Biochimica et Biophysica Acta 1804 (2010) 1882–1888

Contents lists available at ScienceDirect

Biochimica et Biophysica Acta

j ourna l homepage: www.e lsev ie r.com/ locate /bbapap

Proteomic analysis of primary porcine endothelial cells after infection by classicalswine fever virus

Su Li a,b, Hui Qu b, Jianwei Hao b, Jinfu Sun b, Huancheng Guo b, Changming Guo a,Boxing Sun a, Changchun Tu b,⁎a College of Animal Science and Veterinary Medicine, Jilin University, 5333 XiAn Road, Changchun 130062, Chinab Institute of Veterinary Sciences, Academy of Military Medical Sciences, 1068 Qinglong Road, Changchun 130062, China

⁎ Corresponding author. Tel./fax: +86 431 87960009E-mail address: changchun_tu@hotmail.com (C. Tu)

1570-9639/$ – see front matter © 2010 Elsevier B.V. Adoi:10.1016/j.bbapap.2010.05.011

a b s t r a c t

a r t i c l e i n f o

Article history:Received 27 February 2010Received in revised form 5 May 2010Accepted 25 May 2010Available online 1 June 2010

Keywords:PorcineEndothelial cellsClassical swine fever virusProteomics2D-DIGE

Endothelial cells are the main target of classical swine fever virus during infection, and extensivehemorrhage is the most typical clinical sign of classical swine fever. To investigate the molecular mechanismof hemorrhagic pathogenesis, two-dimensional difference gel electrophoresis with fluorescent dyes (2D-DIGE) was used to analyze the proteomic profile of primary porcine umbilical vein endothelial cells(PUVECs) following CSFV infection. Of 15 protein spots with differential expression, 8 were characterized byMALDI-TOF-MS/MS in infected PUVECs at 48 h p.i.: moesin, peroxiredoxin 6, stathmin-1, a protein similar tonascent polypeptide-associated complex alpha subunit isoform 2, phosphoglycerate kinase 1, glucosidase II,transketolase and α-tubulin. These could be sorted into 5 functional groups: glycometabolism, cellproliferation, anti-oxidative stress, inflammatory response and cytoskeleton. Western blot and real-time RT-PCR analysis confirmed the down-regulation of phosphoglycerate kinase 1 (PGK1) and up-regulation ofmoesin identified by 2D-DIGE. Pathway analysis of these 15 differentially expressed proteins showed thatCSFV infection altered the metabolism, cytoskeleton and cell proliferation of PUVECs, and that consequentlyan inflammatory response was induced.

..

ll rights reserved.

© 2010 Elsevier B.V. All rights reserved.

1. Introduction

Classical swine fever (CSF) is a highly contagious swine disease,which results in high morbidity and mortality of infected swine,featuring symptoms of high fever, leukopenia, disseminated intra-vascular coagulation and extensive hemorrhages. The disease is anotifiable one of the World Organization for Animal Health (OIE),causing substantial economic losses to the pig industry worldwide.The pathogen, classical swine fever virus (CSFV), is a small, envelopedvirus with a non-segmented, single-stranded, positive sense RNAgenome, belonging to the genus Pestivirus within the familyFlaviviridae [1].

CSFV has a particular tropism for cells of the immune system andendothelial cells (ECs), featuring atrophy of primary lymphoid tissueand bone marrow [2,3], depletion of T and B lymphocytes [4],monocytes-macrophages and granulocytes, and extensive hemor-rhages in infected pigs [5,6]. In addition, porcine endothelial cells areknown to be particularly susceptible to infection with CSFV [7]. Themonolayer of endothelial cells that coats the luminal surface of bloodvessel walls has numerous functions including prevention ofcoagulation, control of vascular permeability, maintenance of vascular

tone and regulation of leukocyte extravasation [8,9]. Vascularendothelial cells maintain the haemostatic balance by providing aquiescent, anti-thrombotic barrier. However, they are rapidly acti-vated by pathogens to express a proinflammatory and procoagulantphenotype to eliminate infection [10].

Widespread hemorrhages (including petechial bleeding of theskin, mucosae and internal organs) are the main pathologicalcharacteristics of CSF, induced by the infection of, and by functionalchanges in, endothelial cells [7,11]. Primary endothelial cells providean in vitro model to study the response of host cells to CSFV infection.To uncover the molecular mechanism of CSFV-induced hemorrhages,a 2D-DIGE and MS/MS proteomic approach was applied to charac-terize changes in protein expression in CSFV-infected porcineumbilical vein endothelial cells.

2. Materials and methods

2.1. Culture of primary porcine endothelial cells

Pregnant Landrace pigs were selected from a high-health com-mercial farm historically free from major swine pathogens such asCSFV, porcine reproductive and respiratory syndrome virus, porcinecircovirus type 2, porcine pseudorabies virus, porcine parvovirus andswine influenza virus. PUVECs were isolated from the umbilical veinof newborn piglets by collagenase I treatment [12]. This consisted of

Table 1Gel/sample set-up and labeling scheme.

