Pythium prolatum isolated from soil in the Burgundy region:a new record for Europe

Bernard Paul *, Delphine Galland, Isaac MasihLaboratoire des Sciences de la Vigne, Institut Jules Guyot, Universiteè de Bourgogne, B.P. 138, 21004 Dijon, France

Received 18 December 1998; received in revised form 28 January 1999; accepted 29 January 1999

Abstract

Pythium prolatum Hendrix and Campbell has been isolated from a soil sample taken in the Burgundy region in France. Thefungus is easily recognisable by its heavily ornamented oogonia with conical to mammiform spines, elongated sporangia, andits diclinous antheridia forming or originating from a tangled mass of hyphae. Descriptions of the morphological andreproductive aspects of Pythium prolatum, the polymerase chain reaction of the internal transcribed spacer (ITS1) of theribosomal nuclear DNA as well as the nucleotide sequences of ITS1 coding for 5.8 S rRNA are given. z 1999 Federation ofEuropean Microbiological Societies. Published by Elsevier Science B.V. All rights reserved.

Keywords: Sporangia; Antheridia; Oogonia; Nuclear ribosomal DNA; ITS1

1. Introduction

Pythium prolatum is an almost forgotten fungus.Since its original discovery in Georgia, USA [9] ithas been seldom reported from anywhere else inthe world. This rare fungus has been isolated froma soil sample taken in a garden in Genlis in theBurgundy region of France.

The members of the genus Pythium with morethan 120 described species are well distributed inthe world and occupy a wide range of terrestrialand aquatic habitats [6,19]. Most of these live assaprophytes degrading organic materials, but attimes, these can become serious plant pathogens

[8]. One species is also reported to be a mammalianparasite [5]. These are true fungi having coenocyticbranched mycelium, and phylogenetic comparisonsplace them close to algae and higher plants [18].Unlike most of the eumycetes, the members of thisgenus remain diploid throughout their life cycleswith meiosis occurring in the gametangia before fer-tilisation [11]. The female gametangia (oogonia) isusually smooth walled, but species having orna-mented oogonia are not rare for the genus, themost commonly occurring species with such oogoniais Pythium echinulatum. The wall ornamentations areusually spines and are merely extensions of the oo-gonial wall. The spines may be short or long, conicalor curved, with sharp or blunt apices, or may bedigitate, mammiform, or papillate [12]. The oogoniaof Pythium prolatum are conical to mammiform.

In recent days, the morphological descriptions of a

0378-1097 / 99 / $20.00 ß 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved.PII: S 0 3 7 8 - 1 0 9 7 ( 9 9 ) 0 0 0 5 8 - 0

FEMSLE 8657 17-3-99

* Corresponding author. Tel. : +33 (3) 8039-6143;Fax: +33 (3) 8039-6265; E-mail: bpaul@u-bourgogne.fr

FEMS Microbiology Letters 173 (1999) 69^75

species are increasingly supplemented by its molecu-lar characteristics [10]. The polymerase chain reac-tion coupled to restricted fragment length polymor-phism analysis (PCR-RFLP) has become a usefultool in fungal taxonomy [18,21] and is currentlyused to identify di¡erent species of Pythium [2^4,7,13]. Ampli¢cation of the ribosomal gene is usedfor the genetic identi¢cation of many organisms be-cause they comprise both highly conserved sequencesduring evolution and highly variable sequencesamong species and even within species. The riboso-mal nuclear DNA consists of transcribed and non-transcribed regions [2]. The ITS1 (internal tran-scribed spacer) is a non-conserved region and hasbeen ampli¢ed with the PCR method using universalprimers ITS1 and ITS2.

Quite a number of pythiaceous fungi have beenreported from France. Roze and Cornu [20] de-scribed Pythium pythioides (Cystosiphon pythioides)as early as in 1869 from this country, and Butler[1] reported Pythium rostratum from a garden soilin France. Paul [15,16,18] described some new spe-cies like Pythium radiosum, Pythium pachycaule var.rami¢catum, Pythium nodosum, and eight other spe-cies of this genus from the north of France [17].

