promoter mapping and nucleotide sequence of the bchc bacteriochlorophyll biosynthesis gene from...

Gene, 83 (1989) 251-261 Elsevier

251

GENE 03212

Promoter mapping and nucleotide sequence of the b&C hacteriochlorophyll biosynthesis gene from Rhodobacter capsulatus

(Recombinant DNA; chlorophyll synthesis; photosynthetic bacteria; S 1 nuclease protection ; primer extension)

Cheryl L. Wellington” and J. Thomas Beatty”vb

Departments of L1 Microbiology and b Medical Genetics, University of Brihkh Columbia, Vancouver, BC, V6T I W5 (Canada)

Received by T.D. M&night: 10 May 1989 Revised: 23 June 1989 Accepted: 29 June 1989

SUMMARY

Because there are not yet direct assays for most of the proteins required for differentiation of Rhodobacter

cupsukztus cytoplasmic membrane into photosynthetically competent intracytoplasmic membrane, a molecular inquiry into the mechanism and regulation of this process is difficult. We have, therefore, chosen to isolate R. cupsulutus photosynthesis genes by creating in-frame fusions to Iuc’Z vectors, and selecting for those that direct appropriately regulated levels of fi-galactosidase in R. cupsuZutus. One fucZ fusion isolate was used to identify an open reading frame (ORF) of unknown function and flanking sequences that promoted initiation of transcription. The chromosomal copy of this ORF was mutated by insertion of a kanamycin-resistant cartridge into the cloned fragment and substitution for the chromosomal copy by homologous recombination. The phenotype of the resultant mutant cells showed that the ORF encodes 2-desacetyl-2-hydroxyethyl bacteriochlorophyllide a dehydrogenase, an enzyme that catalyzes the penultimate step in bacteriochlorophyll a biosynthesis. The nucleotide sequence of this bchC gene and its 5’ regulatory region were determined. The deduced amino acid sequence shows that the bchC gene encodes a 33-kDa protein that is less hydrophobic than integral membrane proteins of R. cupsulutus, although there are hydrophobic segments that could in principle interact with a lipid membrane. Results of S 1 nuclease protection and primer extension experiments show that a 5’ mRNA end is positioned within the cloned segment, and that this 5’ end maps to sequences with significant sequence similarity to the previously characterized puf operon promoter region.

Correspondence to: Dr. J.T. Beatty, Department of Microbiology, University of British Columbia, Vancouver, BC (V6T lW5 Canada) Tel. (604)228-6896; Fax (604)228-6041.

Abbreviations: aa, amino acid(s); up/~, gene encoding aminogly- coside 3’ phosphotransferase; fiGal, p-galactosidase; bchC, gene encoding 2-desacetyl-2-hydroxyethyl bacteriochlorophyllide a dehydrogenase; Bchl, bacteriochlorophyll; bp, base pair(s); BSA, bovine serum albumin; c’dGTP, 7-deaza-2’-deoxyguanosine-5’-triphosphate; &ALA, &mhrolevulinic acid; ICM,

intracytoplasmic membrane; kb, kilobase or 1000 bp; Km, kanamycin; LH, light-harvesting antenna; Nm, neomycin; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; ONPG, o-nitro- phenyl-D-galactopyranoside; ORF, open reading frame; RC, reaction center; R, resistant/resistance; s, sensitive/sensitivity; Tc, tetracycline; u, units; wt, wild type; XGal, 5-bromo-4-chloro- 3-indolyl-b-D-galactopyranoside; [ 1, denotes plasmid-carrier state; ::, novel joint; ‘, (prime), denotes a truncated gene at the indicated 5’ or 3’ side.

0378-I 119/89/$03.50 0 1989 Elsevier Science Publishers B.V. (Biomedical Division)

252

INTRODUCTION

The purple, nonsulfur phototrophic bacteria, as

exemplified by R. capdatus, are capable of growth by several different metabolic mechanisms, two of which are aerobic respiration and anaerobic photosynthesis (Madigan and Gest, 1979). The species R. caps~la~~ becomes photos~~etic~ly competent only when the external oxygen concen~ation drops below a threshold level, and responds to this stimulus by inducing the synthesis of an extensive ICM system that contains the components necessary and specific for photos~thetic growth. These components include three pi~ent-protein complexes: two LH complexes (B800-850 and B870) that are the primary sites of photon capture, and the RC complex, which is the site of charge separation. The structural polypeptides of the RC and LH complexes are encoded by the puft pm, and puh operons (for reviews, see Drews, 1985; Kiley and Kaplan, 1988).

The tetrapyrrole pigment Bchl a in R. capsulatus is necessary for charge separation in the photosynthetic RC and transfer of light energy between the three pi~ent-protein complexes in the photos~thetic apparatus, and is required for stabilization of the peptide components of these complexes. When mutants blocked in Bchl biosynthesis are grown under conditions that would normally induce the formation of the photosynthetic apparatus, the structural polypeptides of the RC and LH complexes are present at very low steady-state amounts, apparently because they are synthesized and then rapidly de- graded (Dierstein, 1983; Klug et al., 1985; 1986). It has also been demonstrated that mutants blocked in Bchl biosynthesis are impaired in carotenoid accumulation under low oxygen conditions (Biel and Marrs, 1985). These observations suggest that the production of Bchl is required for formation of many of the components of the photosynthetic apparatus. Therefore, an improved underst~ding of the mechanism and regulation of Bchl synthesis would enhance our knowledge of the biogenesis of the photosynthetic apparatus.

