proceedings of the 4th -...

Proceedings of the 4th meeting of IHS

1

Table of Contents

TABLE OF CONTENTS ................................................................ 1

PRELIMINARY PROGRAMME ................................................. 2

ORAL PRESENTATION............................................................... 2

POSTER PRESENTATION........................................................... 8

PARTICIPANTS ........................................................................... 10

ABSTRACTS OF THE 4th MEETING OF THE IHS ............... 17

AUTHOR’S INDEX ...................................................................... 72


2

Preliminary Programme

Oral Presentation

Monday 12 July 2010

08.00- Registration

18.00-20.00 Opening reception (Ming Zhu Yuan Hotel)

Tuesday 13 July 2010

Opening Section Organizer-Wenjun Bu

08.00-08.10 President of IHS - Opening address

08.10-08.20 The leader of the Nankai University – Welcome address

08.20-08.25 The leader of TAST – Welcome address

08.25-08.35 Life and Work of I. Kerzhner etc.

08.35-08.45 Presentation Nils Møller Andersen Awards

08.45-09.00 Take a group photo

IHS reports Section organizer-Paula Mitchel

09.00-09.20

President report

Secretary report

Treasurer report


3

Webmaster report

Various Announcements

Section Organizer - Randall T. Schuh

09.20-09.40 Pavel Štys - Major problems in phylogenetic systematics of the basal

clades of Heteroptera (Enicocephalomorpha and Dipsocoromorpha).

09.40-10.00 Christiane Weirauch - Systematics and Evolution of Heteroptera

10.00-10.30 Wanzhi Cai - Insect culture in China, with special reference to

Heteroptera.

10.30-10.50 Coffee Break

Section Organizer - Ernst Heiss

10.50-11.10 Eric Guilbert & Jakob Damgaard - Molecular Phylogeny of the

Tingidae.

11.10-11.30 Cuiqing Gao - Phylogenetic analysis of Lygaeoidea (Heteroptera:

Pentatomomorpha) of China based on morphological characters.

11.30-11.50

Sunghoon Jung - Ancestral Character States and Correlated

Evolution of the Flower Bugs (Heteroptera: Anthocoridae) using

Bayesian Analysis of MultiStates and Discrete Characters.

11.50-12.10 Min Li - The molecular phylogeny of the Anthocoridae (s.str)

12.10-13.30 Lunch Break

Section Organizer - Mallik B. Malipatil

13.30-13.50 Fedor V. Konstantinov - Bryocorinae (Heteroptera: Miridae):

structural diversity of male genitalia and phylogeny.

13.50-14.10 Thomas J. Henry - Revision and Phylogeny of the New World Plant

Bug Tribe Ceratocapsini (Hemiptera; Miridae; Orthotylinae).


4

14.10-14.30

Pablo Matías Dellapé - A phylogenetic review of Neopamera

Harrington 1980 (Hemiptera: Rhyparochromidae: Myodochini), with

the description of new genera and species.

14.30-14.50 Xiaoxuan Tian - Phylogeny of Pentatomomorpha (Hemiptera:

Heteroptera) based on six Hox genes markers.


15.10-17.00 Poster Session

Wednesday 14 July 2010

Section Organizer - Thomas J. Henry

09.00-09.20 Ernst Heiss - The flat bug genus Barcinus Stal 1873 in the

Oriental-Papuan Region

09.20-09.40 Xiaoshuan Bai - Taxonomy of Aradidae from China: a brief history

09.40-10.00 Mallik B. Malipatil - Nysius Dallas of Australia and South West

Pacific (Hemiptera: Heteroptera: Orsillidae)


Section Organizer - Pingping Chen

10.20-10.40 Elena V. Kanyukova & Nickolay N. Vinokurov - Biodiversity of

the Heteroptera of Siberia and the Russian Far East

10.40-11.00

Abdul Manan Shaikh - A review of a little known genus

Carenoplistus (Hemiptera: Pentatomidae: Halyini) with description of

new species from Pakistan

11.20-13.00 Lunch Break


5

Section Organizer – José Ricardo Inacio Ribeiro

13.00-13.20

Truong Xuan Lam - Diversity of assassin bugs (Hemiptera:

Reduviidae) and roles of the common species in some nature reserves

and national parks in northern Vietnam

13.20-13.40 Xu Zhang - Revision of the pilophorine plant bug genus Pilophorus

Hahn, 1826 (Hemiptera: Heteroptera: Miridae: Phylinae)

13.40-14.00 Ram Keshari Duwal - Faunal comparison of phyline plant bugs

between Nepal and Eastern Asia (Heteroptera: Miridae: Phylinae)

14.00-14.20 Zhonghua Fan - New genus Ramivena of Pentatominae

(Heteroptera: Pentatomidae)


Section Organizer – Eric Guilbert

14.40-15.00 Randall T. Schuh - Distributional and Host Patterns In Australian

Phylinae (Miridae).

15.00-15.20 Alice Exnerová - Multimodal Antipredatory Defences In Terrestrial

Heteroptera: Efficiency Against Bird Predators.

15.20-15.40 Kazutaka Yamada - The flower bugs found in agro-ecosystems of

southern India (Heteroptera: Anthocoridae).

15.40-16.00 Richard J. Packauskas - Leptoglossus occidentalis: worldly traveler

18.00-20.00 Banquet

20.00-21.00 Visit (Haihe River)


6

Thursday 15 July 2010

Field trip/if raining, Change with the program of 16 July.

Friday 16 July 2010

Section Organizer – Waizhi Cai

09.00-09.20 Guanyang Zhang - Sticky bugs on the tree: towards a molecular phylogeny of the Harpactorini (Reduviidae: Harpactorinae).

09.20-09.40 Wei Song Hwang - Towards Resolving The Polyphyletic Reduviinae (Heteroptera:Reduviidae).

09.40-10.00 Tomáš Ditrich - Extraordinary life history in semiaquatic bugs: case

of Velia caprai.

10.00-10.20 Zhaohui Luo - On species diversity of true bugs from Xinjiang province, China


Section Organizer –Masaaki Tomokuni

10.40-11.00

Ondřej Balvín - Mitochondrial and morphological diversity in the

bed bug Cimex lectularius (Heteroptera: Cimicidae) on different

hosts.

11.00-11.20 Jianxin Cui - The behaviour differences between Pentatomidae and Coreidae in tethered flight.

11.20-11.40 Weiting Zhang - Fossil Heteroptera from China

11.40-12.00 Hui Liu - Phylogeographic relationship among Chinese and Japanese populations of Agriosphodrus dohrni (Hemiptera: Reduviidae)

12.00-13.30 Lunch Time


7

Young Heteropterists Time

Section Organizer – Qiang Xie, Min Li, Cuiqing Gao, Zhonghua Fan

13.30-13.45 Hongliu An - The host plant identification of an new invaded lacebug, Corythucha ciliata (Say) in China.

13.45-14.00 Hu Li - The complete mitochondrial genome of assassin bug Agriosphodrus dohrni (Hemiptera: Reduviidae): Sequence, gene organization and comparison with other reduviids

14.00-14.15 Min Li – phylogenetic Analysis of Heteroptera（Insecta:Hemiptera）Based on the Homeobox Genes

14.15-14.30 Haiyu Liu - The complete mitochondrial genome of damsel bug Alloeorhynchus bakeri (Hemiptera: Nabidae)

14.30-14.45 Anna Namyatova - Systematics, phylogeny and biogeography of the plant bug tribes Monaloniini and Odoniellini.

14.45-15.00 Ying Cui - The Mitochondrial Genome of Hackeriella veitchi (Hacker) (Hemiptera: Coleorrhyncha) and Mitochondrial Phylogeny of Hemiptera (Insecta: Paraneoptera)

15.00-15.15 Ying Wang –Research on the secondary structure of LSU nrRNA (28S) of Hemiptera (Hexapoda: Insecta)


15.35-16.00 Closing Session—Paula Mitchel

Saturday 17 July 2010

09.00-12.00 Visit (Ancient Culture Street)

12.00-13.30 Lunch Time

13.00- Free Time


8

Poster Presentation (List alphabetically, according to first

author's family name)

Lily Berniker - Assassins exposed: phylogeny and biogeography of new species of

bee killers, genus Apiomerus (Hemiptera: Reduviidae)………………………51

Bo Cai, Xueqin Shi, Cuiqing Gao, Wenjun Bu - A morphological study on fine

structure of adult metathoracic scent glands in Lygaeoidea (Hemiptera:

