protective signalling mechanisms in the lung induced by...
TRANSCRIPT
![Page 1: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/1.jpg)
Sven Fuest
Protective signalling mechanisms
in the lung induced by
open-lung ventilation strategies
Sven F
uest
•P
rote
ctive s
ignalli
ng m
echanis
ms in the lung induced b
y o
pen-lung v
entila
tion s
trate
gie
s
Dissertation
9 7 8 3 8 6 5 4 1 6 1 0 0
ISBN 3-86541-610-1ISBN: 978-3-86541-610-0
www.lehmanns.de
This thesis evaluates molecular mechanisms involved in acute
respiratory distress syndrome and ventilator-induced lung injury.
Open-lung ventilation strategies are known to be lung protective.
Different molecular biological and immunohistochemical research
methods provided discoveries in the lung protective mechanisms
induced by open-lung ventilation strategies. The thesis illustrates
these scientific findings imbedded in detailed description of the
used research methods and basic as well as up-to-date know-
ledge of acute respiratory distress syndrome, ventilator-induced
lung injury, and cell death mechanisms. Coloured figures facilitate
the understanding of the findings.
1
0
5
25
75
95
100
0
5
25
75
95
100
0
5
25
75
95
100
0
5
25
75
95
100
![Page 2: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/2.jpg)
![Page 3: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/3.jpg)
Protective signalling mechanisms in the lung
induced by open-lung ventilation strategies
Inauguraldissertation
zur Erlangung des Grades eines Doktors der Medizin
des Fachbereichs Medizin
der Justus-Liebig-Universität Gießen
vorgelegt von Sven Fuest
aus Münster
Gießen 2013
![Page 4: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/4.jpg)
Bibliografische Information der Deutschen Nationalbibliothek Die Deutsche Nationalbibliothek verzeichnet diese Publikation in der Deutschen Nationalbibliografie; detaillierte bibliografische Angaben sind im Internet unter http://dnb.ddb.de abrufbar.
© Lehmanns Media, Berlin 2014 Helmholtzstraße 2-9 10587 Berlin Druck und Bindung: docupoint magdeburg, Barleben ISBN 978-3-86541-610-0 www.lehmanns.de Alle Rechte vorbehalten. Dieses Werk, einschließlich aller seiner Teile, ist urheberrechtlich geschützt. Jede Verwertung außerhalb der engen Grenzen des Urheberrechtsgesetzes ist ohne Zustimmung des Verlages unzulässig und strafbar. Das gilt insbesondere für Vervielfältigungen, Übersetzungen, Mikro-verfilmungen, Verfilmungen und die Einspeicherung und Verarbeitung auf DVDs, CD-ROMs, CDs, Videos, in weiteren elektronischen Systemen sowie für Internet-Plattformen.
![Page 5: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/5.jpg)
Aus dem Zentrum für Innere Medizin
Medizinische Klinik und Poliklinik II
Universitätsklinikum Gießen und Marburg GmbH
Standort Gießen
Leiter: Prof. Dr. med. W. Seeger
Gutachter: Prof. Dr. W. Seeger
Gutachter: Prof. Dr. J. Schneider
Tag der Disputation: 20.11.2013
![Page 6: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/6.jpg)
![Page 7: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/7.jpg)
CONTENTS
CONTENTS 1. INTRODUCTION.........................................................................................................1
1.1. Architecture of the lung.........................................................................................1
1.2. Physiology of the lung...........................................................................................1
1.3. Acute respiratory distress syndrome .....................................................................3
1.3.1. Pathophysiology ...........................................................................................3
1.3.2. Animal models..............................................................................................4
1.4. Ventilator-induced lung injury ..............................................................................5
1.4.1. Pathophysiology ...........................................................................................5
1.4.2. Lung protective ventilation...........................................................................8
1.5. Intracellular mechanisms of converting mechanical stimuli ...............................10
1.5.1. Responses to mechanical forces .................................................................10
1.5.1.1. Cell death........................................................................................10
1.5.1.2. Pro-apoptotic pathways ..................................................................10
1.5.1.3. Anti-apoptotic pathways.................................................................13
1.5.1.4. Mitogen-activated protein kinase pathways ...................................15
1.6. Aim of the study ..................................................................................................17
2. MATERIALS AND METHODS ................................................................................18
2.1. Materials ..............................................................................................................18
2.1.1. Equipment...................................................................................................18
2.1.2. Reagents .....................................................................................................19
2.2. Methods ...............................................................................................................20
2.2.1. Animal models............................................................................................20
2.2.2. Protein isolation from lungs .......................................................................22
2.2.3. Measuring protein concentration ................................................................23
2.2.4. SDS polyacrylamide gel electrophoresis....................................................23
2.2.5. Protein blotting ...........................................................................................25
2.2.6. Protein visualisation ...................................................................................25
2.2.7. RNA isolation.............................................................................................27
2.2.8. Measuring RNA concentration...................................................................28
2.2.9. cDNA synthesis ..........................................................................................28
2.2.10. Real-time polymerase chain reaction .......................................................29
![Page 8: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/8.jpg)
CONTENTS
2.2.11. Cryosections - immunohistochemistry .....................................................30
2.2.12. Statistical analysis ....................................................................................32
3. RESULTS....................................................................................................................33
3.1. Protein expression analysis..................................................................................33
3.1.1. The mitogen-activated protein kinases .......................................................33
3.1.2. PI3K-Akt pathway......................................................................................33
3.1.3. Markers of cell death ..................................................................................34
3.2. Gene expression analysis.....................................................................................35
3.3. Immunohistochemistry ......................................................................................38
4. DISCUSSION..............................................................................................................40
5. ABSTRACT ................................................................................................................48
6. ZUSAMMENFASSUNG ............................................................................................49
7. ABBREVIATIONS.....................................................................................................50
8. REFERENCES ............................................................................................................54
9. ERKLÄRUNG ZUR DISSERTATION......................................................................68
10. DANKSAGUNG.......................................................................................................69
![Page 9: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/9.jpg)
INTRODUCTION
1
1. INTRODUCTION
1.1. Architecture of the lung
The lung is a twin organ that is located in the chest, and is connected to the external
environment by the trachea that divides into two principal bronchi. Further divisions
generate the bronchi lobares, bronchi segmentales, bronchioli, bronchioli terminales,
bronchioli respiratorii, ductus alveolares and alveoli. The alveoli are the locations for
the gas exchange (99).
The alveoli are built from two types of epithelial cells, the type I pneumocytes and type
II pneumocytes. The type I pneumocytes are responsible for gas exchange between the
air in the alveoli and the blood in the capillary of the pulmonary vascular tree (52, 99).
The alveolar type I cells cover approximately 95% of the alveolar surface (52). Further,
the type I cells are part of the blood-gas barrier that separates the alveolar airspace from
the interstitium (99). The type II pneumocytes cover approximately 5% of the alveolar
surface and produce and secrete surfactant (52, 99). Another function of these cells is to
clear fluid from the alveolus to prevent pulmonary oedema (52). Type II pneumocytes
can also transform into type I pneumocytes (52, 99). Further, it is known that type II
pneumocytes participate in immunologic reactions by producing cytokines and growth
factors (52).
Another cell type involved in the generation of alveoli are interstitial pulmonary
fibroblasts, which are responsible for the development and formation of the pulmonary
extracellular matrix (ECM) (52).
Additional cell types that can be found in the lung are chondrocytes that are involved in
the construction of the bronchial wall, adenocytes, so-called Clara cells in the wall of
the bronchioli terminales, endothelial cells in the vessels, red blood cells and cells of
the immune system (99).
1.2. Physiology of the lung
The function of the lung is to exchange gases by diffusion. That means the absorption of
oxygen from the air and transmission to the blood, and transmission of CO2 from the
![Page 10: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/10.jpg)
INTRODUCTION
2
blood to the alveoli with release of CO2 into the air. For this, it is necessary that the air
in the lung is regularly exchanged because gas diffusion is dependent upon a
concentration gradient. The exchange of gas between the lung and the environment
occurs by breathing. The airflow adjusts to volume changes of the lung.
The volume of the chest depends on the movement of the ribs and the diaphragm. The
thoracic cavity is lined by the pleural sheets, where the pleura visceralis is linked to the
lung and the pleura parietalis is linked to the ribs and the diaphragm. Because of a
negative pressure between these sheets, thoracic expansion and contraction of the
diaphragm lead to an increase in intrathoracic volume and an expansion of the lung with
a negative pressure in the airways leading to a passive air flow into the lung.
Decontraction of the diaphragm and descent of the ribs combined with the elastic
retraction forces of the lung lead to a decrease in the volume of the thoracic cavity
leading to air flow out of the lung. These dynamics can be illustrated with a pressure-
volume curve [Figure 1; (106)].
Figure 1: Pressure-volume curve in relaxed breathing. The intrapleural pressure - which translates to the intrathoracic cave - changes the intrapulmonary volume and the air flow. The intrapleural pressure is progressively negative from the left to the right. Modified from: (106).
Components that affect the gas exchange, apart from the gas concentrations in the blood
and the air in the alveoli, are the surface area that participates in gas exchange, and the
thickness of the alveolar septal wall that has to be transcended by the gases (106).
![Page 11: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/11.jpg)
INTRODUCTION
3
1.3. Acute respiratory distress syndrome
1.3.1. Pathophysiology
Acute respiratory distress syndrome (ARDS) is defined as a severe lung injury with
acute onset, significant hypoxaemia, bilateral infiltrates on frontal chest radiography,
and the absence of left ventricular failure (10, 36).
Hypoxaemia is measured by the PaO2/FIO2 ratio. That means the partial pressure of
arterial oxygen related to the fraction of inspired oxygen. This ratio must be ≤300 for
the diagnosis acute lung injury (ALI). Acute respiratory distress syndrome is the most
severe subset of ALI with a PaO2/FIO2 ratio ≤200 (10, 36).
Symptoms of left ventricular failure can be dyspnoea, tachypnoea, cardiac asthma, basal
rales, cyanosis, weakness, and cerebral dysfunction. The absence of left ventricular
failure is equivalent to the absence of left atrial hypertension. The left atrial pressure can
be assessed by the pulmonary capillary wedge pressure (PCWP). A PCWP of
≤18mmHg represents a normal left atrial pressure (51).
Lungs affected by acute respiratory distress syndrome exhibit morphologic and
functional alterations in comparison with healthy lungs: the respiratory compliance is
less, the dead space - parts of the lung that do not participate in gas exchange - is
increased, and the partial pressure of arterial CO2 is elevated (39).
The basis of ARDS is a direct or indirect pulmonary injury. Aspiration of gastric
contents, pneumonia, inhalation of toxic gases, inhalation of hyperbaric O2, intoxication
with local applied narcotic drugs or lung transplantation can lead to a direct injury.
Reasons for an indirect injury can be a sepsis, shock, lipid embolism, burns, intoxication
with systemic applied drugs, and pathologic intravascular coagulation (50).
Irrespective of the aetiology, ARDS has three phases. The first is the exudative phase,
the second the proliferative phase, and the third the fibrotic phase (35, 81, 109). The
exudative phase takes up to six days and is characterised by hyaline membranes in the
alveolar walls, oedema and inflammation (81, 109). The four to ten days of the
proliferative phase are characterised by a metaplasia of pneumocytes with reduced
production of surfactant and proliferation of myofibroblasts (35, 81). Lung fibrosis and
pulmonary hypertension are the leading characteristics of the eight or more days that
make up the fibrotic phase (81, 109).
![Page 12: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/12.jpg)
INTRODUCTION
4
The survival in ALI/ARDS depends on the age of the patient, accessory chronic
diseases, and extra-pulmonary organ dysfunction (11).
Acute respiratory distress syndrome and ALI are common diseases with a significant
socio-economic burden. The accurate incidence rates differ depending on the criteria
used to diagnose ALI and ARDS in different studies, and depending on the selected
population. For example, Luhr et al. found with the criteria of the American-European
Consensus Conference [see above, (10)] incidence rates of 13.5 cases per 100,000
inhabitants per year for ARDS and 17.9 cases of ALI per 100,000 inhabitants per year
for Sweden, Denmark and Iceland (62, 75). The 90 day mortality in this study was
above 41% in ARDS and in ALI patients (75).
1.3.2. Animal models
Multiple animal models for ARDS exist. Pneumonia can be induced by intratracheal
instillation of E. coli. Due to this infection, the inflammatory response in this model is
higher than in non-infectious animal models (57). Another manner of inducing ARDS is
the infusion of lipopolysaccharide (LPS) as a model for sepsis (58). In the LPS model,
inflammation and haemorrhage play the crucial role in lung injury (58). By injection
into the central venous vasculature, oleic acid arrives in the pulmonary vessels and leads
to endothelial and epithelial necrosis in the lung (86). In this case, the lung develops
oedema and atelectasis (57, 86). Another possibility to induce lung injury is the repeated
lavage of the lung with saline, causing surfactant depletion (57, 58, 86). This model is
applied as a model for neonatal respiratory distress syndrome and for early ALI in
adults (57). Lachmann et al. developed the saline washout model for removing
surfactant phospholipids from the alvoeli. This procedure causes collapse of unstable
alveoli and subsequent conditions similar to ARDS (60). While the pneumonia model is
chracterised by a gross inflammation, the oleic acid injection and saline lavage models
induce lung injury by a reduction in respiratory system compliance and gas exchange
(57). In both models the respiratory mechanics and the decreased gas exchange that lead
to hypoxaemia are similar (73, 97). Beyond that, the oleic acid model is marked by a
distinct oedema (86). Whereas two of these models (LPS, oleic acid) represent indirect
lung injurious mechanisms, the pneumonia and the saline lavage models lead to a direct
lung injury. The saline lavage model produces acute hypoxaemia where the animal is
![Page 13: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/13.jpg)
INTRODUCTION
5
haemodynamically stable (97). It is conceivable that the inflammatory response in the
pneumonia model leads to a haemodynamic instability in terms of cardiovascular
decompensation.
1.4. Ventilator-induced lung injury
1.4.1. Pathophysiology
Physiologically, breathing works because air flows into the lung due to a negative intra-
thoracic pressure. Mechanical ventilation changes the mechanism by which air enters
the lung.
Ventilator-induced lung injury (VILI) results from injurious mechanical ventilation.
Mechanical ventilation is a method for oxygenation of patients who are not able to
breathe by themselves or who are in danger of being unable to breathe by themselves.
Therapeutic mechanical ventilation is used for central respiratory paralysis (e.g. during
depression of the respiratory centre in the brainstem by drugs such as barbiturates or
opioids; or because of damage to the respiratory centre by a trauma or a tumour), for
peripheral respiratory paralysis (e.g. due to paraplegia or a muscle relaxant), for lung
failure (e.g. because of oedema, pneumonia or pulmonary embolism), for disordered
respiratory mechanics (e.g. by fractures of serial ribs or fracture of the sternum) and for
an increase in respiratory resistance. Prophylactic mechanical ventilation is used on
unconscious patients for preventing aspiration, on patients who have already aspirated,
on patients with an extended shock, on patients with a sepsis, on patients with burns, for
elevated intracranial pressure and for attenuating cardio-pulmonary stress (103).
Ventilator-induced lung injury includes barotrauma, volutrauma, atelectrauma, and
biotrauma (43, 102). Barotrauma is associated with very high positive end-expiratory
pressure (PEEP) of >40 cm H2O and with peak inspiratory pressures (PIP) of >100 cm
H2O; but barotrauma does not seem to play an essential role in VILI (54, 102).
As Halbertsma et al. describe, the main determinant of volutrauma is the end-
inspiratory volume (43). Volutrauma consists of diffuse alveolar damage, pulmonary
oedema, an increase in fluid filtration, and loss of epithelium barrier (102). Dysfunction
or inactivation of surfactant during mechanical ventilation may also participate in the
development of oedema through a change in epithelial permeability due to an increase
![Page 14: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/14.jpg)
INTRODUCTION
6
of alveolar surface tension (34). Another reason for oedema appears to be the disruption
of the blood-gas barrier, primarily in the endothelium due to loss of the endothelial cell
contact to the basement membrane during injurious ventilation (118).
Cyclic opening and collapse of the alveoli during mechanical ventilation causes an
increase in working stretch and shear forces resulting in lung injury [atelectrauma; (43,
102)]. Dreyfuss and Saumon speculate that at the beginning of the atelectrauma,
surfactant inactivation leads to atelectasis with an augmentation of shear stress (34).
