Indian Journal of Experimenta l Biology Vol. 4 1, July 2003, pp. 773-780

Progesterone receptors on human spermatozoa

Chirag Shah. Oeepak Modi , Sushama Gadkar, Geetanjali Sachdeva & Cllander Puri *

ational Instillltc for Research in Reproductive Health , Indi an Coune il of Medical Research, Je hangi r Merwanji Stree t, Pare l, Mumbai 400 0 12, India

Progesterone, pri marily recognized as a female steroid hormone, is reported to affec t several sperm func tions espec iall y capac itat ion, motility and acrosome reaction. These effects of progesterone on the spermatozoa are mediated via the progestc rone binding s ites/proges terone receptor (PR) on the acrosomal membrane. These receptors in response to progesterone increase the intercel lul ar Ca'+ leve ls and stimul ate Ca2+ innux in the mature human spermatozoa via non­genomi c 1Il0de of actions. Characterizat ion of thi s recepto r revea ls that the sperm PR is masked protein and is exposed to the surface by some non-ionic detergents. Loca li zed on to the acrosome region of the spermatozoa, these receptors are recogni z~d by most anti bodies di rec ted towards the C- term in al region of the conve ntional PRo The estimated mo lec ular wcight o f PR on spermatozoa va ries from 27 kDa to 85 kDa . At the mo lecu lar level , sequences encod ing fo r the entire D A and hormone bindi ng domai ns of the convent iona l PR are dctected in the mRNA derived from spermatozoa. No inserti ons, de le ti ons or mutations a re detected in thi s region. T hese results a re suggesti ve of the fac t tha t at least the C terminal region of the conventional PR is conserved in the sperm. It is hypothesized that post-translational mod ifica ti ons o r pept ide splic ing of the conventional PR in spermatozoa may possibly lead to the va ri ant of the steroid hormone recepto r. Detailed charac teri zat ion of the sperm PR will be importalll in understanding the alternate non-geno mic mode of ac tion of ste roi d hormone receptors.

Keywords : Acrosome reac ti on. No n-geno mi c actions, Proges te rone receptors , Sperm , S perm PR protein , Sperm PR transeript

Mammalian spermatozoa must spend some time in the fema le geni ta l tract or under certain conditi ons in vitro before being ab le to fe rtili ze the oocyte. During this time spermatozoa undergoes cellular processes like capacitation which cu lminates with the acrosome reaction, a modi fied exocytotic event involving fu sion followed by ves iculati on of sperm head membrane I. Progesterone, present around or secreted by cumulus oophorus ce ll s, is capab le of initi ating the acrosome reaction in vitro in spermatozoa of severa l mammals, inc luding humans. Hence, it has been postulated that this steroid acting by itse lf and/or in sy nergy with the zona pe lluc ida, is a physio logica l initi ato r o f the acrosome reac tion ill vivo2

. It is be ing well documented that progesterone induces sperm hyperactivari on', s timul ates ac rosome reaction4

.6

,

increases the binding of spermatozoa to the oocyte zona pe lluc ida and increases the sperm penetration rate into hamster oocytes7

. Progeste rone has been fo und to inc rease signifi cantly the number of spermatozoa mov ing with hy peractivated motility even at very low concentrations (- 3 ng/ml ). Thi s

*Correspondcnt author: Phone: ++ 9 1 (022) 24137730 Fax : ++ 9 1 (022) 24 1394 12 Email : dirirr @vsnl.com

effec t was observed on both capac itated and capac itating cell s afte r 10 min incubatio nx.9.

Like other ste roids, progesterone acts to induce transcriptional events medi ated by an intracellular receptor be long ing to the superfamily of nuclear transactivators. Thi s is te rmed as the conventional or genomi c mode of action. However in the case of spermatozoon, progesterone acts on a lmost completely transcriptiona lly inacti ve cell , with mechanisms that are not responsive to antagonist of the c lassical progesterone receptor lO

. Tesarik and Mendoza I I have shown that progesterone induces ci+ innux and Ca2

+ dependent acrosome reaction occur following aggregation of the progesterone receptors on the sperm membrane on ligand bind ing. Cell surface medi ated actio ns of progesterone is a lso demo nstrated by incubating human spermatozoa to proges te rone showing an increase in tyros ine phosphory lati on of a phosphoprote in and a lso increase in concentration of phosphoprote in 12 .

