P

Rr

HNa

b

c

d

ARR1AA

KHSPC

1

iotJ(Mtf(LsK

t

0d

Journal of Virological Methods 171 (2011) 339–344

Contents lists available at ScienceDirect

Journal of Virological Methods

journa l homepage: www.e lsev ier .com/ locate / jv i romet

rotocols

apid identification of human immunodeficiency virus type 1 CRF01 AE and BCecombinants by subtype-specific PCR

ao Luoa,b,1, Qi-Jian Sua,1, Yi-Ming Shaoc, Hui Xingc, Jie Chend, Wei Liud, Zhi-Yong Zhanga,ing Zanga, Xin Xiaoa, Hao Lianga,∗

Center for AIDS Research & Department of Epidemiology, School of Public Health, Guangxi Medical University, Nanning 530021, ChinaSchool of Public Health, Guangdong Medical College, Dongguan 523808, ChinaNational Center for AIDS/STD and Control Prevention, Chinese Center for Disease Control and Prevention, Beijing 100050, ChinaGuangxi Center for Disease Control and Prevention, Nanning 530021, China

rticle history:eceived 29 May 2010eceived in revised form7 November 2010ccepted 22 November 2010vailable online 30 November 2010

eywords:

a b s t r a c t

A subtype-specific PCR approach is described for the identification of HIV-1 intersubtype CRF01 AE andBC recombinants, the two predominant subtypes in Southern China. Primers were designed based onthe env and gag regions of the HIV-1 genome. Nested PCRs with primers targeting the env region wereperformed to amplify subtype C, CRF01 AE, or BC recombinants. To differentiate BC recombinants fromsubtype C virus, a BC recombinant specific gag PCR was then performed. In order to identify the CRF07 BCand CRF08 BC recombinant forms, an additional PCR step was included. Four HIV-1 samples of knownsubtype, 77 samples with unknown-subtype, and 30 HIV-negative control samples were tested by thenew assay. The results of this PCR-based subtyping approach were compared with that of a sequence-

IV

ubtype recombinantsCRhina

based phylogenetic analysis. In total, 73 (94.8%) samples were amplified by the subtype-specific PCRreactions, of which 39 were identified as CRF01 AE, 14 as CRF07 BC, and 20 as CRF08 BC. The sensitivityof this assay was 90.7% for the CRF01 AE recombinant and 100% for BC recombinants. The specificity was100% when used to identify 30 HIV-negative samples. The reproducibility was 93.8% for CRF01 AE, and100% for BC recombinants. This subtype-specific PCR technique represents a simple, rapid, and low-cost

n of H

assay for the identificatio

. Introduction

Human immunodeficiency virus type 1 (HIV-1) has been dividednto three main genetic groups: M (major), O (outlier), and N (newr non-M, non-O). Group M is responsible for the majority of infec-ions. This group can be subdivided into 9 subtypes (A to D, F to H,, and K) and 48 circulating recombinant forms (CRF01 to CRF48)www.hiv.lanl.gov/content/sequence/HIV/CRFs/CRFs.html).

olecular epidemiology surveys demonstrated that HIV-1 geno-ypes A, B′, C, D, CRF01 AE, CRF07 BC, and CRF08 BC have beenound in Southern China, mainly in Yunnan and Guangxi provincesChen et al., 1999; Piyasirisilp et al., 2000; Yang et al., 2003;iang et al., 2009). Of these, CRF01 AE and CRF08 BC recombinant

ubtypes are the predominant strains (Laeyendecker et al., 2005;ok et al., 2008).

Genetic diversity is a hallmark of HIV, making subtyping ofhe virus challenging. Several techniques have been utilized for

∗ Corresponding author. Tel.: +86 771 5358145; fax: +86 771 5351624.E-mail address: haolphd@163.com (H. Liang).