Heteroptera: Pentatomomorpha)………………………………………………51

Chérot F., Costa, L. , Touchet, M. - New combinations and new synonymies in the

subfamily Mirinae…………………………………………………………….52

Chérot, F., Aukema B, Bruers J., Viskens G. - Exotic species of Aradidae and

Miridae recently found in Antwerp harbour………………………………….53

Dominik Chłond, Wanzhi Cai - A Revision of Afrotropical, Oriental and

Palaearctic species of the genus Sirthenea Spinola (Heteroptera: Reduviidae,

Peiratinae)……………………………………………………………………..54

Dominik Chłond, Łukasz Junkiert, Krzysztof Musik - Notes on biology of

Platymeris rhadamanthus Gerstaecker, 1873 (Heteroptera: Reduviidae:

Reduviinae)……………………………………………………………………55

Bill Dolling, Laurence Livermore, Mick Webb - World Catalogue of the

Coreidae……………………………………………………………………….56

Dimitri Forero, Dong Hwan Choe, Christiane Weirauch - Resin Gathering In

Neotropical Resin Bugs (Hemiptera: Reduviidae: Apiomerini): Functional And

Comparative Morphology…………………………………………………….56

Petr Kment, Jitka Vilímová - The nomenclature of the structures forming the

external scent efferent system in Pentatomoidea (Heteroptera)……………....57


9

Elod Kondorosy - Lygaeoidea of Indonesia and neighbouring regions…………..58

María Cecilia Melo - The aquatic and semiaquatic Heteroptera (Hemiptera) from

Argentina…………………………………………………………………..….60

Paula Levin Mitchell, Samuel Bernell Cooke, Sarah Elizabeth Johnson -

Analysis of pentatomid and coreid feeding behavior using electrical penetration

graph techniques………………………………………………………….…..61

Carsten Morkel - True bug species diversity (Insecta, Heteroptera) of

Kellerwald-Edersee National Park (Germany): results of a four-year initial

survey……………………………………………………………………...….62

Anna A. Namyatova - Review of the genus Globiceps Le Peletier & Serville, 1825

(Heteroptera: Miridae)…………………………………………………..……66

José Ricardo Inacio Ribeiro, Ana Lia Estévez, Alan Lane de Melo - The genus

Weberiella De Carlo, 1966 (Insecta: Heteroptera: Belostomatidae) revisited:

new considerations of back-brooding behavior in Belostomatinae……….…..66

Masaaki Tomokuni - Inventory researche of Heteroptera in Sarawak, Malaysia...68

Andrzej Wolski - Revision of the Rhinocylapus-group (Heteroptera: Miridae:

Cylapinae)………………………………………………………………...….68

Weiting Zhang, Yunzhi Yao, Dong Ren, Wanzhi Cai, David A. Rider - Mesozoic

Fossil Heteroptera from China………………………………………...……..69

Weibing Zhu - Exotic coreid bugs introduced into China…………………………71


10

Participants

Hongliu An College of Agriculture, Yangtze University, Jingzhou, Hubei

434025, P. R. China

Berend Aukema Zoölogisch Museum, Afdeling Entomologie, Plantage Middenlaan 64, 1018 DH Ansterdam, Nederland. Email: [email protected]

Xiaoshuan Bai Institute of Life Science and Technology, Inner Mongolia

Normal University, Zhaowuda Road 81, Huhhot 010022,

Inner Mongolia, China.

Email: [email protected]

Ondřej Balvín Department of Zoology, Charles University, Czech Republic.


Lily Berniker Department of Entomology, University of California

Riverside, USA.


Wenjun Bu Institute of Entomology, Nankai University, Tianjin, China.


Wanzhi Cai Department of Entomology, China Agricultural University,

Yuanmingyuan West Road, Beijing 100094, China. Email:

[email protected]

Bo Cai

Langming Cao

Institute of Entomology, Nankai University, Tianjin, China.


Department of Entomology, China Agricultural University,

Yuanmingyuan West Road, Beijing 100094, China.

Pingping Chen Nationale Referentie Centrum,

Plantenzienktenkundige Dienst, The Netherlands.



11

Dominik Chłond Department of Zoology, University of Silesia, Poland.


Jianxin Cui Plant Protection Department, Henan Institute of Science and

Technology, China. Email: [email protected]

Ying Cui Institute of Entomology, Nankai University, Tianjin, China.


Pablo Matías Dellapé Division Entomologia, Museo de La Plata, Argentina.


Tomáš Ditrich Pedagogical Faculty, Dept. of Biology, University of South

Bohemia, Czech Republic. Email: [email protected]

Ram Keshari Duwal Agricultural Biotechnology, Seoul National University, South

Korea. Email: [email protected]

Alice Exnerová Department of Zoology, Charles University in Prague,

Faculty of Science, Czech Republic. Email: [email protected]

Zhonghua Fan Institute of Entomology, Nankai University, Tianjin, China.


Francesco Faraci Italy. Email: [email protected]

Dimitri Forero Department of Entomology, University of California

Riverside, USA.


Chérot Frédéric Etude du Milieu naturel et agricole, Service public de

Wallonie, Belgium. Email: [email protected]

Cuiqing Gao

Taiping Gao



College of Life Sciences, Capital Normal University, Beijing,

China.


12

Jianyu Gao Department of Entomology, China Agricultural University,


Eric Guilbert Department Systematic and evolution, Muséum National

d'Histoire Naturelle, France. Email: [email protected]

Ernst Heiss Research Entomologist, Tiroler Landesmuseum, Austria.


Thomas J. Henry Systematic Entomology Laboratory, Agricultural Research,

National Museum of Natural History, Smithsonian Institution,

USA. Email: thomas.henry@ars. usda. gov

Wei Song Hwang Department of Entomology, University of California

Riverside, USA. Email: [email protected]

Sunghoon Jung Department of Entomology, Seoul National University,

Korea. Email: [email protected]

Łukasz Junkiert Department of Zoology, University of Silesia, Poland.


Elena V. Kanyukova Zoological Museum, Far Eastern State University, Russia.


Petr Kment Department of Entomology, National Museum, Czech

Republic. Email: [email protected]

Elod Kondorosy Department of Zoology, University of Pannonia, Hungary.


Fedor V. Konstantinov Department of Entomology, St. Petersburg State University,

Russia. Email: [email protected]

Truong Xuan Lam Department of Experimental Entomology, Institute of Ecology

Biological resources, Vietnam. Email: [email protected]

Hu Li Department of Entomology, China Agricultural University, Yuanmingyuan West Road, Beijing 100094, China


13

Min Li (Senior) Institute of Entomology, Nankai University, Tianjin, China.


Min Li (Junior) Institute of Entomology, Nankai University, Tianjin, China.


Aiping Liang Institute of Zoology, Chinese Academy of Sciences, China.


Guoqing Liu Institute of Entomology, Nankai University, Tianjin, China.


Hui Liu Entomological Laboratory, Faculty of Agriculture, Kyushu

University, Fukuoka 812-8581, Japan.


Laurence Livermore

Ying Lu

Department of Entomology, The Natural History Museum,

UK. Email: [email protected]


China.

Zhaohui Luo Xinjiang Institute of Ecology and Geography, CAS, 818, South Beijing Road, Urumqi, Xinjiang, China.


Mallik B. Malipatil Department of Primary Industries, Knoxfield Centre, Private

Bag 15, Ferntree Gully Delivery Centre, Vic. 3156, Australia.


Maria Cecilia Melo Departamento Sistemática, Instituto de Limnologia “R.A. Ringuelet” (ILPLA), CCT La Plata CONICET- UNLP. Av. Calchaquí km 23.5, ex Lab. YPF, (1888) Florencio Varela, Buenos Aires, Argentina


Paula L. Mitchell Department of Biology, Winthrop University, Rock Hill, SC

29733, USA. Email: [email protected]

Carsten Morkel Bartholomäusstrasse 24, 37688 Beverungen, Germany.


14

www.umweltgutachten.com. Email: [email protected]

Anna A. Namyatova Saint-Petersburg State University, 199034, Saint-Petersburg, Russia


Richard J. Packauskas Biological Sciences, Fort Hays State University, USA.


John T. Polhemus Colorado Entomological Institute, USA.


Anthony Postle Department of Agriculture, Fisheries and Forestry,

Australian Quarantine and Inspection Service, Australia.


Alex Ramsay RSK Carter Ecological Ltd, UK.


Dávid Rédei

Dong Ren

Department of Zoology, Hungarian Natural History Museum,

Hungary. Email: [email protected]


China. Email: [email protected]

José Ricardo Inacio Ribeiro Campus São Gabriel, Ciências Biológicas, Universidade

Federal do Pampa, Brazil.


Randall T. Schuh Invertebrate Zoology, American Museum of Natural History,

USA. Email: [email protected]

Abdul Manan Shaikh

Aimin Shi

Department of Zoology, Shah Abdul Latif University,

Khairpur Mirs, Pakistan.





15

Jingjing Song


China.

Pavel Štys Department of Zoology, Charles University in Prague,

Faculty of Science, Czech Republic. Email: [email protected]

Xiaoxuan Tian Institute of Entomology, Nankai University, Tianjin, China.