The fourth component of VILI - biotrauma - is due to an upregulation of cytokine
production in the lung, causing an inflammation - mainly an immigration of neutrophils
into the alveolar spaces (53) ˗ and further injuring of the lung. Mechanical ventilation
may lead to systemic inflammatory response syndrome (SIRS) and to multiple-system
organ failure (MSOF), leading to death (33, 102).
Figure 2: Effect of mechanical ventilation on a pressure-volume curve. The boxes mark the most susceptible ventilation conditions for the development of the designated components of VILI. The pressure increases from the left to the right. Modified from: (102).
Figure 2 illustrates regions in the pressure-volume curve that are associated with
different components of VILI (102). The International Consensus Conference in
Intensive Care Medicine identified volutrauma and atelectrauma as the two main
determinants of VILI (54). The menace of atelectrauma is greatest during ventilation
with pressures below the lower inflection point (96). The lower inflection point is
![Page 15: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/15.jpg)
INTRODUCTION
7
thought to represent the pressure/volume at which the alveoli are recruited (122). The
risk of volutrauma is greatest using pressures above the upper inflection point (96). This
upper inflection point marks the pressure/volume at which the alveoli are damaged due
to overinflation (122).
The two most important cell types for the development of VILI seem to be alveolar
macrophages and the pneumocytes (33). It has been shown that macrophages are
responsible for an intense increase of interleukin (IL)-8 production due to mechanical
stress (38). Macrophages also seem to play a crucial role in the mechanical stress-
induced lung remodelling. Furthermore, high TNFα (tumour necrosis factor α)
production seems to be dependent on macrophages (33). Another source of chemokines
may be the alveolar epithelial cells that produce TNFα in response to injurious
ventilation. Dos Santos and Slutsky postulate a crucial role for the pneumocytes as
cytokine and chemokine producers in VILI because of the highly exposed position of
the pneumocytes with respect to the mechanical stimuli during mechanical ventilation
(33).
Figure 3: Overview of potential mechanisms of development and consequences of VILI. Modified from: (38).
![Page 16: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/16.jpg)
INTRODUCTION
8
It is hypothesised that there are reciprocal interactions between the biotrauma-related
immunoreactions and mechanical stress leading to volutrauma, because microbial
products such as LPS enhance responses due to mechanical ventilation, and mechanical
stress aggravates this response to microbial products (78). Figure 3 provides an
overview of potential mechanisms involved in VILI (38).
1.4.2. Lung protective ventilation
One lung protective ventilation management strategy (90) is known as the “open lung”
concept that was coined by Lachmann. The components of this strategy are a pressure-
controlled ventilation with an initial PIP of 40 – 60 cmH2O (recruitment maneuver) that
is adjusted individually due to recruitment, a ratio of the duration of inspiration to
expiration (I:E) of 1:1 to 2:1, a PEEP of 10 – 20 cmH2O, a permissive hypercapnia, and
an initial inspired O2 concentration of 100% that is reduced in long term ventilation to
levels as less as tolerated by the patient. The fundamental idea is that terminal units are
stabilised with an appropriate level of PEEP. This leads to an increase in the aerated
lung fraction and may reduce regional overinflation so that VILI could be limited (54,
74). Further, PEEP may lessen the atelectrauma by stabilising the terminal units leading
to less shear stress of the pneumocytes (34, 38, 90). This could be explained by
preserved surfactant function (38). Using PEEP also decreases extravascular lung water
(74). Setting the PEEP over the lower inflection point results in an increase in the
arterial oxygenation, suggesting a better gas exchange with this strategy compared with
inadequate PEEP (96, 104).
The ARDS Network established the benefit of a low tidal volume ventilation strategy
(105). It was found that the mortality was less in that group compared with a group
ventilated with higher tidal volumes. The ventilation-free days and the days without
nonpulmonary failure were more numerous than in the control group. A decrease in
mortality was also observed in ventilation treatments using low tidal volumes and low
inflation pressures (54) suggesting that a combined ventilation strategy consisting of
low tidal volume and higher PEEP could lead to an increase in the survival rate in
patients requiring mechanical ventilation (4, 38, 54). This strategy also seems to
attenuate the biotrauma (54, 90). Tremblay et al. demonstrated that ventilation with high
PEEP and a moderate tidal volume damps the increase in cytokine levels [TNFα, IL-1β,
![Page 17: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/17.jpg)
INTRODUCTION
9
IL-6, interferon γ (IFNγ), IL-10] in the bronchoalveolar lavage (BAL) fluid compared
with ventilation strategies without PEEP in isolated rat lungs (110). The findings for the
IL-6 values were confirmed for human patients by the ARDS Network (105).
In rat models of VILI, pulmonary oedema was less severe using 30 cmH2O PIP instead
of 45 cmH2O PIP indicating a less severe process of the VILI. There is evidence that
ventilation strategies for reaching a defined target end-inspiratory pressure cause milder
oedema and less lung injury if these strategies include PEEP combined with a lower
tidal volume (96). It has been shown that high PEEP ventilation leads to less alveolar
damage by preventing alveolar instability (91). One study suggests that PEEP and low
tidal volume ventilation have synergistic effects in stabilising the alveoli in which
increasing PEEP has a greater effect than reducing the tidal volume (44).
There is evidence that a further improvement in survival could be achieved by
additional application of recruitment maneuvers. These maneuvers may consist of a 40-
second breathhold at 40 cmH2O airway pressure (79). Other studies suggest that higher
PEEP levels (above the lower inflection point) lead to a higher weaning rate from
mechanical ventilation (5) and a homogenous low tidal volume ventilation (9) whereas
there is no improved survival in ventilation strategies with high PEEP in comparison to
lower PEEP (14).
The American-European Consensus Committee on ARDS postulated the following
goals for “adequate” mechanical ventilation: 1) ensuring of an appropriate gas
exchange, 2) minimising O2 toxicity, 3) recruitment of the alveoli, 4) minimising the
airway pressures, 5) prevention of atelectasis, and 6) responsible use of sedation (6).
The state-of-the-art in mechanical ventilation treatment is the ARDS Network protocol
consisting of low tidal volumes, titration of respiratory rate monitored by a target pH
value of 7.3 to 7.45, and a combination of inspired O2 and PEEP leading to an oximetric
saturation of 88 to 95% (40, 105). A modest hypercapnia due to low tidal volumes is
permitted because it is tolerated in most patients (5, 40).
![Page 18: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/18.jpg)
INTRODUCTION
10
1.5. Intracellular mechanisms of converting mechanical stimuli
1.5.1. Responses to mechanical forces
Mechanical forces influence a multitude of cellular functions, including changes in cell
shape, growth, differentiation, cell-cycle kinetics, apoptosis, motility, gene expression,
and remodelling of the ECM (20). These mechanisms have to be seen as adaptational
mechanisms to extracellular forces via intracellular signalling processes. If the
mechanical stimuli are too strong, the cell membrane is destroyed. Due to this
destruction the cellular adaptation becomes impossible (114).
1.5.1.1. Cell death
There are two forms of cell death. One of these is necrosis. Necrosis is a form of cell
death due to cell swelling and uncontrolled disruption of the cell membrane leading to
liberation of the cell contents. This, in turn, causes inflammatory responses in the direct
environment of the concerned cells (47, 77). This form of cell death is thought to play a
role in epithelial cell death due to alveolar overdistension (77). There is evidence that
type II pneumocytes become necrotic due to increased mechanical stretch in vitro (46).
In contrast, apoptosis is characterised by the formation of membrane bodies, nuclear
pyknosis due to condensation of the chromatin, and nuclear fragmentation. Furthermore,
there is no inflammatory response in the environment of the cells because the cell
contents are not liberated in a free form but in membrane bodies that can be ingested by
phagocytic cells. This form of cell death is also known as controlled cell death (47).
1.5.1.2. Pro-apoptotic pathways
Apoptosis can be promoted by caspases which can be activated by released
mitochondrial products as cytochrome c or the so-called death receptors. To the death
receptors belong TNF receptors and the Fas receptor (77), which can be activated by
TNFα or Fas ligand (47, 77). The Fas ligand exists in two forms, a soluble form and a
membrane related form on the surface of cytotoxic lymphocytes (77). There are several
![Page 19: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/19.jpg)
INTRODUCTION
11
different targets of the caspases such as PARP [poly-adenosine diphosphate (ADP)-
ribose polymerase] that are cleaved by these proteases (71). Cleavage of the targets
leads to deoxyribonucleic acid (DNA) fragmentation, nuclear membrane disruption,
chromatin condensation, and collapse of the cytoskeleton (71). The Fas/Fas ligand
system is known to be more activated in ARDS (3, 49, 56), where the complex
promotes apoptosis (3). Kitamura et al. demonstrated a Fas/Fas ligand-dependent
mechanism of apoptosis in alveolar epithelial and endothelial cells for murine LPS-
induced ALI model (56). That apoptotic mechanisms play a role in the development of
ARDS is supported by the observations of Hashimoto et al. who found increased levels
of the Fas molecule in the BAL fluid of ARDS patients (49). These findings suggest a
destruction of the alveolar barrier leading to severe alveolar oedema and due to this a
poor outcome of the patients. In the lung tissue of patients who died with ALI/ARDS,
markers of apoptosis such as caspase-3, Bax, and p53 were found (3). In vitro studies
demonstrated that type II pneumocytes undergo apoptosis in response to mechanical
stress (46).
Another protein involved in apoptosis is p53. This protein is able to promote apoptosis
in a transcription-dependent manner by recruitment of transcription factors (p53-
inducible genes) and in a transcription-independent manner by cytochrome c release and
caspase activation (93). One direct transcriptional target for p53 is the gene of the
apoptotic peptidase activating factor 1 (Apaf1) (37). Apaf1 binds pro-caspase 9 and
activates this caspase which itself activates caspase 3 (29, 64). Caspase 3, in turn,
cleaves different cell proteins such as PARP or retinoblastoma proteins leading to
apoptosis (64). Another target of p53 is the p21 encoding gene CDKN1A (cyclin-
dependent kinase inhibitor 1a), which regulates several different cellular functions.
Generally, p53 leads, via CDKN1A expression, to cell cycle arrest, not to apoptosis (7,
27, 28). Further findings underscore an anti-apoptotic role of CDKN1A, since Lu et al.
demonstrated the induction of CDKN1A by activating the phosphoinositide 3-kinase
(PI3K)/Akt pathway leading to cell protection from p53-induced apoptosis in prostate
cancer (72). There is also evidence that p21 expression is dependent upon Akt
phosphorylation in ovarian carcinoma cell lines and endothelial cells (82, 100). In
human urothelial carcinoma cells, activation of the PI3K-Akt pathway leads, via
suppression of GSK3β (glycogen synthase kinase 3β) and activation of mTOR
(mammalian target of rapamycin), to CDKN1A induction (124).
![Page 20: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/20.jpg)
INTRODUCTION
12
A further target of p53 is the growth arrest and DNA damage gene 45a (GADD45A).
GADD45A can also be induced in a p53-independent manner, which leads usually to
cell cycle arrest and induction of DNA repair (7, 88). Whether Gadd45 is involved in
pro- or anti-apoptotic mechanisms depends on the interaction partner recruited. In
cooperation with p53, Gadd45 is pro-apoptotic (66). Gadd45a is able to act in an anti-
apoptotic fashion by interaction with β-catenin or Akt (80, 111). In a pneumonia ARDS
model, it was shown that Gadd45a-deficient mice sustain a higher vascular barrier
dysfunction than others because of an inadequate degradation of Akt (80).
An overproduction of reactive oxygen species (ROS) is known to induce both apoptosis
and necrosis (47). Reactive oxygen species can be increased in VILI due to mechanical
stress (1, 19).
Mitogen-activated protein kinases play also an important role in conversion of pro-
apoptotic stimuli, in particular p38 and JNK (see section 1.5.1.4). An overview of some
pro-apoptotic pathways is provided in Figure 4.
Figure 4: Overview of some pro-apoptotic mechanisms. CytoC: cytochrome c, FasL: Fas-ligand, FasLR: Fas-ligand receptor, ROS: reactive oxygen species, XOR: xanthine oxido-reductase.
![Page 21: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/21.jpg)
INTRODUCTION
13
1.5.1.3. Anti-apoptotic pathways
Stretch can activate phospholipase c (PLC)-γ directly, or stretch activates protein
tyrosine kinases (PTK) that activate, in turn, PLC-γ. The activated PLC-γ divides
phosphatidylinositol-4,5-bisphosphate (PIP2) into diacylglycerol (DAG) and inositol-
1,4,5-trisphosphate (IP3). This leads to an increase of Ca2+ influx into the cell and
activation of the protein kinase c (PKC). It is known that this pathway is involved in
proliferation of foetal rat lung cells in response to cyclic stretch and strain (70, 123).
Phosphoinositide 3-kinase is also able to cleave PIP2 into DAG and IP3 (65). This
kinase is activated during high PIP ventilation due to an increase in intracellular Ca2+
concentration by a Ca2+ entry through stretch activated ion channels (83). Other
possibilities of PI3K activation are the activation by hepatocyte growth factor (HGF)
(45, 69), keratinocyte growth factor (KGF) (8, 45), IL-1β (80), bradykinin (45) and
transforming growth factor (TGF)-β (23) as well as platelet-derived growth factor
(PDGF) (108). It can also be activated by ROS (2).
Phosphoinositide 3-kinase phosphorylates different downstream target proteins. One of
these targets is Akt. Akt phosphorylates GSK3β that is inactivated in a phosphorylated
state (69, 83, 108). Dephosphorylated GSK3β is involved in neutrophil infiltration into
the lung, in apoptosis, in TNF-α and IL-1β production, and in lung injury (26). Further,
active GSK3β initiates the degradation of β-catenin by phosphorylation. It is known that
β-catenin plays a crucial role in the integrity of adherens junctions and for the
maintenance of the blood-gas barrier in the lung. Phosphorylation of β-catenin leads to
reduced epithelial and endothelial barrier properties. Taken together, Akt prevents
blood-gas barrier dysfunction following the development of oedema (69, 83).
An important function of Akt is the inhibition of apoptosis (45, 83, 108). Different
aspects of the anti-apoptotic effects of Akt have been discussed. Akt seems to preserve
the mitochondrial membrane by preventing cytochrome c release. Further, Akt is known
to inhibit pro-apoptotic proteins in a direct and an indirect manner. Finally, Akt
modulates gene transcription by phosphorylation of different transcription factors, such
as forkhead or nuclear factor-κB (NF-κB) (125). The Akt deactivation is associated with
cell death in several cell systems. One study suggests a dependence of the activation
status of Akt on nitric oxide and Ca2+ (76) suggesting a pro-apoptotic effect of
gadolinium-sensitive Ca2+ channels (119) and of eNOS (endothelial nitric oxide
synthase) (21) leading to vascular barrier dysfunction in response to mechanical stress
![Page 22: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/22.jpg)
INTRODUCTION
14
in VILI. Prevention of stretch-induced apoptosis in type II pneumocytes seems to be
possible by activating the PI3K-Akt pathway (45).
There is evidence that the PI3K-Akt pathway leads to an enhanced expression of FGF2
(fibroblast growth factor 2) (17, 113, 127). Fibroblast growth factor 2 is known to play a
crucial role in cell survival via the PI3K-Akt pathway due to binding the FGF receptor
inter alia in epithelial cells (120). Thus, it is conceivable that a mechanism exists of
autocrine/paracrine self-induction of FGF2 expression via Akt leading to cell survive as
described for malignant carcinoma cells (12). Another factor that is influenced by Akt-
mediated gene expression is HGF (113) that regulates gene expression via Akt (61).
Gnecchi et al. postulate a paracrine upregulation of HGF (and FGF2) via Akt leading to
cytoprotection in cardiomyocytes (41). An augmentation of HGF in ALI (24) is
described as well as a crucial role of HGF in self-repair and anti-apoptotic mechanisms
in lung cells (85).
A further function of the PI3K-Akt pathway is the regulation of cell proliferation (94).
By stimulation of glucose metabolism, Akt increases intracellular ATP (adenosine
triphosphate) levels. Low ATP levels are a sign of poor energy status of the cell, and
can lead to controlled cell death (42). Adenosine monophosphate (AMP)-activated
protein kinase (AMPK) is a kinase that acts as an energy status sensor that is activated
by an increase in the intracellular AMP:ATP ratio, signalling a low energy state of the
cell (48, 84). Activation of AMPK can lead to cell cycle arrest or apoptosis via p53 (48,
84, 93). Another target of AMPK is mTOR, a factor involved in protein synthesis and
cell growth. AMPK is able to inhibit mTOR (48, 84). Taken together, Akt is able to
inhibit AMPK activation indirectly by increased production of ATP.
