puerarin protects against cadmium-induced proximal tubular...

lable at ScienceDirect

Chemico-Biological Interactions xxx (2016) 1e13

Contents lists avai

Chemico-Biological Interactions

journal homepage: www.elsevier .com/locate/chembioint

Puerarin protects against cadmium-induced proximal tubular cellapoptosis by restoring mitochondrial function

Xiang-Bin Song, Gang Liu, Zhen-Yong Wang, Lin Wang*

College of Animal Science and Veterinary Medicine, Shandong Agricultural University, Daizong Road No. 61, Tai'an 271018, People's Republic of China

a r t i c l e i n f o

Article history:Received 8 June 2016Received in revised form3 September 2016Accepted 3 October 2016Available online xxx

Keywords:CadmiumApoptosisMitochondriaPuerarinProximal tubular cellsPrimary cell culture

Abbreviations: ANT, adenine nucleotide translocasbicinchonininc acid; Cd, cadmium; Calcein-AM, calceicobalt chloride; cyt-c, cytochrome c; DCFH-DA, 20 , 70-MPTP, mitochondrial permeability transition pore; Mpoly ADP-ribose polymerase; PI, propidium iodide; Pbuffered saline; ROS, reactive oxygen species; rPT, rthiobarbituric acid reactive substances; TBA, thiobarbdrial membrane potential.* Corresponding author.

E-mail address: [email protected] (L. Wan

http://dx.doi.org/10.1016/j.cbi.2016.10.0060009-2797/© 2016 Elsevier Ireland Ltd. All rights rese

Please cite this article in press as: X.-B. Sonmitochondrial function, Chemico-Biological

a b s t r a c t

Puerarin (PU) is a potent free radical scavenger with a protective effect in nephrotoxin-mediatedoxidative damage. Here, we show a novel molecular mechanism by which PU exerts its anti-apoptoticeffects in cadmium (Cd)-exposed primary rat proximal tubular (rPT) cells. Morphological assessmentand flow cytometric analysis revealed that PU significantly decreased Cd-induced apoptotic cell death ofrPT cells. Administration of PU protected cells against Cd-induced depletion of mitochondrial membranepotential (DJm) and lipid peroxidation. Cd-mediated mitochondrial permeability transition pore (MPTP)opening, disruption of mitochondrial ultrastructure, mitochondrial cytochrome c (cyt-c) release, caspase-3 activation and subsequently poly ADP-ribose polymerase (PARP) cleavage could be effectively blockedby the addition of PU. Moreover, up-regulation of Bcl-2 and down-regulation of Bax and hence increasedBcl-2/Bax ratio were observed with the PU administration. In addition, PU reversed Cd-induced ATPdepletion by restoring DJm to affect ATP production and by regulating expression levels of ANT-1 andANT-2 to improve ATP transport. In summary, PU inhibited Cd-induced apoptosis in rPT cells byameliorating the mitochondrial dysfunction.

© 2016 Elsevier Ireland Ltd. All rights reserved.

1. Introduction

Cadmium (Cd) is a known occupational hazard and an envi-ronmental pollutant. Unlike complex organic pollutants, Cd cannotbe degraded by microorganisms; instead, it accumulates in eco-systems and enters the food chain through environmentalcontamination of soil and water for an extremely long biologicalhalf-life. It accumulates in multi-organs, particularly the renalcortex, where it preferentially damages the proximal tubule cells,leading to nephrotoxicity [1]. Moreover, conditions for in vivo ex-periments can not as easily be controlled as in vitro. The problemsof the extra-renal influences, which interfere with the observedeffects, could be also eliminated by using in vitro techniques. Fairly

e; BA, bongkrekic acid; BCA,n acetoxymethyl ester; CoCl2,dichlorofluorescein diacetate;DA, malondialdehyde; PARP,U, puerarin; PBS, phosphate-at proximal tubular; TBARS,ituric acid; DJm, mitochon-

g).

rved.

g, et al., Puerarin protects agInteractions (2016), http://dx

large quantities of tissue can be obtained and many concentrationsof toxicant can be measured in the same preparation [2]. And pri-mary cultures can better represent the live tissue than permanentcell lines. For these reasons, the primary cultures of rat proximaltubular (rPT) cells were used for culture in this study. In addtion,there is growing evidence suggesting that oxidative stress andmitochondrial damage are among the fundamental molecularmechanisms of Cd-induced nephrotoxicity [3e6].

In recent years, numerous studies have been performedconcentrating on the potential therapeutic properties of extractsfrom various medicinal plants. The beneficial effects of isoflavoneson human health have been recently given much attention due totheir health-enhancing potential. Puerarin (C21H20O9, PU) is anisoflavone glycoside that is extracted from the root of the wildleguminous creeper, Pueraria lobata and has been widely used totreat myocardial infarction, cerebral ischemia, cancer and osteo-porosis, and diabetic nephropathy in China [7]. PU has been re-ported to possess different biological activities including anti-oxidation, anti-inflammation, anti-apoptosis, cholesterol-lowering, hepatoprotection, renoprotection and neuroprotection[8e11]. Moreover, PU can also alleviate renal damage induced bynephrotoxins [12e14]. Given these beneficial properties, PU waschosen to evaluate its protective effect on Cd-induced

ainst cadmium-induced proximal tubular cell apoptosis by restoring.doi.org/10.1016/j.cbi.2016.10.006

mailto:[email protected]

www.sciencedirect.com/science/journal/00092797

www.elsevier.com/locate/chembioint

http://dx.doi.org/10.1016/j.cbi.2016.10.006



X.-B. Song et al. / Chemico-Biological Interactions xxx (2016) 1e132

nephrotoxicity in vitro.We previously reported that the apoptotic death promoted by

oxidative stress was the main mechanism of low-dose (0e5.0 mM)Cd-induced nephrotoxicity in rPT cells [15]. Mitochondria are thepowerhouse of the eukaryotic cell as they generate ATP throughoxidative phosphorylation. They are also the main source of reac-tive oxygen species (ROS) generation as well as the major targetorganelle of free radical attack [16]. Moreover, mitochondria arewell known as a key mediator of intrinsic apoptotic cell death.Increased formation of ROS, opening of the MPTP and subsequentloss of DJm have been suggested as possible factors responsible formitochondrial dysfunction and central markers of intrinsicpathway of apoptosis [16,17].

As previous study by Bo group [18] had shown that PU pre-vented apoptosis by inhibiting mitochondrial dysfunction, it will beinteresting to check whether PU would play its protective role inCd-induced nephrotoxicity via restoring mitochondrial dysfunc-tion. Hereby, a series of indices related to mitochondria-dependentapoptosis were analyzed to elucidate the nephroprotective effect ofPU on Cd-induced cytotoxicity in primary cultures of rPT cells.