During the course of a study of these fungi in theBurgundy region of France, Pythium prolatum hasbeen isolated and identi¢ed from a garden soil sam-ple taken in Genlis. The fungus is characterised byits smooth-walled and elongated sporangia, its oog-nia heavily ornamented with conical to mammiformspines. The morphological and reproductive detailsof this fungus, together with the sequence of thePCR ampli¢ed ITS1 region of ribosomal nuclearDNA are presented in this paper.

2. Materials and methods

The fungus was isolated from a garden soil sampletaken in Genlis in the Burgundy region of France byusing the usual baiting techniques of boiled hempseed halves [14,19]. The fungus was puri¢ed by re-peated washing with sterile distilled water and sub-culturing on solid media like potato carrot agar(PCA) and corn meal agar (CMA). No antibioticswere used in the puri¢cation process. All the cultureswere incubated at 25³C. The fungus was identi¢ed

with the help of keys provided by Middleton [12],Plaats-Niterink [19], and Dick [6].

The fungal DNA was extracted and the PCR ofthe internal transcribed spacer (ITS1) of the riboso-mal nuclear DNA was done using the proceduresdescribed earlier [18]. Universal primers ITS1 (TCCGTA GGT GAA CCT GCG G) and ITS2 (GCTGCG TTC TTC ATC GAT GC) were synthesisedand the DNA sequence was realised by Oligo Ex-press (Paris). ITS1 is at the 3P-end of the 17SrDNA gene and ITS2 is at the 5P-end of the 5.8SrDNA gene. The sequences obtained were comparedwith the available ITS1 sequences of Pythium :Pythium aphanidermatum, P. acanthicum, P. nodo-sum, and P. ultimum

3. Results

3.1. Morphological description of Pythium prolatum(Figs. 1^4)

Mycelium hyaline, main hyphae 6^8 Wm wide.Colonies on PCA are submerged giving a radiatepattern. The average daily growth of the fungus onPCA is 21 mm. The fungus grows luxuriantly onboiled hemp seed halves in water producing whitishcolonies.

Sporangia and zoospores are rarely formed. Thesporangia (Fig. 1a^j; Fig. 2a^f) are mostly elon-gated, at times spherical, usually possessing hypha-like projections, the spherical ones measuring 19^38Wm diameter and up to 110 Wm in length, terminal orintercalary.

Oogonia (Fig. 1k^n, Fig. 3a^f, Fig. 4a,b) are ter-minal, spherical, heavily ornamented with conical tomammiform spines (Fig. 3e, Fig. 4a,b), measuring24^55 Wm diameter (including spines), the oogonialspines are 4^10 Wm long and up to 5 Wm broad at thebase.

Antheridia are usually diclinous, either arising orgiving rise to a tangled mass of hyphae, usually oneantheridial cell per oogonium making broad lengthwise contact (Fig. 1k,l,n) and at times in£ated (Fig.3d).

Oospores (Fig. 1p^u) are aplerotic, smooth walled,measuring 16^30 Wm diameter, and are providedwith a moderately thick wall.

FEMSLE 8657 17-3-99

B. Paul et al. / FEMS Microbiology Letters 173 (1999) 69^7570

3.2. Nucleotide sequence of ITS1 region

The nucleotide sequence of ITS1 coding for 5.8SrRNA of Pythium prolatum is composed of 168 bases

which are: CTTTAATTAGGCTAAACTAAGGTC-GGAGTAAAATCTGGCTGATCTATCTTTTTAA-ACCCCTTACTTAATTACTGATTTATACTGTG-AGGACGAAAGTCTTTGCTTTTAACTAGATAA-

FEMSLE 8657 17-3-99

Fig. 1. Pythium prolatum: (a^j) sporangia of various shapes; (k^n) oogonia with antheridia; (o) oogonia provided with conical spines;(p^u) oogonia with aplerotic oospores. Scale bar: 20 Wm.