Masaaki Tomokuni Department of Zoology, National Museum of Nature and

Science, Tokyo, 3-23-1 Hyakunin-cho, Shinjuku-ku, Tokyo,

169-0073 Japan.


Nickolay N. Vinokurov Laboratory of Systematic and Ecology of Invertebrates,

Institute for Biological Problems of Cryolithozone, Siberian

Branch, Rusisan Academy of Sciences, Russia.


Ying Wang

Ying Wang





Mick Webb The Natural History Museum, UK.


Christiane Weirauch Department of Entomology, University of California

Riverside, USA. christiane. Email: [email protected]

Andrzej Wolski Institute of Plant Protection, National Research Institute,

Poland. Email: [email protected]

Qiang Xie

Jingyang Xv



The Plant Protection Institute of Tianjin, Tianjin, China.



16

Kazutaka Yamada

Hailin Yang

Tokushima Prefectural Museum, Japan.




Yunzhi Yao Key Lab of Insect Evolution & Environmental Changes,

Capital Normal University, Beijing 100037, China


Xin Yu Institute of Entomology, Nankai University, Tianjin, China.


Weiting Zhang Key Lab of Insect Evolution & Environmental Changes,

Capital Normal University, Beijing 100037, China.


Guanyang Zhang Department of Entomology, University of California,

Riverside, USA. Email: [email protected]

Xu Zhang

Hufang Zhang

Guangyu Zhao



Department of Biology, Taiyuan Normal University, China.




Weibing Zhu Shanghai Institute of Plant Physiology and Ecology, Chinese

Academy of Sciences, China. Email: [email protected]


17

Abstracts of the 4th meeting of the IHS

Major problems in phylogenetic systematics of the basal

clades of Heteroptera (Enicocephalomorpha,

Dipsocoromorpha)

Pavel Štys

Department of Zoology, Faculty of Science, Charles University in Prague, Viničná 7, CZ -

128 44, Praha 2, Czech Republic

E-mail: [email protected]

For a variety of reasons the two basal clades have been rather neglected by heteropterists, and this unfortunate situation continues. The major gaps in knowledge concern comparative and functional morphology, reproduction biology, and genus-level alpha-taxonomy of faunas, particularly those of Neotropical, Madagascan, Oriental, Papuan and New Zealand regions.

It would be unrealistic to expect that species level taxonomy would be comparable to other infraorders in foreseeable future. However, a prerequisite to a major progress in supra-specific taxonomy may only be expected after study of numerous odd genera, both described and undescribed, by students willing to combine taxonomic with morphological studies. The most important task prior to formulation of a genealogical hypothesis is to identify the elementary taxa, i.e. to identify monophyletic clades at whatever position in the hierarchy. This process is analytic and requires splitting of paraphyletic and other non-monophyletic taxa. Only then it is possible to identify synapomorphies and build up the phylogenetic system.

The major problems in higher classification are briefly outlined, as follows (the names of suspected paraphyletic taxa are given in quotation marks).

ENICOCEPHALOMORPHA (ENI): “Aenictopecheidae”: Nymphocorinae, Maoristolinae, Aenictopecheinae, “Murphyanellinae” inc.


18

sed. Enicocephalidae: Phallopiratinae, Phthirocorinae, “Enicocephalinae” (incl. Alienatinae, and “Systelloderini”; “Systelloderes” as metataxon; position of genera with elaborate male genitalia?), Xenicocephalus, Megenicocephalinae inc. sed.

DIPSOCOROMORPHA s. str. (DIP): Dipsocoridae, Stemmocryptidae.

“CERATOCOMBOMORPHA” (CER) (no synapomorphy for DIP & CER = “DIP” s. lat.; no reliable autapomorphy for CER): Ceratocombidae: Trichotonanninae, Ceratocombinae (Ceratocombus as metataxon); Issidomimidae stat. n.; Hypsipterygidae; “Schizopteridae”: (Hypselosomatinae; the rest of the family - "Shizopterinae" & Ogeriinae - is just a mess).

ENI is a sister-group to Euheteroptera but the alleged synapomorphies of DIP and CER with Neoheteroptera are dubious. Nearly nothing is known on function of the male genitalia in ENI (symmetrical), and the male genitalia and complex pregenital and postgenital abdomen in DIP (sinistral) and CER (dextral), and methods of mating and insemination. The opportunities for research are unlimited.

The research was supported by a grant of the Academy of Sciences of Czech Republic (project No. IAA 601110706) to the author.

Systematics and Evolution of Heteroptera

Christiane Weirauch

Department of Entomology, University of California Riverside, USA


Insect culture in China, with special reference to true bugs

Wanzhi Cai

Department of Entomology, China Agricultural University, Yuanmingyuan West Road,

Beijing 100193, China



19

China is one of the countries with a very early agricultural history. About twenty thousand years ago, the ancient Chinese began to grow crops. Early forms of agriculture, including sericulture, were well developed in China in the Neolithic Age (5000 to 7000 years ago). Ancient Chinese have made great contributions to the knowledge of cultural entomology during this long period living with insects, especially in the agricultural activities. As China with a long history and the many nationalities, the connotations of Chinese insect culture are of a great diversity. The basic themes are people can live (having enough foods, having warm clothes, keeping away from the diseases) and can have next generations, live better (being happy, becoming a marquis, becoming a governor, becoming a richer), and live longer or for ever (having a long life, regeneration like a insects). For the safe and prosperity of the society, the Chinese insect culture educate people be kind to all the people, be kind to all the living things, be dutiful, be industrious and be high-minded. The first Chinese entomologist who studied Chinese insect culture is You Qiwei in 1935 and the first foreign entomologist who studied Chinese insect culture is Osten Sacken in 1895. About 30 valuable monographs and more than 200 papers on Chinese insect culture were published during the last decades.

Although insect pests control records can be traced back 3000 years ago in China, the earlier records on Chinese Heteroptera are very limited and most of them are focused on the pest insects (such as litchi stink bug), vectors (such bed bug), and some medically used bugs (such as nine-smelled stink bug, water striders, giant water bugs). The first record of true bug outbreak appeared in 665 BC. One of the eldest Chinese common names of true bugs is fei. The earlier Chinese common name for Heteroptera, chunxiang (Elephants on heaven trees or on Chinese toon trees), firstly appeared at least before 1637 and the modern Chinese common name for Heteroptera, chun, fixed in 1940’s. Modern taxonomic studies of true bugs by Chinese began in the early of 1930’s and two founders of Chinese Heteroptera taxonomy are We-I Yang (1897~1972) and Tsai-Yu Hsiao (1903~1978). About 4200 living species in 51 families and 120 fossil species in 29 families of Heteroptera have been known at present. The active Chinese heteropterists now are in Nankai University (Tianjin), China Agricultural University (Beijing), Inner Mongolia Normal University (Huhhot), Natural History Museum of Taiwan (Taizhong), Chung Hsing University (Taizhong) and about 10 researchers (excluding students) are working on this group in China. The DNA molecular and genomic


20

taxonomic studies of this group started in the end of 20th century in China and about 30 papers or thesis have been published by Chinese heteropterists. Some basic works on the conservation biology of this group are also being done recently.

Molecular Phylogeny of the Tingidae

Eric Guilbert, Jakob Damgaard, D'Haese C.

Department Systematic and evolution, Muséum National d'Histoire Naturelle, France


A molecular phylogeny of the Tingidae is provided on the basis of four genes (COI, COII, 16S and 28S). The results obtained with direct optimization method of parcimony clearly show that Cantacaderini are sister group of (Phatomatini + Tingini) as stated by Lis (1999). The results are discussed on the light of morphological characters.

Phylogenetic analysis of Lygaeoidea (Heteroptera:

Pentatomomorpha) of China based on morphological

characters

Cuiqing Gao, Wenjun Bu

Institute of Entomology, College of Life Science, Nankai University, Tianjin 300071, China


In the present study, a phylogenetic analysis of the Lygaeoidea was conducted based on 112 morphological characters and 46 taxa, including five outgroups. The data matrix of morphological characters was revised from Henry (1997), Dong & Zheng (1997), Xue (2004) and Li (2005), some characters were modified or deleted, 27 new characters were added, especially those of the fine structures of adult metathoracic scent gland (MTGs) and abdominal trichobothria. The major result of this study are (1) Monophyly of the Lygaeoidea is supported, and the Lygaeidae (sensu lato) is supported to be a paraphyletic group; (2) The Pachygronthidae are


21

hypothesized as a paraphyletic group; (3) The Henestarinae are supported as the sister group to the Lygaeidae (sensu stricto), and break from the geocorines, so the result suggests the Henestarinae maybe should be given individual family status; (4) The Cleradini is the basal lineage of the Rhyparochromidae, instead of the Plinthisinae, so the result does not support the Plinthisini to be revised subfamily status.