2. Materials and methods

2.1. Chemicals and antibodies

Cadmium acetate (CdAc2), calcein acetoxymethyl ester (Calcein-AM), Hoechst 33258, collagenase IV, trypsin, EDTA/EGTA, DMEM-F12 (1:1), propidium iodide (PI), bongkrekic acid (BA), cobaltchloride (CoCl2), 20, 70- dichlorofluorescein diacetate (DCFH-DA), 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide(MTT), antibiotic-antimycotic solution and puerarin (40, 7-dihydroxy-8-b-D-glucosylisoflavone; purity > 98%, 82435) werepurchased from Sigma-Aldrich, USA. Accutase cell detachment so-lution and Annexin V-FITC Apoptosis Detection kit were purchasedfrom Pharmingen (Becton Dickinson Company, CA, USA). MitoP-robe™ JC-1 Assay Kit for Flow Cytometry (M34152) was purchasedfrom Molecular Probes Inc. (Eugene, OR, USA). PrimeScript® RTreagent kit with gDNA Eraser and SYBR® Premix Ex TaqTM RT-PCRkit were purchased from Takara Co. Ltd. (Takara, Dalian, China).Mitochondria isolation kit for cultured cells was obtained fromPierce Biotechnology (Rockford, IL, USA). BCA protein assay kit andenhanced chemiluminescence (ECL) kit were obtained from SangonBiotech Co.,Ltd. (Shanghai, China). The following primary anti-bodies were used: Bcl-2 (Cell Signaling Technology, 2870), Bax (CellSignaling Technology, 14796), ANT-1 (Abcam, ab180715), ANT-2(Santa Cruz Biotechnology, sc-70205), cleaved caspase-3 (CellSignaling Technology, 9661), cytochrome c (cyt-c, Cell SignalingTechnology,11940), cleaved PARP (Cell Signaling Technology, 9545),COX IV (Cell Signaling Technology, 11967) and b-actin (Sigma,A5441). All secondary antibodies were purchased from BeijingZhongshan Golden Bridge Biotechnology Co., Ltd (ZSGB, Beijing,China).

2.2. Cell culture and cadmium treatment

Sprague-Dawley rats used in this study were purchased fromShandong University (Ji'nan, China). All procedures followed theethics guidelines and were approved by the Animal Care and UseCommittee of Shandong Agricultural University.

Isolation, identification and culture of rPT cells were as previ-ously described [19]. Based on the doses of Cd in our previous study[15], 2.5 mM Cd were selected in this study. Regarding the optimalconcentration of PU chosen for this experiment, cells were treatedwith a range of PU doses (25, 50, 100, 200, 400, 800 mM) and/or2.5 mM Cd for 12 h to measure the cell viabilities using MTT assay as

Please cite this article in press as: X.-B. Song, et al., Puerarin protects agmitochondrial function, Chemico-Biological Interactions (2016), http://dx

follows: the tetrazolium salt MTT is reduced by the mitochondrialenzyme succinate dehydro-genase in living cells to yield purpleformazan crystals [20]. The absorbance of these formazan dyes at570 nm is proportional to the number of viable cells. The detailedprocedure is performed according to manufacturer's instructions.The stock solutions of CdAc2 and PU were dissolved in sterile ul-trapure water and DMSO, respectively. DMSO was less than 0.1%which exhibits no effect on cell viability. Based on an initialscreening, cell cultures undergoing experimental growth wereincubated with 100 mM PU and/or 2.5 mM Cd, in a serum-free me-dium at 37 �C for 12 h. Images were taken under phase-controlmicroscopy (Olympus, Japan) to analyze the cell morphology.

2.3. Analysis of apoptosis by morphological changes and flowcytometry

Details of the methods are described in our previous study [19].Briefly, in order to assess the effect of PU on apoptosis, rPT cellswere co-treated with 100 mM PU and 2.5 mM Cd for 12 h. Hoechst33258 staining was performed to assess the nuclear morphologicalchanges. 200 cells were randomly selected to count the apoptoticcells within every batch of experiment, each one performed intriplicate. Alternatively, quantitative analysis of apoptosis wasperformed by flow cytometry.

2.4. Measurement of ROS levels and mitochondrial membranepotential (DJm) by flow cytometry

Intracellular ROS generation was detected using a highly sen-sitive flow cytometric assay with the hydrogen peroxide-sensitivedye, DCFH-DA [21]. The first passage cells were seeded in 6-wellplates, then treated with Cd and/or PU (0, 2.5 mM Cd, 100 mMPU þ 2.5 mM Cd, 100 mM PU) for 12 h. After the treatment, rPT cellswere collected, washed twice with PBS and incubated with 100 mMDCFH-DA for 30 min in dark at 37 �C. The incubated cells wereharvested and suspended in phosphate-buffered saline (PBS;140 mM NaCl, 2 mM KCl, 1.5 mM KH2PO4, 8 mM Na2HPO4 pH 7.4)and ROS generation was measured by the fluorescence intensity(FL-1, 530 nm) of 10,000 cells on flow cytometer. Additionally,MitoProbe™ JC-1 Assay Kit was applied to assess the mitochondrialmembrane potential according to the manufacturer's protocol. JC-1exhibits a fluorescence shift from red (aggregates, at high trans-membrane potential) to green (monomers, at lower trans-membrane potential), when the mitochondrial membranepotential decreases [22]. The harvested cells following the treat-ment described above were incubated with 10 mM JC-1 for 20 minin dark at 37 �C, resuspended in PBS for the detection of DJm. Red/green fluorescence intensity ratio is used to quantitate the DJm.

2.5. Measurement of intracellular MDA levels

Thiobarbituric acid reactive substances (TBARS) assay is acommonly used method for the detection of malondialdehyde(MDA) level in biological samples. MDA is a byproduct of the lipidperoxidation and usually employed as a biomarker of oxidativestress [23]. The MDA in the sample was reacted with thiobarbituricacid (TBA) reagent to form a pink pigment, an adduct of TBA andMDA in a 2: 1 M ratio (MDA-TBA adduct), which can be easilyquantified colorimetrically (l¼ 532 nm) [24]. The first passage cellswere seeded in 4-well plates, treated with PU and/or Cd for 12 h.After the treatment, the detached and adherent cells were pooledand harvested by centrifugation. The harvested cells were lyzed inice-cold physiological saline by sonication followed by centrifuga-tion at 15,000� g for 5min at 4 �C. The resulting supernatants wereused immediately to measure theMDA level, using the formation of


X.-B. Song et al. / Chemico-Biological Interactions xxx (2016) 1e13 3

TBARS according to the manufacturer's protocol. The reactionmixture was incubated at 95 �C for 40 min. After cooling, thechromogen was read spectrophotometrically at 532 nm. The pro-tein concentrations of the samples were determined by BCAmethod to normalize the MDA level (nmol/mg protein).

2.6. Transmission electron microscopy on mitochondrialmorphology

After 12 h treatment, rPTcells were collected and fixedwith 2.5%glutaraldehyde in 0.1 M PBS, stained with osmium tetroxide,trapped in 4% agarose, dehydrated with ethanol and embedded inspurr-resin. Ultrathin sections were visualized using PHILIPS CM-120 transmission electron-microscope by the same histologistperson in a “blind” fashion.

2.7. Assessment of mitochondrial permeability transition pore(MPTP)

MPTP opening was assessed using the calcein-AM/cobaltmethod according to [25,26]. rPT cells were seeded on sterilecover glasses placed in the 24-well plates. After 12-h incubationwith Cd and/or PU, cells were washed with PBS and loaded with1 mM calcein-AM for 15 min at 37 �C in recordingmedium, followedby additional incubation with 1 mM CoCl2 for 1 h. After attainmentof quenching, cells were washed by recording medium free ofcalcein-AM and CoCl2. Calcein-AM loaded cells were then imagedon a laser scanning confocal microscope (LSM 710, Carl-Zeiss,Germany). Calcein was excited with an argon laser at 488 nm andemissions were monitored through a 525 nm emission filter.Confocal images were acquired and qualification was done by thedetermination of fluorescence intensity in at least 6 different visualfields selected randomly in one cover glass using Zeiss LSMConfocal Software.