Akt has also been shown to play a role in the neutrophil activation in ALI (125). Li et
al. presented data that suggest that high tidal volume ventilation combined with
hyperoxia leads, via Akt, to an augmentation of eNOS expression leading to lung
neutrophil infiltration (63).
Another target of PI3K is Src, a protein that promotes β-catenin degradation. Src leads
to an increase in vascular permeability. The fact that there is gross oedema in high PIP
ventilated mice is explained by Miyahara et al. in the way that there is an imbalance
between the PI3K modulated downstream effects in favour of the Src pathway (83).
Mitogen-activated protein (MAP) kinases may be involved in anti-apoptotic pathways
as well (see section 1.5.1.4). An overview of some anti-apoptotic pathways is provided
in Figure 5.
![Page 23: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/23.jpg)
INTRODUCTION
15
Figure 5: Overview of anti-apoptotic mechanisms via Akt. CytoC: cytochrome c, FGFR: fibroblast growth factor receptor, P: phosphate. The interrupted lines indicate the consequences of Akt activation.
1.5.1.4. Mitogen-activated protein kinase pathways
There are four known mammalian MAP kinases that are phosphorylated (and thus
activated) by different MAP kinase kinases. The mitogen-activated protein/extracellular
signal-related kinase kinases (MEK) 1 and 2 activate extracellular signal-related kinases
(ERK) 1 and 2, the mitogen-activated protein kinase kinases (MKK) 3 and 6 activate
p38, MKK4/7 activate c-Jun amino-terminal kinase (JNK), and MEK5 activates ERK5
(18, 25).
Uhlig et al. demonstrated that the MAP kinases JNK and ERK1/2 are more
phosphorylated in rats ventilated with high pressure compared with normally ventilated
rats, but saw no differences in p38 phosphorylation (115). The ERK activation due to
mechanical stress was confirmed for rat pneumocytes (22). In contrast, it was also
![Page 24: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/24.jpg)
INTRODUCTION
16
observed activation of p38 and ERK 1 and 2 in high tidal volume ventilated mice, but
no difference in the activation state of JNK was noted (1). MAP kinases are known to
transduce extracellular stimuli to the nucleus where they modify gene expression (18,
115). Further, MAP kinases can modulate gene expression via post-transcriptional
modification of messenger ribonucleic acid [mRNA; (18)].
The ERK activation can be explained by ligand binding to the epidermal growth factor
receptor (EGFR) (112, 121). The EGFR has been shown to be up-regulated due to
stretch (31). There is evidence that the EGFR is necessary for mechanotransduction in
alveolar epithelial cells independent of ligand binding (22). Other mitogens that are able
to activate the ERK cascade are KGF (94), PDGF, TGF-β (121) and insulin (25).
Activation of these receptors leads to activation of the MAPK pathway via the G-
protein Ras (25, 30, 117), whereas the mechanotransduction seems to be independent of
Ras (22). Further, there is evidence that lung epithelial cells may activate ERK cascades
via Fas/Fas ligand interactions in vitro (92). Finally, the ERKs as well as p38 and JNK
can be phosphorylated in response to KGF binding to a receptor on type II pneumocytes
leading to proliferation and differentiation (95). ERKs are known to be involved in
cytokine production (25, 89, 92), cell proliferation (94) and prevention of apoptosis due
to hyperoxia (15) as well as in activation of the xanthine oxidoreductase (XOR), an
enzyme that can generate ROS, due to mechanical stress (1).
The p38 kinase is also known to play a role in the XOR activation. XOR activation is
discussed to play an important role in loss of the blood-gas barrier function in VILI (1).
Reactive oxygen species are increased generated in VILI leading to oxidant stress and a
following increase of production of IL-1β, IL-6, and TNFα (19). The ROS are also
known to play an important role in murine lung epithelial cell death due to hyperoxia
(1). The kinase p38 by itself is also very important for the gene expression of TNF, IL-
1, IL-6, and IL-8 (25, 89). Further, p38 can phosphorylate the GSK3β (69, 107). Finally,
there is evidence that p38 may be involved in TGF-β1-induced blood-gas barrier
dysfunction (13).
Ning and Wang postulate a key role for ERK1/2 and p38 in cellular response to
mechanical ventilation (87). It was observed an activation of these MAP kinases via
PKC leading to transcription of pro-inflammatory chemokines encoding genes due to
activation of NF-κB (87). It has been shown that activation of ERK1/2 due to MEK1/2
activation may lead to an increased degradation and inactivation of the transcription-
![Page 25: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/25.jpg)
INTRODUCTION
17
related peroxisome proliferator-activated receptor PPARγ. Due to this inactivation the
ERK1/2 may be responsible for lung injury in sepsis (55).
Extracellular signal-related kinases 1 and 2 are considered to be important for cell
survival, whereas JNK and p38 may induce apoptosis via Fas ligand induction (18). A
reduction of apoptosis in p38- and JNK-deficient mice under moderate tidal volume
ventilation has been demonstrated, as well as a decrease in oedema levels in JNK-
deficient mice, suggesting an important role for p38 and JNK in development of VILI
(32). Further, there is evidence that p38 activation by TGF-β1 is involved in pro-
apoptotic mechanisms in lung epithelial cells (116). Taken together, there are findings
suggesting both pro-survival and cell death roles for ERK1/2. The JNK and p38 are
involved in cell death mechanisms.
1.6. Aim of the study
The hypothesis of this study was that intracellular signalling pathways in pneumocytes
protect cells from damage in an “open lung” ventilation strategy compared to low
PEEP and high PIP ventilated lungs.
The goal of this study was to identify molecular mechanisms that could be involved in
the protection of the lung tissue during the lung protective ventilation strategy using
high PEEP and low tidal volumes in contrast to a ventilation strategy using lower PEEP
in a saline washout ARDS rat model. This would be determined as follows:
1) Nucleic acids and proteins would be extracted from the lung tissues.
2) The activation of cell protective and cell death pathways would be examined.
3) Areas of cell death in ventilated lungs would be examined to identify the
affected cell type.
![Page 26: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/26.jpg)
MATERIALS AND METHODS
18
2. MATERIALS AND METHODS
2.1. Materials
2.1.1. Equipment
Block heater HBT 130 HLC, Germany
Cannula 22G BD, Netherlands
Centrifuge Biofuge fresco Kendro Laboratory Products, USA
Developing machine; X Omat 2000 Kodak, USA
Falcon tubes: 15 ml, 50 ml Greiner Bio-One, Germany
Film cassette Sigma-Aldrich, Germany
Filter Tip FT: 10, 20, 100, 200, 1000 Greiner Bio-One, Germany
Fluorescence microscope; Leica AS MDW Leica, Germany
Freezer -80 °C Heraeus, Germany
Fridge +4 °C Bosch, Germany
Fusion A153601 Reader Packard Bioscience, Germany
Glass bottles: 250 ml, 500 ml, 1000 ml Fischer, Germany
GS-800™ Calibrated Densitometer Bio-Rad, USA
Hyperfilm™ ECL High Performance Amersham Biosciences, UK
Mini spin centrifuge Eppendorf, Germany
Microtom Micron cool-cut HM355S Micron, Germany
Mortar Haldenwanger, Germany
Multipette® plus Eppendorf, Germany
Nanodrop® spectrophotometer Peqlab, Germany
Nebuliser Penn-Century, USA
Needle 20G Becton Dickinson S.A., Spain
PAP pen Sigma-Aldrich, Germany
PCR thermocycler MJ Research, USA
Pestle Haldenwanger, Germany
Pipetman: P10, P20, P100, P200, P1000 Gilson, France
Pipette tip: 200 µl, 1000 µl Sarstedt, Germany
Pipette tip: 10 µl, 20 µl, 100 µl Gilson, USA
![Page 27: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/27.jpg)
MATERIALS AND METHODS
19
Platform shaker Titramax 1000 Heidolph, Germany
Power supply; PowerPac 300 Bio-Rad, USA
Roto-Shake Genie Scientific Industries, USA
Scalpel FEATHER, Japan
Scientific Imaging Film X-OMAT™ LS Kodak, USA
Test tubes: 0.8 ml, 1.5 ml, 2.0 ml Greiner Bio-One, Germany
Test Tube Shaker Merck Eurolab, Germany
Thermo-Fast® 96 PCR plate Thermo Scientific, USA
Trans-Blot® Transfer Medium Bio-Rad Laboratories, USA
Ventilator Servo 300 Siemens Elema, Sweden
Western blot chambers: Mini Trans-Blot Bio-Rad, USA
2.1.2. Reagents
Acrylamide solution, Rotiphorese Gel 30 Roth, Germany
Alexa Fluor 488 goat anti-mouse IgG Invitrogen, USA
Alexa Fluor 555 goat anti-rabbit IgG Invitrogen, USA
Ammonium persulfate Promega, USA
Bovine serum albumin Sigma-Aldrich, Germany
Bromophenol blue Sigma-Aldrich, Germany
Complete ™Protease Inhibitor Roche, Germany
4ʹ,6-Diamidino-2-phenyl-indol-dihydrochloride Sigma-Aldrich, Germany
DEPC water Roth, Germany
Dithiothreitol Promega, USA
Dulbecco’s phosphate buffered saline 10× PAA Laboratories, Austria
ECL Plus Western Blotting Detection Reagents Amersham Biosciences, UK
Ethylenediaminetetraacetic acid Promega, USA
Ethylene glycol-tetraacetic acid Sigma-Aldrich, Germany
Glycerol Merck, Germany
β-glycerophosphate Sigma-Aldrich, Germany
Glycine Roth, Germany
Hydrochloric acid Sigma-Aldrich, Germany
Isoflurane Pharmachemie, Netherlands
β-mercaptoethanol Sigma-Aldrich, Germany
![Page 28: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/28.jpg)
MATERIALS AND METHODS
20
Methanol Fluka, Germany
N,N,Nʹ,Nʹ-tetramethy-ethane-1,2-diamine Bio-Rad Laboratories, USA
Nonfat dry milk Nestlé, Switzerland
Pancuronium bromide NV Organon, Netherlands
Pentobarbital Ceva Sante Animale, Netherlands
Platinum® SYBR® Green qPCR SuperMix-
UDG kit Invitrogen, USA
Precision Plus Protein™ Standards Bio-Rad Laboratories, USA
QuickStart™ Bradford Protein Assay Bio-Rad Laboratories, USA
RNeasy Protect Mini Kit Qiagen, Germany
Sodium citrate Merck, Germany
Sodium dodecyl sulfate Promega, USA
Sodium ortho vanadate Sigma-Aldrich, Germany
Sodium pyrophosphate Sigma-Aldrich, Germany
SuperScript™III First-Strand Synthesis System Invitrogen, USA
Super Signal® West Pico Luminol/Enhancer
Solution Pierce Biotechnology, USA
Super Signal® West Pico Stable Peroxide
Solution Pierce Biotechnology, USA
Tris Roth, Germany
Tris-Cl United States Biochemical, USA
Triton X-100 Promega, USA
Tween 20 Sigma-Aldrich, Germany
VECTASHIELD mounting medium Vector Laboratories, USA
2.2. Methods
2.2.1. Animal models
All procedures were approved by the experimental animal committee of the Erasmus
Medical Center (Rotterdam, Netherlands). All animals were handled in strict accordance
with the European Community Guidelines. Tissue samples were obtained from specific
![Page 29: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/29.jpg)
MATERIALS AND METHODS
21
pathogen-free male Sprague Dawley rats of 300 g (298 - 331 g, Harlan, Horst,
Netherlands).
The animals were anaesthetised after orotracheal intubation under gaseous anaesthesia
(60% oxygen, 3% isoflurane), using a miniature nebuliser. A sterile polyethylene
catheter was inserted into the carotid artery. Arterial blood gases and the blood pressure
were monitored with this catheter. Thereafter, anaesthesia was changed into
intraperitoneal pentobarbital sodium injections (60 mg/kg). Pancuronium bromide (2
mg/kg, intramuscular) was used to induce muscle relaxation. Lungs were ventilated
using a Servo Ventilator 300 as described in Table 1.
Table 1: Ventilation settings of the different rat groups
low PEEP (1-6) high PEEP (7-12) control (13-18)
PIP [cmH2O] 28 30 14
PEEP [cmH2O] 8 18 4
I:E 1:2 1:1 1:2
Frequency [min-1] 30 50-60 30
Oxygen 100% 100% 100%
FiO2 1.0 1.0 1.0
PIP: peak inspiratory pressure, PEEP: positive end-expiratory pressure, I:E: inspiration: expiration, FiO2: fraction of inspired O2
The rats were divided into three groups: six rats (numbers 1-6) were ventilated with a
low PEEP ventilation setting after inducing lung injury, six rats (numbers 7-12) were
ventilated with a high PEEP after inducing lung injury, and six rats (numbers 13-18)
were ventilated without inducing lung injury as a control. For inducing lung injury,
bronchoalveolar lavage with 1 ml/30 g body weight of isotonic saline solution (body
temperature) was performed 6×.
For every rat PaO2 and PaCO2 was measured before and after lavage and 60 and 120
min after lavage.
After the rats were sacrificed by infusion of an overdose of pentobarbital sodium, the
thorax was opened and the lungs collected under sterile conditions. Immediately, BAL
fluid was obtained by rinsing the airways three times with saline. The BAL fluid was
![Page 30: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/30.jpg)
MATERIALS AND METHODS
22
centrifuged (300 × g for 19 min at 4 °C), and the supernatant and lung tissue were
stored at -80 °C.
All these treatments of the rats were performed by a group from the Erasmus University
in Rotterdam.
Preparations of the whole organs were defrosted from -80 °C. Organs were placed in a
mortar where the lungs were separated from bronchi using disposable scalpels. Lungs
were placed in centrifuge tubes such that one lung of each rat could be used for protein
and RNA investigations and one lung for histology analyses.
2.2.2. Protein isolation from lungs
Frozen lung tissue was crushed into powder under liquid nitrogen with a mortar and
pestle. The powder was completely covered with lysis buffer (Table 2) for extracting
proteins from tissue. The pH of the Tris was adjusted with hydrochloric acid. The
phosphatase inhibitor sodium vanadate and the protease inhibitor cocktail were added
immediately prior to use. The lysate was passed 5-8 × through a syringe needle (20 G)
to fragment larger clusters of tissue. The lysate was placed in a centrifuge tube (2.0 ml)
which was placed on ice for 30 min. Every 5 min, the sample was vortexed. The lysate
was centrifuged at 4 °C at 13,000 rpm for 15 min. The supernatant was aliquoted into
0.8 ml centrifuge tubes and frozen at -80 °C for further experiments.
Table 2: Composition of the lysis buffer
INGREDIENTS CONCENTRATION
Tris (pH 7.5) 20 mM
sodium chloride 150 mM
EDTA 1 mM
EGTA 1 mM
Triton X-100 1 %
Sodium pyrophosphate 2.5 mM
β-glycerolphosphate 1 mM
sodium vanadate 10 µl/ml
CompleteTM Protease Inhibitor 40 µl/ml
EDTA: ethylenediaminetetraacetic acid, EGTA: ethylene glycol tetraacetic acid
![Page 31: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/31.jpg)
MATERIALS AND METHODS
23
2.2.3. Determination of protein concentration
After thawing, the protein concentration in the lysate was determined colometrically
using a Bradford Protein Assay. Quick Start™ Bradford Dye Reagent (200 µl) was
mixed with 20 µl of a 1:100 protein dilution. After an incubation of 15 min at room
temperature the absorbance was measured at a wavelength of 570 nm with the Packard
Fusion™ instrument. The protein concentration was calculated using the standard curve
using Microsoft Excel.
2.2.4. SDS polyacrylamide gel electrophoresis
Proteins were separated using sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS-PAGE). The SDS denatures proteins, binds to the polypeptides,
and provides a consistent negative charge to the polypeptides allowing a migration of
the proteins to the positive electrode in an electric field. The mobility of the proteins
correlates negative with the protein size: larger proteins migrate slower than smaller
ones. According to the molecular weight, the proteins can be separated.
With 2× SDS loading buffer (Table 3) were combined 150 µg of protein. This mixture
was heated at 95 °C for 10 min in a water bath before it was loaded onto the gel
consisting of resolving gel (Table 4) and stacking gel (Table 5). Electrophoresis was
carried out in running buffer (Table 6) at 90 V until the front dye reached the bottom of
the gel.