Progesterone has also been shown to induce a Ca2+

dependent cycli c AMP increase in human spermatozoa l 3

. Since the progesterone- induced ci+ innux is a rap id process, with a max imum effect seen within a minute lO

, the mechani sm of action of

774 INDI AN J EX P BIOl, JULY 2003

progesterone in the spermatozoa appears to be different from that of the genomic mechani sm involving intrace llul ar steroid hormone receptor and the processes of transcription and translation. These rapid effects of progesterone on spermatozoa are believed to be the nongenomic actions and it has been implicated that progesterone induces its effects of Ca~+ influx and acrosome reac ti on via a surface receptorl4

. In the present review we have summarized the research carried out on the characteristics of the progesterone binding sites on the spermatozoa th at finally lead to above ac tions.

Rather than being comprehensive we have foc ussed on the recent research that has been ongoing on the characteri zation of the progesterone binding si tes espec iall y at the biochemical and transcript level. For the purpose of simplicity we refer to the sperm progesterone binding sites as proges terone receptor (PR). Table I summari zes some of the known characteristics of sperm PR and its compari son to the conventional PRo

Biochelllical properties a/sperm progesterone receptor

A demonstrati on of the presence of a surface receptor comes from the studies showing that progesterone covalentl y conjugated to serum albumin , (a mol ecul e which does not allow the steroid to cross the sperm membrane), is able to increase the intrace llul ar concentrat ions of free calcium and . d h . 15 0 . In uce t e acrosome reac ti on . ur prevIous laboratory studies have demonstrated that these PR are masked antigens and when treated with mi ld detergent like digitonin (0.1 %), binding sites are ex posed l6. Using a variety of detergents like SDS, CHAPS, NP40, Triton- X 100, digitonin, deoxycholate etc. , di gitonin were found to expose PR on mature human spermatozoa as studied by radio receptor assay (Fig. I A). Furthermore this effect of digitonin was hi ghly dose dependent and 0.1 % was found to be

Table I - Differences bClwcen classical and sperm progeslerone receptors

Class ical Sperm

localion Intracellular Mcmbrane bound

Isoforms A and B Single

Si ze 90 and 120kDa , Smallcr?

respcctivcly

Mode of act ion Genomic Non ge nomic

Binding with Efficicnl AbsCIll alltiprogcst in s

optimum (Fig. 1 B). These studi es are further substan ti ated by fl ow cytometri c analysis of di gitonin treated and untreated spermatozoa that revealed binding of progesterone to more than 90% of cell s after the treatment with digitonin and that was less than 20% pretreatment (Fig. 2). Treatment with deterge nts increases the permeability and fluidity of the pl asma membrane by di spersal of lipids and fragmentat ion of the membrane and thus exposes the binding sites. It is possible that digitonin reacts with the cho lesterol in the sperm membrane thereby ex pos ing the progesterone binding sites. In deed choles terol sulphate has been found in about 20% of the acrosomal surface area l 7

. Since during capacitation or sperm transport in the female trac t, a number of changes takes place within the pl as ma membrane which includes the rearrangement of lipids and proteins and unmasking of several anti gens, it could be possible that treatment with di gitonin mimics at least some of the changes that take place in the sperm plasma membrane during capacitation in the female genital tract. Therefore, the mechani sm by which progesterone elicits a biological response on human spermatozoa involves its interac ti on with a ce ll surface masked receptor and thereafter rapid onset of its biological effects I0

.18.

A conjugate of fluorescein isothi ocy nate (FITC)­labelled bov ine serum albumin (BSA) and progesterone has been used to loca lize PR in the sperm plasma membrane. The results of these studies show that onl y few percentage of spermatozoa ( 10-30%) binds to the hormone and the binding is marked at w ole or equatori ally at the acrosomal

. f h 1019 I 'b d reg ion 0 uman spermatozoa ' . n antI 0 y labeling studies carri ed out, it was observed that the ex press ion of PR was observed almost on 50% of spermatozoa and was loca li zed at the equatorial region of sperm head. In contrast to these observations the recent studies carried out in our laboratory, where the locali zati on pattern of the PR on digitonin treated mature human spermatozoa was studied by th ree different techniques, viz. immunocytochemistry, direct immu nofl uorescence and flow cytometry, revealed that more than 90% of spermatozoa showed the presence of PR on the acrosomal or equatorial region20 (Fi g. 3). Our data support the report, where image analysis technique was performed to determine the number of spermatozoa responding to progesterone, which indicated that more than 90% of spermatozoa showed the presence of PR21.