Detailed knowledge of the structure and regulation of the genes that encode enzymes of the Bchl biosynthetic pathway (the bclz genes) and of the Bch enzymes themselves remains fragmentary. No bch gene has been sequenced, nor has purification of any enzyme encoded by a bch gene progressed to the

point to where information about its structure can be obtained, although there are reports of the partial pu~~cation of some enzymes of the m~esium branch oftetrapyrrole biosynthesis (Hinchigeri et al., 1981; 1984; Kwan et al., 1986; Richards et al., 1987). However, because assays have not yet been developed for most of the enzymes of the magnesium branch, their p~cation and study has been diffi-

cult. Because of the difficulties noted above in direct

detection of bch and other photosynthesis gene products, we have chosen to identify potential photosynthesis genes by fusing their N termini and regulatory regions to the Eseh~~chia cdi St-truncated lac’ Z gene, and screening for host cells that contain a recombinant plasmid that displays the desired regulation of BGal activity. To search for photosynthesis genes in R. capsulutus, the screen simply consists of plating R. capsulates cells containing a fusion bank on a medium containing XGaI, and choosing for study those colonies whose anaerobic centers have turned blue. After isolation of putative genes by this method, their function in photosynthesis can be evaluated by in vitro mutation and replacement of the chromosomal allele with the mutated copy.

By use of this approach, we have cloned and sequenced an ORF we subsequently identified as the bchC gene, which encodes an enzyme that catalyzes the penultimate step in the biosynthesis of Bchl a

(Biel and Marts, 1983). The deduced aa sequence of the BchC protein is the first primary structure of a chlorophyll biosynthetic enzyme to be published. We demonstrate that the bchCgene is cotranscribed with the b&A gene to form the bchC’ operon. Finally, we show that a 5’ mRNA end maps within the cloned regulatory region, and that this 5’ end is positioned very near a sequence that is similar to the puf operon promoter sequences (Bauer et al, 1988; Adams et al., 1989).

MATERIALS AND METHODS

(a) Bacterial strains and plasmids

The wt R. capsulatus strain, BlO, has been described (Marrs, 1974; Weaver et al., 1975). The bchC mutant CWlOO was derived from BlO by

253

insertion of an aph cartridge into the ORF sequenced in this work, followed by the phenotypic analysis of the resultant mutant strains, The @I gene from transposon Tn903 which confers KmR and NmR was excised from plasmid pUC4K (Vieira and Messing, 1982) as a 1.6-kb BamHI fragment and inserted into the unique BamHI site of the 5.5kb EcoRI-H fragment of pRPS404 (Taylor et al., 1983) that was present in a pUC13 vector. The chime& EcoRI-H: :KmR DNA segment of the resulting plasmid was excised as a 7. I-kb EcoRI fragment and inserted into the EcoRI site of. the mobilizable ‘suicide’ vector, pSUP202 (Simon et al., 1983). This pSUP202 : :EcoRI-H : : KmR plasmid was trans- formed into the donor Eschetichia co& strain, S 17- 1 (Simon et al., 1983), and mobilized by conjugation into R. cupsulazus BlO. Recipient cells were selected by streaking onto plates of RCV medium (Beatty and Gest, 1981) cont~~g 10 pg Km,+& and were screened for reciprocal exchange of the chromosomal copy of the ORF with the plasmid-borne copy containing the aph gene by sensitivity to 0.5 pg Tc/ml. One such isolate was segregated and designated R. capsul~~s CWOO.

Plasmid pTB931 was constructed by insertion of the 6.7-kb BamHI-BglII fragment of pMC931 (Casadaban et al., 1980), containing the Iac’Z gene into the BamHI site of the mobilizable vector pRK291 (Ditta et al., 1985). Plasmid pTB93 1 retains the unique BamHI site that contains the eighth codon of the 5’-truncated Iac’Z gene, and can be used to create translational fusions to the fad2 gene if the reading frame of the cloned N terminus reads 5’-NNNGATCNN-3’ across the BamHI site.

Plasmid pCW 1 was created by random ligation of the products of a Suu3AI partial digest of the EcoRI-H fragment into the Barn HI site of pTB93 1. Recombinant plasmids were conjugated into R. capsulatus BlO as described (Schmidhauser and Helinski, 1985) and screened for oxygen-replate @Gal activity by choosing blue colonies for study. One such colony yielded a plasmid, named pCW1, that had an insert of approx. 450 bp of R. capsulatus DNA, and was the subject of this study.

Plasmid pCW2 was created by insertion of the 13-kb BarnHI-C fragment from pRPS404 (Taylor et al., 1983) into the BarnHI site of pJAJ9 (Johnson

et al., 1986). The BamHI-C fragment contains the C terminus of the bchC gene, the entire b&A gene, and

the entire puf operon. Plasmid pJAJ9 uses the oxygen-regulated puf operon promoter to drive transcription of foreign genes that are inserted into either a unique BamHI site or a unique PstI site (Johnson et al., 1986).

(b) Growth conditions and m~surement of j?Gal activity

Cells of R. capsulutus BlO harboring pTB931 or pCW1 were grown at 34°C under high aeration (300 rev./min in a flask ftied to 8% of its nominal capacity) and low aeration (150 rev./mm in a flask filled to 80% capacity) conditions in RCV medium as described (Belasco et al., 1985) to a density of 3.5 x lo7 cfu/ml, collected by centrifugation, and disrupted by sonication. Extracts were cleared of cell debris by centrifugation and the specilic activity of /IGal activity in cell extracts was measured as previously described (Miller, 1972). Values were nor- malized to the protein content of the extracts (Lowry et al., 1951), with BSA as standard.

(c) Nucleotide sequence analysis

Fragments of DNA to be sequenced were subcloned into Ml3mp18 and M13mp19 vectors ~~isch-Pe~on et al., 1985). Dideoxy chain-termination reactions were carried out essentially as described (Smith, 1980), except that c’-dGTP was used instead of dGTP (Mizusawa et al., 1986; Barr et al., 1986).