Ancestral Character States and Correlated Evolution of the

Flower Bugs (Heteroptera: Anthocoridae) using Bayesian

Analysis of MultiStates and Discrete Characters

Sunghoon Jung1, Hyojoong Kim2, Kazutaka Yamada3, Seunghwan Lee1

1Laboratory of Insect Biosystematics, Division of Entomology, School of Agricultural

Biotechnology, Seoul National University, San 56-1 Shilim-dong, Gwanak-gu, Seoul,

151-742 Korea

2Department of Life Sciences and Division of EcoScience, Ewha University, Seoul, 120-750

Korea

3Tokushima Prefectural Museum, Bunka-no-Mori Park, Hachiman-chô, Tokushima,

770-8070 Japan. E-mail: [email protected]

Investigating the molecular clock, the ancestral character states, and the correlated evolution of discrete binary traits on phylogenetic trees, we studied the evolutionary history of the family Anthocoridae, using ~3000bp of the mitochondrial 16S rRNA and nuclear 18S rRNA and 28S rRNA genes for 44 taxa. The BEAST and BayesTraits were used to examine the divergence times, cladogenesis, and historical habitat patterns. The correlated evolution of discrete characters among habitats and morphological characters was tested by BayesFactors using reversible-jump Markov chain Monte Carlo methodology. Our results suggest that (i) the ancestral habitat patterns of dead plants may have served as an important rule for the stem group of anthocorids; (ii) the radiation of angiosperms and the prey insect in the mid-Cretaceous might have provided anthocorids with more habitat options; and (iii) the transition of habitats played an important role for the change of ovipositor and 3rd to 4th antennal segment patterns in the family Anthocoridae.


22

Key words: Anthocoridae, Phylogeny, molecular dating, ancestral character states, correlated evolution

Molecular phylogenetic analysis of the Anthocoridae (sensu

stricto) (Heteroptera: Cimicomorpha)

Min Li (S), Yunling Ke, Li Xi, Jimeng Hua, Wenjun Bu

Insect Molecular Systematic Lab, Institute of Entomology, College of Life Science,

Nankai University, No. 94 Weijin Road, 300071, Tianjin, China


The family Anthocoridae (sensu stricto) is known as an important group of predators for pests, some of them have been introduced as biological control agents. The previous studies on the phylogenetic relationships within Anthocoridae were based on morphological characters without molecular support. In this study, the molecular markers of 16S rDNA, 18S rDNA and cytochrome oxidase subunit I (COI) gene with a total length about 4 kb were employed to analyze the phylogenetic relationships of Anthocoridae (sensu stricto). The phylogenetic trees analyzed by two algorithms (ML and Bayesian) showed that Anthocoridae could be divided into two main lineages. Lineage I contains Anthocorini (except Elatophilus), Oriini, Dufouriellini (only Amphiareus) and Scolopini (only Calliodis). Almeidini, Anthocorini (only Elatophilus), Dufouriellini (except Amphiareus), Xylocorini, Scolopini (only Scoloposcelis) and Blaptusterini were included in lineage II. However, the genus Bilia does not in the same clade with other genera of Oriini, Dufouriellu forms a single calde, and without the close relateiongship with another clade formed by the genera of Cardiastethus, Dysepicritus and Physopleurella. The results indicated that Anthocorini, Dufouriellini, Oriini and Scolopini are paraphyletic groups. We need to establish new tribes to include the genera of Elatophilus and Bilia respectively. Dufouriellini should be divided into three tribes to include Dufouriellus，((Dysepicritus + Cardiastethus) + Physopleurella) and Amphhiareus respectively. Two sbutribes of Scolopini: Scolopina and Calliodina should be rised to tribe level.


23

Bryocorinae (Heteroptera: Miridae): structural diversity of

male genitalia and phylogeny

Fedor V. Konstantinov

Department of Entomology, St. Petersburg State University, Russia


It is well known that the structure of the male genitalia is widely used in taxonomy of Miridae. Monophyly of several high ranked groups e.g. subfamily Phylinae or tribe Halticini, as well as phylogenetic relationships of Dicyphini and Pilophorini were revealed first and foremost on the grounds of male genitalia structure (Wagner, 1955, Schuh, 1974, 1976, 1984, 1995).

Bryocorinae is a morphologically diverse group of worldwide distribution, containing slightly less than 200 genera arranged in three tribes. Detailed study of the male genitalia reveals a wealth of structural variation. Results of the study are mainly in agreement with the phylogenetic scheme proposed for the subfamily by R.T. Schuh (1976). Cladistic analysis of 46 terminal taxa and 65 morphological characters support the recognition of three tribes, Bryocorini, Dicyphini, and Eccritotarsini. Monophyly of the tribe Bryocorini is further corroborated by a large number of male genitalic characters. The subtribes Monaloniina and Odoniellina are undoubtedly closely related as evidenced by the male genitalia structure and form the sister group to the genus Felisacus. The latter genus is currently placed within Monaloniini but has distinct structure of male genitalia resembling that of some Eccrititarsini. The subtribe Dicyphina form the sister group to a clade comprising Monaloniina, Odoniellina and Felisacus and differs from this group by the absence of supragenital bridge of the genital capsule and the differentiation of aedeagal structures. At least four lineages can be distinguished within the largest tribe Eccritotarsini on the grounds of the structure of head, pronotum, genital capsule, aedeagus, and parameres. Finally, current data do not provide evidence for inclusion of the genus Palaucoris into the subfamily Bryocorinae.


24

Revision and Phylogeny of the New World Plant Bug Tribe

Ceratocapsini (Hemiptera; Miridae; Orthotylinae)

Thomas J. Henry

Systematic Entomology Laboratory, Agricultural Research, National Museum of Natural

History, Smithsonian Institution, USA

E-mail: thomas.henry@ars. usda. gov

A phylogenetic review of Neopamera Harrington 1980

(Hemiptera: Rhyparochromidae: Myodochini), with the

description of new genera and species.

Pablo Matías Dellapé

División Entomología, Museo de Ciencias Naturales de La Plata, Universidad Nacional de La

Plata, Paseo del Bosque, (1900) La Plata, Argentina


The family Rhyparochromidae is one of the most diverse within the infraorder Pentatomomorpha. The tribe Myodochini includes 72 genera and more than 320 species worldwide. Although the South American fauna is poorly known, this is the most diverse group of rhyparochromids in the Neotropics with 32 genera and about 100 species described. The radiation and diversification of the Myodochini in South and Central America appears to have been fostered by the absence of many Old World tribes.

In her review of the Myodochini of the world, Harrington erected the genus Neopamera to include 20 Neotropical species, but she did not find any satisfactory synapomorphies. Up to now the genus Neopamera includes 17 species distributed in the Western Hemisphere, West Indies, Galapagos Is., and Marquesas Is.

In order to analyze the monophyly of Neopamera, about 4500 specimens of the genus and related genera from 16 collections were examined. A phylogenetic analysis was performed on the basis of a data


25

matrix including internal and external morphological characters, including all the known species and new related ones. Following Harrington’s cladistic analysis, species of the genera Cholula, Prytanes, Orthaea, Paisana, Heraeus and Neomyocoris were selected as outgroups.

Neopamera is redefined to include only four of the previously included species.

Additionally, the morphological analysis conducted, supported by the results of the cladistic analysis, showed that external morphological characters and male genitalia justify the creation of new genera including 13 of the known species and 30 new ones.

Phylogeny of Pentatomomorpha (Hemiptera: Heteroptera)

based on six Hox genes markers

Xiaoxuan Tian*, Qiang Xie*, Min Li (J), Cuiqing Gao, Ying Cui, Li Xi, Wenjun Bu§

Institute of Entomology, College of Life Sciences, Nankai University, 94 Weijin Road,

Tianjin, 300071, China

*These authors contributed equally to this work. E-mail: [email protected],

[email protected]

§Corresponding author: [email protected]

Pentatomomorpha is one of the most diversified infraorders of the true bugs (Insecta: Hemiptera: Heteroptera). However, the phylogenetic relationships among superfamilies within this infraorder are still in dispute. In this study, thirty-one species representing twenty-six Pentatomomorpha and four Cimicomorpha putative families and six Hox genes fragments as many as four kilobases for each representative were analyzed to reconstruct the phylogeny of Pentatomomorpha. The (Homeotic) Hox gene family is a group of nuclear genes which is considered to determine animal segments identity. The combined nucleotide sequences and combined amino acid sequences were used separately as two data matrices, and analyzed by employing maximum likelihood and Bayesian methods. Results strongly supported the monophylies of Trichophora and superfamilies Pentatomoidea, Lygaeoidea,


26

Coreoidea and Pyrrhocoroidea. The relationship of (Aradoidea + (Pentatomoidea + (Lygaeoidea + (Coreoidea + Pyrrhocoroidea)))) was mostly congruent with previous results based on morphological data. Our results suggested that the Hox genes should be candidates of novel molecular markers for the phylogenetic research of Pentatomorpha, or even other insects.