1 These authors contributed equally to this study.

166-0934/$ – see front matter © 2010 Published by Elsevier B.V.oi:10.1016/j.jviromet.2010.11.017

IV-1 CRF01 AE and BC recombinants in Southern China.© 2010 Published by Elsevier B.V.

identification of HIV-1 subtypes. Serotyping with the V3 pep-tide in an enzyme-linked immunosorbent assay (Sherefa et al.,1994) has been applied successfully to study the HIV-1 epidemicin Thailand (Gaywee et al., 1996; Kalish et al., 1995). However,enzyme immunoassays often show cross-reactivity and may beindeterminate and unreliable (Karita et al., 2007; Komninakis et al.,2007). Sequence-based phylogenetic analysis is the “gold stan-dard” for HIV subtyping. It is reliable, but requires sophisticatedfacilities and procedures and is therefore not practical as a rou-tine survey method in developing countries. Heteroduplex mobilityassay (HMA) is a frequently used and cost-effective alternative(Buonaguro et al., 1995; Delwart et al., 1993; Novitsky et al., 1996),but it requires parallel electrophoresis gels and is labor-intensiveand time-consuming. Furthermore, a number of recent reportshave shown discordance between results obtained by HMA andDNA sequencing and that HMA may be inappropriate in regionswhere different subtypes are co-circulating (Heslop et al., 2009;

Monteiro et al., 2009; Sarkar et al., 2009). Southern China is one suchregion and contains a high diversity of HIV genotypes. ElectronicMicroarrays have also been used for high-throughput subtypingof HIV-1 (Saunders et al., 2005), but it also requires sophisticatedfacilities and procedures. Polymerase chain reaction (PCR) has a

340 H. Luo et al. / Journal of Virological Methods 171 (2011) 339–344

Table 1Sequences of all primers used in this study.

Primer Sequence (5′–3′) Direction HXB2 position Product size Primer usage Reference

ED5 ATG GGA TCA AAG CCT AAA GCC ATGTG

Forward 6557–65821225 bp

Group M outerprimers

Laeyendecker et al.(2005)

ED12 AGT GCT TCC TGC TGC TCC CAA GAACCC AAG

Reverse 7811–7782

ENV7 CTG TTA AAT GGC AGT CTA GC Forward 7002–7021668 bp

Group M innerprimers

Zhang et al. (2003)ENV8 CAC TTC TCC AAT TGT CCY TYA (Y = C

or T)Reverse 7667–7647

ENV-c1 GTA ATA CCT CAG CCA TAA C Forward 6811–6829315 bp

Subtype C/BC innerprimers

This studyENV-c2 TGT TGG GTC TTG TAC ATA C Reverse 7175–7157ENV-ae1 CTA AGA GAT AAG AAG CAG AAG G Forward 6717–6738

411 bpCRF01 AE innerprimers

This studyENV-ae2 GGA GGG TCT GGT ACA ATT G Reverse 7174–7156Gag F2 ATG GGT GCG AGA GCG TCA RTA TTA

A(R = A or G)Forward 790–814

1242 bpCRF08 /CRF07 BCouter primers

Wei et al. (2004)

Gag e2 TCC AAC AGC CCT TTT TCC TAG G Reverse 2032–2011Gag-bc1 ACA CTA TAT GCT AAA ACA CC Forward 871–889

1079 bpCRF08 /CRF07 BCinner primers

This studyGag-bc2 CAT TTA ACA ATT CTT TTA GAG Reverse 1964–1944

08

5555

npppr(Ptpe

2

2

CfpwfthCiaCvbGcg

2

lsNEpa(w

Gag c CCAGCTCTTCAGACAGGAACAGAG Forward 985–10

Gag-08bc CTCATCTGGCCTGGTGCCACT Reverse 1475–14Gag-07bc TCTGTTATAGATGTCTCCTACTGGAAC Reverse 1581–15

umber of advantages when used for HIV-1 subtyping. It is sim-le, rapid, and less labor intensive (Gaywee et al., 1996). In therevious study, nested PCRs with three pairs of subtype-specificrimers in the second round were used to differentiate the gagegion of HIV-1 genotypes B, C, CRF01 AE, and CRF07/08 BC virusesWei et al., 2004). This report describes a new sensitive and specificCR-based method based on the env and gag region for the detec-ion of CRF01 AE and CRF BC recombinant subtypes, which are theredominant recombinant forms in southern China (Laeyendeckert al., 2005).