(d) Isolation of Rhodobacter capsuiatus cellular RNA

Cultures of R. cupsulatus B 10 were grown at 34°C with high aeration (200 ml of culture in a 2-liter flask shaken at 300 rev./min) to a density of 3 x lo8 cfu/ml, then shifted to low aeration by transfer of the culture to a 250~ml flask that was shaken at 150 rev&in for 30 to 40 mm to stimulate synthesis of mRNA from bch genes, at which time total cellular RNA was isolated as described (von Gabain et al., 1983).

254

RESULTS AND DISCUSSION

(a) Isolation of an oxyg~r~~at~ promoter aud N terminus of a gene from the phot~~~~ cluster of Rhodobacter capsulatus

Althougb in R. cupsuZatu.s many photosynthesis genes have been described and mapped to a SO-kb region referred to as the photos~~esis gene cluster (Taylor et al., 1983), we think that many genes involved in photosynthetic differentiation, whether they map within or out of this cluster, have yet to be discovered. We have, therefore, chosen to isolate

potential R. ~~~~~1~~ photosynthesis genes by creating a bank of in-frame fusions to a 5’-truncated E. coli lad gene present on gene fusion vectors, and selecting for study those R. cupsulatus cells containing recombinant plasmids that synthesize in- creased levels of /?Gal in response to lowered oxygen concentration. Although in this study we elected to restrict the source of R. capsulatus DNA to the EcoRI-H fragment of pRPS404, a region known to contain at least three photosynthesis genes (Taylor et al., 1983), this approach can of course be extended to search the entire chromosome for genes of interest.

The products of a Suu3AI partial digest of the 5.5-kb EcoRI-H (Fig. 1) fragment of pRPS404 were inserted into the unique BumHI site of the broad- host-range vector pTB93 1 to generate a fusion bank. The resultant collection of fusion plasmids was conjugated into R. cupsulutus BlO and TcR recipients were screened for blue colonies, indicating that the cloned insert in pTB931 resulted in synthesis of

E HE E

! crtF bchC ; L&L4 I

I I s 5

- A

Fig. 1. Genetic map ofthe 5.5-kb EcoRI-H fragment of pRPS404 (Taylor et al., 1983) showing the approximate locations of the genes that map partially (CM and &ILp) or completely (BehC) to the EcoRI-H fragment. Also shown are the EcoRI (E), Hind111 (H),BamHI (B), and Suu3AI (S) restriction sites ofinterest. The R. capsulatus insert in pCW1 was found to hybridize to the area between the two Suu3AI sites, and the direction of transcription initiated within this cloned insert is designated by the arrow. The dotted genetic boundaries indicate uncertainty of the exact position of the start of the b&4 gene, and that portions of DNA from the crtF and b&A genes extend beyond the EcoRI sites

BGal. One recombinant plasrnid, pCW1, was isolated and found to contain an R. capsularus insert of approx. 450 bp. Extracts of R. ~aps~la~u~ celts harboring pCW 1 grown with low aeration showed a level of /IGal specific activity approximately five times that observed in extracts of cells grown with high aeration (122 nmol ONPG/min/mg in low 0, extracts, compared with 22.2 nmol ONPG~~lrng in high 0, extracts). Repetition of these experiments with the R. capsulatus insert subcloned into plasmid pXCA601 (Adams et al., 1989), which contains a

transcription terminator that prevents transcription readthrough into sequences fused to fac’2, con- fmed that we had isolated an oxygen-replated promoter, as well as the 5’ coding region of an R. cupsu-

latus gene. The known photosynthesis genes that map par-

tially or completely to the 5.5-kb EcoRI-H fragment of pRPS404 are crrF, a gene that encodes a carotenoid biosynthesis enzyme (Scolrdk et al., 1980), bchC, and b&A (Fig. 1). Because the DNA insert in pCW1 originated from the EcoRI-H fragment, it was likely to contain the promoter, regulatory region, and 5’ terminus of one of these three genes or possibly some uniden~~ gene. The area on the EcoRI-H fragment from which the insert was obtained was localized by Southern blotting to a 400-bp region near the left-most genetic boundary of the bchC gene (Fig. 1). Alignment of restriction maps generated from this insert and from the EcoRI-H fragment indicated that the direction of transcription ori- ginating from the cloned promoter would be from left to right in Fig. 1.

(b) Identi~ca~~ of the gene fused to 1uc’Z

A 1.6-kb KmR cartridge was excised from plasmid pUC4K (Vieira and Messing, 1982) and inserted into the BamHI site of the 5.5-kb EcoRI-H fragment, in order to create a mutation within the ORF derived from the DNA sequence (see section c, below). This BarnHI site contains the codon for aa 120 in the ORE; (see below) and also maps genetically within the b&C gene (Biel and Marrs, 1983). If the gene fused to 1acZ was bchC, recombination of this mutation into the chromosome of an otherwise wt cell should have resulted in the accumulation of an intermediate of Bchl biosynthesis and the loss of the ability to grow photosynthetically. Two previous

255

studies had proposed that the b&C and b&A genes

form an operon, but there was uncertainty about the direction of transcription. Biel and Marrs (1983) had suggested that transcription progressed from the bchcgene toward the b&A gene, whereas Zsebo and Hearst (1984) had concluded that transcription oc- curred in the opposite direction, from the bchA gene toward the b&C gene. Therefore, even if the ORF was the bchC gene, there was uncertainty of what the phenotype of the ORF- strain would be.