2.8. Preparation of protein samples for immunoblotting

After exposed to Cd and PU for 12 h, cells were collected (about2 � 107 cells in each sample), then the mitochondrial and cytosolicprotein fractions were separated and prepared from cell pellets,using a reagent-based method per manufacturer's instruction(mitochondria isolation kit; Pierce). The mitochondria were thenlysed with RIPA buffer (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 0.1%SDS, 0.5% sodium deoxycholate and 1% NP-40) supplemented withprotease inhibitors cocktail (Merck Millipore, Darmstadt, Ger-many). In addition, the collected cells were lysed in RIPA buffer toprepare the whole cell lysates.

Table 1Primer sequences with their corresponding PCR product size.

Gene Primers(50/30)

Bcl-2 TGTGGATGACTGAGTACCGAGAAATCAAACAGAGGTC

Bax CTGCAGAGGATGATTGCTGAGATCAGCTCGGGCACTTTAG

ANT-1 ATTGTGTCGTGAGAATCCTGCTTGTACTTGTCCTTG

ANT-2 GTTCGCCGTCGTATGATGATGGCCTTGCCTCCTTCGTCTC

b-actin TCACCCACACTGTGCCCATCTATGACATCGGAACCGCTCATTGCCGATAG


2.9. Western blotting analysis

After protein quantification with BCA protein assay kit, samplescontaining 30 mg total cell lysates, mitochondrial proteins andcytosolic fractions were subjected to SDS-PAGE gel and transferredto 0.22 mm PVDF membranes. Membranes were incubated over-night at 4 �C with the following primary antibodies: cyt-c (diluted1:1000), cleaved caspase-3 (diluted 1:1000), cleaved PARP (diluted1:500), Bcl-2 (diluted 1:1000), Bax (diluted 1:1000), ANT-1 (diluted1:500), ANT-2 (diluted 1:200), COX IV (diluted 1:1000) and b-actin(diluted 1:5000). The membranes were then incubated withappropriate secondary antibodies (1:5000 dilution). Finally eachprotein was detected on a Chemidoc XRS (Bio-Rad, Marnes-La-Coquette, France) by using the ECL kit. Proteins levels were deter-mined by computer-assisted densitometric analysis (Densitometer,GS-800, BioRad Quantity One). The density of each band wasnormalized to its respective loading control (b-actin or COX IV).Data obtained were then expressed as the ratio of the intensity ofthe protein in chemical (Cd and/or PU)-treated cells to that of thecorresponding protein in control cells. Each test was performed infour experiments with different batches of cells.

2.10. RNA isolation, cDNA synthesis and quantitative real-time PCR(qRT-PCR)

Total cellular RNA was extracted using Trizol according to themanufacturer's manual. 1 mL (about 0.8 mg) RNA was used tosynthesize cDNA by using a PrimeScript® RT reagent kit withgDNA Eraser following to the protocol. qRT-PCR was performed onthe ABI PRISM® 7500 real time PCR analyzer (Applied Biosystems,Foster City, CA, USA) using the SYBR® Premix Ex TaqTM RT-PCR Kit.Four gene-specific primers were designed using Primer 5 softwarewith b-actin as endogenous control (Table 1). qRT-PCR reactionwas performed in triplicate for each sample and a mean value wasused to calculate mRNA levels. All assays were carried out in fourindependent experiments with different batches, each one per-formed in duplicate. Relative quantification and calculation of therange of confidence were performed with the comparative DDCTmethod [27].

2.11. Measurement of intracellular ATP levels and ADP/ATP ratio

Intracellular ATP levels were determined using a luciferin/luciferase based assay. Cells were rinsed with PBS and lysed with0.2 mL lysis reagent (Beyotime Institute of Biotechnology, Haimen,China). The ATP levels were quantified using the ATP Detection Kit(Beyotime Institute of Biotechnology, Haimen, China) with a Siriussingle tube luminometer (Berthold Technologies, GmbH & Co. KG,Germany). Experimental values were compared to an ATP standardcurve with values reported as nmol ATP per mg protein. Also, ADP/

Product(base pairs) Gene bank Accession No.

115bp NM_016993.1

174bp NM_017059.2

124bp NM_053515.1

107bp NM_057102.1

295bp NM_031144.3



ATP ratio was measured in rPTcells by the Bioluminescent ADP/ATPRatio Assay Kit (Abcam, Cambridge, UK; ab65313) following themanufacturer's instructions. Bioluminescence was acquired by theluminometer as mentioned above.

2.12. Statistical analysis

Experiments were performed at least three times with similarresults. Data are presented as the mean ± SEM of the indicatednumber of replicates. Statistical comparisons weremade using one-way analysis of variance (ANOVA) (Scheffe's F test) after ascer-taining the homogeneity of variance between the treatments, andP < 0.05 was regarded as significant.

3. Results

3.1. Protective effect of PU on Cd-induced cell death

Compared with the control, cell viabilities showed no significantchange after treatment with 25e200 mM PU for 12 h (P > 0.05),suggesting non-toxic effect of PU at these doses. However, treat-ment with higher doses of 400e800 mM PU resulted in a significantdecrease in cell viabilities (P < 0.05; Fig. 1). In addition, incubationof rPT cells with 50, 100, 200 mM PU significantly inhibited 2.5 mMCd-induced cell death (P < 0.05), respectively; 100 mM PU exhibitedthe most significant inhibitory effect. So, 100 mM PU was chosen toevaluate its protective effect on Cd-induced cytotoxicity.

As shown in Fig. 2, morphological analysis by phase contrastmicroscopy showed decreased cell density, cellular detachment,shrunk and round morphology in Cd-treated cells (Fig. 2B). How-ever, such morphologic changes were not detected in 100 mMPU þ 2.5 mM Cd (Fig. 2C), demonstrating the significant protectiveeffect of PU on Cd-induced cytotoxicity in rPT cells.

3.2. Cd-induced apoptosis can be reversed by PU in rPT cells

Low-dose Cd-induced cellular death in rPT cells is mediated byapoptosis mechanism [15]. So we next checked whether PUmediated cytoprotective effect via inhibiting the apoptosis. Firstly,apoptotic morphological changes in the nuclear chromatin weredetected by Hoechst 33258 staining (Fig. 3a). In control group, the

PU (μM) 0 0 25 25 50 50 100Cd (μM) 0 2.5 0 2.5 0 2.5 0

Cel

l via

bilit

y (%

of c

ontro

l)

b

a

88

90

92

94

96

98

100

102 a a a

b

c

Fig. 1. Effects of Cd and/or PU on cell viabilities in rPT cells after 12 h treatment. Cells were in12 h to determine the cell survival. Two different colors were chosen to point out which cemean ± SEM (n ¼ 6). Bars with different superscripts are statistically different (P < 0.05).


majority of cells appeared normal with uniformly stained nucleiand the chromatin of normal nuclei was unaltered and spreaduniformly throughout the entire nucleus. Whereas Cd-treated cellsexhibited typical morphological changes of apoptosis: fragmentedchromatin as characterized by a scattered, drop-like structure andcondensed chromatin located at the periphery of the nuclearmembrane. The nuclei of apoptotic cells appeared smaller andshrunken compared with intact cells. However, Cd-inducedapoptotic morphological changes could be potentially inhibitedby co-treatment with PU. Quantification of apoptotic cells byHoechst staining (Fig. 3b) is consistent with the result obtainedfrom flow cytometry analysis (Fig. 3c). These data confirms thepotent inhibitory effect of PU on Cd-induced apoptosis in rPT cells.