The flat bug genus Barcinus Stål 1873 in the Oriental-Papuan

Region

Ernst Heiss

Research Entomologist, Tiroler Landesmuseum, Austria


The Aradid genus Barcinus was erected by Stål 1873 for his species horridus from Malay Peninsula. Only two additional species were known from New Guinea until Usinger & Matsuda 1959 assigned four more new species (bhoutanensis from Bhoutan, ceramensis from Ceram Island, papuensis from Papua New Guinea, and productus from Bismarck Archipelago) to this genus. Only in 2006 another species, B. kormilevi was described by Bai, Heiss & Cai from Hainan Island in SE China.

The distribution pattern of these eight species within the Indo-Pacific region is restricted to three biogeographically different areas: first the rainforests of Central Malaysian Peninsula, Sumatra and Java; second the Himalayan mountain ranges from Bhutan and adjacent Chinese provinces of Xizang (Tibet) and Yunnan reaching Fujian and Hainan Island; and third the Papuan region from Ceram in the West , across New Guinea (Irian Jaya and Papua New Guinea) to the Bismarck Archipelago (New Britain, New Ireland) and to the East.

Species occurring in these three distribution areas show remarkable morphological differences which led to the opinion, that although a basic groundplan of body structures is shared by them, they should be assigned to different taxonomic categories due to biogeographical considerations. Therefore I propose to place the already known 8 species and the 7 new species into 4 distinct genera of which 3 are described as new.


27

Taxonomy of Aradidae from China: a brief history

Xiaoshuan Bai1, Wanzhi Cai2, Ernst Heiss3

1Institute of Life Science and Technology, Inner Mongolia Normal University, Zhaowuda

Road 81, Huhhot 010022, Inner Mongolia, China. E-mail:[email protected]

2Department of Entomology, China Agricultural University, Yuanmingyuan West Road,

Beijing 100094, China. E-mail: [email protected].

3Research Entomologist, Tiroler Landesmuseum, Josef Schraffl Strasse 2a, A-6020

Innsbruck, Austria. E-mail: [email protected]

Aradidae is a large family of Hemiptera, including 9 subfamilies, about 230 genera and over 2000 species presently known around the world. In China, the aradid taxonomy history can be divided into three stages.

The first is starting stage ranges from 1885 to 1955. This stage is characterized by lacking Chinese aradidologist and only few aradids have been named. Finnish scholar Bergroth (1885) described the first species Aradus emarginatus from Beijing. Subsequently, Kiritshenko described Paraneurus sinensis (Kiritshenko, 1913) from Sichuan. Those two aradids was recorded in Wu’s (1935) catalog of Chinese insects. Esaki & Matsuda (1952) established Pseudartabanus Esaki & Matsuda based on a species from Taiwan.

The second is foundation stage ranges from 1955 to 1995. This stage is recognized by large number species and genera of aradids from China have been studied by heteropterists from home and abroad. Kormilev (1955-1987) described 27 species and 2 genera (Arbanatus Kormilev, 1955 and Odontonotus Kormilev, 1955) from China, especially from Taiwan Province. The Chinese scholar Hsiao (1964) firstly described 2 species Aradus discompar Hsiao from Yunnan and Aradus omeiensis Hsiao from Sichuan; later, he established Wuiessa Hsiao, 1964 and Yangiella Hsiao, 1964 according to 2 species from Yunnan. Blöte (1965) named Brachyrhynchus hsiaoi (The species B. membranaceus (Fabricius, 1798) reported from China by Hsiao (1964) was misidentified). Kormilev and Heiss described Paraneurus bimaculatus (Kormilev & Heiss, 1976) and Paraneurus oviventris (Kormilev & Heiss, 1976) from Taiwan. Vásárhelyi described Aradus chinensis Vásárhelyi, 1988 from Tianjin but the species was misidentified and revised by Heiss (2007) and refers to A.


28

hieroglyphicus. Hsiao (1964, 1981) and Liu (1980, 1981, 1992) studied the fauna of aradids from China and described 41 species. In the second volume of “A handbook for determination of Chinese Heteroptera” by Hsiao et al. (1981), Liu keyed and redescribed 78 species in 16 genera and 4 subfamilies of aradids from China.

The third is development stage ranges from 1998 to now. Heiss (1998, 2001, 2003, 2007, 2008, 2009, 2010) described 21 species and established a genus Taiwanaptera Heiss, 2008 from China. In the catalogue of Aradidae of Palaearctic Realm, Heiss (2001) recorded 109 species from China. Hua (2001) compiled the catalogue of Aradidae from China and recorded 111 species. Bai and Cai (2006, 2007, 2008, 2009, 2010) continued to study the fauna of aradid from China and established 2 new genera: Crassocoris Bai, Heiss & Cai, 2007 based on the species from Hainan and Stipesoculus Bai, Wu & Cai, 2007 based on the species from Guangxi, reported 1 first record subfamily, 5 first record genera and 2 first record species from China, and described 8 new species.

Now there are 5 subfamilies (Aradinae, Aneurinae, Calisiinae, Carventinae, Mezirinae), 34 genera and about 150 species have been known from China. We believe that the fauna of aradid from China is very rich and about half of the species remains to be studied.

Nysius Dallas of Australia and South West Pacific (Hemiptera:

Heteroptera: Orsillidae)

Mallik B. Malipatil

Department of Primary Industries, Knoxfield Centre, Private Bag 15, Ferntree Gully

Delivery Centre, Vic. 3156, Australia


During a review of Australian Nysius Dallas, types of all species recorded from Australia and its territories and neighbouring areas in the South West Pacific were examined. As a result of this, several synonymies became necessary. Five other species from Australia and the SW Pacific have had their status confirmed. A key to all species now recognised from Australia and the SW Pacific provided.


29

An overview of the family Orsillidae (formerly in the Lygaeidae, as Orsillinae) in Australia and SW Pacific, together with comments on economic importance, and, worldwide, the very high number of species (over 100, almost half the species in the family) in this genus will be discussed.

Biodiversity of the Heteroptera of Siberia and the Russian Far

East

Nickolay N. Vinokurov

Institute for Biological Problems of Cryolithozone, 41 pr. Lenina, Yakutsk, Russia


Golub V.B.

Voronezh State University, Voronezh, Russia


ElenaV. Kanyukova

Far Eastern State University, Okeanskii prosp. 37, Vladivostok, Russia.


Environment of Siberia and the Russian Far East are most severe in Northern Hemisphere. According to the zoogeographical Zonation offered by O.L. Kryzhanovsky (2002) the investigated territory is attributed to the Boreal and East Asian districts of the Holarctic Regnum. The Hyperboreal (Tundra) sub-district includes the Arctic zone of Northern Asia. The taiga zone of Western Siberia is ascribed to the Euro-Ob’ and the whole territory east of the Yenisei River – to the Angaro-Okhotian super-provinces of the Euro-Canadian sub-district. Forest-steppes and steppes distributed in South Siberia from Urals to Sic-Amuria belong to the Scyphian (Steppe) sub-district which according to A.F. Emelyanov (1974) is a part of Tethian (Desert) sub-regnum. The south of the Russian Far East is ascribed to the Stenopean (Manchurian) sub-district of the East Asian district.


30

On evidence of our investigation, the fauna of Heteroptera of Siberia and the Russian Far East includes 1193 species and subspecies from 400 genera, 40 Families and 7 Infraoders (Table). Half of them belong to 3 Families – Miridae (427), Lygaeidae (138) and Pentatomidae (91), but Family Reduviidae, one of the largest in order Heteroptera, is presented only by 27 species. Тhe core of the Siberian fauna comprises widespread boreal and temperate forest and meadow species. Steppe species are characteristic of South Siberia. However in Eastern Siberia some of them occur far north reaching the Polar Circle where they inhabit islets of Pleistocene relic steppes. Desert faunal element is weak in Siberia. Some Turanian species occur in the south of West Siberia and solitary species of the Gobi Desert biota are found in Altai and Tuva in the border limits of Mongolia. Furthermore several montane Middle Asian species move northwards as far as Altai-Sayan mountain system. The main distinguishing feature of the southern Far East fauna is a wide representation of nemoral East Asian element comprising 441 species or 56% of the total number.