Gel Cy2 labeling Cy3 labeling Cy5 labeling

1 Internal standard M1 C22 Internal standard M2 C33 Internal standard C4 M34 Internal standard C1 M45 Internal standard C5 M5

Note. C1–5 numbers the 5 CSFV-infected PUVEC samples andM1–5 the 5mock-infectedPUVEC samples. Ten CSFV-infected PUVEC and mock-infected samples were randomlydivided into two groups (Cy3 labeling and Cy5 labeling) with each containing 2 infectedand 3 mock-infected, or 3 infected and 2 mock-infected samples. Each sample withinthe group was labeled individually.

1883S. Li et al. / Biochimica et Biophysica Acta 1804 (2010) 1882–1888

washing the umbilical vein in cold phosphate-buffered saline (PBS)and incubating it in Medium 199 (Sigma-Aldrich, St. Louis, USA)supplemented with 1 mg/mL collagenase I for 10 min at 37 °C.Detached cells were collected by flushing, then washed andresuspended inMedium199 supplementedwith 20% heat-inactivatedfetal bovine serum (PAA Laboratories GmbH, Pasching, Austria),2 mM L-glutamine, 50 μg/mL amphotericin B, 100 U/mL penicillin G,and 100 mg/mL Na streptomycin sulfate for culture at 37 °C in 5% CO2.Cultured PUVEC monolayers were verified by detection of factor VIII,the specific endothelial cell marker, by the indirect immunofluores-cent antibody test (IFAT) using rabbit anti-human factor VIII antibody(Boster, Wuhan, China) as the first antibody, followed by FITC-conjugated goat anti-rabbit IgG (Sigma-Aldrich). Cells were passagedupon confluence following dispersion with 0.25% trypsin/0.04% EDTA.

2.2. Virus culture and titration

Monolayers of PUVECs were washed twice with PBS (pH 7.4),drained, then infected with blood stock of the virulent CSFV strainShimen (106.2 TCID50/ml, as titrated in PK-15 cells) at an inputmultiplicity of about 2 TCID50/cell, with 2 h adsorption at 37 °C.Uninfected cells were incubated in Medium 199 as a mock-infectedcontrol. Supernatants were then removed and replaced with Medium199 supplemented as above. Samples of media were collected from8 h to 96 h p.i. at 8 h intervals, and stored at −80 °C for later titrationof infectious virus. Cells were fixed in 80% cold acetone in PBS andexamined for viral antigen by IFAT using CSFV E2 protein-specificmonoclonal antibody WH303 [13], followed by FITC-conjugated goatanti-mouse IgG (Sigma-Aldrich, St. Louis, USA). Supernatants of CSFV-infected PUVECs were titrated for infectious virus in PK-15 cells. Virustiters were determined by the Reed–Münch method [14].

2.3. Protein sample preparation

After isolation and cultivation of PUVECs, 5 flasks of PUVECmonolayers were infected and incubated for 48 h as described above.Five flasks of mock-infected PUVEC were used as uninfected controls.At 48 h p.i., culture media were removed and the monolayers werewashed 3 times with cold ddH2O, then lysed by addition of 150 μllysing solution (7 M urea, 2 M thiourea, 4% CHAPS, 30 mM Tris, pH8.5). Cell debris was removed by centrifugation at 12,000 g for 60 min.The supernatants were treated with the 2D Clean Up Kit (AmershamBiosciences Crop., Piscataway, NJ) to remove nucleic acid and lipid.Protein concentrations were measured with the 2D Quant Kit(Amersham Biosciences Crop.), according to the manufacturer'sinstructions. Samples were stored at −80 °C until 2D-DIGE analysis.

2.4. 2D-DIGE and data analysis

Equal amounts of total cellular protein samples harvested from theabove 10 CSFV-infected and mock-infected PUVECs flasks (50 μgeach) were pooled to constitute the internal standard (500 μg intotal), which was subsequently labeled with Cy2 (GE Healthcare,Piscataway, NJ). In addition, these 10 CSFV-infected and mock-infected PUVEC protein samples were divided into 2 groups, whichwere labeled respectively with Cy3 and Cy5 according to theinstructions of Amersham (GE Healthcare: CyDye DIGE Fluors forEttan DIGE). For 2D-DIGE analysis, 5 replicate gels were used witheach running a total 150 μg labeled protein mixture containing 50 μgCy2-labeled internal standard, 50 μg Cy3- or Cy5-labeled CSFV-infected sample and 50 μg Cy5- or Cy3-labeled mock-infected sample.Gel replicates, sample set-up and labeling schemes are shown inTable 1. The 150 μg labeled protein mixture was diluted withrehydration solution [7 M urea, 2 M thiourea, 2% CHAPS (w/v), 2%DTT (w/v) and 1% pH 3–10 IPG buffer (v/v)] to 450 μl and proteinswere resolved by first-dimension isoelectric focusing (IEF) on 24 cm

immobilized IPG strips with a linear gradient of pH 3–10 (GEHealthcare). Samples were applied by strip holder-loading and IEFwas run in five steps: gel rehydration for 6 h, then electrophoresis at30 V for 6 h, 500 V for 1 h, gradient 1,000 V for 2 h, and 8000 V(gradient between the steps) with a total focusing time of 64 kV·h inan Ettan IPGphor Isoelectric Focusing System I (GE Healthcare).