The 7. I-kb EcoRI-H : : KmR fragment was inserted into the ‘suicide’ vector, pSUP202 (Simon et al.,

1 2 3 4 5 6 7 6 9 10

A

1 2 3 4 5 6 7 6 9 10

Fig. 2. Southern blot of strains showing replacement of the wt copy of the bchC gene with a copy containing the KmR cartridge. Each lane of the 1% agarose gels used for Southern blots contained either 5 pg of chromosomal DNA from the appro-

priate R. capsu1utu.s strains digested to completion withEcoRI, or 2 ng ofpurifted EcoRI-H or EcoRI-H : : KmR fragments that were mixed with 5 pg of sheared salmon sperm DNA (Sigma). Following agarose-gel electrophoresis, the DNA fragments were transferred to a sheet of nitrocellulose paper as described (Maniatis et al., 1982). Radioactive DNA probes for Southem- blot hybridizations were prepared by the method of primer extension using random hexadeoxyribonucleotides as described (Feinberg and Vogelstein, 1983). Blots were prehybridiied, hybridized and washed as previously described (Beatty and Cohen, 1983). Lanes 1 and 9 contain purified 5.5-kb EcoRI-H fragment (the faint band is due to a small amount of the 2.7-kb pUC13 plasmid vector that co-purified with the EcoRI-H fragment), lanes 2 and 10 contain purified 7.1-kb EcoRI-H::KmR fragment, lanes 3 and 8 contain R. capsulutus B 10 chromosomal DNA, and lanes 4 to 7 contain chromosomal DNA from four diierent KmR, Tcs isolates. The DNA in lane 4 was obtained from strain CWlOO. (Panel A)Purified EcoRI-H DNA was radioactively labeled and used as a probe. (Panel B) Purified KmR cartridge DNA was radioactively labeled and used a probe.

1983), and mobilized by conjugation into R. cupsulu-

tus BlO, and KmR TcS recipients were screened for

replacement of the wt gene with the mutated copy by Southem.blotting. Four candidates were tested using radioactively labeled EcoRI-H DNA as a probe, and the resultant autoradiogram revealed only one band in the digested DNA from each mutant strain that comigrated with a purified EcoRI-H : : KmR DNA fragment, indicating that,the mutated copy of this gene had replaced the wt copy (Fig. 2, panel A). To test if the KmR cartridge DNA had integrated into only one site in the chromosome, we used radioactively labeled KmR cartridge DNA as a probe that was hybridized to DNA immobilized on a second, identical filter. The resultant autoradiogram showed hybridization of the probe to only one fragment in the digested DNAs from each of the four strains, and that this fragment comigrated with the authentic EcoRI-H : : KmR segment (Fig. 2, panel B). The combined results of these two blots show that in each of the four strains, the KmR cartridge seems to have integrated into only one site in the R. capsulatus chromosome, which is within the EcoRI-H fragment.

The mutants obtained were incapable of photosynthetic growth and were found to accumulate a pigment with a red-most absorption peak of 660 nm (Fig. 3, scan a), and a red-most fluorescence emission peak of 660 nm (not shown). These absorbance and emission spectra identify the accumulated pigment as 2-devinyl, 2-hydroxyethyl chlorophyllide Q, and indicate that the mutants are blocked in b&4 activity (Yen and Marrs, 1976). Because the bchA

gene product acts before that of the bchC gene product in the Bchl biosynthetic pathway (Pudek and Richards, 1975; Biel and Marrs, 1983), the phenotype observed in the mutant strains is consistent with

0.000 -0

500 800 700 BOOlWll

Fig. 3. Absorption spectrum of pigments accumulated in cultures of R. capsulatus CWlOO (a) and R. capsulatus

CWlOO[pCW2] (b). Cellular pigments were extracted in acetone/methanol (7: 2) in the dark, and characterized by scanning the absorbance from 800 to 500 mn.

256

the hypothesis that the b&C and b&A genes from an operon with the direction of transcription proceeding from bchC toward b&A (from left to right in Fig. 1). Because the mutation created in the ORF appeared to have a polar effect upon b&A, thereby masking the consequences of the mutation of the ORF sequence, conclusive identification of the ORF depended on overcoming the polar effect of this mutation, so that the phenotype of the ORF- strains could be observed directly and compared with the phenotype of known bchC mutant strains. Our laboratory has constructed an RK2-derived expression vector, pJAJ9, which employs the oxygen-regulated pufpro- moter from R. cupsulatus to obtain transcription of appropriately positioned genes (Johnson et al., 1986). The BarnHI-C fragment of pRPS404, which contains a portion of the bchC gene and the entire bchA gene (Taylor et al., 1983), was inserted into pJAJ9. One of the resultant plasmids, pCW2, contained the BarnHI-C fragment inserted into pJAJ9 in an orientation that resulted in transcription of the bchcgene segment and the bchA gene from left to right as shown in Fig. 1. Plasmid pCW2 was conjugated into one of the KmR ORF- strains of R. capsulacus (designated CWlOO) to test the phenotype of cells bearing the mutation in the ORF when complemented in tram with the b&4 gene. Recipient cells remained photosynthetically incompetent, but now accumulated an intermediate of Bchl a biosynthesis with a red-most absorbency peak centered at 710 nm (Fig. 3, scan b) when grown with low aeration. The presence of this product, 2-desacetyl- 2-hydroxyethyl bacteriochlorophyllide a, which also accumulates in cells with known mutations in the bchC gene (Richards and Lascelles, 1969; Taylor et al., 1983; Biel and Marrs, 1983), confirmed the identity of the ORF as the bchC gene. These results argue that the bchC and b&A genes do form an operon, and that the direction of transcription proposed by Biel and Marrs (1983) is correct. It is noteworthy that Young et al. (1989) have indepen- dently demonstrated that the bchC and b&f genes form an operon by experiments similar to our own.

(c) Nucleotide sequence analysis of the b&C gene

Both strands of the R. capsulatus insert on pCW1 were entirely sequenced. Because the N terminus

fused to the Iac’Z gene in pCW1 resulted in expression of BGal, the reading frame of the bchC gene could be deduced by alignment of the IacZ reading frame across the junction with the R. capsulatus insert. The reading frame of the cloned N terminus is proposed to begin at an ATG near a potential ribosome-binding site (GGAG; Fig. 4). Segments of

the EcoRI-H fragment that overlapped this sequenced region were subcloned into phage M 13 vectors and used to extend the sequence to two tandem stop codons 942 nt downstream from the proposed ATG start codon. The nt sequence of the cloned promoter/regulatory region, and the deduced aa sequence of the bchC gene product are presented in Fig. 4. We caution that confirmation of the deduced aa sequence of this ORF requires receipt of the true aa sequence of the BchC protein itself. However, because analysis of codon usage in the proposed reading frame corresponds well with a codon usage table constructed from analyses of other sequenced R. capsulatus genes, whereas there is very poor correspondence in each of the other two reading frames (not shown), it seems likely that this deduced aa sequence is correct.