Table 3: Composition of the loading buffer
INGREDIENTS CONCENTRATION
Tris, pH 6.8 100 mM
SDS 4%
Bromophenol blue 0.2%
Glycerol 20%
DTT 200 mM
SDS: sodium dodecyl sulfate, DTT: dithiothreitol
![Page 32: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/32.jpg)
MATERIALS AND METHODS
24
Table 4: Composition of the resolving gel
INGREDIENTS AMOUNT FOR 1 GEL
Distilled water 4 ml
30% acrylamide 3.3 ml
1.5 M Tris, pH 8.8 2.5 ml
10% SDS solution 100 µl
10% APS 100 µl
TEMED 4 µl
SDS: sodium dodecyl sulfate, APS: ammonium persulfate, TEMED: N,N,Nʹ,Nʹ-tetramethy-ethane-1,2-diamine
Table 5: Composition of the stacking gel
INGREDIENTS AMOUNT FOR 1 GEL
Distilled water 3.4 ml
30% acrylamide 0.8 ml
1,0 M Tris, pH 6.8 0.6 ml
10% SDS solution 50 µl
10% APS 50 µl
TEMED 5 µl
SDS: sodium dodecyl sulfate, APS: ammonium persulfate, TEMED: N,N,Nʹ,Nʹ-tetramethy-ethane-1,2-diamine
Table 6: Composition of 10× running buffer
INGREDIENTS AMOUNT per 1 l
Tris 30 g
Glycine 144 g
10% SDS solution 100 ml
SDS: sodium dodecyl sulfate
![Page 33: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/33.jpg)
MATERIALS AND METHODS
25
2.2.5. Protein blotting
A western blot allows detection of specific proteins in protein mixtures using specific
antibodies for recognition. For antibody interaction the proteins have to be transferred
from the polyacrylamide gel to a 0.25 nitrocellulose membrane. For protein transfer was
used an electric field of 90 V for a duration of 90 min. The procedure was performed in
blotting buffer (Table 7).
Table 7: Composition of the blotting buffer
INGREDIENTS CONCENTRATION
Methanol 20%
Tris 20 mM
Glycine 150 mM
The membranes were then washed 2×5 min while shaking on a Roto-Shake Genie
(Table 8).
Table 8: Composition of the washing buffer
INGREDIENTS AMOUNT
10× Dulbecco’s PBS 100 ml
Tween 20 1 ml
Distilled water filled up to 1 l
PBS: phosphate buffered saline, PBST: PBS/Tween 20
2.2.6. Protein visualisation
At room temperature, membranes were blocked while shaking in blocking buffer for 1 h
(Table 9) followed by incubation with the appropriate primary antibodies during
shaking on a platform shaker at 4 °C overnight. The membranes were washed 3×10 min
with washing buffer and then incubated with a horse-radish peroxidase (HRPO)-linked
secondary antibody for 2 h at room temperature followed by 3×10 min washing. The
concentrations of the primary and secondary antibodies are presented in Table 10.
![Page 34: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/34.jpg)
MATERIALS AND METHODS
26
Specific bands were detected by using the Super Signal® West Pico Luminol/Enhancer
Solution and the Super Signal® West Pico Stable Peroxide Solution. When the signal
was too weak or not detectable, the ECL Plus Western Blotting Detection Reagents A
and B were used.
Table 9: Composition of the blocking buffer
INGREDIENTS CONCENTRATIONS
PBST Table 8
Nonfat dry milk 5 %
PBST: phosphate buffered saline/Tween 20
Table 10: Primary antibodies used in this study
ANTIBODY DILUTION DILUTED
IN SOURCE
DILUTION
Secondary
antibody
CATALOGUE
# COMPANY
Phospho-Akt 1:1000 BSA rabbit 1:2000 9271 Cell Signaling
Akt 1:1000 BSA rabbit 1:5000 9272 Cell Signaling
Phospho-AMPKα 1:667 BSA rabbit 1:2000 2535 Cell Signaling
AMPKα 1:1000 BSA rabbit 1:2000 2532 Cell Signaling
Phospho-
β-Catenin 1:500 BSA rabbit 1:1000 9561 Cell Signaling
β-Catenin 1:1000 BSA rabbit 1:2000 9562 Cell Signaling
Phospho-GSK3β 1:1000 BSA rabbit 1:2000 9336 Cell Signaling
GSK3β 1:2000 BSA rabbit 1:2000 9315 Cell Signaling
MEK1/2 1:1000 BSA rabbit 1:5000 9122 Cell Signaling
Phospho-p38 1:500 BSA rabbit 1:5000 9211 Cell Signaling
p38 1:1000 BSA rabbit 1:5000 9212 Cell Signaling
Phospho-p44/42 1:500 Milk* mouse 1:1000 9106 Cell Signaling
p44/42 1:1000 BSA rabbit 1:5000 9102 Cell Signaling
p53 1:2000 BSA rabbit 1:2000 2527 Cell Signaling
Cleaved PARP 1:1000 Milk* rabbit 1:2000 9545 Cell Signaling
PARP 1:1000 Milk* rabbit 1:2000 9542 Cell Signaling
Phospho-SAPK/JNK 1:500 BSA rabbit 1:1000 9251 Cell Signaling
SAPK/JNK 1:1000 BSA rabbit 1:4000 9252 Cell Signaling
*Milk = blocking buffer; BSA: bovine serum albumin, AMPKα: adenosine monophosphate-activated protein kinase α, GSK3β: glycogen synthase kinase 3β, MEK1/2: mitogen-activated protein/extracellular signal-related kinase kinases 1/2, PARP: poly-ADP-ribose polymerase, SAPK: stress-activated protein kinase, JNK: c-Jun-NH2-terminal kinase.
![Page 35: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/35.jpg)
MATERIALS AND METHODS
27
The luminescence of the HRPO product was detected with Kodak Scientific Imaging
Film or the more sensitive Hyperfilm™ ECL High Performance chemiluminescence
film.
The membranes were rinsed with washing buffer (1×10 min) before stripping in a water
bath of 60 °C for 10 min. For this procedure the membranes were put into a Falcon tube
with stripping buffer (Table 11). This procedure allows detection of the phosphorylated
form and thereafter of the total amount of the appropriate protein with one membrane,
using the described instructions.
Table 11: Composition of 100 ml of stripping buffer
INGREDIENTS VOLUME
Double-distilled water 91.7 ml
10% SDS solution 2 ml
1.0 M Tris pH 6.8 6.25 ml
β-mercaptoethanol 0.7 ml
SDS: sodium dodecyl sulfate
2.2.7. RNA isolation
Isolation of RNA from lung tissue was performed according to the manufacturer’s
instructions provided with RNeasy Protect Mini Kit containing amongst others the
buffers RLT, RW1, and RPE.
The RNA isolation and RNA handling until cDNA synthesis were performed under cold
conditions to prevent RNA degradation. For cooling tissue and/or the centrifuge and
collection tubes was used liquid nitrogen.
A lysis buffer containing 20 µl of 2 M DTT per 1 ml RLT buffer was prepared before
RNA isolation. Analogous to the protein isolation, frozen lung tissue was crushed into
powder under liquid nitrogen with a mortar and pestle. The lysis buffer (600 µl) was
added before a 2 min centrifugation in a cooled 2 ml centrifuge tube followed.
Accordant with the homogenisation of the tissue for the protein analysis, the
homogenisation was performed with a needle and syringe. The lysate was centrifuged
for 3 min before the supernatant was transferred to a new centrifuge tube. At the rate of
![Page 36: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/36.jpg)
MATERIALS AND METHODS
28
1:1 ethanol (70%) was added. This was mixed by pipetting. The mixture was transferred
into a combination of RNeasy spin column and collection tube before 15 sec of
centrifugation (8000 × g). The flow-through was discarded. With 700 µl of RW1 buffer
it was performed an anew centrifugation for 15 sec at 8000 × g. After discarding the
flow-through the RNeasy spin column was washed two times with 500 µl of buffer
RPE. This was performed by one 15 sec and one 2 min centrifugation at 8000 × g.
Adding 50 µl of RNA free water followed by 1 min centrifugation at 8000 × g led to
elution of the RNA.
2.2.8. Measuring RNA concentration
The concentration and quality of the obtained RNA was determined by measuring the
optical density of the obtained solutions with a Nanodrop® spectrophotometer. The
leachate (10 µl) was mixed with 490 µl of 7.0 pH Tris-Cl. The absorbance of the diluted
sample was measured at 260 nm. The amount of RNA was calculated by using the
formula C=A260 × 44 µg/ml × 50 where C is the concentration, A260 is the measured
absorbance, 44 µg/ml is an absolute term describing the correlation of absorbance to the
concentration of RNA (1 unit absorbance corresponds to 44 µg RNA per ml), and 50 is
the dilution factor. By multiplication with the volume of the elution the total amount of
RNA was calculated.
2.2.9. cDNA synthesis
Reverse transcriptase is a RNA-dependent DNA polymerase that transcribes the mRNA
of the obtained solutions into complementary DNA (cDNA). Total RNA (5 µg) was
combined with 1 µl of random hexamers, 1 µl of dNTP mix and autoclaved water up to
10 µl total volume. The mixture was incubated at 65 °C for 5 min, chilled on ice for 1
min, and 10 µl of cDNA Synthesis Mix (Table 12) was added. After gentle mix and
brief centrifugation these mixtures were incubated at 25 °C for 10 min followed by an
incubation of 50 min at 50 °C. With a temperature increase to 85 °C for 5 min the
reactions were stopped by inactivating the reverse transcriptase. The mixtures were put
![Page 37: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/37.jpg)
MATERIALS AND METHODS
29
on ice immediately before 1 µl of E. coli RNase H was added. The cDNA was
generated after a further incubation at 37 °C for 20 min.
Table 12: cDNA Synthesis Mix
REAGENTS VOLUME
10× RT buffer 2 µl
25 mM MgCl2 4 µl
0.1 M DTT 2 µl
RNaseOUT™ 1 µl
SuperScript™ III RT 1 µl
RT: reverse transcriptase, DTT: dithiothreitol
2.2.10. Real-time polymerase chain reaction
Quantitative real-time PCR (qPCR) is used to amplify and quantify a specific DNA
molecule, where SYBR Green I can be used as a detection system, as SYBR Green I is
a double-stranded DNA intercalating dye that fluoresces once bound to double-stranded
DNA. The amount of bound dye correlates with the amount of target amplicon
generated.
The reactions were performed according with the manufacturer’s instructions provided
the Platinum® SYBR® Green qPCR SuperMix-UDG kit (Table 13).
Table 13: Composition of the real-time polymerase chain reaction
REAGENTS VOLUME
Platinum® SYBR® Green qPCR
SuperMix-UDG 13 µl
50 mM MgCl2 1 µl
10 µM forward primer 0.5 µl
10 µM reverse primer 0.5 µl
cDNA template 2 µl
autoclaved water 8 µl
UDG: uracil-DNA glycosylase
![Page 38: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/38.jpg)
MATERIALS AND METHODS
30
The polymerase chain reaction was run with following settings: 2 min with 50 °C for
UDG incubation, 2 min with 95 °C for the denaturation followed by 40 cycles of 15 s
with 95 °C for denaturation of the double stranded DNA and 30 s with 60 °C for primer
annealing and production of complementary DNA strands. The fluorescence intensity
was measured at the end of the elongation phase. Hypoxanthine
phosphoribosyltransferase (HPRT) is a so-called housekeeping gene - ubiquitously and
constitutively-activate gene in mammals - and was used as internal control. For the
comparability between the measurements it was used the ∆∆Ct method
(∆∆Ct=∆Ct(treated)-∆Ct(control)). The primers employed are listed in Table 14.
Table 14: Primer sequences
Gene Accesion Sequences (5ʹ → 3ʹ) Length Applicon
for CGGTCACACGAACTCAGTCA 20 bp APAF1 NM_023979
rev ACTGCCAAATGGTCGTAGGG 20 bp 348 bp
for AGTAGGACTTCGGGGTCTCC 20 bp CDKN1A NM_080782
rev AATGTCAAGGCTCTGGACGG 20 bp 121 bp
for CCGCAGAGCAGAAGATCGAA 20 bp GADD45A NM_024127
rev AGTTATGGTGCGCTGACTCC 20 bp 89 bp
for GCTTGATTTGTCAAGCGCCA 20 bp RBBP7 NM_031816
rev ACAGTACGCAACAGCTCACT 20 bp 115 bp
for AGGCTCCGTGTACTGTGTTG 20 bp RGD1561176 NM_001029910
rev CCTGGCACTGTACGGCTAAA 20 bp 320 bp
for: forward primer, rev: reverse primer, bp: base pairs
To exclude DNA contamination there was performed a control experiment of the PCR
without reverse polymerase. If there was DNA detected the sample was contaminated.
Contaminated samples were discarded.
2.2.11. Cryosections - immunohistochemistry
Immunohistochemistry is a method to detect and localise antigens in tissue sections. It
is based on antibody-antigen interaction and on fluorescence, using a primary antibody
![Page 39: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/39.jpg)
MATERIALS AND METHODS
31
against the target antigen. A secondary antibody against the primary antibody is labelled
with a fluorescent dye that can be examined by microscopy.
Lung tissue was sectioned with a cryostat. The 6 µm-thick sections were placed on a
silanised slide. These slides were washed in PBS for 5 min. To make the sections
permeable sections were put in permeabilisation buffer for 10 min at 4 °C. The
permeabilisation buffer was produced by mixing 0.1% Triton X-100 and 0.1% sodium
citrate in PBS. After permeabilisation the slices were washed out with PBS 3×5 min.
For creating a hydrophobic cycle around the tissue it was used a PAP pen. The slides
were incubated in 100 µl 10% BSA/PBS for 1 h at 4 °C. After this incubation the slides
were washed out with PBS 3×5 min. The primary antibodies (Table 15) were diluted in
100 µl of 0.1% BSA/PBS.
Table 15: Primary antibodies used for immunohistochemistry
ANTIBODY DILUTION SOURCE CATALOGUE # COMPANY
Aquaporin 5 1:1000 rabbit 78486 Abcam, UK
SP-C 1:1000 rabbit AB3786 Chemicon, USA
p53 1:200 mouse 2524 Cell Signaling,
USA
SP-C: surfactant protein C
Incubation with the primary antibodies was performed for 1 h at 4 °C. Protein
accumulation of p53 was used for the detection of apoptosis, aquaporin 5 was used as a
marker for type I pneumocytes, and SP-C (surfactant protein C) as a marker for type II
pneumocytes. After this incubation time, slides were washed with PBS 3×5 min before
the incubation with the secondary antibodies. Secondary antibodies were Alexa Fluor
555 goat anti-rabbit IgG and Alexa Fluor 488 goat anti-mouse IgG. The incubation of
the secondary antibodies was performed in the dark at 4 °C for 1 h at a dilution of
1:1000 in 100 µl 0.1% BSA/PBS. Sections were washed 3×5 min in PBS. The nuclei of
all cells were labelled using DAPI (4',6-diamidino-2-phenyl-indol) that binds to DNA
and fluoresces blue. At room temperature, the sections were incubated with 100 µl of
1:100 DAPI/PBS for 7 min in the dark. Then, the sections were washed 3×5 min with
PBS. After incubation with secondary antibody, respectively with the DAPI the sections
were covered with VECTASHIELD mounting medium for preserving the fluorescence
![Page 40: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/40.jpg)
MATERIALS AND METHODS
32
for the microscopic examination. Images of the save field were taken using three
different fluorescence channels, to identify nuclei (DAPI), cell types (type I
pneumocytes [aquaporin 5] and type II pneumocytes [SP-C]), and apoptosis (p53).
2.2.12. Statistical analysis
The qRT-PCR results were presented as means ± standard error of mean. The ∆∆Ct
values obtained from qRT-PCR were analysed in groups with Grubbs test to determine
and exclude statistical outliers. Statistical outliers are referred in the concerning section.
The data were then subjected to a two-tailed, one-sample Student’s t-test for comparing
two groups with each other (high PEEP vs. low PEEP, high PEEP vs. control, and low
PEEP vs. control). Results were considered statistically significant when p < 0.05. For
the statistical calculations was used GraphPad Prism 5 (GraphPad Software, USA).