The isoelectric-focused proteins on the strips were equilibrated for15 min in equilibration buffer (6 M urea, 30% glycerol, 2% SDS, 0.002%bromophenol blue, 75 mM Tris, pH 8.8) containing 1% DTT, followedby an additional equilibration for 15 min in equilibration buffercontaining 2.5% iodoacetamide. SDS-PAGE was performed on 12.5%gels in the Ettan DALT Six System (GE Healthcare). Gels were run at16 °C at 2 W per gel until the dye front reached the foot. Gels werescanned using a Typhoon 9400 VariableMode Imager (GE Healthcare)at a resolution of 100 pixels and excitation/emission wavelengths of488/520 nm, 520/590 nm and 620/680 nm for the Cy2-, Cy3-, andCy5-labeled proteins respectively. Gel images and statistical analyseswere processed using DeCyder 6.5 software (GE Healthcare) includingthe DIA and BVAmodules. Proteins presenting as spots with≥1.3-foldexpression change between the CSFV-infected and mock-infectedPUVECs in at least 3 gels were identified as being significantly altered.For further characterization of the differentially expressed proteinspots, the same samples were separated by conventional 2Delectrophoresis using a previously described method [15], and theprotein spots were cut from fixed Coomassie blue-stained 2D gelsusing a Spotter Picker (GE Healthcare), and subjected to the followingMS identification.

2.5. Mass spectrometry and database search

After trypsin digestion of each protein spot, the peptide mixtureswere extracted with extraction solution, 50% acetonitrile/0.5%trifluoroacetic acid (TFA), at 37 °C for 1 h and dried under N2. Thepeptides were eluted with matrix solution containing α-cyano-4-hydroxy-cinnamic acid (CHCA; Sigma, St. Louis, MO) in 50%acetonitrile/0.1% TFA and spotted on the target sample plates beforebeing analyzed in a 4700 Proteomics Station (Applied Biosystems,Foster, CA) in automatic mode (the m/z range 800–4000, with anaccelerating voltage of 20 kV). The parent ions with high intensitywere selected and fragmented using collision induced dissociation.Spectra were internally calibrated with peptides from trypsinautolysis. Finally selected protein spots were identified by peptidemass fingerprint (PMF) and confirmed by MS/MS analysis. CombinedMS and MS/MS spectra were subjected to MASCOT (V2.1, MatrixScience, London, U.K.) analysis using GPS explorer software (V3.6,Applied Biosystems) and searched in the NCBI Sus. scrofa database. Amaximum of one missed cleavage per peptide was allowed at a masstolerance of 0.3 Da, and MS/MS tolerance of 0.4 Da. Protein identifica-tions with a score value N80 were positively assigned.

1884 S. Li et al. / Biochimica et Biophysica Acta 1804 (2010) 1882–1888

2.6. Bioinformatical analysis

To identify the functions of the identified proteins, gene ontology(GO) and pathway analyses were performed. The identified proteinswere functionally categorized based on universal GO annotationterms using the online GO tool WEGO [Web Gene OntologyAnnotation Plot (http://wego.genomics.org.cn/)], as described byAshburner et al. [16]. GO analysis was applied to analyze the cellularcomponent, molecular function and biological process of alteredexpression proteins, and pathway analysis was to further understandthe biological processes in which the identified proteins could haveparticipated. Pathway analysis was based mainly on the Database forAnnotation, Visualization and Integrated Discovery (DAVID, 2008),and performed as described by Huang et al. [17].

2.7. Real-time RT-PCR

Monolayers of PUVECs were infected with CSFV as describedabove. Total cellular RNAwas extracted using the RNeasy PlusMini Kit(QIAGEN, GmbH, Hilden, Germany) according to the manufacturer'sinstructions. RNA concentrations were measured spectrophotometri-cally at 260/280 nm (Thermo Fisher Scientific, Wilmington, DE).Synthesis of cDNA was performed with 1000 ng total RNA and 30 UAMV reverse transcriptase (Promega, Madison, WI, USA), 200 μMdNTP (TaKaRa, Dalian, China), 0.4 μM randomprimers (TaKaRa), 0.5 μlRibonuclease Inhibitor (TaKaRa), and 4 μl 5×AMV Reverse Transcrip-tion Buffer (Promega) in a total volume of 20 μl. The mixture wasincubated at 42 °C for 1 h, followed by 15 min at 75 °C. Real-time PCRamplification was performed on a Prism7500 sequence detector(Applied Biosystems) according to the manufacturer's instructions.Total volume was 25 μl, containing 2 μl cDNA template, 12.5 μl2×SYBR Green I, and 0.4 μM forward and reverse primers. PCRreactions were set up in triplicate. For all amplifications, the cycleconditions were 95 °C for 3 min, followed by 40 cycles of 95 °C for30 s, 55 °C for 30 s, 72 °C for 30 s, then extension of 10 min at 72 °C.Porcine β-actin was used as an internal loading control. The primersfor amplifying β-actin, PGK1, and moesin genes are presented inTable 2. Relative fold changes in gene expression were determined bythe 2−ΔΔCt method [18].

2.8. Western blot analysis

Samples of CSFV-infected andmock-infected PUVECswere lysed at48 h p.i. and protein concentration determined as described above.Equal amount (40 μg) of cell lysate samples were subjected to 12.5%SDS-PAGE and then transferred to PVDF membranes (Millipore,Bedford, USA). The PVDF membranes were blocked with 1% BSA in0.01 M PBS for 12 h at 4 °C, and incubated with mouse monoclonalanti-β-actin (Waterson, Beijing, China) (1:200 in 1% BSA/0.01 M PBS),goat polyclonal anti-moesin (1:300, Santa Cruz Biotechnology, SantaCruz, CA or rabbit polyclonal anti-PGK1 (1:500, Abcam, Cambridge, U.K.) then, correspondingly, with HRP-conjugated anti-mouse IgG

Table 2Validation of differentially expressed proteins by real-time RT-PCR.