Several interesting observations regarding this nt sequence can be made. The predicted ikf, of the BchC protein is 33006. Examination of the hydro- phobicity plot generated by the method of Kyte and Doolittle (1982) shows that the BchC protein is predicted to be slightly hydrophobic overall and that it has two more pronounced hydrophobic regions, from Gly-124 to Gly-170 and from Val-219 to Met-250, that may interact with the cell membrane. Because ligands to Bchls in both RC and LH polypeptides are His residues (Michel et al., 1986; Bylina et al., 1988), we examined the proposed aa sequence for His residues. Although the proposed BchC sequence contains four His residues (Fig. 4), it is currently impossible to unambiguously predict a chlorin tetrapyrrole-binding site from a primary sequence and it will be necessary to experimentally test the BchC protein and mutant derivatives to correlate which, if any, of these residues have functional significance for enzymatic activity. The determination of this gene sequence will greatly facilitate future purification of the encoded enzyme for functional studies of enzymatic activity, as well as of the overall physiology of chlorophyll synthesis and photosynthetic complex biogenesis.

257

10 20 30 40 50 60 70 80

~GAGGCCGRACGCGGCTGACAC~CTGCGTTCGGACCCGGCTTTGACCCGGGGGTCAGAAAGTCGCACATCCGTCTG Sau3Rl

90 100 110 120 130 140 150 160

TCGCAAAACTGTCT~TCATTGACAGTCGGGCGTATGATACACACAGGCGTGATCAGCCCGACTCTCCG

170 180 190 200 210 220 230 240 _Q_ metqvvimsgpkaistgia

GCCCGATCATACCGGGAGCAG~TGGAAACGCAAGTCGC~GTCGTCAT~TGTCCGGGCCC~GGCCATCTCGACGGGCATCGC

250 260 270 280 290 300 310 320 gltdpgpgdlvvdiaysgistgteklf

CGGTCTGACCGACCCCGGGCCGGGGGACCTCGTCGTGGRTATTGT

330 340 350 360 370 380 390 400 wlgtmppfpgmgyplvpgyesfgevv

TCTGGCTCGGCACCATGCCACCCTTCCCGGGCATGGGATA CGGAGAGGTCGTT rfindI11

410 420 430 440 450 460 470 480

q a apdtgfrpgdhvfipgancftgglr CAAGCCGCCCCCGACACCGGCTTCCGACC~GC~CGTCTTCATTCCCGGC~CC~CTGCTTCACCGGCGGGTTGCG

Sau3AI 490 500 510 520 530 540 550 560

g lfggas krlvtaasrvcrldpaigpe CGGGCTGTTCGGCGGGGCGTCGAAGCGCGCCTTGTCACGGCCGCCTCGCGCGTTTGTCGGCT~CGCCATCGGCCCCG

BdmEI 570 580 590 600 610 620 630 640

g a 11a1aata rhalagfdna lpdliv AGGGCGCGCTTCTGGCCCTTGCCGCCACCGCGCGGCATGCATGCGCTGGCCGGGTTTGAC~T~TCTGCCG~ATCTGATCGTC

650 660 670 680 690 700 710 720

ghgtlgr lla rltlaaggkppmvwetn GGCCACGGCACCCTCGGGCGCCTTCTGGCCCGTCTGACCCTGGCTGCCGGTGGCAAGCCGCCGATGGTCTGGG~CCAA

730 740 750 760 770 780 790 800 parrtgavgyevldpeadprrdykaiy

TCCTGCCCGTCGCACGGGCGCGGTCGGCTACGAGGTTCTGGACCCCG~GCCGATCCCCGGCGCGACTAC~GGCCATCT

810 820 830 840 850 860 870 880 dasgapglidqlvgr lgkggelvlcg

ATGACGCCTCGGGCGCGCCCGGTCTGATCGACCAGCTCGTCGGGCGTCTGGGC~GGGCGGGG~CTGGTGCTGTGCGGC

890 900 910 920 930 940 950 960

f Y tv pv s fafvpafmkemrlriaaewq TTCTATACGGTGCCGGTCAGCTTCGCCTTTGTTCCCGCCTCA

970 980 990 1000 1010 1020 1030 1040 padlsatraliesgalsldglithrrp

GCCGGCCGACCTTTCGGCCACGCGCGCGCTGATCG~GCGGGGCGCTCTCGCTGGATGGTCTCATCACGCATCGTCGCC

1050 1060 1070 1080 1090 1100 1110 1120 aaeaaeayqta fedpdc lk mi ldw k d

CCGCGGCGGAGGCGGCCGAGGCCTATCAGACCGCTTTCG~GACCCTGACTGCCTG~GATGATCCTTGACTGG~GAT

1130 1140 1150 1160 1170 1180 1190 a k * * GC~TAATGACTGACGCACCCAACCTGAAGGGATTTGACGCCCC

19

46

72

99

126

152

179

206

232

259

286

312

314

Fig. 4. Nt sequence of the b&C gene and its promoterjreguiatory region. Deduced aa sequence (in single-letter code) beginning with au ATG start codon and ribosome-binding site (SD), and ending with two tandem stop codons (*), is shown above the nt sequence. Restriction sites of interest are underlined, and include the two Sau3A-I sites used for insertion of the N terminus of the bchC gene in pCW1, the Hind111 site used as a reference point in the Sl-nuclease protection experiment, and the BumHI site used for interposon mutagenesis. The nt sequence is numbered above the sequence, (with the last digits aligned with the corresponding nt), and the aa sequence is numbered on the right margin.