![Page 41: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/41.jpg)
RESULTS
33
3. RESULTS
3.1. Protein expression analysis
3.1.1. The mitogen-activated protein kinases
It is known that different extracellular stimuli like stretch at the cell surface evoke a
change in the activation state of different MAP kinases. Figure 6 illustrates the
activation states of different MAP kinases due to the different ventilation strategies, and
in absence and presence of lung injury.
There was no evidence for a different abundance of phosphorylated MEK1/2 in the
different treated rat groups. But the phosphorylation state of the ERK1 and ERK2 in
injured rat lungs was increased compared to the lungs of non-injured rat lungs
independent of the used ventilation strategy. Further, there was no difference in the
abundance of phosphorylated JNK in the three different rat groups. It was noted an
increase in p38 phosphorylation in lung-injured rats independent of the chosen
ventilation setting.
Figure 6: Phosphorylated (p) MAP kinases and total MAP kinases in the lung tissue lysates.
3.1.2. PI3K-Akt pathway
The PI3K-Akt pathway is known to be involved in cellular responses due to mechanical
ventilation. Figure 7 illustrates that the fraction of phosphorylated Akt was highest in
![Page 42: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/42.jpg)
RESULTS
34
the rat group with underlying lung injury and ventilated with high PEEP whereas the
levels of total Akt were similar. The phosphorylation state of GSK3β was increased in
that group. The fraction of phosphorylated β-catenin was lower in the rat group with
lung injury that was ventilated with high PEEP. Furthermore, the phosphorylation state
of AMPKα was lower in the group with lung injury ventilated with high PEEP. These
results suggest a lung protective effect of high PEEP ventilation settings because the
PI3K-Akt pathway is known to be involved in anti-apoptotic mechanisms as described
in section 1.5.1.3.
Figure 7: Expression at phosphorylation status (p) of PI3K-Akt pathway proteins in the different lung tissue lysates.
3.1.3. Markers of cell death
Both p53 and PARP were investigated as markers of cell death. Figure 8 illustrates that
highest degree of cell death occured in the group of rats that was ventilated with low
PEEP after inducing lung injury. The levels of the cell death markers in the rat group
that was ventilated with high PEEP after lung injury were similar to the levels in that
group without lung injury suggesting lung protective effects of high PEEP ventilation
settings.
![Page 43: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/43.jpg)
RESULTS
35
Figure 8: Cell death markers due to the different treatments of the rats.
3.2. Gene expression analysis
The amount of specific mRNA correlates with the activation state of the associated
gene. Selected p53-inducible genes with known pro-apoptotic gene products were
investigated in this study: Apaf1, CDKN1a and Gadd45a, as well as the pro-apoptotic
but p53-independent genes retinoblastoma binding protein Rbbp7 and the rat equivalent
of the ALG2 interacting protein ALIX - RGD1561176.
Figure 9: The gene expression of APAF1 in the low PEEP ventilated rat group, the open lung approach ventilated group and the rat group without lung injury compared with HPRT. * indicates statistical significance (p<0.05).
![Page 44: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/44.jpg)
RESULTS
36
Figure 10: The gene expression of CDKN1A in the low PEEP ventilated rat group, the open lung approach ventilated group and the rat group without lung injury compared with HPRT. * indicates statistical significance (p<0.05).
Figure 11: The gene expression of GADD45A in the low PEEP ventilated rat group, the open lung approach ventilated group and the rat group without lung injury compared with HPRT. * indicates statistical significance (p<0.05).
![Page 45: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/45.jpg)
RESULTS
37
Figure 12: The gene expression of RBBP7 in the low PEEP ventilated rat group, the open lung approach ventilated group and the rat group without lung injury compared with HPRT* indicates statistical significance (p<0.05).
Figure 13: The gene expression of RGD1561176 in the low PEEP ventilated rat group, the open lung approach ventilated group and the rat group without lung injury compared with HPRT.
![Page 46: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/46.jpg)
RESULTS
38
With the Grubbs test were identified as statistical outliers the values of rat 10 for the
CDKN1a and the GADD45a analyses, and the value of rat 9 for the RGD1561176
analysis; these samples were excluded before the statistical calculations were done. The
expression of the investigated genes was highest in the tissue lysates of the rat group
that was ventilated with low PEEP ventilation approach suggesting a pro-apoptotic
effect of low PEEP ventilation. Whereas the differences between the low and high
PEEP ventilated rat groups were not statistically significant for the pro-apoptotic but
p53-independent genes RBBP7 (Figure 12) and RGD1561176 (Figure 13), there was a
statistical significance between these groups considering the expression state of the pro-
apoptotic and p53-inducible genes APAF1 (Figure 9), CDKN1a (Figure 10) and
GADD45a (Figure 11). Furthermore, there were no statistical significant differences in
apoptotic gene expression between the high PEEP ventilated group and the control
group. These findings provide an evidence of p53-dependent pro-apoptotic mechanisms
in low PEEP ventilation settings whereas high PEEP ventilation seems to protect the
lung leading to an outcome as if there was no lung injury. These findings corroborate
the results of the protein investigations that also demonstrated a higher rate of apoptosis
in the low PEEP ventilated lung tissue compared to the high PEEP ventilated group.
3.3. Immunohistochemistry
Immunohistochemistry was performed to detect the structures of the lungs that are
affected the most by cell death in VILI.
Figure 14 illustrates the results with the type I pneumocyte cell marker aquaporin 5. The
colocalisation of the apoptosis marker p53 with the type I pneumocyte marker
suggested apoptosis in type I pneumocytes in low PEEP ventilated rats.
In Figure 15, staining for the type II pneumocyte marker SP-C is illustrated. The
staining of the apoptosis marker p53 generally did not colocalise with the SP-C staining,
suggesting, by comparison with Figure 14, that the p53 accumulation is largely found in
type I pneumocytes rather than in type II pneumocytes. These findings permit the
conclusion that the type I pneumocytes are affected more by cell death than the type II
pneumocytes in low PEEP ventilated rats.
![Page 47: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/47.jpg)
RESULTS
39
Figure 14: Images from sections from rat 1. (A) Staining with DAPI, (B) staining with aquaporin 5, (C) staining with p53 antibodies. (D) composite of the three images (A), (B) and (C). The arrows indicate the colocalisation of aquaporin 5 and p53 staining.
Figure 15: Images from sections from rat 1. (A) Staining with DAPI, (B) staining with S-PC, (C) staining with p53 antibodies. (D) composite of the three images (A), (B) and (C). The arrows indicate the divergence of p53 and SP-C staining (bulky arrows: p53 signal without SP-C signal, thin arrows: SP-C signal without p53 signal).
![Page 48: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/48.jpg)
DISCUSSION
40
4. DISCUSSION
Acute respiratory distress syndrome is the major reason for morbidity and mortality in
patients treated in intensive care units, although lung protective ventilation strategies -
i.e. high PEEP ventilation strategies - lead to a decrease in mortality rate due to ARDS
(68, 98, 126). The basis of ARDS is a direct or an indirect pulmonary injury (50).
Mechanical ventilation is the basis of treatment of patients with ARDS (103). But
mechanical ventilation may itself lead to further damage of the lung tissue by
mechanical forces (34, 43, 54, 102, 118). To minimize the risk of VILI lung protective
ventilatory strategies consisting of a PIP of 40-60 cmH2O, a ratio of the duration of
inspiration to expiration (I:E) of 1:1 to 2:1, a PEEP of 10-20 cmH2O, a permissive
hypercapnia, and inspiration of low levels of O2 were developed (90).
The aim of this study was to investigate molecular pathways that could be involved in
the protection of the lung tissue during the lung protective ventilation strategy using
high PEEP and low tidal volumes, in contrast to a ventilation strategy using lower PEEP
in a saline washout ARDS rat model.
For most investigations reported here, the whole lung tissue, not individual cells or cell
types were investigated. The advantage of this kind of investigation is that the organ
was treated in a natural manner because the organ was located in situ in the organism.
All interacting mechanisms - direct lung reactions as well as systemic retroactions on
the lung due to mechanical ventilation - were involved. The handicap of this method is
that it was not possible to assign the observed reactions to specific cells or cell types.
The immunohistochemical investigations attempted to fill this gap.
According to the pressure-volume curve illustrated in Figure 2 ventilation settings must
be adapted to the pressure-volume curve as pictured in Figure 16 to prevent VILI by
volutrauma or atelectrauma.
As described in the introduction, volutrauma and atelectrauma are the most important
determinants of VILI (54). Volutrauma is evoked by application of high end-inspiratory
volumes (43). Atelectrauma is induced by cyclic opening and collapse of the alveoli
![Page 49: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/49.jpg)
DISCUSSION
41
(16, 67). In the “open lung” ventilation strategy both of them are prevented because the
pressure-volume curve is approximated to the scheme in Figure 16.
Figure 16: Approximation to the pressure-volume curve without induction of traumata leading to VILI. 2. Modified from: (102).
Barotrauma seems to be largely unimportant for the development of VILI (54, 102). The
result of using this kind of ventilation strategy should be lung protective ventilation.
The MAP kinases can be activated by mitogens such as TGF-β and bone morphogenetic
proteins, or due to mechanical stimuli. Two of these MAP kinases are MEK1 and
MEK2. These kinases are known to be activated due to TGF-β binding to the epidermal
growth factor receptor (121). Phosphorylation of MEK1/2 usually leads to ERK1/2
activation. Western blot results revealed an equal phosphorylation state of MEK1/2 in
all rat groups independent of induction of lung injury and independent of the ventilation
strategy (Figure 6). Whereas, with western blots it was demonstrated that the
phosphorylation state of the ERKs was higher in the rat lungs with induced lung injury,
but there was no difference between the two ventilation strategies (Figure 6). It is
known that ERK1/2 can be activated via EGF receptors due to mechanical stimuli, such
as postulated for VILI (22, 31). There are also findings that suggest a cell damaging
![Page 50: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/50.jpg)
DISCUSSION
42
effect of MEK1/2-mediated ERK1/2 activation (55, 101). The western blot analyses do
not allow a conclusion as to the cell origin.
Although the MEK1/2 activation state did not reveal a difference in the rat groups, the
ERK phosphorylation state was equal in the lung injured rat groups but independent of
the ventilation strategy increased to the non-injured rat group suggesting an
upregulation due to lung injury. It can be speculated that an unknown interacting factor
that is upregulated due to lung protective ventilation inhibits the ERK activation by
MEK. Taken together, this would speak for a preponderance of the pro-apoptotic power
of ERK in the whole lung despite possible protective effects in particular lung cells.
Another MAP kinase that is known to be activated due to pressure applied in
mechanical ventilation is JNK (115). In the western blot studies, there was no difference
in the phosphorylation state of the JNK comparing the absence and presence of lung
injury or with different ventilation settings (Figure 6). Uhlig et al. compared two
ventilation settings in the absence of lung injury (115). Comparable to the findings in
this study, there was no significant difference in the JNK phosphorylation state.
Furthermore, Abdulnour et al. could not find any differences in phosphorylation of JNK
comparing a high tidal and a low tidal volume ventilation at all (1). Thus, it seems that
differences in PEEP settings do not lead to an activation of the JNK as well as the
absence or presence of ARDS.
The third MAP kinase investigated was p38, which is known to be activated by
mechanical stress (1, 115). In the investigations of Uhlig et al. no differences were
found in phosphorylation of p38 between high and low PIP ventilation (115). These
findings are comparable with the results of the western blots in this study that did not
reveal any differences between high and low PEEP ventilation, suggesting that the type
of ventilation strategy is not relevant for p38 activation. But in the data presented here,
there was a difference in phosphorylation state comparing injured and uninjured rat
lungs (Figure 6). The kinase p38 is known to be an important factor in development of
cell damage and blood-gas barrier dysfunction in VILI (13, 18, 32, 116).
The MAP kinase western blots suggest an activation of ERK1/2 and an activation of
p38 in the saline lavaged rat lungs compared with non-injured rat lungs.
Akt is a kinase that can lead, via different steps, to inhibition of apoptosis (45, 83, 108).
The Akt can prevent VILI due to PI3K activation (83). During high PIP ventilation was
seen an increase of PI3K activation state (83).
![Page 51: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/51.jpg)
DISCUSSION
43
Western blot analyses in this study revealed an increased Akt activation state in lung
tissues of the “open lung” ventilated rats. The phospho-Akt levels in the tissues of rats
that were not injured were similar to the tissue of the low PEEP ventilated rats.
Consistent with these findings further western blots demonstrated increased
phosphorylation states of GSK3β in the “lung protective” ventilated rat lung tissues
(Figure 7). Glycogen synthase kinase 3β is a target of Akt. It is known that
dephosphorylated GSK3β is involved in apoptosis and lung injury (26). Glycogen
synthase kinase 3β in dephosphorylated state phosphorylates β-catenin. By
phosphorylation β-catenin is marked for decomposition leading to decreased blood-gas
barrier function (69, 83). The western blot analyses of β-catenin revealed that the tissue
of the high PEEP ventilated rat group contained a lower level of phospho-β-catenin than
the tissue of the other groups (Figure 7). Indirectly, Akt is able to inactivate another pro-
apoptotic protein – the AMPKα (42, 48, 84, 93). The western blot analyses of AMPKα
revealed a lower level of the AMPKα phosphorylation state in the rat group with lung
injury and high PEEP ventilation compared with the other groups (Figure 7).
Figure 17 gives an overview of the found anti-apoptotic mechanisms due to the “open
lung” ventilation strategy.
Figure 17: Summary of the lung protective cellular mechanisms via Akt in the “open lung” ventilation strategy. ATP: adenosine triphosphate, ADP: adenosine diphosphate, AMP: adenosine monophosphate, P: phosphate. The interrupted lines indicate the consequences of Akt activation.
![Page 52: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/52.jpg)
DISCUSSION
44
Via p53, AMPKα is able to induce apoptosis (48, 84, 93). Further western blot analyses
demonstrated that the p53 levels in the lung tissue of rats ventilated with the protective
strategy were similar to the p53 levels in the tissue of the non-injured rats. In contrast,
the p53 levels in the lung tissue of the low PEEP ventilated rats were higher than in the
high PEEP ventilated rats and in the non-injured rats (Figure 8). Another marker of cell
death is cleaved PARP (71). Western blots revealed - consistent with the findings for
the p53 levels - the highest fractions of cleaved PARP in the group with the low PEEP
ventilation strategy (Figure 8).
Further, the RT-PCR results demonstrated a higher level of expression for genes that are
involved in pro-apoptotic mechanisms of cells for the low PEEP ventilated rat groups.
APAF1 (29, 37, 64), CDKN1A (7, 27, 28), and GADD45A (7, 66, 88) are p53-
inducible genes that are known to be involved in pro-apoptotic mechanisms due to
induction by p53. The RT-PCR results for these genes revealed a higher expression in
the low PEEP ventilated rat group compared with the “open lung” ventilated group. The
results for these genes were statistically significant (Figures 9, 10, 11). These findings
indicate a p53-dependent pathway of converting cell damaging physical stimuli in low
PEEP ventilation to apoptosis. Further, there were RT-PCR results of the pro-apoptotic
but p53-independent genes RBBP7 and RGD1561176 that suggest also a p53-
independent apoptosis pathway. Both genes were upregulated in the low PEEP
ventilated rat group. In contrast to the results of the p53-inducible genes, the results for
the p53-independent genes were not statistically significant (Figures 12, 13).
A reason for anti-apoptotic effects in the high PEEP ventilated rat group may be
prevention of the atelectrauma that could damage the lung due to shear stress.
Prevention of the atelectrauma leads to activation of cell protective mechanisms leading
to decreased gene expression of pro-apoptotic genes. In this way it can be explained that
the PCR results are similar in the high PEEP ventilated rat group and the rat group
without induced lung injury whereas the low PEEP ventilated rat group where the gene
expression of the pro-apoptotic genes is not negatively influenced.
An overview of apoptotic mechanisms is given in Figure 18.
![Page 53: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/53.jpg)
DISCUSSION
45
Figure 18: Overview of the pro-apoptotic mechanisms in low PEEP ventilation confirmed by my investigations. ATP: adenosine triphosphate, ADP: adenosine diphosphate, AMP: adenosine monophosphate, P: phosphate.