Table. Distribution of heteropteran in Siberia and the Russian Far East

Infraorder

Asian part of

Russia

Western

Siberia

Eastern

Siberia

Russian Far

East

Dipsocoromorpha 6 3 2 6

Enicocephalomorpha 1 - - 1

Nepomorpha 69 36 39 45

Leptopodomorpha 41 25 32 29

Gerromorpha 33 12 15 30

Cimicomorpha 620 275 341 446

Pentatomomorpha 423 236 262 277

Total: 1193 587 691 834


31

A review of a little known genus Carenoplistus (Hemiptera:

Pentatomidae: Halyini) with description of new species from

Pakistan

*Abdul Manan Shaikh, **Nasreen Memon, ***Arshad Azmi

*Department of Zoology, Shah Abdul Latif University, Khairpur Mirs, Pakistan

**Department of Zoology, University of Sindh, Jamshoro, Pakistan

***Department of Zoology, Karachi University, Pakistan


Jakovlev (1881) described little known genus Carenoplistus to accommodate Signoret’s acutus. After that Kirkaldy (1909), Hoberlandt (1959 and 1995), Stichel (1962), Puchkov (1965) re described C. acutus from different location. Since then no further addition in the number of species were observed. After about 80 years, Kiritshenko (1963) described a new species C. brevis from Afghanistan, later on Abbasi (1986) and Memon and Ahmed (1998) redescribed C. acutus from Pakistan. After that Ahmed and Memon (2002) added third new species of this genus C. karachiensis based on single female from Karachi, Pakistan, which was the first species that has scent gland ostiole with peritreme and spermathecal bulb with two processes. Presently a new species of genus Carenoplistus is redescribed from Quetta that also has peritreme and bulb with processes from Pakistan on the basis of metathoracic scent gland and male and female genitalia and compared with allied species C. acutus. The key of all four species of genus Carenoplistus is also given.

Title

John T. Polhemus

Colorado Entomological Institute, USA



32

Diversity of assassin bugs (Hemiptera: Reduviidae) and roles

of the common species in some nature reserves and national

parks in northern Vietnam

Xuan Lam Truong1, Wanzhi Cai2

1Institute of Ecology and Biological Resources, Vietnamese Academy of Science and

Technology, No. 18 Hoang Quoc Viet. Cau Giay, Ha Noi, Vietnam


2 Department of Entomology, China Agricultural University, Yuanmingyuan West Road,



The diversity of the assassin bugs (Hemiptera: Reduviidae) and the common species’ roles in some national parks and nature reserves in northern Vietnam are poorly known. The purpose of this paper is to study diversity, discovery new species, new record species for fauna of Vietnam and the common species’ roles of assassin bugs (Heteroptera: Reduviidae) in some national parks and nature reserves such as Tam Dao (Vinh Phuc Province), Xuan Son (Phus Tho Province), Copia (Son La Province), Hoang Lien (Lao Cai Province), Cuc Phuong (Ninh Binh Province) and Pumat (Nghe An Province). Seventy-nine species of assassin bugs from the sites of northern Vietnam were found. Among them there were 5 newly recorded Vietnamese species (Acanthaspis geniculata, Acanthaspis subinermis, Sirthenea dimidiate, Peirates leturoides and Ectomocoris biguttulus). Based on frequency and individual number of assassin bugs, we recorded 14 common species, and they had very important role in protection of crop plants. Sycanus falleni and Sycanus croceovittatus were found to be significant to control insect pests on crops at buffer zones of national parks or nature reserves. The Simpson diversity-index is 0.68 and higher than that in central area and delta.


33

Revision of the pilophorine plant bug genus Pilophorus Hahn,

1826 (Hemiptera: Heteroptera: Miridae: Phylinae)

Xu Zhang, Guoqing Liu

Institute of Entomology, Nankai University, Tianjin 300071, China


The genus Pilophorus is the largest genus of the tribe Pilophorini. It contains more than 100 species in the Palearctic, Nearctic, and Oriental regions. Only one species is known from Africa and none are as yet recorded from the neotropics or Australia. In the period of my research on the genus, 39 species are recognized from China, including 6 species described as new to science, 15 species firstly recorded in China, and a new synonym of Pilophorus Hahn 1826. Pilophorus badius (Zou, 1985) [Spinolosus] is proposed as a new combination. In my research I firstly comprehensively take photographs of SEM of male genitalia to exposing the detailed structure of male genitalia. The type specimens of the new species are deposited in the Institute of Entomology, College of Life Sciences, Nankai University, Tianjin, China.

Faunal comparison of phyline plant bugs between Nepal and

Eastern Asia (Heteroptera: Miridae: Phylinae)

Ram Keshari Duwal1, TomohideYasunaga2, Seunghwan Lee1

1 Program in Entomology, Department of Agricultural Biotechnology, Seoul National

University, South Korea


2 Research Associate, Department of Entomology, Division of Invertebrate Zoology,

American Museum of Natural History, New York, USA


Nepal, situated at Southern slope of Himalaya is zoo-geographically considered as the Oriental Region. A watershed of the northern Himalayan


34

border is assumed to be border of the Palearctic Region. In phyline plant bugs, most of the genera such as Atractotomoidea Yasunaga, 1999; Campylomma Reuter, 1878; Decomia Poppius, 1915; Europiella Reuter, 1909; 1914 and Moissonia Reuter, 1894 are found in both Nepal and East Asia. But some genera, Alnopsallus Duwal, Yasunaga and Lee, Aplagiognathus Duwal, Yasunaga and Lee, Leucophylus Duwal, Yasunaga and Lee, Psallomorpha Duwal, Yasunaga and Lee, Zanchiphylus Duwal, Yasunaga and Lee, etc appear to be restricted to Nepal or Himalayan Ranges. On the other hand Plagiognathus Fieber, 1858; Psallus Fieber, 1858; Phylus Hahn, 1831; Salicarus Kerzhner, 1962; Compsidolon Reuter, 1899; etc are yet to be confirmed from Nepal, although these genera are Euro-Siberian elements and widely distributed from Europe to Japan Archipelago. The Himalaya appears to be a barrier for distribution of these genera. Based on these examples and their distribution pattern, we will discuss zoogeographical relationships of phyline plant bugs between Nepal and Eastern Asia.

New genus Ramivena Fan & Liu of Pentatominae

(Heteroptera: Pentatomidae)

Zhonghua Fan1, Guoqing Liu

Institute of Entomology, Nankai University, Tianjin 300071, China

1E-mail: [email protected]

Pentatoma was erected by Oliver in 1789, but contained no species originally. Lamarck (1801) first placed Cimex rufipes Linnaeus, 1758 in this genus. Thus Cimex rufipes Linnaeus should be the type of genus Pentatoma Oliver. Over thirty species have been reported in this genus. Most of them distribute only in southwest of China. Others can distribute in India, eastern Russia, Korea and Japan. Only one species Pentatoma rufipes Linnaeus can also be found in Europe.

However, Pentatoma Oliver was found not to be monophyletic, and both the morphological and the genital characters represent diversity. The cladistic analysis by Ling & Zheng (1983) also supported that the interspecific difference in the genus even greater than that with species in allied genera, and they suggested it should be further divided.


35

The rufipes-group, which includes Pentatoma angulata, longirostrata, montana, nigra, rufipes, can be seen as Pentatoma sensu stricto. While the other species should be considered to belong outside Pentatoma and can be divided into several different groups.

One of the groups, Ramivena, is described here as new. Three species were transferred from genus Pentatoma Oliver into this new genus, and another two species are reported as new. This new genus distributes in Oriental, mainly in the South of China and India.

Distributional and Host Patterns In Australian Phylinae

(Miridae)

Randall T. Schuh

Invertebrate Zoology, American Museum of Natural History, USA


Multimodal Antipredatory Defences In Terrestrial Heteroptera:

Efficiency Against Bird Predators

Alice Exnerová1, Kateřina Hotová Svádová, Pavel Štys

Charles University in Prague, Faculty of Science, Department of Zoology, Viničná 7, CZ-128

44, Praha 2, Czech Republic


True bugs exhibit a diversity of antipredatory strategies ranging from cryptic coloration to chemical protection advertised with conspicuous warning signals. Heteropteran defence mechanisms are often multimodal, involving (1) chemical protection and/or chemical warning signalisation by dorso-abdominal (larvae) or metathoracic (adults) scent glands secretion; (2) conspicuous aposematic (warning) coloration that consists of particular colours and patterns; (3) specific antipredatory behaviour, i.e. startling behaviour and aggregation forming; (4) warning stridulation; (5) mechanical protective devices (tough cuticle, spines, sharp cutting edges,


36

mandibular stylets). Several aposematic species may form various types of mimetic complexes. Theoretically, multimodal defensive mechanisms and warning signals may either act synergistically, or be independent and potentially effective against different predators.

Our experiments are focused on the efficiency of various defensive and signalling mechanisms in European terrestrial Heteroptera and on interspecific and intraspecific variation in behaviour of predators. Here we concentrate on a few generally important aspects for which we have gathered experimental evidence: (1) importance of a particular warning colour and pattern for recognition of aposematic true bugs by bird predators; (2) predator-dependent conception of the extent and type (within Batesian-Müllerian continuum) of mimetic complex of European red-and-black species of Pentatomomorpha; (3) effect of aggregation in Pyrrhocoris apterus (Pyrrhocoridae) on the efficiency of its warning signal; (4) function of startling behaviour in Coreus marginatus (Coreidae); (5) effect of warning stridulation in Tritomegas sexmaculatus (Cydnidae); (6) effect of major components of heteropteran defensive secretion on the reaction of bird predators.