. Materials and methods

.1. Sample collection and DNA extraction

Seventy-seven HIV-1 positive samples provided by the Guangxienter for Disease Control and Prevention (CDC) were collected

rom Nanning (n = 30), Liuzhou (n = 25) and Baise (n = 22) in Guangxirovince, between 2007 and 2009. For each individual infectedith HIV-1, demographic information such as gender, age, HIV risk

actors, and length of infection, were obtained through a ques-ionnaire. Thirty HIV-1-negative peripheral blood samples fromealthy adult volunteer blood donors were provided by the GuangxiDC. Their HIV-negative status was confirmed by the HIV enzyme

mmunoassay. These samples were obtained under a protocolpproved by the Guangxi CDC Institutional Review Board and Ethicsommittee. Informed consent was obtained from each subject andolunteer blood donor. All HIV-positive samples were identifiedy HIV enzyme-linked immunosorbent assays and Western blot.enomic DNA was extracted from 300 �l of whole blood with aommercial DNA extraction kit (QIAquick Gel Extraction kit, Qia-en, Germany).

.2. Primer design

The env and gag regions of CRF01 AE and BC recombinants circu-ating in southern China were selected as the targets. The nucleotideequences of these strains were obtained from the Los Alamosational Laboratory sequence database (www.hiv.lanl.gov). The

D5/ED12 primer pair (Delwart et al., 1993) was used as the outerrimers for the env region (Table 1). The PCR products were thenmplified using the nested primers ENV7/ENV8 and sequencedZhang et al., 2003). The Gag F2/Gag e2 primer set (Wei et al., 2004)as employed as the outer primers for subtyping based on the

See below CRF08 /CRF07 BC inner forwardprimer This study

480 bp CRF08 BC inner reverse primer590 bp CRF07 BC inner reverse primer

gag region. The inner env and gag primers used for subtyping theCRF01 AE and BC recombinants were designed with Primer Premier5.0 software. These primers were targeted to sequences specific tothe recombinant forms and that are highly conserved within thesubtype. Primer pairs ENV-ae1/ENV-ae2 and ENV-c1/ENV-c2 in theenv region were designed for amplification of the CRF01 AE andBC recombinants, respectively (Table 1). Because BC recombinantshave pure subtype C in the env region and subtype C backboneswith small portions of subtype B in the gag region (Piyasirisilp et al.,2000; McCutchan et al., 2002; Su et al., 2000), ENV-c1/ENV-c2 maycross-react with both subtype C and BC recombinant viruses. There-fore, the additional primer pair Gag-bc1/Gag-bc2 was designedbased on the conserved gag portions of subtype B virus to dis-tinguish the BC intersubtype recombinants from pure subtype Cvirus. To further differentiate CRF07 /CRF08 BC from BC recombi-nants, three inner gag primers were also designed. The sequencesand positions of all primers are shown in Table 1 and Fig. 1.

2.3. PCR analysis and quality control

The first round PCR was performed with universal primer pairsfor HIV-1M group strains, and the second round reaction withthe subtype-specific primers. The first round PCR was performedin a 50 �l mixture containing 1× buffer, 200 �M (each) dNTP,1.5 mM MgCl2, 0.4 �M of each outer primer, 2.5 U of Taq poly-merase (CAS, Shanghai, People’s Republic of China) and 15 �l DNAtemplate. Then, 5 �l of first-round PCR products was added tothe second-round mixtures containing 1× buffer, 200 �M (each)dNTP, 1.5 mM MgCl2, 2.5 U of Taq polymerase, and 0.4 �M ofprimer in a 50 �l reaction. In the second round PCR, both ENV-ae1/ENV-ae2 and ENV-c1/ENV-c2 primer pairs were present inthe PCR mixture. Hot-start and touchdown techniques were usedto decrease the frequency of nonspecific reactions (Roux, 1995).PCR conditions are listed in Table 2. Subtype determination wasmade based on second-round PCR product sizes identified on anagarose gel (pure C and BC recombinant, approximately 315 bp;CRF01 AE, approximately 411 bp). When a 315 bp band appeared,an additional PCR with primer pair Gag-bc1/Gag-bc2 was per-formed to differentiate between pure subtype C virus or a BC

recombinant. The presence of a 1079 bp fragment confirmed thata BC recombinant was present instead of a subtype C virus.Another PCR was performed, with primer pairs Gag c/Gag-07bcand Gag c/Gag-08bc, to differentiate CRF07 BC from CRF08 BCvirus. Subtype determination was made based on PCR product

H. Luo et al. / Journal of Virological Methods 171 (2011) 339–344 341

F the mp

s4

tTIvaawf

2

Pwrpus(ABafc2N

3

3

i

.

ig. 1. Sketch map of subtype-specific nested PCR. The upper part of the diagram isart shows the approximate positions of primers used in nested PCR.

izes (CRF07 BC, approximately 590 bp; CRF08 BC, approximately80 bp).