B. Paul et al. / FEMS Microbiology Letters 173 (1999) 69^75 71

CAACTTTCAGCAGTGGATGTCTAGGCTCGC-GCATCGATGAAGAACGCAGCA

This sequence, when compared with the ITS1 se-quences (FASTA)of Pythium aphanidermatum (174

bases), P. acanthicum (189 bases), P. nodosum (245bases), and P. ultimum (221 bases) gives the align-ment as shown in the Fig. 5.

FEMSLE 8657 17-3-99

Fig. 2. Microscopic study of vegetative and reproductive structures of Pythium prolatum : (a^d) sporangia; (e) sporangia with hypha-likeoutgrowths; (f) smooth-walled sporangia and ornamented oogonia, (g^h) ornamented oogonia. Scale bar: 40 Wm.

B. Paul et al. / FEMS Microbiology Letters 173 (1999) 69^7572

FEMSLE 8657 17-3-99

Fig. 3. Reproductive structures of Pythium prolatum : (a^c) oogonia with conical spines ; (d) antheridia with oogonia containing an apler-otic oospore; (e^f) oogonia covered with mammiform to conical spines. Scale bar: 20 Wm.

Fig. 4. Scanning electron micrographs of ornamented oogonia of Pythium prolatum. Scale bar: 10 Wm.

B. Paul et al. / FEMS Microbiology Letters 173 (1999) 69^75 73

4. Discussion

Pythium prolatum is characterised by its heavilyornamented oognia with conical to mammiform pro-jections, its elongated sporangia, and its diclinousantheridia. The morphological characteristics ofthis isolate do not vary much from that found inthe literature. The only di¡erence worth mentioningis the size of the oogonia. The oogonia of this isolateare bigger than those described by Plaats-Niterink[19], 24^55 Wm instead of 17^33 Wm. This di¡erencecan be attributed to the inclusion of the length ofspines. Our measurements are inclusive of spines,while those of Plaats-Niterink are perhaps not (ac-cording to the scale of her drawings, the oogoniaincluding spines are 30^45 Wm in diameter). Accord-ing to the observations of Plaats-Niterink [19],Pythium prolatum is closely related to Pythium anan-drum and Pythium megalacanthum. However, inthese species, the density of the oogonial spines isless than that found in Pythium prolatum. The an-theridial characters are also di¡erent.

The ITS1 sequence of Pythium prolatum with its

168 bases ¢ts in the prescribed length of 151^365 bpfor the genus Pythium [13]. This sequence, whencompared with those of Pythium acanthicum, P.aphanidermatum, P. nodosum, and P. ultimum showsthat it resembles P. ultimum more (85% identity)than P. acanthicum (74% identity). If only oogonialcharacteristics are taken into account, P. acanthicumshould have been closer to P. prolatum as both haveornamented oogonia, but this is not the case here.Since morphologically Pythium prolatum closely re-sembles P. megalacanthum and P. anandrum, itwould be interesting to compare the ITS1 sequencesof these fungi with those of P. prolatum. Unfortu-nately, the ITS1 sequences of these species are notavailable at present hence such a comparison cannotyet be made.

Acknowledgments

The authors would like to thank Prof. HubertDulieu of the `Universiteè de Bourgogne' for doingthe alignments and comparisons of the ITS1 regions

FEMSLE 8657 17-3-99

Fig. 5. CLUSTAL W Multiple sequence alignment of the ITS1 regions of Pythium aphanidermatum, P. acanthicum, P. nodosum, P. ulti-mum and P. prolatum.

B. Paul et al. / FEMS Microbiology Letters 173 (1999) 69^7574

of the described fungi. Thanks are also due to Al-phonsa Chereyathmanijyil of our laboratory for herhelp in preparation of this manuscript.

References

[1] Butler, E.J. (1907) An account of the genus Pythium and someChytridiaceae. Mem. Dept. Agr. India Bot. 1, 1^160.