Taken together, these findings suggest that the “open lung” ventilation strategy in rats
promotes cell survival and lung protection. The study presented here, as well as the
work of others, reveal that Akt responds to mechanical stimuli, such as those induced by
mechanical ventilation, in the lung. It is proposed here that Akt drives the
phosphorylation, and thereby inactivation, of GSK3β. This would be protective, since
active GSK3β leads to the degradation of β-catenin, which in turn leads to loss of blood-
gas barrier integrity (69, 83), a key feature of pulmonary oedema (38). The ability of
Akt to promote phosphorylation, and hence, inactivation of GSK3β, would promote the
stability of β-catenin, and thus, promote blood-gas barrier integrity. Furthermore, Akt
may lead, via a reduction in the AMP:ATP ratio (42), to less phosphorylation of
AMPKα (48, 84), leading to inactivation of AMPKα. The apoptosis rate of affected
cells would then decrease, because AMPKα promotes cell death (48, 84, 93).
![Page 54: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/54.jpg)
DISCUSSION
46
A further mechanism of lung protection is the lower steady-state expression level of p53
in the lungs of “open lung” ventilated rats. Increased steady-state levels of p53, as seen
in low PEEP ventilated lungs, leads - via gene regulation - to increased rates of
apoptosis in the lungs of the low PEEP ventilated rats. The pro-apoptotic activity of p53
is related to the increased expression of pro-apoptotic p53-inducible genes, the
expression of which was increased in the lungs of low PEEP ventilated rats. However,
the increased expression of pro-apoptotic p53-independent genes was also noted,
indicating that p53-independent pro apoptotic pathways were also operative in the lungs
of low PEEP ventilated rats.
Thus, this study revealed the activation of anti-apoptotic pathways, particularly the
PI3K-Akt pathway, and inactivation of pro-apoptotic pathways, including p53-
dependent and p53-independent mechanisms of apoptosis.
Since it was established that the most harmful effects occur in the low PEEP ventilated
rat lungs it was evident to investigate the most affected cells in a most affected lung.
The immunohistochemical investigations demonstrated that the cell-injurious stimuli
impacted primarily the type I pneumocytes (Figures 14, 15). These cells are in the “front
line” in the barrier to the environment, and protect the other lung tissue from harmful
physical, chemical, and biological stimuli (52, 99). The reason why type I pneumocytes
are primarily affected is not known, however, reasons may include the vastly increased
abundance of type I pneumocytes, and the different biological properties and locations
of type I pneumocytes when compared with type II pneumocytes. The activation of
ERK1/2 noted in this study may also have bearing on the differences observed in the
apoptosis of type I pneumocytes versus type II pneumocytes. All injured (i.e. saline
lavaged) lungs exhibited an increase in the activation state of ERK1/2, as documented
by increased levels of ERK1/2 phosphorylation. Thus, ERK1/2 activation appears to be
a general response to injury in saline-lavaged lungs. Activation of ERKs can lead to
harmful reactions in the cell, mediated by ROS generation (1, 19, 47). However,
ERK1/2 activation may also serve to prevent apoptosis, as has been described for
hyperoxic-injury to type II pneumocytes (15). Thus, it may be speculated that ERK1/2-
drived pathways operate differently in type I pneumocytes versus type II pneumocytes,
which may underlie the differences observed in the apoptosis of type I pneumocytes
versus type II pneumocytes. However, no data to support this idea are provided in the
studies reported here.
![Page 55: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/55.jpg)
DISCUSSION
47
The data presented here make a strong case for the “open lung” ventilation concept as a
lung protective ventilation strategy in an intensive care setting. Some of the molecular
pathways that may underlie this protective effect of high PEEP ventilation have been
revealed, namely, the activation of Akt, which drives anti-apoptotic, and counteracts
pro-apoptotic pathways operative in the ventilated, injured lung. Subsequent studies
should address whether inhibition of Akt activation in this background may negate the
positive effects of Akt activation during high PEEP ventilation of injured lungs, thus
validating the Akt pathway as the protective pathway induced by high PEEP ventilation.
![Page 56: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/56.jpg)
ABSTRACT
48
5. ABSTRACT
The acute respiratory distress syndrome (ARDS) is the major reason for morbidity and
mortality in patients treated in intensive care units. Direct or indirect pulmonary injury
can lead to ARDS. Mechanical ventilation is the basis of treatment of patients with
ARDS. Mechanical ventilation may induce by itself further damage of the lung tissue.
To minimise the risk of subsequent ventilator-induced lung injury (VILI), “protective
ventilation” strategies were developed. The mechanisms of lung protection due to
protective ventilation settings are largely unknown.
The molecular mechanisms of lung protection were examined in lung tissue from a
saline lavage ARDS rat model. Rats were divided into three groups: one without
induction of lung injury, one with induction of lung injury and low positive end-
expiratory pressure (PEEP) ventilation, and one group with induction of lung injury and
high PEEP ventilation (“open lung”).
From these studies Akt has emerged as a candidate mediator of lung protective
pathways during mechanical ventilation of lungs with an “open lung” concept. Akt
inhibits the pro-apoptotic factor p53 directly. Further, Akt inactivates AMP-activated
protein kinase α (AMPKα) and glycogen synthase kinase 3β (GSK3β). The kinase
AMPKα normally activates p53, and thus, Akt can also inhibit p53 indirectly. Active
GSK3β leads to a degradation of β-catenin leading to cell membrane instability and
apoptosis. This route of apoptosis induction is also subverted by Akt.
That there was a reduced degree of apoptosis under protective “open lung” ventilation
was indicated by western blot analyses for the apoptosis marker cleaved poly-ADP-
ribose polymerase (PARP), where the amount of cleaved PARP was lowest in the rat
group ventilated with the “open lung” strategy. These findings were corroborated by
real-time PCR analyses of the pro-apoptotic p53-inducible genes APAF1, CDKN1A
and GADD45A, which presented highest expression levels in the low PEEP-ventilated
rat group, suggesting p53-dependent apoptotic pathways in VILI. Finally,
immunohistochemical examinations revealed that the type I pneumocytes were more
affected by apoptosis than type II pneumocytes during mechanical ventilation of the
lung.
![Page 57: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/57.jpg)
ZUSAMMENFASSUNG
49
6. ZUSAMMENFASSUNG
Das akute respiratorische Distress-Syndrom (ARDS) ist der Hauptgrund für Morbidität
und Mortalität von auf Intensivstationen behandelten Patienten. ARDS entwickelt sich
auf dem Boden einer direkten oder indirekten Schädigung der Lunge. Mechanische
Beatmung stellt die Basistherapie von ARDS-Patienten dar. Maschinenbeatmung kann
selbst zu weiteren Schädigungen des Lungengewebes führen. Um das Risiko einer
entsprechenden beatmungsassoziierten Lungenschädigung (VILI) zu minimieren,
wurden lungenschonende Beatmungsstrategien entwickelt. Wie diese Strategien die
Lunge schonen, ist größtenteils noch ungeklärt.
Molekulare Mechanismen, die zur Lungenschonung beitragen, wurden in
Lungengeweben eines Saline-Lavage ARDS-Rattenmodells untersucht. Die Ratten
wurden drei Gruppen zugeteilt: bei einer Gruppe wurde kein ARDS verursacht, bei
einer wurde nach ARDS-Auslösung ein niedriger PEEP zur Beatmung gewählt und
einer nach ARDS-Provokation eine Beatmung mit hohem PEEP (“open lung“)
angeboten. Als Dreh- und Angelpunkt anti-apoptotischer Effekte lungenprotektiver
Beatmung entpuppte sich Akt. Akt hemmt den pro-apoptotischen Faktor p53 direkt.
Darüberhinaus inaktiviert Akt sowohl die AMP-aktivierte Proteinkinase α (AMPKα) als
auch die Glycogensynthasekinase 3β (GSK3β). Normalerweise aktiviert AMPKα p53,
so dass Akt p53 auch indirekt hemmen kann. Aktive GSK3β führt zum Abbau von β-
Catenin, was zur Instabilisierung von Zellmembranen und auch zur Apoptose führt.
Dieser Apoptoseweg ist also ebenfalls durch Akt blockiert. Dass unter
lungenprotektiver Beatmung tatsächlich weniger Zellen in die Apoptose gehen, zeigten
die Western blot-Analysen mit dem Apoptose-Marker poly-ADP-Ribosepolymerase
(PARP), bei denen der Anteil von gespaltener PARP in der mit der “open lung”-
Strategie beatmeten Rattengruppe am geringsten war. Diese Ergebnisse wurden von
real-time PCR-Untersuchungen der pro-apoptotischen, p53-induzierbaren Gene APAF1,
CDKN1A und GADD45A gestützt, die die höchsten Expressionslevel in der mit
geringem PEEP beatmeten Gruppe zeigten, was einen p53-abhängigen
Apoptosesignalweg nahelegt. Schließlich wurde mit immunhistochemischen
Untersuchungen gezeigt, dass die Typ I-Alveolarepithelzellen in höherem Maße als die
Typ II-Alveolarepithelzellen von Apoptose unter mechanischer Beatmung betroffen
sind.
![Page 58: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/58.jpg)
ABBREVIATIONS
50
7. ABBREVIATIONS
A
ADP adenosine diphosphate
ALI acute lung injury
AMP adenosine monophosphate
AMPK AMP-activated protein kinase
Apaf1 apoptotic peptidase activating factor 1
APS ammonium persulfate
ARDS acute respiratory distress syndrome
ATP adenosine triphosphate
B
BAL bronchoalveolar lavage
BMP bone morphogenetic protein
BSA bovine serum albumin
C
cAMP cyclic adenosine monophosphate
CDKN1A cyclin-dependent kinase inhibitor 1a
cDNA complementary DNA
CO2 carbon dioxide
D
DAG diacylglycerol
DAPI 4',6-diamidino-2-phenyl-indol
D-MEM Dulbecco’s modification of Eagle’s medium
DNA deoxyribonucleic acid
dNTP deoxynucleotide triphosphates
dsDNA double-stranded DNA
DTT dithiothreitol
![Page 59: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/59.jpg)
ABBREVIATIONS
51
E
ECM extracellular matrix
EDTA ethylenediaminetetraacetic acid
EGF epidermal growth factor
EGTA ethylene glycol tetraacetic acid
ELISA enzyme-linked immunosorbent assay
eNOS endothelial nitric oxide synthases
ERK extracellular signal-related kinase
F
FCS foetal calf serum
FGF fibroblast growth factor
G
g gram or centrifugal force
Gadd growth arrest and DNA damage
GSK3β glycogen synthase kinase 3β
GTP guanosine triphosphate
H
HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic
acid
HGF hepatocyte growth factor
HRPO horseradish peroxidase
HPRT hypoxanthine phosphoribosyltransferase
I
IFNγ interferon γ
IL interleukin
IP3 inositol-1,4,5-trisphosphate
J
JNK c-Jun-NH2-terminal kinase
![Page 60: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/60.jpg)
ABBREVIATIONS
52
K
KGF keratinocyte growth factor
L
l liters
LPS lipopolysaccharide
M
µ micro
m milli
MAPK mitogen-activated protein kinase
MEK mitogen-activated protein/extracellular signal-
related kinase kinase
MKK mitogen-activated protein kinase kinase
MLC myosin light chain
mRNA messenger ribonucleic acid
MSOF multiple-system organ failure
mTOR mammalian target of rapamycin
N
NF-κB nuclear factor-κB
NOS nitric oxide synthase
P
PARP poly-ADP-ribose polymerase
PBS phosphate-buffered saline
PBST PBS + 0.1 % Tween 20
PCR polymerase chain reaction
PCWP pulmonary capillary wedge pressure
PDGF platelet-derived growth factor
PEEP positive end-expiratory pressure
PI3K phosphoinositide 3-kinase
PIP peak inspiratory pressure
PIP2 phosphatidylinositol-4,5-bisphosphate
![Page 61: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/61.jpg)
ABBREVIATIONS
53
PKA protein kinase A
PKC protein kinase C
PLC phospholipase C
PPAR peroxisome proliferator-activated receptor
PTK protein tyrosine kinase
R
Rbbp 7 retinoblastoma binding protein 7
ROCK Rho-associated kinase
ROS reactive oxygen species
rpm revolutions per minute
S
SAPK stress-activated protein kinase
SDS sodium dodecyl sulfate
SIRS systemic inflammatory response syndrome
SP-C surfactant protein C
T
TEMED tetramethylethylenediamine
TGFβ transforming growth factor-β
TNFα tumour necrosis factor α
Tris tris(hydroxymethyl)aminomethane
U
UDG uracil-DNA glycosylase
V
V volt
VILI ventilator-induced lung injury
![Page 62: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/62.jpg)
REFERENCES
54
8. REFERENCES
1. Abdulnour RE, Peng X, Finigan JH, Han EJ, Hasan EJ, Birukov KG,
Reddy SP, Watkins JE 3rd, Kayyali US, Garcia JG, Tuder RM, Hassoun
PM. Mechanical stress activates xanthine oxidoreductase through MAP
kinase-dependent pathways. Am J Physiol Lung Cell Mol Physiol,
291(3), 345-353 (2006)
2. Ahmad A, Ahmad S, Chang LY, Schaack J, White CW. Endothelial Akt
activation by hyperoxia: role in cell survival. Free Radic Biol Med,
40(7), 1108-1118 (2006)
3. Albertine KH, Soulier MF, Wang Z, Ishizaka A, Hashimoto S,
Zimmerman GA, Matthay MA, Ware LB. Fas and fas ligand are up-
regulated in pulmonary edema fluid and lung tissue of patients with acute
lung injury and the acute respiratory distress syndrome. Am J Pathol,
161(5), 1783-1796 (2002)
4. Amato MB, Barbas CS, Medeiros DM, Magaldi RB, Schettino GP,
Lorenzi-Filho G, Kairalla RA, Deheinzelin D, Munoz C, Oliveira R,
Takagaki TY, Carvalho CR. Effect of a protective-ventilation strategy on
mortality in the acute respiratory distress syndrome. N Engl J Med,
338(6), 347-354 (1998)
5. Amato MB, Barbas CS, Medeiros DM, Schettino Gde P, Lorenzi Filho
G, Kairalla RA, Deheinzelin D, Morais C, Fernandes Ede O, Takagaki
TY, et al. Beneficial effects of the "open lung approach" with low
distending pressures in acute respiratory distress syndrome. A
prospective randomized study on mechanical ventilation. Am J Respir
Crit Care Med, 152(6 Pt 1), 1835-1846 (1995)
6. Artigas A, Bernard GR, Carlet J, Dreyfuss D, Gattinoni L, Hudson L,
Lamy M, Marini JJ, Matthay MA, Pinsky MR, Spragg R, Suter PM. The
American-European Consensus Conference on ARDS, part 2:
Ventilatory, pharmacologic, supportive therapy, study design strategies,
and issues related to recovery and remodeling. Acute respiratory distress
syndrome. Am J Respir Crit Care Med, 157(4 Pt 1), 1332-1347 (1998)
![Page 63: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/63.jpg)
REFERENCES
55
7. Baldi A, De Luca A, Esposito V, Campioni M, Spugnini EP, Citro G.
Tumor suppressors and cell-cycle proteins in lung cancer. Patholog Res
Int, 605042 (2011)
8. Bao S, Wang Y, Sweeney P, Chaudhuri A, Doseff AI, Marsh CB, Knoell
DL. Keratinocyte growth factor induces Akt kinase activity and inhibits
Fas-mediated apoptosis in A549 lung epithelial cells. Am J Physiol Lung
Cell Mol Physiol, 288(1), 36-42 (2005)
9. Barbas CS, de Matos GF, Pincelli MP, da Rosa Borges E, Antunes T, de
Barros JM, Okamoto V, Borges JB, Amato MB, de Carvalho CR.