This assay was tested using four positive controls of known sub-ype (subtypes B, C, and BC recombinants CRF07 BC and CRF08 BC).hese samples were provided by the Division of Virology andmmunology at the National Center for AIDS/STD Control and Pre-ention, Chinese Center for Disease Control and Prevention. Inddition, 30 samples from HIV-1-negative individuals were useds negative controls. In order to assess reproducibility, this assayas repeated five times on each of 20 samples selected at random

rom HIV-1 positive individuals.

.4. Sequence-based phylogenetic analysis

To determine whether the subtyping results by subtype-specificCR were accurate, the env region of each HIV-1 positive sampleas analyzed by sequencing and phylogenetic analysis. Second

ound PCR products obtained with one set of inner universalrimers were separated by agarose gel electrophoresis, purifiedsing a Qiagen gel extraction kit, and directly sequenced. DNAequencing was performed by using fluorescent dye terminatorsPrism BigDye terminator cycle sequencing ready reaction kit;pplied Biosystems) and an automated DNA sequencer (Appliediosystems model 310). To exclude the possibility of nonspecificmplification, 50% of the PCR products were randomly selectedor sequencing and aligned with Clustal X. Phylogenetic trees wereonstructed by the neighbor-joining method using MEGA package.1. Subtype reference sequences were obtained from Los Alamosational Laboratory database.

. Results

.1. Sequence-based phylogenetic analysis

Phylogenetic analysis of the 77 sequences derived fromndividuals infected with HIV revealed 43 sequences that clus-

apping of genome of CRF01 AE, subtypes B, C, CRF07 BC, and CRF08 BC. The lower

tered with CRF01 AE, while 14 and 20 sequences clusteredwith CRF 07BC and CRF08 BC, respectively. The sequencesamplified by subtype-specific primers were the same assequences obtained using the universal primer set, exclud-ing nonspecific amplification of similar-sized products. Theseresults were also confirmed by an online subtyping tool(http://www.ncbi.nlm.nih.gov/retroviruses/subtype/subtype.html)In addition, the DNA sequences amplified by subtype-specificprimers were also confirmed by online subtyping as well.

3.2. Assay reliability

Among the 77 samples, 94.8% (73 of 77) could be amplified bythis assay. The agarose gel electrophoresis results of a representa-tive sample are shown in Fig. 2. Of the 73 samples amplified by thistechnique, 39 were initially identified as CRF01 AE and 34 as sub-type C. All of the subtype C samples were amplified by the primerpair Gag-bc1/Gag-bc2 (Fig. 3) and identified as BC recombinants.34 samples amplified by primer pair Gag c/Gag-07bc or Gag c/Gag-08bc showed that 14 were defined as CRF07 BC and 20 classifiedas CRF08 BC (Fig. 4). Positive controls, including C, CRF07 BC, andCRF08 BC, were amplified by ENV-c1/ENV-c2, generating productsof the expected size (315 bp). CRF07 BC and CRF08 BC controls,but not the subtype C control, could also be amplified by the Gag-bc1/Gag-bc2 primer set (1079 bp) (Fig. 5). Both ENV-ae1/ENV-ae2and ENV-c1/ENV-c2 did not amplify the subtype B isolate. Basedon the results of phylogenetic analysis, the sensitivity of subtype-specific primer PCR was 90.7% (39 of 43) for CRF01 AE, 100% (14 of14) for CRF07 BC and 100% (20 of 20) for CRF08 BC. This assay didnot amplify any of the 30 HIV-negative samples (100% specificity).

3.3. Assay reproducibility

Of the 20 samples tested for assay reproducibility, 7 sampleswere BC recombinants, and 13 samples were CRF01 AE recom-binants. The assay was performed five times per sample. The

342 H. Luo et al. / Journal of Virological Methods 171 (2011) 339–344

Table 2Polymerase chain reaction conditions.