Protein name Primersa Sequences (5′-3′) Productlength(bp)

Real-timeRT-PCR foldchange

Moesin F CTTTGTCTTCTATGCTCCTC 389 6.3R CTTCCTGACGCTCTTTGG

PGK1 F TGGACCTGTGGGCGTATTTG 361 −4.3R CTTGGCTACTTGCTGAATCTTGAC

Porcineβ-actin

F CGGGACCTGACCGACTACCT 411R GGCCGTGATCTCCTTCTGC

a F and R represent forward and reverse primer, respectively.

(Sigma-Aldrich, 1:1,000 in 1% BSA/0.01 M PBS), HRP-conjugatedanti-goat IgG (1:3,000, Proteintech Group Inc., Chicago) or HRP-conjugated anti-rabbit IgG (1:5,000, Proteintech), with washingbetween. The protein bands were visualized with SuperSignal WestPico chemiluminescence substrate (Pierce Biotechnology, Inc., Rock-ford, IL).

3. Results

3.1. Preparation of PUVECs and CSFV infection

In all PUVEC cultures, more than 95% of the cells stained positivelyfor factor VIII on the cell surface and displayed typical cobblestonemorphology (data not shown), indicating that EC had been success-fully isolated and cultured. Once viral growth had reached its peak at48 h p.i. as measured by detection of CSFV antigen using IFAT (Fig. 1)and virus titration (Fig. 2), infected and mock-infected PUVECs wereused for proteomic analysis.

3.2. 2D-DIGE and identification of differentially expressed proteins

Using 2D-DIGE to compare proteomic expression in CSFV-infectedand mock-infected PUVECs, about 1400 protein spots were visualizedon each gel (see Fig. 3), with 15 of them showing at least 1.3-foldquantitative alteration between mock- and infected PUVECs. Of these,8 were successfully identified by MALDI-TOF-MS/MS and weresearched against the NCBI Sus. scrofa database for their proteinnames. The identified up-regulated proteins following CSFV infectionwere moesin, peroxiredoxin 6, stathmin-1, and a protein similar tonascent polypeptide-associated complex alpha subunit isoform 2. Thedown-regulated proteins were PGK1, glucosidase II, transketolase andα-tubulin (see Table 3).

3.3. GO and pathway analysis

Based on GO, the annotation terms of 8 differentially expressedproteins could be linked to cellular component, molecular functionand biological process categories (Fig. 4). Of the identified proteinslocated subcellularly, 5 were in organelles, 6 in the cytoplasm and 2within protein complexes. Molecular function ontology revealed thatthe majority of proteins possessed either binding activity (6 proteins)or catalytic activity (5 proteins) (Fig. 4). Biological process ontologyrevealed that 7 proteins were involved in physiological processes, 6 incellular processes, 2 in regulation of biological processes and theremaining 3 in growth, inflammatory response and development(Fig. 4). Pathway analysis based on DAVID showed that thedifferentially expressed proteins weremainly involved inmetabolism,leukocyte transendothelial migration, MAPK signaling and gapjunction (Table 3). This analysis also showed that CSFV infectionaltered the metabolism, the cytoskeleton and cell proliferation ofPUVECs, and that consequently an inflammatory response wasinduced.

3.4. Validation of differentially expressed proteins by real-time RT-PCRand Western blot

Two of 8 differentially expressed proteins, moesin and PGK1, wereselected based on the availability of commercial antibodies to confirmthe 2D-DIGE results by real-time RT-PCR andWestern blot. The mRNAlevel of moesin was observed to increase 6.3-fold while that of PGK1decreased 4.3 fold after CSFV infection (Table 2). These changes wereconsistent with the results of 2D-DIGE analysis (Fig. 5A). Western blotresults (Fig. 5B) were also consistent with 2D-DIGE, revealingsignificant up-expression of moesin and down-expression of PGK1following CSFV infection.

Fig. 1. Dynamics of CSFV growth. Detection of CSFV antigen in infected PUVEC monolayers was by IFAT at 24 (A) and 48 (B) h p.i. C: mock-infected control PUVECs at 48 h (200×magnification).

1885S. Li et al. / Biochimica et Biophysica Acta 1804 (2010) 1882–1888

4. Discussion

One of the main pathological characteristics of CSF is theproduction of widespread hemorrhages, indicating changes in theintegrity and function of the endothelium as a result of CSFV infection.Altered expression of cytokines and chemokines has been reportedfollowing CSFV infection [7,11], some of which are potent enhancersof vascular permeability and mediators of pathologic changes such ashigh fever, coagulation defects, and the bleeding observed in somesingle-stranded RNA viral infections [19]. The endothelial cell is one ofthe cell types producing cytokines and chemokines in response tostimuli. To investigate the pathological changes occurring in endo-thelial cells at the molecular level after CSFV infection, the 2D-DIGEand MS/MS proteomic approach was used to analyze proteinexpression of PUVECs following CSFV infection. Of the 15 differentiallyexpressed proteins in CSFV-infected PUVECs, 8 were characterized byMALDI-TOF-MS/MS, leaving 7 unidentified due to their very lowabundance. Of the 8 identified proteins, consensus changes inexpression of 6 proteins were present in 5 gels and of the other 2 in4 gels, indicating that the identified proteomic changes did indeedoccur following CSFV infection. These identified proteins provide astrong basis for further investigation of CSFV–host interactions andthemolecular pathogenesis of ECs. The potential roles of some of themin CSFV-induced pathology of ECs are discussed below.

