pure.knaw.nl · rons innervate brain stem nuclei and might thus be related to autonomic dis-...

9

Upload: lythuy

Post on 26-Feb-2019

212 views

Category:

Documents

0 download

Report

Download

Embed Size (px):

TRANSCRIPT

Page 1: pure.knaw.nl · rons innervate brain stem nuclei and might thus be related to autonomic dis- turbances in MS. In MS the staining intensity for A VP was clearly lower and for OXT slightly

Page 2: pure.knaw.nl · rons innervate brain stem nuclei and might thus be related to autonomic dis- turbances in MS. In MS the staining intensity for A VP was clearly lower and for OXT slightly

Page 3: pure.knaw.nl · rons innervate brain stem nuclei and might thus be related to autonomic dis- turbances in MS. In MS the staining intensity for A VP was clearly lower and for OXT slightly

Page 4: pure.knaw.nl · rons innervate brain stem nuclei and might thus be related to autonomic dis- turbances in MS. In MS the staining intensity for A VP was clearly lower and for OXT slightly

Page 5: pure.knaw.nl · rons innervate brain stem nuclei and might thus be related to autonomic dis- turbances in MS. In MS the staining intensity for A VP was clearly lower and for OXT slightly

Page 6: pure.knaw.nl · rons innervate brain stem nuclei and might thus be related to autonomic dis- turbances in MS. In MS the staining intensity for A VP was clearly lower and for OXT slightly

Page 7: pure.knaw.nl · rons innervate brain stem nuclei and might thus be related to autonomic dis- turbances in MS. In MS the staining intensity for A VP was clearly lower and for OXT slightly

Page 8: pure.knaw.nl · rons innervate brain stem nuclei and might thus be related to autonomic dis- turbances in MS. In MS the staining intensity for A VP was clearly lower and for OXT slightly

Page 9: pure.knaw.nl · rons innervate brain stem nuclei and might thus be related to autonomic dis- turbances in MS. In MS the staining intensity for A VP was clearly lower and for OXT slightly

High-resolution mapping of time since disturbance and forest … · 2018. 12. 6. · H. Gu et al.: High-resolution mapping of time since disturbance 6323 turbances of varying severity;

pure.knaw.nl · 2 Department of Plant Pathology, University of Tsukuba, Tennodai, Tsukuba, Ibaraki, 305, Japan 3 Department of Plant Pathology, University of Stellenbosch, Shellenbosch,

SOCIETY OF AMERICAN FORESTERS Western Forester...Foresters have been dealing with dis-turbances and other “surprises” for decades. Based on a strong scientific foundation compiled

Endocrine diseases, perspectives and care in Turner syndrome · ovarian failure (2). The main endocrine problems are short stature, ovarian failure, immune diseases and dis-turbances

pure.knaw.nl · PDF filewijkingen: 3', placenta-insufficiëntie: 2; solutio placentae: y, placenta praevia: 5; placenta circumvallata: 3', constrictie + torsie navelstreng: 1 ;

pure.knaw.nl€¦ · Web viewActivating Senior Potential in Ageing Europe: an Employers’ Perspective. Wieteke Conen, Harry van Dalen, Kène Henkens, Joop Schippers. European Commission

Adaptive Second-order Sliding Mode Control of UAVs for ... · turbances. The control design includes the selection of the sliding manifold and the development of quasi-continuous

Bases genéticas e a evolução do comportamentogrupoetco.org.br/arquivos_br/aulas/etologia_aula_12.pdf · · 2016-05-1928/05/2013 3 Nocaute do gene Oxt em camundongos - Não produzem

pure.knaw.nl P. GOLD* , HANS CLEVERS* BALBINO ALARCON*, SABRINA DUNLAP* , JIRI NOVOTNY t ALAN F. WILLIAMS$, AND Cox TERHORST* …

Investigations of the response of hybrid particle ... · turbances. The recent results of the detection of the solar extreme events (2003–2005) by the monitors of the Aragats Space-Environmental

pure.knaw.nl€¦ · Web viewCombined effects of carbon, nitrogen and phosphorus on CH 4 production and denitrification in wetland sedimentsSang Yoon Kim1, Annelies J. Veraart1, Marion

pure.knaw.nl€¦ · Web view1Institute of Environmental Biology, Ecology & Biodiversity, Utrecht University, Padualaan 8, 3584 CH Utrecht, The Netherlands2Dept. of Forest Mycology

Calcium transients in brain ischemia: role in neuronal injury · Neuronal calcium homeostasis: mechanisms and importance Calcium homeostasis in neurones and its dis- turbances in