(d) Mapping of the 5’ end of the bc;hCA ~an~rip~

We performed a 5’ end-mapping by Sl-nuclease protection experiment with mRNA isolated from

R. eap~u~u~ BlO. The probe used to protect the bchCA mRNA from Sl-nuclease digestion was desigued to contain 15 bp of heterologous vector DNA as a tail (see legend to Fig. 5), so it allowed

258

distinction between protection from S I-nuclease digestion of the 400-bp R. capsulatus-derived seg-

ment of the probe by an mRNA that would initiate upstream from the 5’-most nt of the R. capsulatus segment, and self-protection of the entire chimeric probe by DNA-DNA reanealing.

Two bands that each resulted from protection of the probe by mRNA were observed in an autoradio-

2522

525

169

69

1234 . . .

5

Fig. 5. Sl nuclease protection mapping of 5’ ends of bchC

mRNA. A double-stranded bipartite DNA probe was prepared by radioactively labelling pCW1 at the 5’ ends generated by digestion with Hind111 (containing the codon for aa 67 in the bchC gene), followed by digestion of the labeled plasmid with FrpI (located in the vector 15 bp from the junction to the R. capsulatus insert), and purification ofthe 415-bp HindHI-FspI fragment. This probe (50 ng) was hybridized with 10 pg ofE. coli

tRNA (lane 2), or 10 pg of RNA extracted from R. capsulatus B 10 (lanes 3,4, and 5) at 51 “C for 3 h. Hybrids were trimmed with 500 u (lanes 2 and 3), 1000 u (lane 4), or 1500 u (lane 5) of Sl nuclease as described (Zucconi and Beatty, f988). The sizes, in nt, ofHaeII1 fragments of single-stranded M13mpll DNA (lane 1) are given on the left margin.

gram of a polyacrylamide gel of S l-protected hybrids (Fig. 5). The predominant band approx. 250 nt in length indicated a 5’ end around nt position 150 in the sequenced region, and a minor band approx. 400 nt in length indicated readthrough into the region delimited by the probe from an upstream promoter. Several possible interpretations of this result can be entertained. One possibility is that both bands observed in Fig. 5 result from protection of the probe by primary transcripts of overlapping operons, the major band representing mRNA that initiates within the cloned bchC4 operon promoter segment, and the minor band representing mRNA that initiates upstream from this promoter, most likely from the crtEF operon promoter, as the crtEF operon is the next known operon located upstream from the cloned region on the R. capsulatus chromosome (Young et al., 1989). Alternatively, the bchCA operon may be served by two promoters, one located within and one located upstream from the area delimited by the probe. Another possibility is that the minor band represents the primary bcK4 transcript, and that this primary transcript is processed to yield a shorter, more stable mRNA molecule that gave rise to the major band observed in Fig. 5.

The exact position of the bchC-proximal 5’ end observed in Fig. 5 was determined by the method of primer extension. Fig. 6 shows an autoradiogram of a polyacrylamide gel on which the primer extension products were run alongside a dideoxy sequencing ladder that was generated by using the same oligo primer and a DNA fragment that contained the cloned promoter region as template. The band in lane 1 of Fig. 6 corresponds to the major band detected in the 5’ Sl-nuclease protection experiment, and its position shows that this 5’ end maps to nt 137 of the sequenced region, 48 bp upstream from the proposed ATG start codon the bchC4 operon (Fig. 4).

The nt sequences flanking this major 5’ end are shown aligned with the proposed puf operon promoter sequence in Fig. 7. Of particular significance are three conserved boxed sequences: a conserved 5’-CGGGC-3’ is located 23 nt upstream from the puf + 1 site and 19 nt upstream from the major bchCA 5’ end, a 5’-TTCA-3’ is located 6 nt (puf promoter) or 7 nt (putative bchCA promoter) downstream from the 5’-CGGGC-3’ sequence, and a third conserved 5’-TACA-3’ sequence is found

259

Fig. 6. High-resolution primer extension mapping of the predominant b&C mBNA 5’ end. A 24mer oligo primer complementary to nt 199-223 (Fig. 4) was radioactively labeled at the 5’ end and hybridized to 1Opg of total RNA isolated from R. cupsuZatus BlO. After extension with Moloney murine leukemia virus reverse transcriptase (Adams et al., 1989) the extension products (lane 1) were compared with a sequencing ladder generated by using the same primer and a 4.1-kb FspI double-stranded DNA fragment from pCW1 containing the R. capsulatus insert as template in chain-terminating reactions (lanes G, A, T, and C) performed as described (Hattori and Sakaki, 1986). To allow direct comparison with the sequences in Figs. 4 and 8, this autoradiograrn is intentionally inverted and lanes labeled with the complementary base.

6 nt (puf promoter) or 5 nt (putative b&CA promoter) downstream from the 5’-TTCA-3’ sequence. Because the major bchCA 5’ end maps to a region that has significant sequence similarity to puf operon promoter sequences (Bauer et al., 1988;

bdhCI

b 96 137

Fig. 7. Alignment of puf operon promoter sequences with proposed promoter sequences from the bchC operon. Numbers of the first and last nt of these sequences correspond to the sequence positions of the puf operon promoter region (Adams et al., 1989), and of the bcbCA operon promoter region (Fig. 4). Identical sequences are boxed, and the nt from which transcription is proposed to be initiated are marked by arrows.

Adams et al., 1989), and because this region contains sufficient information to express /IGal in an oxygen-dependent manner, we tentatively conclude that this 5’ end arises from transcription initiation at a bchCA operon promoter.