3.3. PU suppressed ROS generation and loss of DJm in Cd-treatedrPT cells

The intracellular ROS production with exposure to 2.5 mM Cdalone for 12 h treatment was elevated (Fig. 4a), whereas co-treatment with 100 mM PU significantly (P < 0.01) reduced theintracellular ROS level. Simultaneously, the level of intracellularMDA (a common end product of lipid peroxidation) was measuredto study the protective effect of PU on Cd-induced oxidative lesions(Fig. 4b). Cd exposure resulted in the significant generation of MDAlevels in rPT cells, compared with the control group; while additionof PU significantly decreased the Cd-induced intracellular MDAlevels (P < 0.01). Moreover, a significant decrease in DJm occurredin 2.5 mM Cd-treated rPT cells (P < 0.01), being 70.2% of the controlvalue (Fig. 4c). Likewise, PU treatment showed significant protec-tion of mitochondrial membrane potential in Cd-treated cells(86.7% of the control value).

3.4. PU attenuated Cd-induced mitochondrial ultrastructuralchanges and MPTP opening

Changes in mitochondrial morphology in rPTcells exposed to Cdand/or PU are shown in Fig. 5. In control group, the majority ofmitochondria had normal structures with intact membranes andcristae. Cells treated with 2.5 mM Cd showed typical morphologicalchanges of damage, mitochondria swelling, rupture of the mito-chondrial outer membrane and distorted mitochondrial cristae

100 200 200 400 400 800 800 2.5 0 2.5 0 2.5 0 2.5

bb

b

b

a

c

c

cubated with a range of PU doses (0, 25, 50, 100, 200, 400, 800 mM) and/or 2.5 mM Cd forlls were treated with CdAc2 (black) and which were not (white). Data are presented as


Fig. 2. Effect of Cd and/or PU on morphological changes in rPT cells observed under phase contrast microscope. Representative images, Magnification �200. Among the groups, A:control; B: 2.5 mM Cd; C: 100 mM PU þ 2.5 mM Cd; D: 100 mM PU.


(disruption or loss), whereas cells co-treated with Cd and PUexhibited obvious alterations in damaged mitochondria, with thealterations always less pronounced than that in cells treated withCd alone. As shown in Fig. 6, a reduction in mitochondrial calceinfluorescence represented the opening of MPTP during Cd exposureand Cd-mediated MPTP opening could be significantly reversed byco-incubation with PU. Compared with the Cd alone treatmentgroup, the mitochondrial calcein fluorescence significantlyincreased from 31.3% (2.5 mMCd) to 80.6% (2.5 mMCdþ 100 mMPU).

3.5. Cd-induced cyt-c release, caspase-3 activation and PARPcleavage can be reversed by PU

Translocation of cyt-c frommitochondria to cytosol due toMPTPopening, eventually caspase-3 activation (elevated cleaved caspase-3 level) and concomitant PARP cleavage are hallmarks ofmitochondria-mediated caspase-dependent apoptosis [28]. In thisstudy, increased cytosolic cyt-c levels as well as decreased mito-chondrial cyt-c levels were revealed in Cd-exposed rPT cells(Fig. 7a), accompanied by enhancement in cleaved caspase-3 pro-tein level (Fig. 7b). Furthermore, specific cleaved PARP antibodywas used to demonstrate Cd-induced PARP cleavage fragment(Fig. 7c). Based on these findings, it is conceivable that MPTPopening leads to the release of cyt-c, caspase-3 activation and PARPcleavage during Cd-induced mitochondrial apoptotic process.However, such changes can be significantly reversed by the addi-tion of PU, suggesting that PU could inhibit Cd-induced apoptosis


via blocking of caspase-dependent pathway.

3.6. PU inhibited Cd-induced apoptosis by altered expressions ofBcl-2 family proteins

The Bcl-2 family of proteins is the key regulator of intrinsicapoptosis (mitochondrial pathway of apoptosis), including pro-apoptotic and anti-apoptotic proteins [17]. In order to gain in-sights into the molecular mechanisms of PU inhibited Cd-inducedapoptosis, Bcl-2 (anti-apoptotic) and Bax (pro-apoptotic) werechosen to explore the role of both in the cytoprotection of PUagainst Cd-induced apoptosis. Fig. 8 shows that 2.5 mM Cd causedsignificantly decreased Bcl-2 and increased Bax expression at bothprotein and mRNA levels, leading to lower Bcl-2/Bax ratio. How-ever, PU efficiently suppressed such down-regulation of Bcl-2 andup-regulation of Bax, alleviating Cd-mediated reduction in the ratioof Bcl-2/Bax in rPT cells.

3.7. PU administration restored the ATP depletion in Cd-treatedcells

Intracellular ATP levels determine cell death fate by apoptosisand decreased ATP levels commit cells to apoptosis, while ADP/ATPratio is a reliable index for cell viability, cellular energy status andapoptosis [29,30]. As shown in Fig. 9, a significantly decreasedcellular ATP production indicated that disruption of energy meta-bolism is involved in Cd-induced apoptosis in rPT cells. And


(a)

(b) (c)

0

4

8

12

16

20

24

28

32Ap

opto

tic c

ells

(%)

Cd (μM) 0 2.5 2.5 0 PU (μM) 0 0 100 100

#**

0

5

10

15

20

25

30

35

40

% a

popt

otic

cel

ls

Cd (μM) 0 2.5 2.5 0 PU (μM) 0 0 100 100

**

#

Fig. 3. Effect of PU on Cd-induced apoptosis in rPT cells, measured by morphological changes and flow cytometry. (a) Cells were incubated with 2.5 mM Cd and/or 100 mM PU for12 h and nuclear chromatin changes (apoptosis) were analyzed by confocal microscopy after Hoechst 33258 staining. Changes of nuclei fragmentation with condensed chromatinare evident (thin arrows). (b) The statistical results of apoptotic cells assessed by Hoechst 33258 staining are expressed as mean ± SEM of three separate experiments and each oneperformed in triplicate (n ¼ 9). (c) Cells were treated with Cd and/or PU for 12 h to assess the apoptosis using flow cytometry. Data are mean ± SEM of three separate experimentsand each one performed in triplicate (n ¼ 9).**P < 0.01; #P < 0.01.


increase in the ADP/ATP ratio is another indicator of alterations inenergymetabolism during Cd exposure. Moreover, co-treatment Cdwith PU significantly restored the ATP levels and reduced the ADP/ATP ratio, indicating that PU has significant rescue effect on Cd-induced ATP depletion.