•

lo -

776 INDI AN J EXP BIOL, JUL Y 2003

Fig. 3 - III situ loca l izalion of progcslcronc rcccplOrs on spermalozoa using di rec l fluorescence. M Olile spermalozoa were labellcd wi lh progcslerone as descri bed in Fig. 2 and viewed undcr l1uorcsccnce microscope lIsing a lri plc band pass filler. The cx pression is exclusively nOled in the acrusomal reg ion.

Another membrane associated PR has been iso lated and parti all y purified from porcine li ver membranes26. An antibody directed aga inst thi s protein reveals, two proteins of 28 and 56 kDa, whereas under native condi ti ons, a protein co mplex of about 200 kDa is detected27

. Recentl y there is a report of a novel PR isoform (termed as S) which consists a prev iously uni denti fied 5' sequence ca lled exon S and the C­termin al of the classica l PR, lac king the DNA binding and term inal reg ions. The predi cted molecul ar mass encod ing ror thi s gene sequence is ex pected to be of 29 k Da2~ .

More recentl y, immunoprec ipitation of sperm membrane proteins using an antibody aga inst the C terminus of the conventi onal PR followed by 2D electrophoresis identified 2 protein bands of approx imately 59 and 29 kDa2Y

• Database search of the molecul ar masses and the sequence of the peptides obtained after tryptic di gesti on of the spots did not find a signi ficant match with prev ious protein sequences29. At present the reasons fo r the vari able findings are unclear, it is apparent th at the sperm PR has a molec ul ar weight of 50-60 kDa, unlike the uterine PR (PR-B of 120 kDa and PR-A of 90 kDa) . According to Sabeur et al .,22 the lower molecul ar weight sperm PR is probabl y proteo lyti cally cleaved from the larger protein that occurs during processing without pro tease inhibitors.

Irrespective of the size of sperm PR , it is of interest to note th at most of these sperm antigens of vari ous molecul ar masses are detected by monoc lonal anti bodi es agai nst the C-terminal of the convent iona l PR suggesti ng th at at least at the C-termin al of sperm PR is conserved and there is some homology of the conventi onal PRo In thi s contex t it is of interes t [0

note that a monoc lonal antibody (MA 410) aga inst the C termin al of the conventi onal PR inh ibits fo llicul ar fluid deri ved progesterone medi ated ac rosome reac ti on (Fig. 4). However it is not clear whether one or more of these proteins are in vo lved in medi atin g proges terone ac ti ons.

From these studies three hypotheses ari se concerning the progesterone membrane receptors on human spermatozoa: I. There exists a possibility of more than one type of

PR on the sperm membrane. 2. The receptor is totall y different from the genomi c

receptor in size but the progesterone bindin g reg ion is preserved.

3. The receptor is an iso form of genomic progesterone recep tor. In parti cul ar, the recent identi fica ti on of a third isoform of PR (C-isoform) showing the molec ul ar weight of 50-60 kDa containing the C­terminal and a part of DN A binding reg ion of the A and B isoforms30

.32

, raises the poss ibility of the sperm PR being similar to the C-i sofonn .

Molecular characterization of sperm progesterone receptor

Unlike the monoclonal antibody approach, li gand spec ific ity ex peri ments conducted in our laboratory demonstrated di fferences in the hormone binding domain of sperm PR and uterine PR o Unlike uterine PR, sperm PR does not bind to mifepri stone and other progesterone antagonists ill vil ro l6

. These observations were consistent with earlier reports demonstrating th e in ability of mi fe pri stone and ZK 98.299 to block the progesterone-mediated increase in calc ium influ x in spermatozoaH

.10

. These reports suggested the possibility that the sperm PR being di stinct from the conventional PRo

These differences in the molecul ar size, mode of ac tion, and the peculi ar locati on of sperm PR as compared to the conventional PR prompted us to in vestiga te. 1. Whether there exist any PR-like transcripts 111

mature human spermatozoa 2. Whether these resembl e the conventi onal PR In

terms of its genomic organi za tion, i.e., the

SHAH el al.: PROGESTERONE RECEPTORS ON HUMAN SPERMATOZOA 777

presence of an -termin al domain, DNA binding domain, and hormone binding domain .