4.1. The impact of CSFV infection on energy metabolism of ECs

The present study revealed that 3 key cellular proteins, PGK1,transketolase (TK) and glucosidase II, which are involved in energymetabolism, were down-regulated (Table 3). PGK1 is a glycolytic enzymeand plays an important role in cellular energy production [20–22]. Tumorcells in breast cancer usually have altered metabolism, with an increaseduptake of glucose, and enhanced glycolysis and angiogenesis, that islargely induced by up-regulation of PGK1 [23–25]. Expression of PGK1

Fig. 2. Growth curve of CSFV in PUVECs showing the peak at 48 h p.i.

was down-regulated in CSFV-infected PUVECs (Table 3), indicating thatactivity of the host glycolytic pathway is probably reduced by CSFV.

TK is a key enzyme catalyzing several reactions in the pentosephosphate pathway (PPP), and serves as a bridge between PPP and theglycolytic pathway. It can improve the adaptation of cells to a variety ofmetabolic needs under different environmental conditions by facilitatingthe carbohydrate metabolic pathways [26]. Glucosidase II is involved inglycan biosynthesis in the endoplasmic reticulum [27]. Down-regulationof TK and glucosidase II in CSFV-infected PUVECs might also have animpact on PPP andglycanbiosynthesis. Taking all the evidence together, itseems likely that CSFV infection alters the glycometabolism of ECs.

4.2. Inhibition of EC proliferation by CSFV infection

Stathmin 1 is a 17-kDa cytoplasmic tubulin-binding phosphopro-tein expressed in cells that have reentered the cell cycle [28], andplays an important role in cellular proliferation and regulation ofmitosis [29]. Overexpression of this protein can result in arrest of cellsin earlymitosis [30]. Thus, increased expression of stathmin 1 in CSFV-infected PUVECs will hamper the endothelial cell cycle, resultingin inhibition of cell proliferation. In addition to its role in

Fig. 3. 2D-DIGE image. Shown is one of the 5 replicate 2D-DIGE gels of an overlay of 3dye scan. Green spot: down-regulation; Red spot: up-regulation. Spots are numberedaccording to Table 3.

Table 3Proteins showing at least 1.3-fold quantitative expression differences in CSFV-infected PUVECs detected by 2D-DIGE.

Protein description Spotno.a

Identified protein GI no.b PI MW(KDa)

Proteinscore

Sequencecoverage[%]c

Pvalue

Ratio(infection/control)d

Pathways(DAVID analysis)

Glycometabolism 1047 PGK1 gi|47169449

8.01 44 144 35 0.0055 0.67 Glycolysis

192 Glucosidase II gi|47522680

5.64 107 129 11 0.0026 0.53 N-glycan biosynthesis

901 Transketolase gi|162952052

7.21 68 84 10 0.0001 0.57 Pentose phosphatepathway

Cell proliferation 1350 Stathmin-1 gi|49615355

5.76 17 107 52 0.0042 1.55 MAPK signaling pathway

Anti-oxidative stressprotein

1297 Peroxiredoxin 6 gi|47523870

5.73 25 101 31 0.0047 1.42 Phenylalaninemetabolism pathway

Inflammatory responseand permeability of ECs

785 Moesin gi|57527987

6.3 68 103 27 0.0033 1.71 Leukocytetransendothelialmigration pathway

Cytoskeleton protein 514 Tubulin alpha gi|113205626

4.94 50 213 34 0.0008 0.69 Gap junction pathway

Other 1289 Similar to nascent polypeptide-associated complex alpha subunitisoform 2

gi|194037562

4.52 23 104 30 0.0073 1.35

a Labels of protein spots in Fig. 3.b GI no. is the MASCOT result of MALDI-TOF-MS/MS searched from the NCBInr database.c Sequence coverage (%): Number of amino acids spanned by the assigned peptides divided by the sequence length.d Level of protein expression in infected cells relative to that of uninfected cells.

1886 S. Li et al. / Biochimica et Biophysica Acta 1804 (2010) 1882–1888

glycometabolism described above, TK also regulates cell proliferationand its down-regulation has been shown to reduce cell proliferation invitro and in vivo [31,32]. A recent study noted the inhibition ofproliferation of immortalized porcine umbilical vein endothelial cellsby CSFV NS2 protein [33]. Our study showed that down-regulation ofTK and up-regulation of stathmin1 are potentially involved in theinhibition of EC proliferation following CSFV infection.