MAHARISHI UNIVERSITY OF MANAGEMENT VEDIC LITERATURE … samhita/5.sushruta_kalpa.pdf · 2019-07-28 · ko…kl" Svrvw’Ty ' £*çSt u mdm Czit 31O ˙„yeNmyUr ¨i√¶" £oxt" x

pure.knaw.nl Georgopoulos,¶ Frits Meijlink,S and Hans Clevers ... GGGCAAGTAGGGCACCCTTTGAAGCTCT annealed to CCC- AGAGCTTCAAAGGGTGCCCTACTTG. All oligonucleotides

CD74’and’OxytocinDRelated’Networks ... - Poster Talks · ... [CCK]%and%oxytocin% [OXT],%p=2.093e,4).%%% LowDG60vs. HighD,G60% Comparison%of%LowD60%vs%HighD60%showed% diﬀerenZal%expression%of%CD74%(upregulated,

ON SEISMIC RAYS AND WAVES* (Part One)authors.library.caltech.edu/47745/1/331.full.pdftematic study of the various phases of the propagation problem of seismic dis- turbances, both

JITTER CHARACTERIZATION IN SPACE MECHANISMSesmats.eu/esmatspapers/pastpapers/pdfs/2017/ayari.pdf · turbances using control schemes, over some bandwidth which depends on how the degrees

Legislative Assembly THURSDAY MARCH · ::\Ir. JENKI~SOX (Fr:ssifern): Pursuant to leave given n1e yesterday, I desire to present a Bill with reference to the suppression of dis turbances

pure.knaw.nl · Tulane University, Department of Medicine, and Veterans Administration Hospital, New Orleans, USA Summary. Using antibodies against A VT, ot-MSH, LHRH and somatostatin,

Negroes Move North - University of Minnesotamoses.law.umn.edu/.../Negroes_Move_North_The_Survey...in the movement, probably due to the economic and social di.. turbances of the decade

pure.knaw.nl file · Web

Developmental Trauma, Attachment, and Addiction...before and after 15 min parent-child “play and touch” session Stimulatory Contact LOW HIGH LOW HIGH Affectionate Touch OXT Levels

pure.knaw.nl · Author: karinh Created Date: 7/1/2015 2:07:44 PM

pure.knaw.nl · Web viewIntegrating quantitative morphological and qualitative molecular methods to analyze soil nematode community responses to plant range expansion . Stefan Geisen1,2,*,

Oxytocin modulates behavioral and physiological …...J. Cavanaugh et al. / Psychoneuroendocrinology 66 (2016) 22–30 23 primates (Neumann and Landgraf, 2012). For instance, OXT-deﬁcient

Reinforcement: Specifying P.A. Amplification...Comino v \oxt Month . \ext month will feature a complete listing of the papers to be presented at the 37th Audio Engineering Society

For Peer Review - pure.knaw.nl · Raaijmakers, Jos; Netherlands Institute of Ecology, Microbial Ecology Keywords: aquaculture, beneficial microbes, microbiomes, emerging diseases,

Chapter 9 Tools and Resources for Evaluating the ... 9... · Exhibit 1: Data Elements for Evaluating and ... aQd reOLabOe VtaQdardL]ed teVtV aQd JradXatLoQ drop oXt aQd reteQtLoQ

OXYGEN ENRICHMENT SYSTEMS Providing PSA Oxygen Systems ... · Systems for a highly reliable on-site oxygen source with low capital and operating costs. Oxair OXT-Series ranges from

pure.knaw.nl€¦ · Web viewClimate & Global Dynamics Laboratory, National Center for Atmospheric Research, Boulder, CO 80307, USA Institute for Arctic & Alpine Research, University

Basteria - pure.knaw.nl · Basteria TIJDSCHRIFT VAN DE NEDERLANDSE MALACOLOGISCHE VERENIGING VOL. 26, NO. 5 en6, PAG.61—88 28-XII-1962 Thelifecycle of thewatersnailAplexa hypnorum

Speciﬁcation and Estimation of Spatial Autoregressive ...econweb.umd.edu/~kelejian/Research/KP_0507.pdf · turbances to be generated by a spatial autoregressive process. Consistent

ErweiterungenfürLibreOﬃce erstellen - amantke.de · 2 DerContainerOXTundsein Inhalt Innerhalb des komprimierten Datei-Containers OXT beﬁnden sich mehrere Dateien undesistregelmäßigaucheinespezielleStrukturangelegt

Local oxytocin tempers anxiety by activating GABAA ... · the PVN in female prairie voles. We established a pharmacolog-ical paradigm demonstrating intra-PVN injections of Oxt prevent