In view of the emerg ing concept suggesting that the progesterone-PR complex in human spermatozoa apparentl y may not req uire interaction with 0 A to induce biological effects, studies on the molecular characteri za ti on of PR transcripts in spermat ozoa is of great signi ficance in understandi ng the nonclass ica l mode of action of steroids .

We believe that the sperm RNA contains transcripts of differentiating spermatogonia and can be successfull y used to study the molecul ar organizat ion of sperm PRo Our study demonstrates the presence of PR transcript in human spermatozoa by RT_PCR3J . Total R A from mature human spermatozoa was reverse transcribed using anchored oligo(dT) primers ; followed by PCR amp lificati on for regions spanning the 0 A binding domain (DBD; as forward primer) and the hormone binding domain (HBD: as reverse primer) of the conventi onal PR o A PCR product was obtained that had the expected size of endometri al PR (Fig. 5) indicating that the sperm progesterone receptors at the transcript level conta in seq uences that encode for the DNA binding region. To study if this PR transcript has any mutations or

25

%

A c 20

r

0

s 0 15

m e

r 10

e a c

5

0

n o .

deletions, we cloned the amplified transcript and sequenced it. The resulting sequence was subject to homology searches using the BLAST and FASTA formats. The results revea led that the cloned part ial transcript of sperm PR had the entire DBD and a part of HBD along with the hinge region (Fig . 6). As compared to conventional PR , no de leti ons, in sert ions or mutati ons were identifi ed in thi s tran.-cript indicating complete homology of the sperm derived PR transcript to the conve'ntional uterine PR transcript. Recently a study on tes ti cular cD library screen ing has identified a nove l exon in the DBD of the PR transcriptn . But our studi es have fail ed to detect this exon by RTPCR in the sperm or testi cul ar R A samples. Thus our study demonstrates that the DBD of the sperm PR is identi ca l to the conventional PR in the molecu lar organi zat ion. Interestingly, using a strategy similar to ours, Luconi el al. 29also found the transcripts of the DBD in the sperm cDNA population; howeve r as compared to placental PR, the size of the DBD differed in sperm PR29

. At present it is unclear if the transcript detected by thi s group contains the additi onal exon reponed by Hirata e l al. 28

, but at other regions the transcript size of sperm PR was similar to conven ti onal PR o

Follicular Fluid Follicular Fluid + MA410 (1 :10 dilut ion)

Foiilcular Flu id + MA410 (1 :20 dilution)

Fig. 4 - Effect of monoc lonal anti body (MA 41 0) against PR on follicular fluid induced acrosome reacti on ill I·ilro. M otile sperm::uozoa were treated with human foll icu lar nuid with or without the monoclonal ant ibody and the percentage of acrosome reacted spermatozoa were enumerated.

778 IN DIAN J EXP 810L. JUL Y 2003

However di fferences between the PR sequences of sperm R A and endometr ial RNA if an y at regions other than DBD can not be ruled out. But using spec i ri c pri Illers for the con vent ional PR we amp l i ried sperm R A encod ing fo r HBD to its entity and f ind no differences between the transcript sizes of sperm derived PR as compared to the endometrium PR (Fig . 6). Sequence analysis o f thi s fragment revea led complete homology to the conventional PR (Sachdeva el 01. unpublished observations) further confirming our notion that the sperm PR transcript may be idcllli ca l to the conventional PR tran script. A simil ar conc lusion has been drawn from rccent ~ tudi cs on the

PR transcri pt derived from xenopus oocytes . In thi s sys tem, along w ith the conventional PR , there ex ists a PR that has non-genom ic mode of act ion similar to that described in sperm .14 . Sequence analys is of the PR transcri pt in these oocytes revealed its complete homology to the conventional PR:14 further substan­tiating the notion that at leas t at the transcri pt level , PR \-\l ith non-genomic mode of ac ti ons may be similar to PR having the conventional mode of acti on (Fig. 7).

To summari ze, our result s indicate th at the entire transcr ipt for the genomic PR is present on human spermatozoa. however, in the absencc of the genomic recepto r in these cells suggests that no tra ns lational of

bp 2 :3

'; 3b

'J. S L.