Primer paira Reaction conditions No. of cycles

ED5/ED12 94 ◦C for 5 min 194 ◦C for 30 s, 57 ◦C for 30 s, 72 ◦C for1 min

30

72 ◦C for 10 min 1ENV7/ENV8 94 ◦C for 5 min 30 s, 50 ◦C for 50 s, 72 ◦C

for 50 s1

94 ◦C for 30 s, 54 ◦C for 30 s, 72 ◦C for1 min

30

72 ◦C for 10 min 1ENV-c1/ENV-c2,

ENV-ae1/ENV-ae2b94 ◦C for 5 min, 56 ◦C for 1 min, 72 ◦Cfor 2 min

1

94 ◦C for 30 s, 54 ◦C for 30 s, 72 ◦C for1 min

3

94 ◦C for 30 s, 52 ◦C for 30 s, 72 ◦C for1 min

3

94 ◦C for 30 s, 50 ◦C for 30 s, 72 ◦C for1 min

3

94 ◦C for 30 s, 48 ◦C for 30 s, 72 ◦C for1 min

3

94 ◦C for 30 s, 46 ◦C for 30 s, 72 ◦C for1 min

20

72 ◦C for 10 min 1Gag F2/Gag e2 94 ◦C for 5 min, 52 ◦C for 1 min, 72 ◦C

for 2 min 30 s1

94 ◦C for 30 s, 52 ◦C for 30 s, 72 ◦C for1 min 30 s

30

72 ◦C for 10 min 1Gag-bc1/Gag-bc2 94 ◦C for 5 min, 48 ◦C for 1 min, 72 ◦C

for 2 min1

94 ◦C for 30 s, 48 ◦C for 30 s, 72 ◦C for1 min

35

72 ◦C for 10 min 1Gag c/Gag-07bc or Gag

c/Gag-08bcb94 ◦C for 2 min 1

94 ◦C for 30 s, 59 ◦C for 30 s, 72 ◦C for30 s

1

94 ◦C for 30 s, 58 ◦C for 30 s, 72 ◦C for30 s

3

94 ◦C for 30 s, 57 ◦C for 30 s, 72 ◦C for30 s

3

94 ◦C for 30 s, 56 ◦C for 30 s, 72 ◦C for30 s

3

94 ◦C for 30 s, 55 ◦C for 30 s, 72 ◦C for30 s

3

94 ◦C for 30 s, 54 ◦C for 30 s, 72 ◦C for30 s

3

94 ◦C for 30 s, 53 ◦C for 30 s, 72 ◦C for30 s

25

soar3

4

ipss

nc3ci

Fig. 2. Subtype specific PCR of env to distinguish CRF01 AE from BC recombinants.

The available assays for HIV subtyping based on DNA sequencesare laborious and not suitable for the rapid testing of a large numberof samples. PCR-based methods have been previously developedfor limited HIV subtyping (Chen et al., 2002; Wei et al., 2004;

Fig. 3. Subtype specific PCR of gag to differentiate between subtype C and BC recom-

72 ◦C for 10 min 1

a Primer pairs listed as forward/reverse primers.b Touchdown PCR was carried out for two primer pairs.

ubtyping assay failed in 2 of 5 tests for one individual and in 1f 5 attempts for two other individuals. The samples that failed tomplify all contained CRF01 AE recombinant viruses. The overalleproducibility of the assay was 100% for BC recombinants (35 of5 tests), and 93.8% for CRF01 AE recombinants (61 of 65 tests).

. Discussion

The purpose of this study was to develop a rapid method for thedentification of HIV-1 CRF01 AE and BC recombinants. The com-arison between sequence-based phylogenetic analyses and theubtype-specific primer PCR method illustrates the high sensitivity,pecificity, and reproducibility of this new approach.

In recent years, there has been a surge in the number of

ew HIV-infections in China. By the end of 2009, the recordedumulative number of HIV infections and AIDS cases had reached19,877 (http://www.unaids.org). HIV subtyping is an importantomponent in the monitoring of the spread of HIV with importantmplications in the development of HIV/AIDS prevention programs

The subtype-specific primers are ENV-ae1/ENV-ae2 and ENV-c1/ENV-c2 targetingthe env region of HIV-1. Lane M: DNA Marker; Lane 1: H2O; Lane 2: negative; Lane3: BC recombinant (315 bp); Lane 4: BC recombinant (315 bp); Lane 5: CRF01 AE(411 bp); Lane 6: CRF AE (411 bp); Lane 7: CRF01 AE (411 bp).