4.3. Inflammatory response of ECs to CSFV infection

Moesin is an abundant protein in ECs and platelets [34,35]. It interactswith the endogenous proinflammatory chemokines ICAM-1 andVCAM-1,resulting in lymphoblast adhesion and spread on the endothelium, and in

Fig. 4. Gene ontology (GO) categories of the identified proteins, classified into cellular compThe number of proteins is the number of times that the GO term is used to annotate protei

transendothelial migration (TEM) of leucocytes [36]. Moesin can alsomodulateTNF-α induced increases inendothelial permeability that canbecompletely prevented by inhibition of moesin expression by smallinterfering RNA [37]. It has been found that the expression of TNF-α isincreased in CSFV-infected pigs [38,39]. Thus, up-regulation of moesin inCSFV-infected PUVECs (Fig. 3, Table 3) likely modulates TNF-α inducedincreases in endothelial permeability, providing a possible clue to themolecular mechanism of hemorrhage pathology caused by the infection.

4.4. CSFV-induced host cell oxidative stress and cystoskeleton changes

Peroxiredoxin-6 (PRDX6) belongs to family of antioxidant proteins(peroxiredoxins), which reduce peroxide levels by reducing agents such

onent, molecular function and biological process by WEGO according to the GO terms.ns in the cluster.

Fig. 5. Surface labeling 2D-DIGE andWestern blots of protein expression. (A) 2D-DIGE analysis of differentially expressed moesin and PGK in the gel containing Cy3 (mock-infected)and Cy5 (CSFV-infected) labeled sample, with a Cy2 labeled internal control. (B) Western blot analysis of moesin, PGK1 and β-actin in CSFV-infected and mock-infected PUVECs. β-Actin was used as an internal control.

1887S. Li et al. / Biochimica et Biophysica Acta 1804 (2010) 1882–1888

as thioredoxin. Overexpression of PRDX6 can protect cells from oxidativestress,whereasantisense treatment results inoxidant stress andapoptosis[40]. PRDX6 has been found to be up-regulated not only in the CSFV-infected PUVECs of the present study, but also in the CSFV-infected PK-15cells of our previous study [15]. This finding strongly implicates the up-regulation of anti-oxidative stress proteins in host cells as amechanism torelieve cellular oxidative stress induced by CSFV infection and to facilitatepersistent infection and inhibition of apoptosis.

As cytoskeletal proteins, α- and β-tubulins form microtubules bypolymerization, and act as tracks to move cellular components based onpolarized filaments. Some viruses, such as human immunodeficiencyvirus [41], simian virus 40 [42] and herpes simplex virus type 1 [43] usethe cytoskeleton for infection and replication. A recent study showed thatthe cellular skeleton was involved in porcine circovirus type 2 infectionand replication through altered expression of cytoskeletal proteins ininfected PK-15 cells [44]. In the present study, the expression ofα-tubulinwas down-regulated, indicating that cytoskeletal proteins are probablyinvolved in CSFV replication in ECs.

In summary, the 2D-DIGE proteomics approach has demonstratedthat most of the cellular proteins with altered expression appear tohave roles in host response and CSFV pathogenesis. Glycometabolism,proliferation, and the cytoskeleton of PUVECs were mainly affected,and an inflammatory response was induced by CSFV infection. Thus,the integrity of the endothelium would have been damaged, with aresulting increase in permeability, thereby causing the hemorrhagesobserved in CSFV-infected animals. All differentially expressedproteins are therefore potentially involved in CSFV pathogenesis,with moesin likely playing an important role in the inflammatoryresponse of the host and in vascular permeability.

Acknowledgments

This work was supported by National “973” Program (Grant No.2005CB523200) and National Key Technology R&D Program (GrantNo. 2006BAD06A03). We thank Professor Linsen Hu and Dr. MingChang (No.1 hospital of Jilin University) for technical help with 2D-DIGE, Dr. Shuqi Xiao (Sun Yat-sen University) for technical help withthe GO analysis, and Professor Trevor W. Drew at VeterinaryLaboratories Agency (Weybridge) of UK for providing mAb WH303.

References

[1] F.X. Heinz, M.S. Collett, R.H. Purcell Gould, C.R. Howard, R.J.M., Moormann, C.M.Rice, H.-J. Thiel, Family Flaviridae, in: C.M. Fauquet, M. Mayo, J. Maniloff, U.Desselberger, L.A. Ball (Eds.), Virus Taxonomy. Eighth Report of the International

Committee on Taxonomy of Viruses, Academic Press, San Diego, 2004,pp. 981–998.

[2] E.J. van der Molen, J.T. van Oirschot, Pathomorphological lesions in lymphoidtissues, kidney and adrenal of pigs with congenital persistent swine fever,Zentralbl. Veterinärmed. B 28 (1981) 89–101.

[3] A. Summerfield, S.M. Knötig, R. Tschudin, K.C. McCullough, Pathogenesis ofgranulocytopenia and bone marrow atrophy during classical swine fever involvesapoptosis and necrosis of uninfected cells, Virology 272 (2000) 50–60.

[4] A. Summerfield, S.M. Knötig, K.C. McCullough, Lymphocyte apoptosis duringclassical swine fever: implication of activation-induced cell death, J. Virol. 72(1998) 1853–1861.

[5] A. Summerfield, F. McNeilly, I. Walker, G. Allan, S.M. Knöetig, K.C. McCullough,Depletion of CD4(+) and CD8(high+)T-cells before the onset of viraemia duringclassical swine fever, Vet. Immunol. Immunopathol. 78 (2001) 3–19.

[6] A. Summerfield, K. Zingleb, S. Inumaru, K.C. McCullough, Induction of apoptosis inbone marrow neutrophil-lineage cells by classical swine fever virus, J. Gen. Virol.82 (2001) 1309–1318.