If the major 5’ end results from transcription initiation, then the minor band in Fig. 5 must represent mRNA that initiates from upstream of the bchC gene. Young et al. (1989) have recently provided genetic evidence that transcripts from the crtEF operon (the next operon upstream from the bchCA operon) extend into the b&CA promoter region, and the minor band in Fig. 5 could represent such a transcript. We will present a more detailed analysis of these overlapping mRNAs elsewhere (C.L.W. and J.T.B., manuscript in preparation).

Transcription of the R. capsulatus bchCA, puf, and put operons seems to be modulated in a similar fashion in response to the concentration of oxygen sensed by cells (Adams et al., 1989; Bauer et al., 1988; Biel and Marrs, 1983; Forrest et al., 1989), so it is possible that there is a transcriptional control factor that recognizes an nt sequence motif common to all of these promoters. Additional studies of these promoters and the factors that interact with them should improve our understanding of the mechanisms by which R. capsulatus cells respond to a change in oxygen tension.

ACKNOWLEDGEMENTS

We thank D.A. Young and B.L. Marrs for valuable discussions and for sharing their unpub- lished data, and W.R. Richards and B.R. Green for helpful comments. C.L.W. was supported by a Canadian N.S.E.R.C. postgraduate fellowship. This

260

research was supported by the Canadian

N.S.E.R.C. operating grant A-2796 to J.T.B.

REFERENCES

Adams, C.W., Forrest, M.E., Cohen, S.N. and Beatty, J.T.: Transcriptional control of the R. capsulatus puf operon: a structural and hmctional analysis. J. Bacterial. 171 (1989) 473-482.

Barr, P.J., Thayer, R.M., Laybourn, P., Najarian, R.C., Seela, F. and Tolan, D.R.: 7-Deaza-2’-deoxyguanosine-5’-triphosphate: enhanced resolution in Ml3 dideoxy sequencing. BioTechniques 4 (1986) 428-432.

Bauer, C.E., Young, D.A. and Marrs, B.L.: Analysis of the Rhodobacter capsulatus puf operon: location of the oxygen- regulated promoter region and the identification of an additional puf-encoded gene. J. Biol. Chem. 263 (1988) 4820-4827.

Beatty, J.T. and Cohen, S.N.: Hybridization of cloned Rho- dopseudomonas capsulatus photosynthesis genes with DNA from other photosynthetic bacteria. J. Bacterial. 154 (1983) 1440-1445.

Beatty, J.T. and Gest, H.: Generation of succinyl-coenzyme A in photosynthetic bacteria. Arch. Microbial. 129 (1981) 335-340.

Belasco, J.G., Beatty, J.T., Adams, C.W., von Gabain, A. and Cohen, S.N.: Differential expression of photosynthesis genes in R. capsulatus results from segmental differences in stability within the polycistronic rxcA transcript. Cell 40 (1985) 171-181.

Biel, A.J. and Marrs, B.L.: Transcriptional regulation of several genes for bacteriochlorophyll biosynthesis in Rhodopseudo-

monas capsulata in response to oxygen. J. Bacterial. 156 (1983) 686-694.

Biel, A.J. and Marrs, B.L.: Oxygen does not directly regulate biosynthesis in Rhodopseudomonas capsulata. J. Bacterial. 162 (1985) 1320-1321.

Bylina, E.J., Robles, S.J. and Youvan, D.C.: Directed mutations affecting the putative bacteriochlorophyll-binding sites in the light-harvesting I antenna of Rhodobacter capsulatus. Israel J. Chem. 28 (1988) 73-78.

Casadaban, M.J., Chou, J. and Cohen, S.N.: In vitro gene fusions that join an enzymatically active beta-galactosidase segment to amino-terminal fragments of exogenous proteins: Eschert-

chia coli plasmid vectors for the detection and cloning of translational initiation signals. J. Bacterial. 143 (1980) 971-980.

Dierstein, R.: Biosynthesis of pigment-protein complex polypeptides in bacteriochlorophyll-less mutant cells of Rhodopseudo-

monas capsulata YS. FEBS Lett. 160 (1983) 281-286. Ditta, G., Schmidhauser, T., Yakobson, E., Lu, P., Liang, X.-W.,

Finlay, D.R., Guiney, D. and Helinski, D.R.: Plasmids related to the broad host range vector pRK290 useful for gene cloning and for monitoring gene expression. Plasmid 13 (1985) 149-153.

Drews, G.: Structure and functional organization of light- harvesting complexes and photochemical reaction centers in membranes of phototrophic bacteria. Microbial. Rev. 49 (1985) 59-70.

Feinberg, A.P. and Vogelstein, B.: A technique for radiolabeling DNA restriction fragments to high specific activity. Anal. Biochem. 132 (1983) 6-13.

Forrest, M.E., Zucconi, A.P. and Beatty, J.T.: The pufQ gene product ofRhodobacter capsulatus is essential for formation of B800-850 light-harvesting complexes. Curr. Microbial. 19 (1989) 123-127.

Hattori, M. and Sakaki, Y.: Dideoxy sequencing using denatured plasmid templates. Anal. Biochem. 152 (1986) 232-238.

Hinchigeri, S.B., Chan, J.C.S. and Richards, W.R.: Purification of S-adenosyl+methionine: magnesium protoporphyrin methyltransferase by afftnity chromatography. Photo- synthetica 15 (1981) 351-359.

Hinchigeri, S.B., Nelson, D.W. and Richards, W.R.: The puriti- cation and reaction mechanism of S-adenosyl+metbionine:

magnesium protoporphyrin methyltransferase from Rhodop-

seudomonas sphaeroides. Photosynthetica 18 (1984) 168-178. Johnson, J.A., Wong, W.K.R. and Beatty, J.T.: Expression of

cellulase genes in Rhodobacter capsulatus by use of plasmid expression vectors. J. Bacterial. 167 (1986) 604-610.

Kiley, P.J. and Kaplan, S.: Molecular genetics of photosynthetic membrane biosynthesis in Rhodobacter sphaeroides. Mi- crobiol. Rev. 52 (1988) 50-69.