and the selection of HIV vaccine immunogens. The economicallyunder-developed areas of southern China account for nearly 50% ofall recorded HIV infections. There is a need for an efficient and cost-effective method to subtype common HIV subtypes in southernChina, where the majority of HIV infections occur.

binant. When DNA is successfully amplified by the nested PCR containing the primerset ENV-c1/ENV-c2, the subtype can be narrowed to either HIV-1 subtype C or BCrecombinant. Additional PCR runs with the primer set Gag-bc1/Gag-bc2 is conductedto amplify the gag region to differentiate between subtype C and BC recombinantvirus. Lane M: DNA Marker; Lane 1: BC recombinant (1079 bp); Lane 2: BC recom-binant (1079 bp); Lane 3: negative; Lane 4: H2O.

H. Luo et al. / Journal of Virological M

Fig. 4. Subtype specific PCR of gag to differentiate between CRF07 BC and CRF08 BC.The subtype-specific primers Gag c/Gag-07bc and Gag c/Gag-08bc target the gagregion of HIV-1. Lane M: DNA Marker; Lane 1: positive control for CRF07 BC (590 bp);Lane 2: positive control for CRF08 BC (480 bp).

Fig. 5. Subtype specific PCR of gag to differentiate positive control samples includingpure subtype C, CRF07 BC and CRF08 BC. The subtype-specific primers are Gag-bc1/Gag-bc2 targeting the conserved gag portions of subtype B virus. Lane M: DNAMarker; Lane 1: CRF07 BC (1079 bp); Lane 2: CRF08 BC (1079 bp); Lane 3: subtypeC; Lane 4: subtype B; Lane 5: H2O.

ethods 171 (2011) 339–344 343

Yagyu et al., 2002, 2005). In this study, a novel PCR-based sub-typing method was designed for the identification of CRF01 AEand BC recombinants, which are the major HIV-1 isolates found insouthern China (Laeyendecker et al., 2005; Kok et al., 2008). In addi-tion, this technique can further categorize CRF BC virus into eitherthe CRF07 BC or CRF08 BC recombinants. These subtype-specificprimers can distinguish rapidly between CRF01 AE, CRF07 BC, andCRF08 BC recombinants with a high degree of specificity, sensitiv-ity, and reproducibility.

This assay has some notable limitations. Since genetic diver-sity is a hallmark of HIV, new CRFs may appear in regions likesouthern China where multiple subtypes are co-circulating. Theprimer pair Gag-bc1/Gag-bc2 based on the gag portions of subtypeB would not be able to distinguish BC inter-subtype recombinantsfrom pure subtype C virus if the subtype recombination occurredin regions of the genome outside of gag. In addition, there was nota pure subtype C samples in the study. Even though Gag-bc1/Gag-bc2 primers are specific to BC inter-subtype recombinants, becauseof their similarity to subtype C, it is necessary to confirm CRF BCrecombinant assignment by PCR using Gag c/Gag-07bc and Gagc/Gag-08bc primers. Potential causes for poor amplification by thisassay include inadequate amounts of proviral DNA, poor qualitytemplate, and primer-template mismatch.

In summary, a simple, rapid, and economically feasible methodwas developed for the identification of HIV-1 subtypes. While thisassay is targeted to the HIV-1 CRF01 AE, CRF07 BC, and CRF08 BCrecombinant subtypes, the approach described here can be easilyadapted to identify HIV-1 inter-subtype recombinants prevalent inother regions of the world.

Acknowledgments

This study was supported by the Guangxi Natural Science Fund(No. 0447049) and the Guangxi Educational Personnel Department(No. 200677) in China. We thank Jonathan Li (Section of RetroviralTherapeutics, Brigham and Women’s Hospital) for his suggestionson the manuscript. We also thank Min Wei at Lady Davis Insti-tute, McGill AIDS Center, Jewish General Hospital, McGill Universityfor his helpful support, as well as Chanjian Lu at Hengxian CountyCenter for Disease Control and Prevention for his assistance.