Financial support was provided by Czech Science Foundation (project 206/07/0507).

The flower bugs found in agro-ecosystems of southern India

(Heteroptera: Anthocoridae)

Kazutaka Yamada 1, Bindu, K.2, Nasreem, A. 2, Nasser, M. 2, Ballal, C. R.3, Poorani, J. 3

1Tokushima Prefectural Museum, Japan

E-mail: [email protected]; [email protected]

2 Department of Zoology, University of Calicut, Kerala, India

3 National Bureau of Agriculturally Important Insects, Karnataka, India

The species of the family Anthocoridae have attracted the attention of researchers who work in agro-ecosystems because they include many biological control agents against major agricultural pests. In fact, Orius


37

have been studied extensively as an effective predator of serious agricultural pest, and a few species of the genus have been deliberately introduced as biocontrol agents in the world.

Since most members of anthocorid bugs, such as Orius, Wollastoniella, Montandoniola, Anthocoris, Cardiastethus, Xylocoris, etc., found in agro-ecosystems, are superficially similar to each other, it is sometimes difficult to accurately identify them. To establish modern taxonomic research for such natural enemies, adequate taxonomic study on the family Anthocoridae is very much required. The purpose of this study is to provide the useful morphological characters for accurately distinguishing the flower bug species found in the agro-ecosystems of southern India. Herein, we introduce the key characters for their identification and biological information on each species.

Leptoglossus occidentalis: worldly traveler

Richard J. Packauskas

Biological Sciences,Fort Hays State University,USA


A review of the history of Leptoglossus occidentalis, some interesting natural history, details of its invasion of Europe, and parallels to another species in the genus.

Sticky bugs on the tree: towards a molecular phylogeny of

the Harpactorini (Reduviidae: Harpactorinae)

Guanyang Zhang

Department of Entomology, University of California, Riverside, USA



38

Towards Resolving The Polyphyletic Reduviinae

(Heteroptera: Reduviidae)

Wei Song Hwang



The polyphyletic Reduviinae is one of the biggest taxonomic problem within Reduviidae. Reduviinae have been a dumping ground for ill-defined taxa and further complication was caused by diagnostic groups being raised as subfamilies. Reduviinae (145 genera, ~1100 spp.) is the second largest subfamily after Harpactorinae (~2003 spp.) and its polyphyletic nature has been confirmed by recent molecular and morphological analyses (Weirauch & Munro, 2009; Weirauch, 2008). A molecular phylogenetic analysis based on a wide sampling of Reduviinae genera is here conducted and seeks to identify monophyletic clades within Reduviinae. This will break Reduviinae into manageable groups for taxonomic revision and facilitate the future search for synapomorphic characters within each clade.

Extraordinary life history in semiaquatic bugs: case of Velia

caprai

Tomáš Ditrich 1,2,*, Papáček M. 1

1Dept. of Biology, Faculty of Education, University of South Bohemia, Jeronýmova 10, 371

15 České Budějovice, Czech Republic

2Dept. of Ecosystem Biology, Faculty of Science, University of South Bohemia, Branišovská

31, 370 05 České Budějovice, Czech Republic

*E-mail: [email protected]

Temperate semiaquatic bugs (Heteroptera: Gerromorpha) are univoltine to polyvoltine, overwintering either in an egg or adult stage. Overwintering of European Velia caprai (Heteroptera: Veliidae) was considered as adults by most studies, although two early authors supposed


39

overwintering in the egg stage. We showed that this bug regularly overwinters in both egg and adult stage, a strategy uncommon within true bugs and rare in insects generally. This species also exhibit unusual longevity - after overwintering, the adults reproduce, stay alive through season and are able to overwinter second time. Adults mate in four distinct periods - before and after first and second overwintering. A single specimen can thus successfully survive three winters - one in egg stage and two others as adult. This unique life history trait was recently confirmed also in both Central European (48°N) and Norwegian (60°N) population, and is thus probably shared through Europe. Both nymphs and adults of V. caprai colonize small forest streams and puddles, where spring floods are likely to occur. Upstream dispersal is thus necessary, as individuals (especially nymphs) are drifted downstream during floods. However, this species is predominantly apterous and an upstream movement via water is impossible through common riffles in the streams. We confirmed that V. caprai is capable of terrestrial movement and preferably disperse to the upper parts of the stream and possibly to new habitats. Terrestrial dispersion is most probably associated with low response of wings development to the environmental factors.

The research was supported by the grant MSM 6007665801.

On species diversity of true bugs from Xinjiang province,

China

Zhaohui Luo1, Vikolai N. Vinokurov2, Wanzhi Cai3, Zhaozhi Lv1

1Xinjiang Institute of Ecology and Geography, CAS, 818, South Beijing Road, Urumqi,

Xinjiang, China. Email: [email protected]

2Institute for Biological Problems of Cryolithozone SD RAS


Beijing 100193, China.

True bug is a significant component of the global insect biota, and represents an important part of the global insect fauna. Xinjiang has been chosen as the study system because in China it cover a large part of zone, and it represent an important desert landscapes. As taxa considered valid, a total of about 20,000 individuals of true bugs belonging to 23 families,


40

218 genera and 446 species were collected in Xinjiang regions during last four years, of which 1 new species was found, 3 genera and 16 species were reported from China for the first time. True bugs have exhibit morphological adaptions to their environment, making them excellent subjects for ecological and biogeographic studies.

Mitochondrial and morphological diversity in the bed bug

Cimex lectularius (Heteroptera: Cimicidae) on different hosts

Ondřej Balvín1, Jitka Vilímová2

1, 2Charles University, Faculty of Science, Department of Zoology, Vinicna 7, 128 44 Praha 2,

Czech Republic

E-mail: [email protected], [email protected]

Understanding population structure of pest organisms is important for their control. The bed bug Cimex lectularius, a blood-sucking parasite of man, has recently undergone a dramatic resurgence in developed countries. Still, its original hosts are bats. The bed bug is common in their roosts, especially in roosts of Myotis myotis in central Europe.

Partial sequences of mitochondrial genes cytochrom oxidase subunit I (658bp) and 16S ribosomal gene (382bp) were examined in 146 individuals representing 30 samples from man and 36 from bats collected in several European countries. Total 36 nucleotide sites were polymorphic and 21 haplotypes were distinguished. Almost all samples were represented by two or more individuals but only three samples showed heterozygosity. Only one haplotype was shared between populations from man and from bats. Phylogenetic analyses revealed one poorly supported clade comprising exclusively samples from bats. Results of molecular analysis suggest that populations of bed bug from man and from bats are largely mutually isolated. Pattern in geographic and host distribution of haplotypes often appeared to reflect expected relationships among collecting sites.

Morphological analysis was performed using 64 body proportions and comprehensive set of relative characters in 98 individuals from 46 samples from man and 77 individuals from 34 samples from bats. Bed bugs from bats were significantly larger in most body sizes and significantly different


41

in many relative characters as well. As example, a difference in relative width and length of legs may show an adaptation to different dispersal strategies on different hosts.

The behaviour differences between Pentatomidae and

Coreidae in tethered flight

Jianxin Cui

Henan Institute of Science and Technology, Xinxiang, Henan, China


Selected specimens in tethered flight of Halyomorpha picus (Pentatominae), Plautia fimbriata (Pentatominae) and Graphosoma rubrolineata (Podopinae), under Pentamidae (Heteroptera), compared with those of Cletus rusticus (Coreinae) and Riptortus pedestris (Alydinae), under Coreidae, have greater mean flight distance of one takeoff with longest flight journey (Udmax), and greatly less mean halts. FDPH, Flight distance per halt, as a new parameter which equalling to mean Accumulative Flight Distance devided by mean Halts, is compared among these 5 true bugs species. H. picus, P. fimbriata and G. rubrolineata, with FDPH of 1118.2, 422.0 and 244.9 respectively are more adaptive to travel long distance flight in natural enviroment when bothered, and C. rusticus and R. pedestris, with FDPH of 38.6 and 69.5, respectively, are preferred short distance in the same condition.

Fossil Heteroptera from China

Weiting Zhang, Yunzhi Yao1

1Key Lab of Insect Evolution & Environmental Changes, Capital Normal University, Beijing

100037, China


In recent years, we recorded Late Mesozoic Heteroptera from China, referring 9 families 33 genera 34 species. Among the 9 families, Rhopalidae, Vetanthocoridae, Primipentatomidae and Venicoridae


42

represent the first fossil record in the world. Miridae, Cydnidae and Pentatomidae are the oldest in geological history. Cydnidae, Ochteridae and Naucoridae represent the first fossil record from China.