A

I , tv] bp

: 35 3

1GB 872

(' :) 3

31 0

28 ,271

bp 1 2 3 I , J M

S 3 6

780

B

b p

1353 l07S 87 2 (,03

31 0 2.8 1,2 '/1

Fig. 5 - (AJ RT-PCR detection or PR transcrip ts. Endometrial R IA (lane I ) and sperlll R A (lane 2--1) were revcrse tra nscribed u~ing oligo (dT) primers and ampliried using PR speciric primers. Product or expccted sizc (536bp) wc re detected in lanc I (po~ iti ve control) ~ In d lanc -I. No products wcre detccted when reverse tran scriptase ( lane 2) or ol igo (ciT) primcrs ( lane 3) wc rc omittcd rrom thc mi xture. Lane M is molecu lar wc ight markc rs. (8 ) To rul e out lL:ukocyte con taminat ion in semcn samplcs spcrm cD A preparat ions were also subjected to PCR amplirication 1'0 1' C D 45 sequcnccs. 0 products were detected in lane I (sperm eDNA) ampliried \\ i th CD 45 primers, PR transcri pts werc detected in the same samplc (Lanc 2). Lane 3 is Icukocyte cDN A amplifi cd w ith CD 45 primers showing two iso­rorms or CD 45 transc ripts. bu t no bands wcre tlL:tceted in lanc 4 containing Icukocyte eDNA ampliri cd wi th PR primcrs. Lane 5 is icui-.o­cy tc cD IA aillplifi ed 1'0 1' acti n (positi ve control). Mis Illolccu lar weight l1larke r.

TTGATTCAGAAGCCAGCCAGAGCCCACAATA C AGCTTCGAGT C ATTA CCT 51 C AGAAGAT TTGTTTaATCTGTGGGGATGAAGCATCAGG C TGTCATTATGG tOt TG TC C TTAC CTG T G G GA GCTG TAAG G TC TTCTTTAAG AG G GC A ATG G AAG 151 G GC A GCAC AACTACTTATG TGCTG GAAGATGACTG C ATCGTTGATAAAAT ~1 CGC AGAAAAAACTGCCCAGCATGTCGCCTTAGAAAGTGCTGTCAGGCTG ~1 GCATGG TCCTTGGAGGTCGAAAATTTAAAAAGTTCAATAAAGTCAGAGTT ~1 G TGAG AGCACTGGATGCTGTTGCTCTCCCACAGCCATTGGGCGTTCCAAA ~ 1 TGAAAGCCAAGCCCTAAGCCAGAGATTCACTTTTTCACCAGGTCAAGACA 401 TAC AG TTGATTCCACCACTGATCAACCTG TTAAT G AGCATTGAACCAGAT 451 G TGATCTATGCAGGACATGACAACACAAAACCTGACAC CTCCAGTTCTTT ~ 1 GCTG ACA AGTCTTAATCAACTAGGCGAGAGGCAACTAATCCCGCGGCCAT ~1 GGCGGC CGGGAGCATGCGACGTCGGGCCCAATTCGCCCTATAGTGAGTCG 001 TA TTACAA TTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCC 651 T G Q C G T T A C C C A ACT T A A T C G

Fig. 6- Scqucnce or the 536 bp PR transcript idcnt i f icd by RT-PCR or sperm RNA . Thc scqucnccs or the primcrs used arc in bold face, vec tor sequcnce is underlincd. The sequence shows cO lllplete hOlllo logy to thc convcntional PR o

SHA H el al.: PROGESTERONE RECEPTORS ON HUMAN SPERM ATOZOA 779

J '!

Fig. 7 - RT-PCR detccti on of sperm PI{ transcripts cncoding for the D A and hormone bi nding domain of thc conventional PRo Product of the expectcd si7.e (766 bp) was detected in lane 1 and 2 (sperm R A) and lane 4 (Endometrial RNA). Lane 3 contains PCR ampli ficat ion of Aetin (positi ve contro l) cDNA from sper­matozoa. Lane M is molccular weight markers. Lcukocyte con­tam ination was ruled out by ampli ficat ion of CD 45 in sperm R A as in Fi g. 5.

these transcripts occurs in these ce ll s or that post translat ional modifi cation , possibl y lead ing to a protein with a different molecular weight are operative. Altern atively, the presence of these transcripts in mature human spermatozoa might not be an index of act ive sy nthesis, but simply reflects the transcripti on/translational ac tivit ies during maturation processes in the testi s. Further studi es are also needed to determ ine the nature of the isofonn- S detected in spermatozoa by Hirata ef aF8.

FUf llre direcrions

The resu lts of molecu lar charac terization of sperm PR suggests that at least at the transcri pt level the sperm PR is identi ca l to the conventi onal PRo This raises to the possibility that there may ex ists post transcri ptional/translational mod i fications andlor sp li cing of the PR peptide that may result in the protein of reduced molecular weight. It may be necessary to isolate the PR protein from the sperm membrane and determine its structure and conformati on.