References

Buonaguro, L., Del-Guadio, E., Monaco, M., Greco, D., Corti, P., Beth-Giraldo, E.,Buonaguro, F.M., Giraldo, G., 1995. Heteroduplex mobility assay and phyloge-netic analysis of V3 region sequences of human immunodeficiency virus type1 isolates from Gulu, northern Uganda. The Italian-Ugandan Cooperation AIDSProgram. J. Virol. 69, 7971–7981.

Chen, J., Young, N.L., Subbarao, S., Warachit, P., Saguanwongse, S., Wongsheree,S., Jayavasu, C., Luo, C.C., Mastro, T.D., 1999. HIV type 1 subtypes in Guangxiprovince, China, 1996. AIDS Res. Hum. Retroviruses 15, 81–84.

Chen, M.Y., Wang, W.K., Lee, M.C., Twu, S.J., Wu, S.I., Lee, C.N., 2002. Rapid detectionof human immunodeficiency virus type 1 subtype e infection by PCR. J. Clin.Microbiol. 40, 3805–3809.

Delwart, E.L., Shpaer, E.G., Louwagie, J., McCutchan, F.E., Grez, M., Rübsamen-Waigmann, H., Mullins, J.I., 1993. Genetic relationships determined by aDNA heteroduplex mobility assay: analysis of HIV-1 env genes. Science 262,1257–1261.

Gaywee, J., Artenstein, A.W., VanCott, T.C., Trichavaroj, R., Sukchamnong, A., Amlee,P., de Souza, M., McCutchan, F.E., Carr, J.K., Markowitz, L.E., Michael, R., Nit-tayaphan, S., 1996. Correlation of genetic and serologic approaches to HIV-1subtyping in Thailand. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 13,392–396.

Heslop, O.D., Smikle, M.F., Vickers, I.E., Christian, N.A., Harvey, K.M., Figueroa, J.P.,Brown, S.E., Christie, C.D., Bain, B., Barton, E.N., 2009. High genetic diversityin human immunodeficiency virus-type 1 in Jamaica. West Indian Med. J. 58,

195–200.

Kalish, M.L., Baldwin, A., Raktham, S., Wasi, C., Luo, C.C., Schochetman, G., Mastro,T.D., Young, N., Vanichseni, S., Rübsamen-Waigmann, H., 1995. The evolv-ing molecular epidemiology of HIV-1 envelope subtypes in injecting drugusers in Bangkok, Thailand: implications for HIV vaccine trials. AIDS 9, 851–857.

3 gical M

K

K

K

L

L

M

M

N

P

44 H. Luo et al. / Journal of Virolo

arita, E., Price, M., Hunter, E., Chomba, E., Allen, S., Fei, L., Kamali, A., Sanders, E.J.,Anzala, O., Katende, M., Ketter, N., 2007. Investigating the utility of the HIV-1 BED capture enzyme immunoassay using cross-sectional and longitudinalseroconverter specimens from Africa. AIDS 21, 403–408.

ok, K.T., Oliver, G.P., Xiao, J.L., Xiao, X.H., Hong, S., Adeeba, K., Yutaka, T., 2008. Tem-poral and spatial dynamics of human immunodeficiency virus type 1 circulatingrecombinant forms 08 BC and 07 BC in Asia. J. Virol. 82, 9206–9215.

omninakis, S., Fukumori, L., Alcalde, R., Cortina, M., Abdala, L., Brito, A., Sanabani,S., Duarte, A.J., Casseb, J., 2007. Techniques used to identify the Brazilian variantof HIV-1 subtype B. Braz. J. Med. Biol. Res. 40, 301–304.

aeyendecker, O., Zhang, G.W., Quinn, T.C., Garten, R., Ray, S.C., Lai, S., Liu, W., Chen,J., Yu, X.F., 2005. Molecular Epidemiology of HIV-1 Subtypes in Southern China.J. Acquir. Immune Defic. Syndr. 38, 356–362.

iang, Y.B., Liu, J.L., Li, Y.P., Zhu, H., Hou, Z.S., Zhang, S.F., Zhang, J.S., Qin, W.H.,Deng, Y., Liu, Y.F., Ji, R.C., Zhang, J.C., Wang, C.M., Wang, Z.J., 2009. Molecular-epidemiological survey of HIV-1 in the border areas of Yunnan. Chin. J. AIDS STD15, 457–459.