3.8. Role of ANT in the protection of PU against Cd-inducedapoptosis

ATP is mostly produced in the mitochondria by oxidativephosphorylation, then transferred to the cytosol via the ANT inexchange for ADP [30]. Hence, we focused on ANT, a crucial factor inATP utilization, to investigate its role in the cytoprotection of PUagainst Cd-induced apoptosis. Compared with Cd treatment alone,co-treatment Cd with BA (a specific inhibitor of ANT function)significantly restored the reduced ATP levels with decreased ADP/ATP ratio, which further confirmed that ANT dysfunction played akey role in Cd-induced ATP depletion (Fig. 10). Given the differentphysiological properties of ANT isoforms in apoptosis and mito-chondrial energy metabolism, we analyzed the expression levels of


ANT-1 and ANT-2. As shown in Fig. 11, Cd caused a significant in-crease in ANT-1 protein and mRNA levels, but ANT-2 protein andmRNA levels were significantly down-regulated during this pro-cess. However, co-incubation with PU and Cd significantly pre-vented Cd-induced ANT-1 up-regulation and ANT-2 down-regulation (P < 0.01), suggesting that PU played its rescue role onCd-induced ATP depletion by modulating the differential expres-sion of ANT isoforms.

4. Discussion

As previously reported, oxidative stress promoted the apoptosisin primary cultures of rPT cells exposed to Cd, while the collapse ofDJm highlighted the pivotal role of mitochondria in promoting theonset of Cd-induced apoptosis [15]. Moreover, mitochondrialdamage is involved in Cd-induced nephrotoxicity [5]. As a widelydistributed dietary antioxidant, little is known about the protectiveaction of PU against Cd-induced nephrotoxicity in vitro, although itpotentially contributes to the inhibition of mitochondrialdysfunction [18]. Based on our previous results and initial screening


(a) (b)

0

4000

8000

12000

16000

20000

24000

28000

Cd (μM) 0 2.5 2.5 0 PU (μM) 0 0 100 100

ecnecserou lFF

CD

#**

MD

A (n

mol

/mgp

rote

in )

Cd (μM) 0 2.5 2.5 0 PU (μM) 0 0 100 100

0

0.1

0.2

0.3

0.4

0.5

0.6

#**

(c)

Cd (μM) 0 2.5 2.5 0 PU (μM) 0 0 100 100

JC-1

Flu

ores

cenc

e (%

of c

ontro

l)

0

20

40

60

80

100

120

**#

Fig. 4. Effects of Cd and/or PU on generation of ROS (a), intracellular MDA levels (b) and DJm (c) in rPT cells. Cells were treated with 2.5 mM Cd and/or 100 mM PU for 12 h, thencells were collected. (a) The harvested cells were incubated with 100 mM DCFH-DA for 30 min at 37 �C, then DCF fluorescence was measured using flow cytometer with FL-1 filter.Fluorescence results are expressed as mean fluorescence intensity. (b) The harvested cells were used to detect the MDA levels using a commercial kit. (c) The harvested cells wereincubated with 10 mM JC-1 for 20 min at 37 �C, then green and red fluorescence was measured using flow cytometer with FL-1 filter (530 nm) and FL-2 filter (585 nm), respectively,and 10,000 events were acquired. The values of red/green fluorescence intensity ratio are quantified in a relative way to the control group, whose value is set at “100%”. Each barrepresents mean ± SEM (n ¼ 6). **P < 0.01; #P < 0.01.


of the optimal dose of PU (Fig. 1), 2.5 mM Cd and 100 mM PU werechosen in this study. Herein, this study was designed to investigatethe protective effect of PU on Cd-induced cytotoxicity in rPT cellsand treatment of 12 h exposure were chosen primarily.

Compared with the Cd treatment alone, significant increase incell viabilities (Fig. 1) and improvement of morphological changes(Fig. 2) after co-treatment with Cd and PU showed the protectiveaction of PU against Cd-induced cellular death. Consistent with thisresult, Cd-elevated apoptosis can be dramatically inhibited by co-incubation with PU, confirmed by two methods (Fig. 3); more-over, PU greatly alleviated Cd-induced intracellular ROS productionand MDA levels (markers of oxidative stress) (Fig. 4a and b).Mitochondria are the major source of intracellular ROS generationand highly sensitive to excess ROS [31]. Mitochondrial dysfunctionis largely attributed to the damaging effects of ROS [32]. Further-more, PU could significantly restore Cd-induced disruption of DJm(Fig. 4c) and mitochondrial ultrastructural changes in rPT cells(Fig. 5), indicating that PU played its anti-oxidative and anti-apoptotic roles by recovering Cd-induced mitochondrialdysfunction.

MPTP opening is a determinant factor in the activation ofmitochondria-mediated apoptosis under oxidative stress condi-tions [33], which could result in the loss of the DJm and subse-quent mitochondrial impairment (disruption of mitochondrialinner membrane integrity, mitochondrial matrix swelling andrupture of the mitochondrial outer membrane) [34,35]. Data inFig. 6 showed that PU contributed to inhibiting Cd-induced


apoptosis by blocking the MPTP opening. Moreover, MPTP open-ing directly results in the disruption of mitochondrial membranes,which will trigger the release of apoptogenic protein cyt-c frommitochondria to cytoplasm, and then activates death-driving pro-teolytic proteins known as caspases [33,36]. Caspase-3 is the mostwell-known downstream effector caspase and it is activatedthrough cleavage into active subunit (cleaved caspase-3) whichfacilitates apoptosis [37]. Cleaved caspase-3 will cleave a specificset of protein substrates, including procaspases themselves andPARP (one of the main cleavage targets of caspase-3), resulting inthe spreading of apoptotic death stimulus and eventually in theexecution of cell death [38]. In this study, PU significantly reversedCd-induced mitochondrial cyt-c release, caspase-3 activation andPARP cleavage in rPT cells (Fig. 7), explaining in detail the exactmechanism of PU against Cd-induced apoptosis by blocking MPTPopening.

In addition, Bcl-2 family proteins could regulate mitochondria-mediated apoptosis via controlling mitochondrial membranepermeability [39]. Increased Bax level can oligomerize and per-meabilize the mitochondrial outer membrane to promote the cyt-crelease, whereas decreased Bcl-2 level cannot prevent apoptosis byblocking the cyt-c release and subsequent caspase activation [17].Thus, the Bcl-2/Bax ratio determines the sensitivity of cells toapoptotic stimuli. As shown in Fig. 8, PU significantly inhibited Cd-induced Bax up-regulation, Bcl-2 down-regulation and resultingdecrease in the Bcl-2/Bax ratio at protein and mRNA expressionlevels, highlighting that PU can act on Bcl-2 family proteins to play


Fig. 5. Representative electron micrographs of mitochondria in rPT cells. Among the figures, A: control; B: 2.5 mM Cd; C: 100 mM PU þ 2.5 mM Cd; D: 100 mM PU. Swelling ofmitochondria, disruption of mitochondrial membranes (thin arrows) and damaged mitochondrion cristae (thick arrows) are marked in the figures.