Mechanical ventilation in acute respiratory failure: recruitment and high
positive end-expiratory pressure are necessary. Curr Opin Crit Care,
11(1), 18-28 (2005)
10. Bernard GR, Artigas A, Brigham KL, Carlet J, Falke K, Hudson L, Lamy
M, LeGall JR, Morris A, Spragg R. Report of the American-
European Consensus conference on acute respiratory distress syndrome:
definitions, mechanisms, relevant outcomes, and clinical trial
coordination. Consensus Committee. J Crit Care, 9(1), 72-81 (1994)
11. Bernard GR. Acute respiratory distress syndrome: a historical
perspective. Am J Respir Crit Care Med, 172(7), 798-806 (2005)
12. Billottet C, Elkhatib N, Thiery JP, Jouanneau J. Targets of fibroblast
growth factor 1 (FGF-1) and FGF-2 signaling involved in the invasive
and tumorigenic behavior of carcinoma cells. Mol Biol Cell, 15(10),
4725-4734 (2004)
13. Birukova AA, Birukov KG, Adyshev D, Usatyuk P, Natarajan V, Garcia
JG, Verin AD. Involvement of microtubules and Rho pathway in TGF-
beta1-induced lung vascular barrier dysfunction. J Cell Physiol, 204(3),
934-947 (2005)
14. Brower RG, Lanken PN, MacIntyre N, Matthay MA, Morris A,
Ancukiewicz M, Schoenfeld D, Thompson BT; National Heart, Lung,
and Blood Institute ARDS Clinical Trials Network. Higher versus lower
positive end-expiratory pressures in patients with the acute respiratory
distress syndrome. N Engl J Med, 351(4), 327-336 (2004)
![Page 64: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/64.jpg)
REFERENCES
56
15. Buckley S, Driscoll B, Barsky L, Weinberg K, Anderson K, Warburton
D. ERK activation protects against DNA damage and apoptosis in
hyperoxic rat AEC2. Am J Physiol, 277(1 Pt 1), 159-166 (1999)
16. Budinger GR, Chandel NS, Donnelly HK, Eisenbart J, Oberoi M, Jain M.
Active transforming growth factor-beta1 activates the procollagen I
promoter in patients with acute lung injury. Intensive Care Med, 31(1),
121-128 (2005)
17. Cao H, Dronadula N, Rao GN. Thrombin induces expression of FGF-2
via activation of PI3K-Akt-Fra-1 signaling axis leading to DNA synthesis
and motility in vascular smooth muscle cells. Am J Physiol Cell Physiol,
290(1), 172-182 (2006)
18. Chang L, Karin M. Mammalian MAP kinase signalling cascades. Nature,
410(6824), 37-40 (2001)
19. Chapman KE, Sinclair SE, Zhuang D, Hassid A, Desai LP, Waters CM.
Cyclic mechanical strain increases reactive oxygen species production in
pulmonary epithelial cells. Am J Physiol Lung Cell Mol Physiol, 289(5),
834-841 (2005)
20. Chicurel ME, Chen CS, Ingber DE. Cellular control lies in the balance of
forces. Curr Opin Cell Biol, 10(2), 232-239 (1998)
21. Choi WI, Quinn DA, Park KM, Moufarrej RK, Jafari B, Syrkina O,
Bonventre JV, Hales CA. Systemic microvascular leak in an in vivo rat
model of ventilator-induced lung injury. Am J Respir Crit Care Med,
167(12), 1627-1632 (2003)
22. Correa-Meyer E, Pesce L, Guerrero C, Sznajder JI. Cyclic stretch
activates ERK1/2 via G proteins and EGFR in alveolar epithelial cells.
Am J Physiol Lung Cell Mol Physiol, 282(5), 883-891 (2002)
23. Coulter KR, Doseff A, Sweeney P, Wang Y, Marsh CB, Wewers MD,
Knoell DL. Opposing effect by cytokines on Fas-mediated apoptosis in
A549 lung epithelial cells. Am J Respir Cell Mol Biol, 26(1), 58-66
(2002)
24. Crosby LM, Waters CM. Epithelial repair mechanisms in the lung. Am J
Physiol Lung Cell Mol Physiol, 298(6), 715-731 (2010)
25. Cuschieri J, Maier RV. Mitogen-activated protein kinase (MAPK). Crit
Care Med, 33(12 Suppl), 417-419 (2005)
![Page 65: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/65.jpg)
REFERENCES
57
26. Cuzzocrea S, Crisafulli C, Mazzon E, Esposito E, Muià C, Abdelrahman
M, Di Paola R, Thiemermann C. Inhibition of glycogen synthase kinase-
3beta attenuates the development of carrageenan-induced lung injury in
mice. Br J Pharmacol, 149(6), 687-702 (2006)
27. Das S, Boswell SA, Aaronson SA, Lee SW. P53 promoter selection:
choosing between life and death. Cell Cycle, 7(2), 154-157 (2008)
28. Das S, Raj L, Zhao B, Kimura Y, Bernstein A, Aaronson SA, Lee SW.
Hzf Determines cell survival upon genotoxic stress by modulating p53
transactivation. Cell, 130(4), 624-637 (2007)
29. Deng WG, Kawashima H, Wu G, Jayachandran G, Xu K, Minna JD,
Roth JA, Ji L. Synergistic tumor suppression by coexpression of FUS1
and p53 is associated with down-regulation of murine double minute-2
and activation of the apoptotic protease-activating factor 1-dependent
apoptotic pathway in human non-small cell lung cancer cells. Cancer
Res, 67(2), 709-717 (2007)
30. Derynck R, Zhang YE. Smad-dependent and Smad-independent
pathways in TGF-beta family signalling. Nature, 425(6958), 577-584
(2003)
31. Dolinay T, Kaminski N, Felgendreher M, Kim HP, Reynolds P, Watkins
SC, Karp D, Uhlig S, Choi AM. Gene expression profiling of target
genes in ventilator-induced lung injury. Physiol Genomics, 26(1), 68-75
(2006)
32. Dolinay T, Wu W, Kaminski N, Ifedigbo E, Kaynar AM, Szilasi M,
Watkins SC, Ryter SW, Hoetzel A, Choi AM. Mitogen-activated protein
kinases regulate susceptibility to ventilator-induced lung injury. PLoS
One, 3(2), e1601 (2008)
33. Dos Santos CC, Slutsky AS. Invited review: mechanisms of ventilator-
induced lung injury: a perspective. J Appl Physiol, 89(4), 1645-1655
(2000)
34. Dreyfuss D, Saumon G. Ventilator-induced lung injury: lessons from
experimental studies. Am J Respir Crit Care Med, 157(1), 294-323
(1998)
![Page 66: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/66.jpg)
REFERENCES
58
35. Fahy RJ, Lichtenberger F, McKeegan CB, Nuovo GJ, Marsh CB,
Wewers MD. The acute respiratory distress syndrome: a role for
transforming growth factor-beta 1. Am J Respir Cell Mol Biol, 28(4),
499-503 (2003)
36. Fan E, Needham DM, Stewart TE. Ventilatory management of acute lung
injury and acute respiratory distress syndrome. JAMA, 294(22), 2889-
2896 (2005)
37. Fortin A, Cregan SP, MacLaurin JG, Kushwaha N, Hickman ES,
Thompson CS, Hakim A, Albert PR, Cecconi F, Helin K, Park DS, Slack
RS. APAF1 is a key transcriptional target for p53 in the regulation of
neuronal cell death. J Cell Biol, 155(2), 207-216 (2001)
38. Frank JA, Matthay MA. Science review: mechanisms of ventilator-
induced injury. Crit Care, 7(3), 233-241 (2003)
39. Gattinoni L, Bombino M, Pelosi P, Lissoni A, Pesenti A, Fumagalli R,
Tagliabue M. Lung structure and function in different stages of severe
adult respiratory distress syndrome. JAMA, 271(22), 1772-1779 (1994)
40. Girard TD, Bernard GR. Mechanical ventilation in ARDS: a state-of-the-
art review. Chest, 131(3), 921-929 (2007)
41. Gnecchi M, He H, Noiseux N, Liang OD, Zhang L, Morello F, Mu H,
Melo LG, Pratt RE, Ingwall JS, Dzau VJ. Evidence supporting paracrine
hypothesis for Akt-modified mesenchymal stem cell-mediated cardiac
protection and functional improvement. FASEB J, 20(6), 661-669 (2006)
42. Gottlob K, Majewski N, Kennedy S, Kandel E, Robey RB, Hay N.
Inhibition of early apoptotic events by Akt/PKB is dependent on the first
committed step of glycolysis and mitochondrial hexokinase. Genes Dev,
15(11), 1406-1418 (2001)
43. Halbertsma FJ, Vaneker M, Scheffer GJ, van der Hoeven JG. Cytokines
and biotrauma in ventilator-induced lung injury: a critical review of
the literature. Neth J Med, 63(10), 382-392 (2005)
44. Halter JM, Steinberg JM, Gatto LA, DiRocco JD, Pavone LA, Schiller
HJ, Albert S, Lee HM, Carney D, Nieman GF. Effect of positive end-
expiratory pressure and tidal volume on lung injury induced by alveolar
instability. Crit Care, 11(1), R20 (2007)
![Page 67: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/67.jpg)
REFERENCES
59
45. Hammerschmidt S, Kuhn H, Gessner C, Seyfarth HJ, Wirtz H. Stretch-
induced alveolar type II cell apoptosis: role of endogenous bradykinin
and PI3K-Akt signaling. Am J Respir Cell Mol Biol, 37(6), 699-705
(2007)
46. Hammerschmidt S, Kuhn H, Grasenack T, Gessner C, Wirtz H.
Apoptosis and necrosis induced by cyclic mechanical stretching in
alveolar type II cells. Am J Respir Cell Mol Biol, 30(3), 396-402 (2004)
47. Han SI, Kim YS, Kim TH. Role of apoptotic and necrotic cell death
under physiologic conditions. BMB Rep, 41(1), 1-10 (2008)
48. Hardie DG, Hawley SA, Scott JW. AMP-activated protein kinase--
development of the energy sensor concept. J Physiol, 574(Pt 1), 7-15
(2006)
49. Hashimoto S, Kobayashi A, Kooguchi K, Kitamura Y, Onodera H,
Nakajima H. Upregulation of two death pathways of perforin/granzyme
and FasL/Fas in septic acute respiratory distress syndrome. Am J Respir
Crit Care Med, 161(1), 237-243 (2000)
50. Herold G. Adult Respiratory Distress Syndrome. In: Herold G (Hrsg.).
Innere Medizin. Köln. 316-317 (2009)
51. Herold G. Herzinsuffizienz. In: Herold G (Hrsg.). Innere Medizin. Köln.
190-198 (2009)
52. Herzog EL, Brody AR, Colby TV, Mason R, Williams MC. Knowns and
unknowns of the alveolus. Proc Am Thorac Soc, 5(7), 778-782 (2008)
53. Imanaka H, Shimaoka M, Matsuura N, Nishimura M, Ohta N, Kiyono H.
Ventilator-induced lung injury is associated with neutrophil infiltration,
macrophage activation, and TGF-beta 1 mRNA upregulation in rat lungs.
Anesth Analg, 92(2), 428-436 (2001)
54. International consensus conferences in intensive care medicine:
Ventilator-associated Lung Injury in ARDS. Am J Respir Crit Care
Med, 160(6), 2118-2124 (1999)
55. Kaplan JM, Hake PW, Denenberg A, Nowell M, Piraino G, Zingarelli B.
Phosphorylation of extracellular signal-regulated kinase (ERK)-1/2 Is
associated with the downregulation of peroxisome proliferator-activated
receptor (PPAR)-γ during polymicrobial sepsis. Mol Med, 16(11-12),
491-497 (2010)
![Page 68: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/68.jpg)
REFERENCES
60
56. Kitamura Y, Hashimoto S, Mizuta N, Kobayashi A, Kooguchi K,
Fujiwara I, Nakajima H. Fas/FasL-dependent apoptosis of alveolar cells
after lipopolysaccharide-induced lung injury in mice. Am J Respir Crit
Care Med, 163(3 Pt 1), 762-769 (2001)
57. Kloot TE, Blanch L, Melynne Youngblood A, Weinert C, Adams AB,
Marini JJ, Shapiro RS, Nahum A. Recruitment maneuvers in three
experimental models of acute lung injury. Effect on lung volume and
gas exchange. Am J Respir Crit Care Med, 161(5), 1485-1494 (2000)
58. Krebs J, Pelosi P, Tsagogiorgas C, Zoeller L, Rocco PR, Yard B, Luecke
T. Open lung approach associated with high-frequency oscillatory or
low tidal volume mechanical ventilation improves respiratory
function and minimizes lung injury in healthy and injured rats. Crit
Care, 14(5), R183 (2010)
59. Kwong J, Hong L, Liao R, Deng Q, Han J, Sun P. p38alpha and
p38gamma mediate oncogenic ras-induced senescence through
differential mechanisms. J Biol Chem, 284(17), 11237-11246 (2009)
60. Lachmann B, Robertson B, Vogel J. In vivo lung lavage as an
experimental model of the respiratory distress syndrome. Acta
Anaesthesiol Scand, 24(3), 231-236 (1980)
61. Lee YH, Suzuki YJ, Griffin AJ, Day RM. Hepatocyte growth factor
regulates cyclooxygenase-2 expression via beta-catenin, Akt, and
p42/p44 MAPK in human bronchial epithelial cells. Am J Physiol Lung
Cell Mol Physiol, 294(4), 778-786 (2008)
62. Lewandowski K, Lewandowski M. Epidemiology of ARDS. Minerva
Anestesiol, 72(6), 473-477 (2006)
63. Li LF, Liao SK, Lee CH, Huang CC, Quinn DA. Involvement of Akt and
endothelial nitric oxide synthase in ventilation-induced neutrophil
infiltration: a prospective, controlled animal experiment. Crit Care,
11(4), R89 (2007)
64. Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M, Alnemri ES,
Wang X. Cytochrome c and dATP-dependent formation of Apaf-
1/caspase-9 complex initiates an apoptotic protease cascade. Cell, 91(4),
479-489 (1997)
![Page 69: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/69.jpg)
REFERENCES
61
65. Liang J, Slingerland JM. Multiple roles of the PI3K/PKB (Akt) pathway
in cell cycle progression. Cell Cycle, 2(4), 339-345 (2003)
66. Liebermann DA, Hoffman B. Gadd45 in stress signaling. J Mol Signal, 3,
15 (2008)
67. Liebler JM, Qu Z, Buckner B, Powers MR, Rosenbaum JT.
Fibroproliferation and mast cells in the acute respiratory distress
syndrome. Thorax, 53(10), 823-829 (1998)
68. Lin WC, Lin CF, Chen CL, Chen CW, Lin YS. Prediction of outcome in
patients with acute respiratory distress syndrome by bronchoalveolar
lavage inflammatory mediators. Exp Biol Med (Maywood), 235(1), 57-65
(2010)
69. Liu F, Schaphorst KL, Verin AD, Jacobs K, Birukova A, Day RM,
Bogatcheva N, Bottaro DP, Garcia JG. Hepatocyte growth factor
enhances endothelial cell barrier function and cortical cytoskeletal
rearrangement: potential role of glycogen synthase kinase-3beta. FASEB
J, 16(9), 950-962 (2002)
70. Liu M, Tanswell AK, Post M. Mechanical force-induced signal
transduction in lung cells. Am J Physiol, 277(4 Pt 1), 667-683 (1999)
71. Lu Q, Harrington EO, Rounds S. Apoptosis and lung injury. Keio J Med,
54(4), 184-189 (2005)
72. Lu S, Ren C, Liu Y, Epner DE. PI3K-Akt signaling is involved in the
regulation of p21(WAF/CIP) expression and androgen-independent
growth in prostate cancer cells. Int J Oncol, 28(1), 245-251 (2006)