[2] Chen, W. (1992) Restriction fragment length polymorphismsin enzymatically ampli¢ed ribosomal DNAs of 3 heterothallicPythium species. Phytopathology 82, 1467^1472.

[3] Chen, W., Hoy, J.W. and Schneider, R.W. (1992) Species-spe-ci¢c polymorphisms in transcribed ribosomal DNA of ¢vePythium species. Exp. Mycol. 16, 22^34.

[4] Chen, W., Schneider, R.W. and Hoy, J.W. (1992) Taxonomicand phylogenetic analyses of ten Pythium species using iso-zyme polymorphisms. Phytopathology 82, 1234^1244.

[5] De Cock, A.W.A.M., Mendoza, L., Padhye, A.A., Ajello, L.and Kaufman, L. (1987) Pythium insidiosum sp. nov., theetiologic agent of pythiosis. J. Clin. Microbiol. 25, 344^349.

[6] Dick, M.W. (1990) Keys to Pythium. University of ReadingPress, Reading.

[7] Grosjean, M.C. (1992) Classi¢cation et identi¢cation des es-peéces du genre Pythium, champignons phytopathogeénes dusol, par l'analyse de l'espace interne transcrit de l'operon ri-bosomique. Ph.D. Thesis, University of Lyon.

[8] Hendrix, F.F. and Campbell, W. (1973) Pythiums as plantpathogens. Annu. Rev. Phytopathol. 11, 77^98.

[9] Hendrix, F.F. and Campbell, W.A. (1969) A new species ofPythium with spiny oogonia. Mycologia 61, 387^391.

[10] Leèvesque, C.A., Harlton, C.E. and de Cock, A.W.A.M. (1998)

Identi¢cation of some oomycetes by reverse dot blot hybrid-isation. Phytopathology 88, 213^222.

[11] Martin, F. (1995) Meiotic instability of Pythium sylvaticum asdemonstrated by inheritance of the nuclear markers and kar-yotype analysis. Genetics 139, 1233^1246.

[12] Middleton, J.T. (1943) The taxonomy, host range and geo-graphic distribution of the genus Pythium. Mem. TorreyBot. Club 20, 1^171.

[13] Mugnier, J. and Grosjean, M.C. (1995) PCR catalogue inplant pathology: Pythium. In: Rhoêne-Poulenc Agro. Lyon,France.

[14] Paul, B. (1987) A new species of Pythium with ornamentedoogonia from Algeria. Mycologia 79 (5), 797^802.

[15] Paul, B. (1992) Pythium radiosum, a new species with orna-mented oogonia from France. Mycol. Helvetica 5, 1^8.

[16] Paul, B. (1993) A new variety of Pythium isolated from culti-vated soil in France. Mycol. Helvetica 5, 149^156.

[17] Paul, B. (1994) Some species of Pythium isolated from culti-vated soils in northern France. Cryptogamie Mycol. 15 (4),263^271.

[18] Paul, B., Galland, D., Bhatnagar, T., Dulieu, H. (1998) A newspecies of Pythium isolated from the Burgundy region ofFrance. FEMS Microbiol. Lett. 158, 207^213.

[19] Plaats-Niterink, A.J. Van der (1981) Monograph of the genusPythium. Studies in Mycology, Centraalbureau voor Schim-melcultures, Baarn. 21, 1^242.

[20] Roze, E. and Cornu, M. (1869) Cystosiphon pythioides Rozeand Cornu. Ann. Sci. Nat. Bot. 11 (5), 72^91.

[21] White, T.J., Bruns, T., Lee, S.B. and Taylor, J.W. (1990)Ampli¢cation and direct sequencing of fungal ribosomalRNA genes for phylogenetics. In: PCR Protocols A guideto Methods and Application (Innis, M.A., Ed.), pp. 315^322.

FEMSLE 8657 17-3-99

B. Paul et al. / FEMS Microbiology Letters 173 (1999) 69^75 75