real time rt pcr data analysis. broad and long term objective to characterize the expression of...

21
Real Time RT PCR Real Time RT PCR Data Analysis Data Analysis

Post on 21-Dec-2015

213 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

Real Time RT PCR Real Time RT PCR Data AnalysisData Analysis

Page 2: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

Broad and Long Term ObjectiveBroad and Long Term Objective

To characterize the expression of ribulose 1-5 bisphosphate To characterize the expression of ribulose 1-5 bisphosphate

carboxylase oxygenase and chlorophyll AB binding gene in carboxylase oxygenase and chlorophyll AB binding gene in Lycopersicon esculentumLycopersicon esculentum (Tomato) leaves subjected to either 48 or (Tomato) leaves subjected to either 48 or 72 hours in the dark as compared to the expression in leaves grown 72 hours in the dark as compared to the expression in leaves grown under normal 12 hr light/dark cycle and harvested at noon.under normal 12 hr light/dark cycle and harvested at noon.

Page 3: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

Research PlanResearch Plan

RNA Isolation leaf material grown in light and in the dark

RNA Electrophoresis and cDNA synthesis

RBCS3 and Cab-1b transcript quantitation

by real time PCR

Analysis of real time PCR data

Page 4: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

Today’s Laboratory ObjectivesToday’s Laboratory Objectives

1.1. To learn how to interpret real time PCR data.To learn how to interpret real time PCR data.

Melt Curve AnalysisMelt Curve Analysis

Analysis of Cycle ThresholdsAnalysis of Cycle Thresholds

Calculating Relative FCalculating Relative Fold Change using the 2ΔCt

method

2.2. To interpret real time RT PCR data and draw meaningful To interpret real time RT PCR data and draw meaningful conclusions: ie, determine the conclusions: ie, determine the relative quantitation of RBCS3