[7] E. Campos, C. Revilla, S. Chamorro, B. Alvarez, A. Ezquerra, J. Domínguez, F. Alonso,In vitro effect of classical swine fever virus on a porcine aortic endothelial cell line,Vet. Res. 35 (2004) 625–633.

[8] E.M. Boyle Jr, E.D. Verrier, B.D. Spiess, Endothelial cell injury in cardiovascularsurgery: the procoagulant response, Ann. Thorac. Surg. 62 (1996) 1549–1557.

[9] K.K. Wu, P. Thiagarajan, Role of endothelium in thrombosis and hemostasis, Ann.Rev. Med. 47 (1996) 315–331.

[10] A. Bierhaus, P.P. Nawroth, Modulation of the vascular endothelium duringinfection–the role of NF-kappa B activation. In Host Response Mechanisms inInfectious Disease, Contrib. Microbiol. 1 (2003) 86–105.

[11] E. Benasude, J.L.E. Turner, H.R. Wakeley, D.A. Sweetman, C. Pardieu, T.W. Drew, T.Wileman, P.P. Powell, Classical swine fever virus induces proinflammatorycytokines and tissue factor expression and inhibits apoptosis and interferonsynthesis during the establishment of long-term infection of porcine vascularendothelial cells, J. Gen. Virol. 85 (2004) 1029–1037.

[12] L. Bruno, K. Aly, Isolation and culture of primary endothelial cells, in: C.D.Helgason, C.L. Miller (Eds.), Basic Cell Culture Protocols (3rd edition), Vol. 290,Humana Press, 2005, pp. 315–329.

[13] M. Lin, F. Lin, M. Mallory, C. Alfonso, Deletions of structural glycoprotein E2 ofclassical swine fever virus strain Alfort/187 resolve a lineal epitope of monoclonalantibody WH303 and the minimal N terminal domain essential for bindingimmunoglobulin G antibodies of a pig hyperimmune serum, J. Virol. 74 (2000)11619–11625.

[14] J.C. Hierholzer, R.A. Killington, Virus isolation and quantitation, in: B.W.J. Mahy, H.O. Kangro (Eds.), Virology Methods Manual, Academic Press, London, 1996,pp. 25–46.

[15] J.F. Sun, Y. Jiang, Z.X. Shi, Y. Yan, H.C. Guo, F.C. He, C.C. Tu, Proteomic alteration ofPK-15 cells after infection by classical swine fever virus, J. Proteome Res. 12(2008) 5263–5269.

[16] M. Ashburner, C.A. Ball, J.A. Blake, D. Botstein, H. Butler, J.M. Cherry, A.P. Davis, K.Dolinski, S.S. Dwight, J.T. Eppig, M.A. Harris, D.P. Hill, L. Issel-Tarver, A. Kasarskis, S.Lewis, J.C. Matese, J.E. Richardson, M. Ringwald, G.M. Rubin, G. Sherlock, Geneontology: tool for the unification of biology. The Gene Ontology Consortium, Nat.Genet. 25 (2000) 25–29.

[17] D.W. Huang, B.T. Sherman, R.A. Lempicki, Systematic and integrative analysis of largegene lists using DAVID bioinformatical resources, Nat. Protoc. 4 (2009) 44–57.

[18] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method, Methods 25 (2001) 402–408.

[19] M. Bray, Pathogenesis of viral hemorrhagic fever, Curr. Opin. Immunol. 17 (2005)399–403.

[20] D.M. Schulz, C. Böllner, G. Thomas, M. Atkinson, I. Esposito, H. Höfler, M. Aubele,Identification of differentially expressed proteins in triple-negative breast

1888 S. Li et al. / Biochimica et Biophysica Acta 1804 (2010) 1882–1888

carcinomas using DIGE and mass spectrometry, J. Proteome Res. 8 (2009)3430–3438.

[21] J.Wang, J.Wang, J. Dai, Y. Jung, C.L.Wei, Y.Wang, A.M.Havens, P.J. Hogg, E.T. Keller, K.J. Pienta, J.E. Nor, C.Y. Wang, R.S. Taichman, A glycolytic mechanism regulating anangiogenic switch in prostate cancer, Cancer Res. 67 (2007) 149–159.

[22] J. Wang, G. Ying, J. Wang, Y. Jung, J. Lu, J. Zhu, K.J. Pienta, R.S. Taichman,Characterization of phosphoglycerate kinase-1 expression of stromal cells derivedfrom tumor microenvironment in prostate cancer progression, Cancer Res. 70(2010) 471–480.

[23] C.D. Young, S.M. Anderson, Sugar and fats that's where it's at: metabolic changesin tumors, Breast Cancer Res. 10 (2008) 202.

[24] M. Kabbage, K. Chahed, B. Hamrita, C.L. Guillier, Protein alterations in infiltratingductal carcinomas of the breast as detected by nonequilibrium pH gradientelectrophoresis andmass spectrometry, J. Biomed. Biotechnol. 2008 (2008) 564127.

[25] D. Zhang, L.K. Tai, L.L. Wong, L.L. Chiu, Proteomic study reveals that proteinsinvolved in metabolic and detoxification pathways are highly expressed in HER-2/neu-positive breast cancer, Mol. Cell. Proteomics 4 (2005) 1686–1696.