cCutchan, F.E., Carr, J.K., Murphy, D., Piyasirisilp, S., Gao, F., Hahn, B., Yu, X.F., Beyrer,C., Birx, D.L., 2002. Precise mapping of recombination breakpoints suggests acommon parent of two BC recombinant HIV Type 1 strains circulating in China.AIDS Res. Hum. Retroviruses 18, 1135–1140.

onteiro, J.P., Alcantara, L.C., de Oliveira, T., Oliveira, A.M., Melo, M.A., Brites, C.,Galvao-Castro, B., 2009. Genetic variability of human immunodeficiency virus-1 in Bahia state, Northeast, Brazil: high diversity of HIV genotypes. J. Med. Virol.81, 391–399.

ovitsky, V., Arnold, C., Clewley, J.P., 1996. Heteroduplex mobility assay for subtyp-ing HIV-1: improved methodology and comparison with phylogenetic analysisof sequence data. J. Virol. Methods 59, 61–72.

iyasirisilp, S., McCutchan, F.E., Carr, J.K., Sanders-Buell, E., Liu, W., Chen, J., Wag-ner, R., Wolf, H., Shao, Y., Lai, S., Beyrer, C., Yu, X.F., 2000. A recent outbreakof human immunodeficiency virus type 1 infection in southern China wasinitiated by two highly homogeneous, geographically separated strains, circu-lating recombinant form AE and a novel BC recombinant. J. Virol. 74, 11286–11295.

ethods 171 (2011) 339–344

Roux, K.H., 1995. Optimization and troubleshooting in PCR. In: Dieffenbach, C.W.,Dveksler, G.S. (Eds.), PCR Primer: A Laboratory Manual 53. Cold Spring HarborLab. Press, Plainview, NY.

Sarkar, R., Sengupta, S., Mullick, R., Singh, N.B., Sarkar, K., Chakrabarti, S., 2009.Implementation of a multiregion hybridization assay to characterize HIV-1strains detected among injecting drug users in Manipur, India. Intervirology 52,175–178.

Saunders, N.A., Alexander, S., Tatt, I., 2005. env Gene typing of human immunod-eficiency virus type 1 strains on electronic microarrays. J. Clin. Microbiol. 43,1910–1916.

Sherefa, K., Sonnerborg, A., Steinbergs, J., Sallberg, M., 1994. Rapid grouping of HIV-1infection in subtypes A to E by V3 peptide serotyping and its relation to sequenceanalysis. Biochem. Biophys. Res. Commun. 205, 1658–1664.

Su, L., Graf, M., Zhang, Y., von Briesen, H., Xing, H., Köstler, J., Melzl, H., Wolf, H., Shao,Y., Wagner, R., 2000. Characterization of a virtually full-length human immun-odeficiency virus type 1 genome of a prevalent intersubtype (C/B′) recombinantstrain in China. J. Virol. 74, 11367–11376.

Wei, M., Guan, Q., Liang, H., Chen, J.P., Chen, Z., Hei, F.X., Feng, Y., Hong, K.X., Huang,H.L., Xing, H., Shao, Y.M., 2004. Simple subtyping assay for human immunode-ficiency virus type 1 subtypes B, C, CRF01 AE, CRF07 BC, and CRF08 BC. J. Clin.Microbiol. 42, 4261–4267.

Yagyu, F., Ikeda, Y., Ariyoshi, K., Sugiura, W., Wongkhomthong, S.A., Masuda, M.,Ushijima, H., 2002. Differentiation of subtypes B and E of human immunodefi-ciency virus type 1 by polymerase chain reaction using novel env gene primers.J. Virol. Methods 101, 11–20.

Yagyu, F., Okitsu, S., Tanamoto, K., Ushijima, H., 2005. Determination of HIV-1 sub-types (A–D, F, G, CRF01 AE) by PCR in the transmembrane region (gp41) withnovel primers. J. Med. Virol. 76, 16–23.

Yang, R., Kusagawa, S., Zhang, C., Xia, X., Ben, K., Takebe, Y., 2003. Identificationand characterization of a new class of human immunodeficiency virus type 1recombinants comprised of two circulating recombinant forms, CRF07 BC andCRF08 BC, in China. J. Virol. 77, 685–695.

Zhang, J., Yu, X., Liang, H., 2003. Subtype analysis and sequence research of HIV-1 inShandong province. Chin. J. Microbiol. Immunol. 23, 366–370.