or Cab-1b transcript levels in light- vs. dark-grown tomato plants

Page 5: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

Plate Set UpPlate Set Up

A1Tiffany/ShinobuLight

A2 Light

A3Light

A4Dark

A5Dark

A6Dark

A7NT

A8NT

A9 Max/KittyLight

A10Light

A11Light

A12Dark

B1Jack/SeanLight

B2Light

B3Light

B4Dark

B5Dark

B6Dark

B7NT

B8NT

B9Dark

B10Dark

B11NT

B12NT

C1Robyn/Cricket

C2Light

C3Light

C4Dark

C5Dark

C6Dark

C7NT

C8NT

C9AshleyAdnan

C10Light

C11Light

C12Dark

D1Thao/TramLight

D2Light

D3Light

D4Dark

D5Dark

D6Dark

D7NT

D8NT

D9Dark

D10Dark

D11NT

D12NT

E1Sandy/Beads

E2Light

E3Light

E4Dark

E5Dark

E6Dark

E7NT

E8NT

E9EEKLight

E10Light

E11Light

E12Dark

F1OBE/Chris

F2Light

F3Light

F4Dark

F5Dark

F6Dark

F7NT

F8NT

F9Dark

F10Dark

F11NT

F12NT

G1Damon/Phoenix

G2Light

G3Light

G4Dark

G5Dark

G6Dark

G7NT

G8NT

G9 G10 G11 G12

H1CourtneyAmanda

H2Light

H3Light

H4Dark

H5Dark

H6Dark

H7Dark

H8NT

H9 H1024 D&P

H1124 D&P

H1224 D&P

Page 6: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

1 aaaaatgaaa aactcgtcag aaagaaaaag caaaagcaac aaaaaaattg caagtatttt 61 ttaaaaaaga aaaaaaaaac atatcttgtt tgtcagtatg ggaagtttga gataaggacg 121 agtgaggggt taaaattcag tggccattga ttttgtaatg ccaagaacca caaaatccaa 181 tggttaccat tcctgtaaga tgaggtttgc taactctttt tgtccgttag ataggaagcc 241 ttatcactat atatacaagg cgtcctaata acctcttagt aaccaattat ttcagcaatg 301 gcttcttcag taatgtcctc agcagctgtt gccacccgcg gcaatggtgc acaagctagc 361 atggttgcac ccttcactgg actcaagtcc accgcttctt tccctgtttc aaggaagcaa 421 aaccttgaca ttacctccat tgctagcaac ggtggaagag tcagttgcat gcaggtttgt 481 gtgtgtatat atatatacgt acaacaaaat tcattgacta taatgttata ctcgattagc 541 taatttaact atttataatt gtataggtgt ggccaccaat taacatgaag aagtacgaga 601 ctctgtcgta ccttcctgat ttgtccgacg agcaattgct cagcgaaatt gagtacctat 661 tgaaaaatgg atgggttcct tgcttggaat tcgagactga ggtcaacatc tatctcctct 721 gtttttaaaa tttactagct agtatgttga tatgtcgtgt taacagtgtt gtgggatatc 781 atgtgcagca cggatttgtg taccgtgaga accataagtc accaggatac tacgatggca 841 gatactggac catgtggaag ttgcccatgt tcgggtgcac tgatgcaacc caggtcttgg 901 ctgaggtgca ggaggcaaag aaggcttacc cacaggcatg ggtccgtatc atcggattcg 961 acaatgttcg tcaagtgcag tgcatcagtt tcatcgctta caagcccgaa ggatactaaa 1021 tgtgtatatg tcaacagtga gaaactgttc gcattttccg ttttgcttct ttctttctat 1081 tcaatgtatg ttgttggatt ccagttgaat ttattatgag aactaataat aatagtaata 1141 atcatttgtt tctttactaa tttgcatttt cacatatgat ttctggtgca tatcataatt 1201 ttcattccac caatattaat ttccccattc aagttactta tgaaatagaa atcctcttct 1261 ccgactactt tatttgtccg aaagtcttgt ggctgctata taacgcaaaa tggatagaga 1321 agattcatta ctaagccgat c

RubisCO Small Subunit accession #X05986

Coding Sequence

Page 7: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

RubisCO Primer SetsRubisCO Primer Sets

Start Length Tm %G+C Seq

Primer Set A

Left Primer 276 20 60.69 45 AAATGGATGGGTTCCTTGCT

Right Primer 422 20 59.58 50 AAGACCTGGGTTGCATCAGT

Product Size: 147

Primer Set B:

Left Primer 216 22 59.87 50 GTCGTACCTTCCTGATTTGTCC

Right Primer 375 20 59.96 55 GGTCCAGTATCTGCCATCGT

Product Size: 160

Page 8: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

Chlorophyll A/B Binding Protein (CAB-1b) Accession # M14443 Chlorophyll A/B Binding Protein (CAB-1b) Accession # M14443 Coding Sequence Coding Sequence

1 atgaagaagt tgatggatta tagattgcca agtgtgctac acatgggatc ttgataccca1 atgaagaagt tgatggatta tagattgcca agtgtgctac acatgggatc ttgataccca 61 atgagatcat acatatagat atcacttgat aagatgattc tctctctttt ctcctatata 61 atgagatcat acatatagat atcacttgat aagatgattc tctctctttt ctcctatata