It is envisaged th at these studies will help to

unravel mechanisms of progesterone binding to the sperm membranes and its alternate (non-genomic) mode of acti on. This may be of help in understanding the ro le of steroid hormones in sperm func tions and fert ili zati on.

Acknowledgement 'The data presented

(N IRRH /MS/3/2003) was In the present revIew funded by ICMR . CS is

grateful to Lady Tata Memorial Trust for JRF. The data presented is a part of M. Sc. thesi s of CS and SG.

References 1 Yanagimaehi R, M ammalian fenili za ti on, In Th e physiology

uf reprodllCliul1. ed ited by E Knobi1. J D Neill (Raven press . New York) 1994, 189.

2 Mei zel S. Pill ai M C. Diaz- Perez E & Thomas P, Initiati on of the human sperm acrosome reacti on by components of human follicular nuid and cu mulus secretion s includi ng stcroids, In Fenili: alioll ill IIWII/II/uis. edited by B:lVi ste r B D. Cummins J. Ro ldan E R S (Scrono Symposia. Norwcll M A. USA) 1990. 327.

3 Ca logero A E. Fi shel S & Green S, Erfects of y-amino­but yric acid on human spcrm motilit y and hyperacti va ti on. M ol HIIIIl Reprod. 2 ( 1996) 733 .

4 Osman R A , A ndria M L. Jones A D & Meizel S. Stcroid induced exocy tosis : The human sperm acrosomc reaction. iJ iochelll Biophys Res COIIIIIIIIII , 160 ( 1989) 82 8.

5 Foresta C, RossalO M . M ioni R & Zorzi M , Progcsterone induces capac it at ion in human spermatozoa. Alldmlogio. 2-i ( 1992) 17.

6 Bronson R A , Peres lcn i T & Golightl y M. Progesterone promotes the ac rosome reaction in capac itated human spcrmatozoa as judged by nowcylOmetry and CD-i6 stain ing. M ol /-111111 Reprod, 5 ( 1999) 507.

7 Sucldo C E. Oehni nge r' S & Subias E. Erfect of progesterone on human . perm<lt ozoa by a fraction or human fol licular fluid. Galllele Res. 14 ( 1993) 10.

8 Ulher M L. Leung A , Chan S Y W & Wang C, Direc t effect;, of progestcrone and anti progesterone on human spcrm hyperacti va ted mot ilit y and acrosome reacti on, Fenif Sierif, 58 ( 1993) 11 9 1.

9 Ca logero A E. Burrello . Barone , Palermo 1. Grasso U & D ' Agata R, Effects of progesterone on sperm funct ion: mechanism or act ion, 1-111111 Reprod. 15 ( 1) (2000) 28.

10 Blackmore P F, Neulen J, Lallanzio F & Becb S J. Ccll surface binding sites for progesterone mediated calcium uptake in human sperm, J Bioi Cirelli , 266 ( 1991 ) 18655.

11 Tesarik J, Mendoza C, Insights inlO the func ti ons of a sperm surface progesterone ev idence of ligand- induced reccptor aggregation and the proteolysis. EXfJ Cell Res, 205 ( 1993a) 1 1 1.

12 Tesari k J, Moos J & Mendoza C, Stimulati on of protei n tyrosine phosphorylation by a progesterone receptor on th.: cell surfacc of human sperm. Endocrinulogy, 133 ( 1993b) 328 .

13 Parinaud J & M ilhet P, Progcsterone induced C}+ depcndent 3'.5'-cyc lic adenosine monophosphate increase in human sperm, J Ciill Enducrinol. M ewb, 81 ( 1996) 1357.

14 Meizel S. Amino acid neurotrasmi ller receptorl chl oride channels of mammalian sperm and the acrosome reacti on, Bioi Reprod. 56 ( 1997) 569.

15 Mcizcl S & Turner K 0, Progesterone acts at the plasma mcmbrane or human sperm, M ol. Cell. Endocr illol , 11 (199 1) R1.

16 A mbhaikar M B & Puri C P, Cell surface binding sites for progesterone on human spermatozoa., M ol HIIIIl Repmd. 4 (5) ( 1998) 413.