(a) (b)

Rel

ativ

e C

alce

in F

luor

esce

nce

(% o

f con

trol)

0

20

40

60

80

100

120

Cd(μM) 0 2.5 2.5 0 PU(μM) 0 0 100 100

**#

Fig. 6. Effect of PU on Cd-induced MPTP opening in rPT cells, monitored by confocal microscopy. After a 12-h incubation with Cd and/or PU, cells were loaded with calcein-AM andCoCl2 (cytosolic calcein quencher) to determine the calcein fluorescence in the mitochondria. (a) Representative confocal images. (b) Quantification of calcein fluorescence. Thevalues of calcein fluorescence are quantified in a relative way to the control group, whose value of fluorescence is set at “100%”. Among the groups, A: control; B: 2.5 mM Cd; C:100 mM PU þ 2.5 mM Cd; D: 100 mM PU. Data in (b) represent mean ± SEM of three separate experiments and each one performed in duplicate (n ¼ 6). **P < 0.01; #P < 0.01.


Please cite this article in press as: X.-B. Song, et al., Puerarin protects against cadmium-induced proximal tubular cell apoptosis by restoringmitochondrial function, Chemico-Biological Interactions (2016), http://dx.doi.org/10.1016/j.cbi.2016.10.006

Fig. 7. Effects of Cd and/or PU on cyt-c release and subsequent caspase-3/PARP activation in rPT cells. Cells were treated with 2.5 mM Cd and/or 100 mM PU for 12 h and thenfractionated into the cytoplasm, the mitochondria and total cell lysates, respectively. Cyt-c (a), cleaved caspase-3 (b), and cleaved PARP (c) protein levels were assessed by westernblot analysis. Upper panels are representative images of western blot and lower panels are quantitative analysis performed with images of four independent experiments(mean ± SEM, n ¼ 4), respectively. **P < 0.01; #P < 0.01.


its protective role against Cd-induced mitochondrial dysfunction.Another notable event in the role of mitochondria-mediated

apoptosis is related to cellular ATP production and utilization. Inthis study, decreased ATP levels and increased ADP/ATP ratiodemonstrate that abnormal cellular energy metabolism couldpromote Cd-induced apoptosis in rPT cells, but PU plays animportant role in rescuing Cd-induced ATP depletion (Fig. 9). Next,the possible mechanism was elucidated from the point of ATPproduction and transport. Firstly, ATP is mostly produced in themitochondria through the electron transport chain, the primaryfunction of which is ATP synthesis through the oxidative phos-phorylation process [16]. It should be stressed that DJm is thedriving force for mitochondrial ATP synthesis and loss of DJm canresult in ATP depletion, because DJm is primarily achieved by a Hþ

ion gradient generated by electron transport and this Hþ gradient isused by the F0F1-ATPase synthase to synthesize ATP [40]. PU exertsits capacity to restore ATP production possibly by alleviating Cd-induced DJm collapse (Figs. 4c and 9), but this needs furtherinvestigation. After formation, ATP is then transferred to the cytosolby the ADP/ATP carrier-ANT (the unique catalyst of ADP/ATPtranslocase in mitochondrial inner membrane) in exchange withADP [30]. Meanwhile, ANT takes up a conformational orientation


toward the cytoplasm (c-state) or toward the mitochondrial matrix(m-state), while BA can bind to the ANT ATP-binding site anddirectly lock ANT at m-state to increase matrix adenine nucleotidebinding affinity [41,42]. Data in Fig.10 suggest that ANT dysfunctionplayed a key role in Cd-induced ATP depletion. Two isoforms (ANT-1, ANT-2) play different roles in the apoptotic process because theirexpression vary according to mitochondrial energy metabolism[41]. As a pro-apoptotic protein, enhanced ANT-1 can induce theincrease of ATP export from the matrix and subsequent ATPdepletion [41]. While ANT-2 has an anti-apoptotic function, it actsas a direct inhibitor of the mitochondrial permeability transitionfunction by favoring the import of ATP into mitochondria andmaintaining m-state of ANT [41]. Data in Fig. 11 indicate that Cdmay affect ATP transport by regulating the expression of ANT iso-forms, while PU can reverse the variations in ANT-1/ANT-2expression to restore ATP transport.

However, side effects of PU therapy has also been reported. Forexample, PU (5 and 10 mM) caused retardation of mouse embryonicdevelopment and decreased the viability. PU injection led to he-molysis clinically [43]. This status might be attributed to differentdoses, treatment times and dosage forms of PU used in differentanimal and cell models. Although good connections exist between


Fig. 8. Effects of Cd and/or PU on protein levels of Bcl-2 (a) and Bax (b), analyzed by immunoblot; and mRNA transcription levels of their encoding genes (c, d), assessed by qRT-PCRmethod. (a, b): Representative images of western blot were shown (upper panels) and quantitative data (lower panels) were performed with images of four independent ex-periments (mean ± SEM, n ¼ 4), respectively. (c, d): The graphs represent the mRNA transcription levels of two genes, which are quantified in a relative way to the control group (itsexpression level is set at one). Data represent mean ± SEM (n ¼ 8). **P < 0.01; #P < 0.01.

)t orpg

m/PTAlo

mn(sleve l

PTA

0

2

4

6

8

10

12

14

Cd (μM) 0 2.5 2.5 0 PU (μM) 0 0 100 100

**#

(a)

AD

P/A

TP ra

tio

0

1

2

3

4

5

6

Cd (μM) 0 2.5 2.5 0 PU (μM) 0 0 100 100

**#

(b)

Fig. 9. Effects of Cd and/or PU on intracellular ATP levels and ADP/ATP ratio in rPT cells. Cells were treated with Cd and/or PU for 12 h, then collected to measure the cellular ATPlevels (a) and ADP/ATP ratio (b). Values represent mean ± SEM made in six different primary cultures (n ¼ 6). **P < 0.01; #P < 0.01.


in vitro and in vivo toxicity data, there are many other possibledifferences in biovailability of test compounds between in vitro andin vivo systems andwithin in vitro systems [44]. The poor solubility,low oral bioavailability, and short elimination half-life of puerarin


limit its clinical application further. For that matter, further re-searches are needed to improve its oral bioavailability and atten-uate side effects [43]. Additionally, there is some difference in totalanti-oxidant capacity between in vitro culture medium and in vivo


(b)(a)

)torpg

m/PTAlo

mn(slevel

PTA

Cd (μM) 0 2.5 2.5 0 BA (μM) 0 0 2 2

0

2

4

6

8

10

12

14**

#

0

1

2

3

4

5

6

AD

P/A

TP ra

tio

Cd (μM) 0 2.5 2.5 0 BA (μM) 0 0 2 2

**#

Fig. 10. Effects of Cd and/or BA (ANT inhibitor) on intracellular ATP levels and ADP/ATP ratio in rPT cells. Cells were incubated with 2.5 mM Cd and/or 2 mM BA for 12 h to determinethe ATP levels (a) and ADP/ATP ratio (b). Values represent mean ± SEM made in six different primary cultures (n ¼ 6). **P < 0.01; #P < 0.01.

Fig. 11. Effects of Cd and/or PU on protein levels of two ANT isoforms (a, b), analyzed by immunoblot; and mRNA expression levels of their encoding genes (c, d), assessed by qRT-PCR method. (a, b): Representative images of western blot were shown (upper panels) and quantitative data (lower panels) were performed with images of four independentexperiments (mean ± SEM, n ¼ 4), respectively. (c, d): The graphs represent the mRNA transcription levels of two genes, which are quantified in a relative way to the control group(its expression level is set at one). Data represent mean ± SEM (n ¼ 8). **P < 0.01; #P < 0.01.


environment. It has been reported that cells in culture are sur-rounded by a fluid that has a lower total anti-oxidant capacity thantheir in vivo environment [45], althoughmedia containing pyruvateshowed much less H2O2 production due to its ability to removeH2O2 [46]. In this study, cells of four groups (control; 2.5 mM Cd;


100 mMPUþ 2.5 mM Cd; 100 mM PU) were cultured under the samemedium (DMEM-F12), which can counteract the effect of mediumcomponents on the results (ROS and MDA).