Klug, G., Kaufmann, N. and Drews, G.: Gene expression of pigment-binding proteins of the bacterial photosynthetic apparatus: transcription and assembly in the membrane of Rhodopseudomonas capsulata. Proc. Natl. Acad. Sci. USA 82 (1985) 6485-6489.

Klug, G., Liebetanz, R. and Drews, G.: The influence of bacteriochlorophyll biosynthesis on formation of pigment- binding proteins and assembly of pigment protein complexes in Rhodopseudomonas capsulata. Arch. Microbial. 146 (1986) 284-291.

Kwan, L.Y.rM., Darling, D.L. and Richards, W.R.: Affinity chro- matographic purification of two enzymes of the latter stages of chlorophyll synthesis. In Akoyunoglou, G. and Senger, H. (Eds.), Regulation of Chloroplast Differentiation. Plant Biology Series, Vol. 2. Liss, New York, 1986, pp. 57-62.

Kyte, J. and Doolittle, R.F.: A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157 (1982) 105-132.

Lowry, O.H., Rosebrough, N.J., Farr, A.L. and Randall, R.J.: Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193 (1951) 265-275.

Madigan, M.T. and Gest, H.: Growth of the photosynthetic bacterium Rhodopseudomonas capsulata chemoautotrophi- tally in darkness with H, as the energy source. J. Bacterial. 137 (1979) 524-530.

Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982.

Marrs, B.: Genetic recombination in Rhodopseudomonas cap-

sulata. Proc. Natl. Acad. Sci. USA 71 (1974) 971-973.

261

Michel, H., Epp, 0. and Deisenhofer, J.: Pigment-protein inter- actions in the photosynthetic reaction centre from Rhodopseu-

domonas viridis. EMBO J. 5 (1986) 2445-2451. Miller, J.H.: Experiments in Molecular Genetics. Cold Spring

Harbor Laboratory, Cold Spring Harbor, NY, 1972, pp. 352-355.

Mizusawa, S., Nishimura, S. and Seela, F.: Improvement of the dideoxy chain-termination method of DNA sequencing by use of deoxy-7-deazaguanosine triphosphate in place of dGTP. Nucleic Acids Res. 14 (1986) 1319-1324.

Pudek, M.R. and Richards, W.R.: A possible alternate pathway of bacteriochlorophyll biosynthesis in a mutant ofRhodopseu-

domonas sphaeroides. Biochemistry 14 (1975) 3132-3137.

Richards, W.R., Fung, M., Wessler, A.N. and Hinchigeri, S.B.: The purification and properties of three latter-stage enzymes of chlorophyll synthesis. In Biggens, J. (Ed.), Progress in Photosynthesis Research, Vol. IV. Nijhoff, Dordrecht, 1987,

pp. 475-482. Richards, W.R. and Lascelles, J.: The biosynthesis of bacterio-

chlorophyll. The characterization of latter-stage inter- mediates from mutants of Rhodopseudomonas sphaeroides.

Biochemistry 8 (1969) 3473-3482. Scolnik, P.A., Walker, M.A. and Mans, B.L.: Biosynthesis of

carotenoids derived from neurosporene in Rhodopseudo-

monas cupsula~a. J. Biol. Chem. 255 (1980) 2427-2432. Schmidhauser, T.J. and Helinski, D.R.: Regions of broad-host-

range plasmid RK2 involved in replication and stable maintenance in nine species of Gram-negative bacteria. J. Bacterial. 164 (1985) 446-455.

Simon, R., Priefer, U. and Ptlhler, A.: A broad host range mobili-

zation system for in vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria. Bio/Technology 1 (1983) 37-45.

Smith, A.H.J.: DNA sequence analysis by primed synthesis. Methods Enzymol. 166 (1980) 560-580.

Taylor, D.P., Cohen, S.N., Clark, W.G. and Marrs, B.L.: Align- ment of genetic and restriction maps of the photosynthesis region of the Rhodopseudomonas capsulata chromosome by a conjugation-mediated marker rescue technique. J. Bacterial. 154 (1983) 580-590.

Vieira, J. and Messing, J.: The pUC plasmids, an Ml3mp7- derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19 (1982) 259-268.

von Gabain, A., Belasco, J.G., Schottel, J.L., Chang, A.C.Y. and Cohen, S.N.: Decay of mRNA in Escherichia cok investi- gation of the fate of specific segments of transcripts. Proc. Natl. Acad. Sci. USA 80 (1983) 653-657.

Weaver, P.F., Wall, J.D. and Gest, H.: Characterization of Rhodopseudomonas capsulata. Arch. Microbial. 105 (1975) 207-216.

Yanisch-Perron, C., Vieira, J. and Messing, J.: Improved Ml3 phage cloning vectors and host strains: nucleotide sequences of the Ml3 and pUCl9 vectors. Gene 33 (1985) 103-119.

Yen, H.-C. and Marrs, B.: Map of genes for carotenoid and bacteriochlorophyll biosynthesis in Rhodopseudomonas capsu-

lata. J. Bacterial. 126 (1976) 619-629.

Young, D.A., Bauer, C.E., Williams, J.C. and Mans, B.L.: Genetic evidence for superoperonal organization of genes for photosynthetic pigments and pigment-binding proteins in Rhodobacter capsulatus. Mol. Gen. Genet. 218 (1989) l-12.

Zsebo, K.M. and Hearst, J.E.: Genetic-physical mapping of a photosynthetic gene cluster from R. capsulata. Cell 37 (1984) 937-947.

Zucconi, A.P. and Beatty, J.T.: Posttranscriptional regulation by light of the steady-state levels of mature B800-850 light- harvesting complexes in Rhodobacter capsulatus. J. Bacterial. 170 (1988) 877-882.

promoter mapping and nucleotide sequence of the bchc bacteriochlorophyll biosynthesis gene from...

Documents