73. Luecke T, Meinhardt JP, Herrmann P, Weiss A, Quintel M, Pelosi P.
Oleic acid vs saline solution lung lavage-induced acute lung injury:
effects on lung morphology, pressure-volume relationships, and
response to positive end-expiratory pressure. Chest, 130(2), 392-401
(2006)
74. Luecke T, Roth H, Herrmann P, Joachim A, Weisser G, Pelosi P, Quintel
M. PEEP decreases atelectasis and extravascular lung water but not lung
tissue volume in surfactant-washout lung injury. Intensive Care Med,
29(11), 2026-2033 (2003)
![Page 70: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/70.jpg)
REFERENCES
62
75. Luhr OR, Antonsen K, Karlsson M, Aardal S, Thorsteinsson A, Frostell
CG, Bonde J. Incidence and mortality after acute respiratory failure
and acute respiratory distress syndrome in Sweden, Denmark, and
Iceland. The ARF Study Group. Am J Respir Crit Care Med, 159(6),
1849-1861 (1999)
76. Luo HR, Hattori H, Hossain MA, Hester L, Huang Y, Lee-Kwon W,
Donowitz M, Nagata E, Snyder SH. Akt as a mediator of cell death. Proc
Natl Acad Sci U S A, 100(20), 11712-11717 (2003)
77. Martin TR, Hagimoto N, Nakamura M, Matute-Bello G. Apoptosis and
epithelial injury in the lungs. Proc Am Thorac Soc, 2(3), 214-220 (2005)
78. Martin TR. Interactions between mechanical and biological processes in
acute lung injury. Proc Am Thorac Soc, 5(3), 291-296 (2008)
79. Meade MO, Cook DJ, Guyatt GH, Slutsky AS, Arabi YM, Cooper DJ,
Davies AR, Hand LE, Zhou Q, Thabane L, Austin P, Lapinsky S, Baxter
A, Russell J, Skrobik Y, Ronco JJ, Stewart TE; Lung Open Ventilation
Study Investigators. Ventilation strategy using low tidal volumes,
recruitment maneuvers, and high positive end-expiratory pressure for
acute lung injury and acute respiratory distress syndrome: a randomized
controlled trial. JAMA, 299(6), 637-645 (2008)
80. Meyer NJ, Huang Y, Singleton PA, Sammani S, Moitra J, Evenoski CL,
Husain AN, Mitra S, Moreno-Vinasco L, Jacobson JR, Lussier YA,
Garcia JG. GADD45a is a novel candidate gene in inflammatory lung
injury via influences on Akt signaling. FASEB J, 23(5), 1325-1337
(2009)
81. Meyrick B. Pathology of the adult respiratory distress syndrome. Crit
Care Clin, 2(3), 405-428 (1986)
82. Mitsuuchi Y, Johnson SW, Selvakumaran M, Williams SJ, Hamilton TC,
Testa JR. The phosphatidylinositol 3-kinase/AKT signal transduction
pathway plays a critical role in the expression of p21WAF1/CIP1/SDI1
induced by cisplatin and paclitaxel. Cancer Res, 60(19), 5390-5394
(2000)
![Page 71: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/71.jpg)
REFERENCES
63
83. Miyahara T, Hamanaka K, Weber DS, Drake DA, Anghelescu M, Parker
JC. Phosphoinositide 3-kinase, Src, and Akt modulate acute ventilation-
induced vascular permeability increases in mouse lungs. Am J Physiol
Lung Cell Mol Physiol, 293(1), 11-21 (2007)
84. Motoshima H, Goldstein BJ, Igata M, Araki E. AMPK and cell
proliferation - AMPK as a therapeutic target for atherosclerosis and
cancer. J Physiol, 574(Pt1), 63-71 (2006)
85. Nakamura T, Mizuno S. The discovery of hepatocyte growth factor
(HGF) and its significance for cell biology, life sciences and clinical
medicine. Proc Jpn Acad Ser B Phys Biol Sci, 86(6), 588-610 (2010)
86. Neumann P, Berglund JE, Fernández Mondéjar E, Magnusson A,
Hedenstierna G. Dynamics of lung collapse and recruitment during
prolonged breathing in porcine lung injury. J Appl Physiol, 85(4), 1533-
1543 (1998)
87. Ning QM, Wang XR. Activations of mitogen-activated protein kinase
and nuclear factor-kappaB by mechanical stretch result in ventilation-
induced lung injury. Med Hypotheses, 68(2), 356-360 (2007)
88. O'Reilly MA, Staversky RJ, Watkins RH, Maniscalco WM, Keng PC.
p53-independent induction of GADD45 and GADD153 in mouse lungs
exposed to hyperoxia. Am J Physiol Lung Cell Mol Physiol, 278(3), 552-
559 (2000)
89. Oudin S, Pugin J. Role of MAP kinase activation in interleukin-8
production by human BEAS-2B bronchial epithelial cells submitted to
cyclic stretch. Am J Respir Cell Mol Biol, 27(1), 107-114 (2002)
90. Papadakos PJ, Lachmann B. The open lung concept of alveolar
recruitment can improve outcome in respiratory failure and ARDS. Mt
Sinai J Med, 69(1-2), 73-77 (2002)
91. Pavone LA, Albert S, Carney D, Gatto LA, Halter JM, Nieman GF.
Injurious mechanical ventilation in the normal lung causes a progressive
pathologic change in dynamic alveolar mechanics. Crit Care, 11(3), R64
(2007)
![Page 72: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/72.jpg)
REFERENCES
64
92. Perl M, Chung CS, Perl U, Lomas-Neira J, de Paepe M, Cioffi WG,
Ayala A. Fas-induced pulmonary apoptosis and inflammation during
indirect acute lung injury. Am J Respir Crit Care Med, 176(6), 591-601
(2007)
93. Pietsch EC, Sykes SM, McMahon SB, Murphy ME. The p53 family and
programmed cell death. Oncogene, 27(50), 6507-6521 (2008)
94. Portnoy J, Curran-Everett D, Mason RJ. Keratinocyte growth factor
stimulates alveolar type II cell proliferation through the extracellular
signal-regulated kinase and phosphatidylinositol 3-OH kinase pathways.
Am J Respir Cell Mol Biol, 30(6), 901-907 (2004)
95. Qiao R, Yan W, Clavijo C, Mehrian-Shai R, Zhong Q, Kim KJ, Ann D,
Crandall ED, Borok Z. Effects of KGF on alveolar epithelial cell
transdifferentiation are mediated by JNK signaling. Am J Respir Cell Mol
Biol, 38(2), 239-246 (2008)
96. Ricard JD, Dreyfuss D, Saumon G. Ventilator-induced lung injury. Eur
Respir J Suppl, 42, 2-9 (2003)
97. Rosenthal C, Caronia C, Quinn C, Lugo N, Sagy M. A comparison
among animal models of acute lung injury. Crit Care Med, 26(5), 912-
916 (1998)
98. Rubenfeld GD, Herridge MS. Epidemiology and outcomes of acute lung
injury. Chest, 131(2), 554-562 (2007)
99. Schiebler TH, Schmidt W. Atmungsorgane. In: Schiebler TH, Schmidt W
(Hrsg.). Anatomie. Springer, Heidelberg. 489-506 (2003)
100. Schönherr E, Levkau B, Schaefer L, Kresse H, Walsh K. Decorin-
mediated signal transduction in endothelial cells. Involvement of
Akt/protein kinase B in up-regulation of p21(WAF1/CIP1) but not
p27(KIP1). J Biol Chem, 276(44), 40687-40692 (2001)
101. Sharon H, Amar D, Levdansky E, Mircus G, Shadkchan Y, Shamir R,
Osherov N. PrtT-regulated proteins secreted by Aspergillus fumigatus
activate MAPK signaling in exposed A549 lung cells leading to necrotic
cell death. PLoS One, 6(3), e17509 (2011)
102. Slutsky AS. Lung injury caused by mechanical ventilation. Chest, 116(1),
9-15 (1999)
![Page 73: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/73.jpg)
REFERENCES
65
103. Striebel HW. Beatmungstherapie. In: Striebel HW. Anästhesie –
Intensivmedizin – Notfallmedizin. Schattauer, Stuttgart. 330-362 (2006)
104. Takeuchi M, Goddon S, Dolhnikoff M, Shimaoka M, Hess D, Amato
MB, Kacmarek RM. Set positive end-expiratory pressure during
protective ventilation affects lung injury. Anesthesiology, 97(3), 682-692
(2002)
105. The Acute Respiratory Distress Syndrome Network. Ventilation with
lower tidal volumes as compared with traditional tidal volumes for
acute lung injury and the acute respiratory distress syndrome. N Engl J
Med, 342(18), 1301-1308 (2000)
106. Thews G, Thews O. Lungenatmung. In: Schmidt RF, Lang F (Hrsg.).
Physiologie des Menschen mit Pathophysiologie. Springer, Heidelberg.
755-785 (2007)
107. Thornton TM, Pedraza-Alva G, Deng B, Wood CD, Aronshtam A,
Clements JL, Sabio G, Davis RJ, Matthews DE, Doble B, Rincon M.
Phosphorylation by p38 MAPK as an alternative pathway for GSK3beta
inactivation. Science, 320(5876), 667-670 (2008)
108. Toker A. Protein kinases as mediators of phosphoinositide 3-kinase
signaling. Mol Pharmacol, 57(4), 652-658 (2000)
109. Tomashefski JF Jr. Pulmonary pathology of acute respiratory distress
syndrome. Clin Chest Med, 21(3), 435-466 (2000)
110. Tremblay L, Valenza F, Ribeiro SP, Li J, Slutsky AS. Injurious
ventilatory strategies increase cytokines and c-fos m-RNA expression in
an isolated rat lung model. J Clin Invest, 99(5), 944-952 (1997)
111. Tront JS, Huang Y, Fornace AJ Jr, Hoffman B, Liebermann DA.
Gadd45a functions as a promoter or suppressor of breast cancer
dependent on the oncogenic stress. Cancer Res, 70(23), 9671-9681
(2010)
112. Tschumperlin DJ, Dai G, Maly IV, Kikuchi T, Laiho LH, McVittie AK,
Haley KJ, Lilly CM, So PT, Lauffenburger DA, Kamm RD, Drazen JM.
Mechanotransduction through growth-factor shedding into the
extracellular space. Nature, 429(6987), 83-86 (2004)
![Page 74: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/74.jpg)
REFERENCES
66
113. Tsubaki M, Yamazoe Y, Yanae M, Satou T, Itoh T, Kaneko J, Kidera Y,
Moriyama K, Nishida S. Blockade of the Ras/MEK/ERK and
Ras/PI3K/Akt pathways by statins reduces the expression of bFGF, HGF,
and TGF-β as angiogenic factors in mouse osteosarcoma. Cytokine,
54(1), 100-107 (2011)
114. Uhlig S. Ventilation-induced lung injury and mechanotransduction:
stretching it too far? Am J Physiol Lung Cell Mol Physiol, 282(5), 892-
896 (2002)
115. Uhlig U, Haitsma JJ, Goldmann T, Poelma DL, Lachmann B, Uhlig S.
Ventilation-induced activation of the mitogen-activated protein kinase
pathway. Eur Respir J, 20(4), 946-956 (2002)
116. Undevia NS, Dorscheid DR, Marroquin BA, Gugliotta WL, Tse R, White
SR. Smad and p38-MAPK signaling mediates apoptotic effects of
transforming growth factor-beta1 in human airway epithelial cells. Am J
Physiol Lung Cell Mol Physiol, 287(3), 515-524 (2004)
117. Van Aelst L, D'Souza-Schorey C. Rho GTPases and signaling networks.
Genes Dev, 11(18), 2295-2322 (1997)
118. Vlahakis NE, Hubmayr RD. Cellular stress failure in ventilator-injured
lungs. Am J Respir Crit Care Med, 171(12), 1328-1342 (2005)
119. Vlahakis NE, Hubmayr RD. Response of alveolar cells to mechanical
stress. Curr Opin Crit Care, 9(1), 2-8 (2003)
120. Wang S, Zhang Z, Lin X, Xu DS, Feng Y, Ding K. A polysaccharide,
MDG-1, induces S1P1 and bFGF expression and augments survival and
angiogenesis in the ischemic heart. Glycobiology, 20(4), 473-484 (2010)
121. Wharton K, Derynck R. TGFbeta family signaling: novel insights in
development and disease. Development, 136(22), 3691-3697 (2009)
122. Whitehead T, Slutsky AS. The pulmonary physician in critical care • 7:
ventilator induced lung injury. Thorax, 57(7), 635-642 (2002)
123. Wirtz HR, Dobbs LG. The effects of mechanical forces on lung
functions. Respir Physiol, 119(1), 1-17 (2000)
124. Yohn NL, Bingaman CN, DuMont AL, Yoo LI. Phosphatidylinositol 3'-
kinase, mTOR, and glycogen synthase kinase-3β mediated regulation of
p21 in human urothelial carcinoma cells. BMC Urol, 11-19 (2011)
![Page 75: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/75.jpg)
REFERENCES
67
125. Yum HK, Arcaroli J, Kupfner J, Shenkar R, Penninger JM, Sasaki T,
Yang KY, Park JS, Abraham E. Involvement of phosphoinositide 3-
kinases in neutrophil activation and the development of acute lung injury.
J Immunol, 167(11), 6601-6608 (2001)
126. Zambon M, Vincent JL. Mortality rates for patients with acute lung
injury/ARDS have decreased over time. Chest, 133(5), 1120-1127 (2008)
127. Zhang B, Cao H, Rao GN. Fibroblast growth factor-2 is a downstream
mediator of phosphatidylinositol 3-kinase-Akt signaling in 14,15-
epoxyeicosatrienoic acid-induced angiogenesis. J Biol Chem, 281(2),
905-914 (2006)
![Page 76: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/76.jpg)
68
9. ERKLÄRUNG ZUR DISSERTATION
„Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig und ohne unzulässige
Hilfe oder Benutzung anderer als der angegebenen Hilfsmittel angefertigt habe. Alle
Textstellen, die wörtlich oder sinngemäß aus veröffentlichten oder nichtveröffentlichten
Schriften entnommen sind, und alle Angaben, die auf mündlichen Auskünften beruhen,
sind als solche kenntlich gemacht. Bei den von mir durchgeführten und in der
Dissertation erwähnten Untersuchungen habe ich die Grundsätze guter
wissenschaftlicher Praxis, wie sie in der „Satzung der Justus-Liebig-Universität Gießen
zur Sicherung guter wissenschaftlicher Praxis“ niedergelegt sind, eingehalten sowie
ethische, datenschutzrechtliche und tierschutzrechtliche Grundsätze befolgt. Ich
versichere, dass Dritte von mir weder unmittelbar noch mittelbar geldwerte Leistungen
für Arbeiten erhalten haben, die im Zusammenhang mit dem Inhalt der vorgelegten
Dissertation stehen, oder habe diese nachstehend spezifiziert. Die vorgelegte Arbeit
wurde weder im Inland noch im Ausland in gleicher oder ähnlicher Form einer anderen
Prüfungsbehörde zum Zweck einer Promotion oder eines anderen Prüfungsverfahrens
vorgelegt. Alles aus anderen Quellen und von anderen Personen übernommene
Material, das in der Arbeit verwendet wurde oder auf das direkt Bezug genommen wird,
wurde als solches kenntlich gemacht. Insbesondere wurden alle Personen genannt, die
direkt und indirekt an der Entstehung der vorliegenden Arbeit beteiligt waren. Mit der
Überprüfung meiner Arbeit durch eine Plagiatserkennungssoftware bzw. ein
internetbasiertes Softwareprogramm erkläre ich mich einverstanden.“
Gießen, 14.05.2013 Sven Fuest
![Page 77: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/77.jpg)
69
10. DANKSAGUNG
An dieser Stelle möchte ich allen danken, die zu der vorliegenden Arbeit beigetragen
haben.
Insbesondere gilt der Dank Herrn Dr. Rory Morty für die Möglichkeit der Promotion,
der Überlassung des Themas sowie die engagierte Unterstützung während der
Durchführung der Arbeit.
Darüberhinaus möchte ich allen Mitgliedern der AGs Eickelberg und Morty –
insbesondere Simone Becker - für die gute Einarbeitung und die jederzeit gewährte
Hilfe und Unterstützung bei den Experimenten danken. Zudem danke ich den
Mitarbeitern der Erasmus-Universität Rotterdam, insbesondere Herrn MD Irwin Reiss,
für die Durchführung der Versuche am Tier sowie für die Präparation und Überlassung
der Rattenlungen.
Familie und Freunden sei für die langjährige Unterstützung in Studium und während der
Anfertigung der Dissertation gedankt.
![Page 78: Protective signalling mechanisms in the lung induced by ...geb.uni-giessen.de/geb/volltexte/2014/10785/pdf/... · respiratory distress syndrome and ventilator-induced lung injury](https://reader034.vdocuments.us/reader034/viewer/2022051811/601f8cc5d34d8f01bd4b4bde/html5/thumbnails/78.jpg)
Sven Fuest
Protective signalling mechanisms
in the lung induced by
open-lung ventilation strategies
Sven F
uest
•P
rote
ctive s
ignalli
ng m
echanis
ms in the lung induced b
y o
pen-lung v
entila
tion s
trate
gie
s
Dissertation
9 7 8 3 8 6 5 4 1 6 1 0 0
ISBN 3-86541-610-1ISBN: 978-3-86541-610-0
www.lehmanns.de
This thesis evaluates molecular mechanisms involved in acute
respiratory distress syndrome and ventilator-induced lung injury.
Open-lung ventilation strategies are known to be lung protective.
Different molecular biological and immunohistochemical research
methods provided discoveries in the lung protective mechanisms
induced by open-lung ventilation strategies. The thesis illustrates
these scientific findings imbedded in detailed description of the
used research methods and basic as well as up-to-date know-
ledge of acute respiratory distress syndrome, ventilator-induced
lung injury, and cell death mechanisms. Coloured figures facilitate
the understanding of the findings.
1
0
5
25
75
95
100
0
5
25
75
95
100
0
5
25
75
95
100
0
5
25
75
95
100