In summary, the possible protective mechanism of PU againstCd-induced apoptosis in rPT cells is expounded (Fig. 12). Firstly, co-


Fig. 12. Scheme of the protective mechanism of PU against Cd-induced apoptosis in rPT cells by recovering mitochondrial dysfunction. Cd-induced mitochondrial permeabilitytransition (MPT) activation (MPTP opening) promoted the mitochondrial ultrastructural changes, mitochondrial cyt-c release and caspase-3 activation and PARP cleavage, leading toapoptosis in rPT cells. Cd-mediated collapse of DJm via MPTP opening and differential expression levels of ANT-1 and ANT-2 caused ATP depletion, which resulted in apoptosis inrPT cells. Also, decreased Bcl-2 and increased Bax together with down-regulation of Bcl-2/Bax ratio at both transcription and translation levels are involved in Cd-induced apoptosis.However, these changes can be potently blocked by the addition of PU.


treatment with PU protected rPTcells against Cd-induced apoptosisas evidenced by promoting cell viability, improving morphologicalchanges and reducing apoptosis. Secondly, PU attenuated Cd-induced mitochondria-mediated apoptosis by blocking MPTPopening, mitochondrial cyt-c release, caspase-3 activation andconcomitant PARP cleavage. Meanwhile, up- and down-regulationsof Bcl-2 and Bax with increased Bcl-2/Bax ratio due to PU admin-istration alleviated Cd-induced mitochondrial apoptosis. Thirdly,PU reversed Cd-induced ATP depletion by affecting DJm and theexpression of ANT isoforms to promote ATP production andtransport.

Conflict of interest

None declared.

Acknowledgements

This work was supported by the National Nature ScienceFoundation of China (No. 31472251), a Foundation for the Author ofNational Excellent Doctoral Dissertation of PR China (No. 201266)and the fund of Fok Ying Tong Education Foundation under GrantNo. 141022. We thank Bilon Khambu (Indiana University School ofMedicine, Indianapolis, Indiana 46202) for revising this paper.

Transparency document

Transparency document related to this article can be foundonline at http://dx.doi.org/10.1016/j.cbi.2016.10.006.

References

[1] F. Th�evenod, W.K. Lee, Live and let fie: roles of autophagy in cadmiumnephrotoxicity, Toxics 3 (2015) 130e151.

[2] P.J. Boogaard, J.F. Nagelkerke, G.J. Mulder, Renal proximal tubular cells insuspension or in primary culture as in vitro models to study nephrotoxicity,Chem. Biol. Interact. 76 (1990) 251e291.

[3] W.K. Lee, U. Bork, F. Th�evenod, Mitochondria as a target of cadmium neph-rotoxicity: induction of swelling and cytochrome c release, Toxicol. Mech.Methods 14 (2004) 67e71.

[4] G. Gobe, D. Crane, Mitochondria, reactive oxygen species and cadmiumtoxicity in the kidney, Toxicol. Lett. 198 (2010) 49e55.

[5] L. Wang, J.J. Li, J.G. Li, Z.P. Liu, Effects of lead and/or cadmium on the oxidativedamage of rat kidney cortex mitochondria, Biol. Trace Elem. Res. 137 (2010)69e78.


[6] A. Kobroob, N. Chattipakorn, O. Wongmekiat, Caffeic acid phenethyl esterameliorates cadmium-induced kidney mitochondrial injury, Chem. Biol.Interact. 200 (2012) 21e27.

[7] S.Z. Hou, Z.R. Su, S.X. Chen, M.R. Ye, S. Huang, L. Liu, H. Zhou, X.P. Lai, Role ofthe interaction between puerarin and the erythrocyte membrane in puerarin-induced hemolysis, Chem. Biol. Interact. 192 (2011) 184e192.

[8] C.M. Liu, J.Q. Ma, S.S. Liu, Z.J. Feng, A.M. Wang, Puerarin protects mouse liveragainst nickel-induced oxidative stress and inflammation associated with theTLR4/p38/CREB pathway, Chem. Biol. Interact. 243 (2016) 29e34.

[9] N. Wang, Y.M. Zhang, L. Wu, Y.J. Wang, Y.J. Cao, L.C. He, X. Li, J.J. Zhao, Puerarinprotected the brain from cerebral ischemia injury via astrocyte apoptosis in-hibition, Neuropharmacology 79 (2014) 282e289.

[10] Y. Yuan, J. Zong, H. Zhou, Z.Y. Bian, W. Deng, J. Dai, H. Gan, Z. Yang, H.L. Li,Q.Z. Tang, Puerarin attenuates pressure overload-induced cardiac hypertro-phy, J. Cardiol. 63 (2014) 73e81.

[11] B. Wang, S.B. Chen, X.F. Yan, M.D. Li, D.Q. Li, G.X. Ti, The therapeutic effect andpossible harm of puerarin for treatment of stage III diabetic nephropathy: ameta-analysis, Altern. Ther. Health Med. 21 (2015) 36e44.

[12] C.M. Liu, J.Q. Ma, Y.Z. Sun, Puerarin protects rat kidney from lead-inducedapoptosis by modulating the PI3K/Akt/eNOS pathway, Toxicol. Appl. Phar-macol. 258 (2012) 330e342.

[13] J.Q. Ma, J. Ding, Z.H. Xiao, C.M. Liu, Puerarin ameliorates carbon tetrachloride-induced oxidative DNA damage and inflammation in mouse kidney throughERK/Nrf2/ARE pathway, Food Chem. Toxicol. 71 (2014) 264e271.

[14] Y. Zhang, H. Wang, L. Yu, J. Chen, The Puerarin improves renal function in STZ-induced diabetic rats by attenuating eNOS expression, Ren. Fail. 37 (2015)699e703.

[15] L. Wang, J. Cao, D.W. Chen, X.Z. Liu, H. Lu, Z.P. Liu, Role of oxidative stress,apoptosis, and intracellular homeostasis in primary cultures of rat proximaltubular cells exposed to cadmium, Biol. Trace Elem. Res. 127 (2009a) 53e68.

[16] G. Paradies, V. Paradies, F.M. Ruggiero, G. Petrosillo, Protective role of mela-tonin in mitochondrial dysfunction and related disorders, Arch. Toxicol. 89(2015) 923e939.

[17] W.A. Siddiqui, A. Ahad, H. Ahsan, The mystery of BCL2 family: Bcl-2 proteinsand apoptosis: an update, Arch. Toxicol. 89 (2015) 289e317.

[18] J. Bo, B.Y. Ming, L.Z. Gang, C. Lei, A.L. Jia, Protection by puerarin against MPPþ-induced neurotoxicity in PC12 cells mediated by inhibiting mitochondrialdysfunction and caspase-3-like activation, Neurosci. Res. 53 (2005) 183e188.