[26] B.L. Horecker, The pentose phosphate pathway, J. Biol. Chem. 277 (2002)47965–47971.

[27] R. Hoffrogge, S. Beyer, R. Hübner, S. Mikkat, E. Mix, C. Scharf, U. Schmitz, S.Pauleweit, M. Berth, Igor Z. Zubrzycki, H. Christoph, J. Pahnke1, Olaf. Wolk-enhauer, A. Uhrmacher, Uwe Vöker, A. Rolfs, 2-DE profiling of GDNF over-expression-related proteome changes in differentiating ST14A rat progenitorcells, Proteomics 7 (2007) 33–46.

[28] D.C. Rowlands, A. Williams, N.A. Jones, S.S. Guest, G.M. Reynolds, P.C. Barber, G.Brown, Stathmin expression is a feature of proliferating cells of most, if not all, celllineages, Lab. Invest. 72 (1995) 100–113.

[29] S.J. Mistry, G.F. Atweh, Role of stathmin in the regulation of the mitotic spindle:potential applications in cancer therapy, Mt. Sinai J. Med. 69 (2002) 299–304.

[30] C.I. Rubin, G.F. Atweh, The role of stathmin in the regulation of the cell cycle, J. Cell.Biochem. 93 (2004) 242–250.

[31] B. Rais, B. Comin, J. Puigjaner, J.L. Brandes, E. Creppy, D. Saboureau, R. Ennamany,W.-N. Paul, Lee, L.G. Boros, M. Cascante, Oxythiamine and dehydroepiandroster-one induce a G1 phase cycle arrest in Ehrlich's tumor cells through inhibition ofthe pentose cycle, FEBS Lett. 456 (1999) 113–118.

[32] A. Ramos-Montoya, W.N. Lee, S. Bassilian, S. Lim, R.V. Trebukhina, M.V. Kazhyna, C.J. Ciudad, V. Noe, J.J. Centelles, M. Cascante, R.V. Trebukhina, Pentose phosphate

cycle oxidative and nonoxidative balance: a new vulnerable target for overcomingdrug resistance in cancer, Int. J. Cancer 119 (2006) 2733–2741.

[33] Q.H. Tang, Y.M. Zhang, L. Fan, G.. Tong, L. He, C. Dai, Classical swine fever virus NS2protein leads to the induction of cell cycle arrest at S-phase and endoplasmicreticulum stress, Virol. J. (2010) Ahead of published.

[34] S. Tsukita, S. Yonemura, ERM (ezrin/radixin/moesin) family: from cytoskeleton tosignal transduction, Curr. Opin. Cell Biol. 9 (1997) 70–75.

[35] M. Berryman, Z. Franck, A. Bretscher, Ezrin is concentrated in the apical microvilliof a wide variety of epithelial cells whereas moesin is found primarily inendothelial cells, J. Cell Sci. 105 (1993) 1025–1043.

[36] O. Barreiro, M. Yáñez-Mó, J.M. Serrador, M.C. Montoya, M. Vicente-Manzanares, R.Tejedor, H. Furthmayr, F. Sánchez-Madrid, Dynamic interaction of VCAM-1 andICAM-1 with moesin and ezrin in a novel endothelial docking structure foradherent leukocytes, J. Cell Biol. 157 (2002) 1233–1245.

[37] M. Koss, G.R. Pfeiffer II, Y.Wang, S.T. Thomas, M. Yerukhimovich, W.G. Gaarde, C.D.Doerschuk, Q. Wang, Ezrin/radixin/moesin proteins are phosphorylated byTNF-αand modulate permeability increases in human pulmonary microvascularendothelial cells, J. Immunol. 176 (2006) 1218–1227.

[38] C. Choi, K.K. Hwang, C. Chae, Classical swine fever virus induces tumor necrosisfactor-alpha and lymphocyte apoptosis, Arch. Virol. 149 (2004) 875–889.

[39] P.J. Sánchez-Cordón, A. Núñez, F.J. Salguero, M. Pedrera, M. Fernández de Marco, J.C. Gómez-Villamandos, Lymphocyte apoptosis and thrombocytopenia in spleenduring classical swine fever: role of macrophages and cytokines, Vet. Pathol. 42(2005) 477–488.

[40] Y. Manevich, A.B. Fisher, Peroxiredoxin 6, a 1-Cys peroxiredoxin, functions inantioxidant defense and lung phospholipid metabolism, Free Radic. Biol. Med. 38(2005) 1422–1432.

[41] D.R. Soll, Researchers in cell motility and the cytoskeleton can play major roles inunderstanding AIDS, Cell Motil. Cytoskel. 37 (1997) 91–97.

[42] L. Pelkmans, D. Puntener, A. Helenius, Local actin polymerization and dynaminrecruitment in SV40-induced internalization of caveolae, Science 296 (2002)535–539.

[43] A.H. Koyama, T. Uchida, The mode of entry of herpes simplex virus type 1 intoVero cells, Microbiol. Immunol. 31 (1987) 123–130.

[44] X. Zhang, J.Y. Zhou, Y.P. Wu, X.J. Zheng, G.P. Ma, Z.T. Wang, Y.L. Jin, J.L. He, Y. Yan,Differential proteome analysis of host cells infected with porcine circovirus type 2,J. Proteome Res. 8 (2009) 5111–5119.