121 121 ttctcaaccc caactaactt catcttcatc acccatcaaa cacttaattc ttctctt acccatcaaa cacttaattc ttctcttaaa 181 ataaacacaa atggcagctg ctacaatggc tctttcttcc ccttcatttg ctggacaggc 181 ataaacacaa atggcagctg ctacaatggc tctttcttcc ccttcatttg ctggacaggc 241 agtc241 agtcaaactc tcaccatctg cctcagaaat ttctggaaat ggaaggatca ctatgagaaa gaaat ttctggaaat ggaaggatca ctatgagaaa 301 ggctgttgcc aagtccgccc catctagcag cccatggtat ggccctgacc gtgttaagta 301 ggctgttgcc aagtccgccc catctagcag cccatggtat ggccctgacc gtgttaagta 361 cttgggccca ttctctggtg agtccccaag ctacttgacc ggtgaa361 cttgggccca ttctctggtg agtccccaag ctacttgacc ggtgaatttc ctggtgatta 421 421 cgggtgggat accgctggac tttcagcaga ccctgaaact tttgccaaga accgtgaact ggat accgctggac tttcagcaga ccctgaaact tttgccaaga accgtgaact 481 tgaagtgatc cactgcagat gggctatgct tggtgctctt ggatgtgtct tccctgagct 481 tgaagtgatc cactgcagat gggctatgct tggtgctctt ggatgtgtct tccctgagct 541 cttggcccgt aatggtgtca agttcggtga ggctgtgtgg ttcaaggccg gatcccagat 541 cttggcccgt aatggtgtca agttcggtga ggctgtgtgg ttcaaggccg gatcccagat 601 cttcagtgaa ggtggacttg actacttggg caacccaagc ttggtccatg cacaaagcat 601 cttcagtgaa ggtggacttg actacttggg caacccaagc ttggtccatg cacaaagcat 661 cttggccatc tgggcttgcc aagttgtgtt gatgggagct gttgagggtt accgtattgc 661 cttggccatc tgggcttgcc aagttgtgtt gatgggagct gttgagggtt accgtattgc 721 tggtggacct cttggtgagg ttgtcgaccc actctaccct ggtggcagct tcgacccatt 721 tggtggacct cttggtgagg ttgtcgaccc actctaccct ggtggcagct tcgacccatt 781 aggccttgct gaagacccag aggcatttgc tgagctcaag gtaaaggaga tcaagaacgg 781 aggccttgct gaagacccag aggcatttgc tgagctcaag gtaaaggaga tcaagaacgg 841 tagacttgct atgttctcta tgtttggatt ctttgttcaa gctattgtca ccggaaaggg 841 tagacttgct atgttctcta tgtttggatt ctttgttcaa gctattgtca ccggaaaggg 901 tccattggag aaccttgctg atcaccttgc agaccccgta aacaacaatg cctgggcttt 901 tccattggag aaccttgctg atcaccttgc agaccccgta aacaacaatg cctgggcttt 961 cgccacaaac tttgtccccg gaaaatgact ctaaacgtct caagtcttgg tcgtttgatg961 cgccacaaac tttgtccccg gaaaatgact ctaaacgtct caagtcttgg tcgtttgatg

1021 acagtgtaaa gatgtagtgt gctacctgac aatataatga aattttgttt gtgtttgaat1021 acagtgtaaa gatgtagtgt gctacctgac aatataatga aattttgttt gtgtttgaat 1081 ggcttttctg tactgagttt cattttccca agtcaactca taaatcaagc actaacaatg1081 ggcttttctg tactgagttt cattttccca agtcaactca taaatcaagc actaacaatg 1141 atacaacaaa atgacccctc acatatgagt aataactaga aaaactgcaa tgctatgttg1141 atacaacaaa atgacccctc acatatgagt aataactaga aaaactgcaa tgctatgttg 1201 taaggttgaa cttgaatttt caactagagc agtttattta atttaatgaa ttc1201 taaggttgaa cttgaatttt caactagagc agtttattta atttaatgaa ttc

Page 9: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

Chlorophyll A/B Binding Protein Chlorophyll A/B Binding Protein Primer SetPrimer Set

Start Length Tm %G+C Seq

Primer Set A

Left Primer 55 21 59.86 47.62 AAACTCTCAACCATCTGCCTCA

Right Primer 236 20 60.74 50 CACCCGTAATCACCAGGA

Product Size: 147

Page 10: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

Real Time RT PCR Cycling Real Time RT PCR Cycling ParametersParameters

Polymerase activationPolymerase activation 95° C 95° C 10 min10 min40 cycles40 cyclesDenaturationDenaturation 95° C 95° C 60 sec60 secPrimer AnnealingPrimer Annealing 60° C 60° C 30 sec30 secExtensionExtension 7272˚ C˚ C 45 sec45 sec