[19] L. Wang, H. Wang, M.Z. Hu, J. Cao, D.W. Chen, Z.P. Liu, Oxidative stress andapoptotic changes in primary cultures of rat proximal tubular cells exposed tolead, Arch. Toxicol. 83 (2009b) 417e427.

[20] F. Denizot, R. Lang, Rapid colorimetric assay for cell growth and survivalmodifications to the tetrazolium dye procedure giving improved sensitivityand reliability, J. Immunol. Methods 89 (1986) 271e277.

[21] D.Z. Wong, H.A. Kadir, S.K. Ling, Bioassay-guided isolation of neuroprotectivecompounds from Loranthus parasiticus against H2O2-induced oxidativedamage in NG108-15 cells, J. Ethnopharmacol. 139 (2012) 256e264.

[22] P. Rana, S. Nadanaciva, Y. Will, Mitochondrial membrane potential measure-ment of H9c2 cells grown in high-glucose and galactose-containing mediadoes not provide additional predictivity towards mitochondrial assessment,Toxicol. In Vitro 25 (2011) 580e587.

[23] A. Ayala, M.F. Mu~noz, S. Argüelles, Lipid peroxidation: production, meta-bolism, and signaling mechanisms of malondialdehyde and 4-hydroxy-2-nonenal, Oxid. Med. Cell. Longev. (2014), http://dx.doi.org/10.1155/2014/360438.



http://refhub.elsevier.com/S0009-2797(16)30429-X/sref1



























































































http://dx.doi.org/10.1155/2014/360438

http://dx.doi.org/10.1155/2014/360438


[24] V. Nair, G.A. Turner, The thiobarbituric acid test for lipid peroxidation:structure of the adduct with malondialdehyde, Lipids 19 (1984) 804e805.

[25] V. Petronilli, G. Miotto, M. Canton, M. Brini, R. Colonna, P. Bernardi, F. Di Lisa,Transient and long-lasting openings of the mitochondrial permeability tran-sition pore can be monitored directly in intact cells by changes in mito-chondrial calcein fluorescence, Biophys. J. 76 (1999) 725e734.

[26] H. Katoh, N. Nishigaki, H. Hayashi, Diazoxide opens the mitochondrialpermeability transition pore and alters Ca2þ transients in rat ventricularmyocytes, Circulation 105 (2002) 2666e2671.

[27] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data usingreal-time quantitative PCR and the 2(T)(-Delta Delta C) method, Methods 25(2001) 402e408.

[28] Y. Komoike, H. Inamura, M. Matsuoka, Effects of salubrinal on cadmium-induced apoptosis in HK-2 human renal proximal tubular cells, Arch. Tox-icol. 86 (2012) 37e44.

[29] M. Goto, J. Holgersson, M. Kumagai-Braesch, O. Korsgren, The ADP/ATP ratio: anovel predictive assay for quality assessment of isolated pancreatic islets, Am.J. Transpl. 6 (2006) 2483e2487.

[30] K. Sinha, J. Das, P.B. Pal, P.C. Sil, Oxidative stress: the mitochondria-dependentand mitochondria-independent pathways of apoptosis, Arch. Toxicol. 87(2013) 1157e1180.

[31] M. Ott, V. Gogvadze, S. Orrenius, B. Zhivotovsky, Mitochondria, oxidativestress and cell death, Apoptosis 12 (2007) 913e922.

[32] T. Sen, N. Sen, G. Tripathi, U. Chatterjee, S. Chakrabarti, Lipid peroxidationassociated cardiolipin loss and membrane depolarization in rat brain mito-chondria, Neurochem. Int. 49 (2006) 20e27.

[33] E. Jacotot, A. Deniaud, A. Borgne-Sanchez, Z. Touat, J.P. Briand, M. Le Bras,C. Brenner, Therapeutic peptides: targeting the mitochondrion to modulateapoptosis, Biochim. Biophys. Acta 1757 (2006) 1312e1323.

[34] J.S. Armstrong, The role of the mitochondrial permeability transition in celldeath, Mitochondrion 6 (2006) 225e234.

[35] S. Gupta, G.E. Kass, E. Szegezdi, B. Joseph, The mitochondrial death pathway: a


promising therapeutic target in diseases, J. Cell. Mol. Med. 13 (2009)1004e1033.

[36] S. Shimizu, M. Narita, Y. Tsujimoto, Bcl-2 family proteins regulate the releaseof apoptogenic cytochrome c by the mitochondrial channel VDAC, Nature 399(1999) 483e487.

[37] A.B. Parrish, C.D. Freel, S. Kornbluth, Cellular mechanisms controlling caspaseactivation and function, Cold Spring Harb, Perspect. Biol. 5 (2013), http://dx.doi.org/10.1101/cshperspect.a008672.

[38] D. Dias da Silva, H. Carmo, A. Lynch, E. Silva, An insight into the hepatocellulardeath induced by amphetamines, individually and in combination: theinvolvement of necrosis and apoptosis, Arch. Toxicol. 87 (2013) 2165e2185.

[39] S. Cory, D.C.S. Huang, J.M. Adams, The Bcl-2 family: roles in cell survival andoncogenesis, Oncogene 22 (2003) 8590e8607.

[40] G. Kroemer, J.C. Reed, Mitochondrial control of cell death, Nat. Med. 6 (2000)513e519.

[41] A. Chevrollier, D. Loiseau, P. Reynier, G. Stepien, Adenine nucleotide translo-case 2 is a key mitochondrial protein in cancer metabolism, Biochim. Biophys.Acta 1807 (2011) 562e567.

[42] M.B. Heaton, K. Siler-Marsiglio, M. Paiva, A. Kotler, J. Rogozinski, S. Kubovec,M. Coursen, V. Madorsky, Ethanol influences on bax associations with mito-chondrial membrane proteins in neonatal rat cerebellum, Dev. Neurobiol. 73(2013) 127e141.

[43] Y.X. Zhou, H. Zhang, C. Peng, Puerarin: a review of pharmacological effects,Phytother. Res. 28 (2014) 961e975.

[44] N.I. Kramer, M. Krismartina, B.J. Blaauboer, J.L.M. Hermens, Measuring andmodeling bioavailability in in vitro systems, Chem. Biol. Interact. 169 (2007)137.

[45] M. Wnuk, E. Slota, G. Bartosz, Total anti-oxidant capacity of cell culture media,Clin. Exp. Pharmacol. Physiol. 34 (2007) 781e786.

[46] L.H. Long, B. Halliwell, Artefacts in cell culture: pyruvate as a scavenger ofhydrogen peroxide generated by ascorbate or epigallocatechin gallate in cellculture media, Biochem. Biophys. Res. Commun. 388 (2009) 700e704.





















































http://dx.doi.org/10.1101/cshperspect.a008672

http://dx.doi.org/10.1101/cshperspect.a008672

































本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP

图书馆。

图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页文献云下载图书馆入口外文数据库大全疑难文献辅助工具

http://www.xuebalib.com/cloud/

http://www.xuebalib.com/

http://www.xuebalib.com/cloud/


http://www.xuebalib.com/vip.html

http://www.xuebalib.com/db.php

http://www.xuebalib.com/zixun/2014-08-15/44.html


puerarin protects against cadmium-induced proximal tubular...

Documents