17 Langlais J, Kan F W K , Granger L , Bleau G & Robert s K D. Identi fica ti on of sterol receptors that stimulate cholestcrol

780 INDIAN J EX P BIOL. JULY 2003

efflux from human spermat ozoa during il/ I'ilm capac itat ion, CalliI'l l' Res. 20 ( 1987) 185.

I ' Thomas P & Mei l-e l S. Phosphatidy linositol 4.5-b iphosphate hydrolysis in hUlllan stimulated with folli cular nuid or progesterone is dependent upon.Ca2+innux. Bioc/le ll/ J. 264 ( 1989) 539.

19 Tesarik J & Mendonza C. Defec ti ve fu ncti on of a nongcnomic progesterone receptor as a so le sperm anomaly in infertil e patients. Ferril. Sleril. 58 ( 1992a) 793.

:W Gadkar S. Shah C A. Sachdev;l G. Samant U & Puri C P. Progesterone receptor as an indicator of sperm function. Bioi III i< l'pmd, 67 (2002) 1327.

2 1 Plant A. McLaughl in E A & Ford W C .L. Intrace llul ar calc ium measurements in individua l human sperm demonstratcs that the majorit y can respond to progesterone. Ferril. Sle ril , 64 ( 1995) 12 13.

22 Sahcu r K. Edwards 0 P & M eize l S. I-Iuman sperm plasma mcmbrane progesterone receptor(s) and the acrosome react ion. Bioi Reprod. 54 ( 1996) 993 .

13 Luconi M, Bonnaccorsi L. Maggi M , Pecchioli p. Krausz. C. f orti G & Baldi E. Identifi cati on and characteri zation of functional nongenomic progesterone receptors on human sperm mcmbrane. J Clil/ £I/doc r il/ol Mel , 83 ( 1998) 877.

24 BenoIT S., Hurley I, Cooper G W, M andel F S, Rosenfield 0 L & Hershlag A . Head spec ifi c mannose-l igand reecptor express ion in human cho lesterol loss . /i I/III Repmd. 8 (1995) 214 1.

25 Bruckcr C. Sandow B A . Blackmore P F. Lip ford G B & Hodgen G D. M onoclonal ant ibody AG7 inhibits ferti l izati on pmt sperm zo na-binding, M ol Rl'prod Del'. 33 ( 1992) 45 1.

26 Meyer C, Schmid R. Scriba P C & Wehling M . Puri fica ti on and partial sequcncing of a high affinity progesterone

binding protein in porcine li ver microsomes. £lIm J Bioc!II! III. 239 ( 1996) 726.

27 Meyer C, Schmid R, Scriba P C, Falkeinstei n E & Wehling M. Characteri za tion of a high affinity progc, terone binding prote in by an tipeptide antibody. Sleroids. 63 ( 1998) III .

n Hirata S. Shoda T. Kato J & Hoshi K . The nove l isoform of the progesterone receptor cDNA in the human tes ti s and detection of its IllRN A in the human uterine endomet rium. Ol/m/llg.\' . 39 (2000) 39.

29 Lucolli M , Bonnuccorsi L , Bini LeI lIl., Characteri za tion of membra lle nongenomic receptors for progesterone in human spermatozoa, Slero iils. 67 (2002) 505.

30 Wei L L , Gonza lez-A ller C, Wood W 1\1 . Miller L A & Ilorw it i . K B, 5'-heterogi nit y in human proge,terone receptor tran scripts pred icts a new amino term inal truncated "C" receptor .md unique A receptor messages. M ol EI/dncril/ol . 4 ( 19l)0) Ill33.

3 1 Wei L L. Hawki ns P. Baker C. Norris B. Sheridan P L & Quinn P G, An amino termin al truncated progcs terone receptor iso fonn. PRc, enhances progest in mediated tr<:ulsc l'iptional acti vity . M ol £I/docril/ol, 10 ( 1993) 1379.

32 Wei L L & Minner R. Ev idence for the presence of third progesterone protein in human breast cancer cell line T47D. ClIl/ ce r Hes. 54 ( 1996) 340.

33 Sachdeva G, Shah C A, Kholkute S 0 & Puri C P, Detect ion of progesterone receptor transcript in human spermatoLoa. iJiol Reprod. 62 (2000) 16 10.

34 Bayaa M. Booth R A , Sheng Y & Liu X J. The class ica l progesterone receptor mediates Xenopus oocy te matu ration through a nongenomic mechanism. Proc arl Acad Sci USA. 97 (2000) 12607.