Melt CurvesMelt CurvesDenaturationDenaturation 95° C 95° C 1 min1 minRenaturationRenaturation 55° C 55° C 1 min1 minDenaturationDenaturation Ramp 0.5° C every 10 secRamp 0.5° C every 10 sec

Page 11: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

Defining Parameters ofDefining Parameters ofReal Time RT PCRReal Time RT PCR

Cycle Threshold: Cycle # when product fluoresence exceeds that of background

Fold Change: 2ΔCt

Melt Curve: fluorescence plotted as a function of temperature as thermal cycler heats through dissociate temperature of product

Page 12: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

Data Analysis Work FlowData Analysis Work Flow

Extract Amp Plots, Melt Curve and Raw Data using ICycler SoftwareExtract Amp Plots, Melt Curve and Raw Data using ICycler Software

Excel Data Analysis

Examine Data OPD File containing Data OutputNTCMelt CurveAmp Plots

Data Presentation and Interpretation

Page 13: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

NTC ControlsNTC Controls

NTC’s- Negative Control Rxn with Primers but without TemplateNTC’s- Negative Control Rxn with Primers but without Template Examine Amp Plots to determine whether or not you have any amplification Examine Amp Plots to determine whether or not you have any amplification

products.products. The presence of an amplication product is indicative of contaminationThe presence of an amplication product is indicative of contamination Sources of contamination: water, primers, SYBR Green Master Mix, Pipets, etcSources of contamination: water, primers, SYBR Green Master Mix, Pipets, etc

Page 14: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

Melt Curve Analysis Melt Curve Analysis

Melt Curve used to Assess Specificity of RxnMelt Curve used to Assess Specificity of Rxn Do you have a single amplification peak or multiple amplification Do you have a single amplification peak or multiple amplification

peaks?peaks? Single Peak= Single ProductSingle Peak= Single Product Multiple Peaks= Multiple ProductsMultiple Peaks= Multiple Products What is the peak melt temperature and how does this correlate with the What is the peak melt temperature and how does this correlate with the

expected melt peak temperature?expected melt peak temperature? To further verify that you have amplified correct product can sequence To further verify that you have amplified correct product can sequence

amplification productamplification product

Page 15: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

Output data: Melt curveOutput data: Melt curve**

Relative fluorescence units

Gradual temperature-dependent fluorescencequenching

Rapid decrease in fluorescence caused by denaturation of dsDNA (PCR product)

Negative first derivative offluorescence/temperature

Melt peak (85.5º C)

Page 16: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

Identification of multiple PCR Identification of multiple PCR products using a melt curveproducts using a melt curve

product 2(Tm 86.9º C)

Under identical solvent conditions, Tm is determined by G/C content and length of dsDNA

primer dimer(Tm 77.0º C) product 1

(Tm 85.5º C)

Page 17: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

Output data: Amplification plotOutput data: Amplification plot**

Threshold

Relative fluorescence units

Ct Identifier25.925.9 B1 (red)B1 (red)

27.027.0 C1 (blue)C1 (blue)

Etc.

B1

C1

Ct Table*

Page 18: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

Output data: Amplification plotOutput data: Amplification plot

Wednesday Lab, Group #9

Page 19: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

Operator Variability in Operator Variability in Real Time PCR AnalysisReal Time PCR Analysis

Page 20: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

Relative Quantitation Relative Quantitation of Transcript Levelsof Transcript Levels**

Determine average Ct for each treatment (light, dark) ± standard deviation Determine ΔCt |Ct dark – Ct light| Calculate relative difference in transcript levels between samples (2ΔCt) Make a histogram to describe the relative difference in transcript abundance between light and dark samples

Caveats:• Amplification efficiency is rarely 2• Genomic DNA contamination

Page 21: Real Time RT PCR Data Analysis. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll

Presentation of Real Presentation of Real Time RT PCR DataTime RT PCR Data

What to includeWhat to include::► Melt CurveMelt Curve► Raw Quantitative GraphRaw Quantitative Graph► Histogram of Relative Fold ChangeHistogram of Relative Fold Change