17.jpg)
Output data: Amplification plotOutput data: Amplification plot**
Threshold
Relative fluorescence units
Ct Identifier25.925.9 B1 (red)B1 (red)
27.027.0 C1 (blue)C1 (blue)
Etc.
B1
C1
Ct Table*
![Page 18: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/18.jpg)
Output data: Amplification plotOutput data: Amplification plot
Wednesday Lab, Group #9
![Page 19: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/19.jpg)
Operator Variability in Operator Variability in Real Time PCR AnalysisReal Time PCR Analysis
![Page 20: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/20.jpg)
Relative Quantitation Relative Quantitation of Transcript Levelsof Transcript Levels**
Determine average Ct for each treatment (light, dark) ± standard deviation Determine ΔCt |Ct dark – Ct light| Calculate relative difference in transcript levels between samples (2ΔCt) Make a histogram to describe the relative difference in transcript abundance between light and dark samples
Caveats:• Amplification efficiency is rarely 2• Genomic DNA contamination
![Page 21: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll](https://reader036.vdocuments.us/reader036/viewer/2022062714/56649d5d5503460f94a3c4e5/html5/thumbnails/21.jpg)
Presentation of Real Presentation of Real Time RT PCR DataTime RT PCR Data
What to includeWhat to include::► Melt CurveMelt Curve► Raw Quantitative GraphRaw Quantitative Graph► Histogram of Relative Fold ChangeHistogram of Relative Fold Change