The earliest known fossil Pentatomomorpha insects were found in late Triassic strata in midwest China and England. 14 families 158 genera fossil Pentatomomorpha insects have been reported. A cladistic analysis based on the combination of fossil and extant morphological characters clarified the phylogenetic status of the new family and allowed the reconstruction of the intersuperfamily and interfamily relationships of the Infraorder Pentatomomorpha. Phylogeny anaysis showed that Venicoridae locating between Aradoidea and Trichophora, may be as the direct ancestor to Trichophora. Pentatomoidea is a monophyletic group. Piesmatidae should be treated as a superfamily. In Pentatomoidea，Primipentatomidae fam. nov. locates between Urostylidae and the remaining families. Cydnidae which is a family in traditional sence may be a paraphyletic group. In Coreoidea (sensu lato), both Lygaeoidea and Idiostoloidea are monophyletic groups. Pachymeridiidae that was considered as the direct ancestor to Pachymeridiidae in the past, was classified into Idiostoloidea. Coreoidea (sensu stricto) and Pyrrhocoroidea are sister groups.

Origin time of Pentatomomorpha may be tracked back to Middle or Early Triassic，which is earlier than the existing fossil record. The center of origin located is Center Asia. Bugs underwent three times large-scale adaptive radiation during their evolution. In the fist time ocurred during Late Triassic and Early Jurassic, bugs moved from Center Asia to Europe and south Asia, arrived in Hunan province and Guangxi Zhuang Autonomous Region, China, and then went to the north, arrived in Northeast China and Nest Mongolia in the Middle Jurassic; In the second time occured during Late Jurassic and Early Cretaceous. bugs migrated in two lines: (1) Europe - Mongolia - Northeast China, (2) Europe - (North Africa) - South America - Antarctica - Australia. In the third time occured during Late Cretaceous and Palaeocene. these bugs quickly moved from Eastern Asia to Europe again, and then transferred to Greenland, and then entered into North Amarica, then divided into two lines, one line went along the east coast of North America from north to south, the other one went along the west coast of North America, eventually formed the present-day distribution patterns.

Jiulongshan and Yixian Formations of northeastern China yielded many Heteroptera fossils, which provide solid material foundation for studying the


43

role played by Heteroptera in late Mesozoic ecosystem. Heteroptera successfully utilizes enormous array of different habitats. They live under rotten wood, under soil, on trees, in the water, at the edge of water bodies and on the surface of water. Feeding types include phytophagous, predatory, and hematophagous. Their habitat diversity suggests a quite wide distribution range and a broad niche. In ecosystem, bugs lying in the middle of food chain, mainly occupy the second and the third trophic level and act as primary consumer and secondary consumer. They play an irreplaceable role in keeping the concatenation of food chain and ensuring the smooth proceeding of material cycle and energy flow.

Phylogeographic relationship among Chinese and Japanese

populations of Agriosphodrus dohrni (Hemiptera:

Reduviidae)

Hui Liu 1, Hu Li 2, Tadashi Ishikawa 3, Wanzhi Cai 2, Satoshi Kamitani 1

1Entomological Laboratory, Faculty of Agriculture, Kyushu University, Fukuoka 812-8581,

Japan. E-mail: [email protected]



31-10-18, Higashi-Jonan, Oyama, Toshigi, 323-0829 Japan

A large-sized diurnal reduviid bug, Agriosphodrus dohrni (Signoret), is distributed in South to East Asia: China, Japan, Vietnam and India. It is a potential biological control agent against some important agricultural pests. To reveal the phylogeographic relationship among populations of A. dohrni from China and Japan, we conducted phylogenetic and nested clade analyses (NCA) using three mitochondrial genes, cyt b, ND5 and COI, with specimens originated from more than ten sampling sites. We found several divergent clades of haplotypes in Chinese populations. This result was caused by an ancient vicariance. Furthermore, the largest genetic distance was observed between Shaanxi and Fujian populations, indicating genetic isolation between these regional populations. Based on these phylogeographic patterns, coupled with an assumption of molecular clock, the evolutionary history of Chinese populations was deduced. Japanese


44

populations of A. dohrni were very closely related to Henan and Shaanxi populations of China. Japanese populations consisted of only one haplotype, indicating their recent demographic expansion scenario after A. dohrni invaded into Japan, possibly from Henan Province or Shaanxi Province.

Young Heteropterists Time

The host plant identification of an new invaded lacebug,

Corythucha ciliata (Say) in China

Hongliu An, Baorong Wan, Chuanren Li*

College of Agriculture, Yangtze University, Jingzhou, Hubei 434025, P. R. China

*E-mail: [email protected]

Corythucha ciliata (Say)（Hemiptera: Tingidae）is an invasive alien species newly discovered in the continent of China, which has been a native species in the mideast of North American and has spreaded across the southern and central Europe, South Korea, Japan and Chile. It feeds on sycamore trees (Platanus spp.) and destroys the gardon landscape in urban areas in all of the invaded countries.

In the light of the contradiction between the host diversity in the originally distributional areas and the host unity in the threatened areas, and also for evaluating its damage to the botancial flora of China, we do the hostplant identification through the selective and non-selective host identification, and select Platanus sp., Broussonetia sp., chestnut and rhododendron as its potential hosts. By the observations of 2 continual generations on the habitat, feeding behavour and individual development of the lacebug in each potential plants in the network room, we find the lacebug only exhibits specific preference to Platanus sp., which could lure the adults to feed and lay eggs, and could allow the egg and nymph to developped normally. However, the lacebug can occasionally rest on the other three kinds of plants, they seem non-selective to those trees even in a high population density. Feeding the 2nd instar nymphs, 4th instar nymphs and adults on the young leaves of the four kinds of plants in


45

laboratory, we can conclude that the bugs on sycamore leaves can feed, grow and lay eggs, but the bugs on the other three plants can’t feed on plant leaves and die within 3 days with the dead worms shriveled. In conclusion, Broussonnetia sp., chestnut and rhododendron of China is not the hosts of the invaded species Corythucha ciliata (Say).

Key words Corythucha ciliata (Say), hostplant, identification

The complete mitochondrial genome of assassin bug

Agriosphodrus dohrni (Hemiptera: Reduviidae): Sequence,

gene organization and comparison with other reduviids

Hu Li 1, Jianyu Gao 1, Haiyu Liu 1, Hui Liu 1, Aiping Liang 2, Wanzhi Cai 1,*



2 Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese

Academy of Sciences, Beijing 100101, China

*corresponding author, E-mail: [email protected]

The sequence of the mitochondrial DNA (mtDNA) of the assassin bug Agriosphodrus dohrni from the reduviid subfamily Harpactorinae has been completed. The molecule is 16, 470 bp in length with an A+T content of 72.2%, contains the typical 13 protein–coding, 22 tRNAs, two ribosomal RNAs and a control region. Comparison of this sequence with the other two completely sequenced reduviid mtDNAs (Triatoma dimidiata and Valentia hoffmanni) showed that gene order and orientation are identical to the ancestral arrangement, and nucleotide composition, codon usage, and amino acid composition are very similar, which show a much higher bias towards A+T. All protein–coding genes use standard initiation codons (methionine and isoleucine), except ND1 starts with GTG. All tRNAs have the typical clover-leaf structure, except the dihydrouridine (DHU) arm of tRNASer(AGN) forms a simple loop. Comparisons of secondary structures of the two mitochondrial ribosomal subunits showed that the sequence and structure of rrnL is more conservative than that of rrnS in the sequenced assassin bugs.


46

The control region or the A+T–rich region is located in the conserved position between rrnS and tRNAIle- tRNAGln- tRNAMet gene cluster. The A+T content of this region is almost the lowest in the mitochondrial genome and can be divided into four parts: (1) a 410 bp region that is bordered by rrnS and a conserved region, of which the G+C content (43.4%) is higher than the whole genome; (2) a 188 bp region heavily biased toward A+T (79.2%), including a 33 bp conserved region at the beginning; (3) a region composed of six long tandem repeats; (4) the remainder of the control region. The highly conserved sequence block with the G element in the end existed in the control region of the three sequenced assassin bugs, and this might lead to investigations of their involvement in insect replication and potentially transcription initiation.

Phylogenetic Analysis of Heteroptera (Insecta: Hemiptera)

Based on the Homeotic Genes

Min Li (J)1, Jing Wang, Xiaoxuan Tian, Yang Liu, Haoyang Wu, Qiang Xie, Wenjun Bu

Insect Molecular Systematic Lab, Institute of Entomology, College of Life Science, Nankai

University, No. 94 Weijin Road, 300071, Tianjin, China


Heteroptera is one suborder of Hemiptera with the most diversified bodyshapes, and consists of 7 infraorders. The phylogenetic relationships among the 7 infraorders are still in dispute. We present a molecular phylogenetic investigation of these infraorders, with 28 taxa sampled. Five Hox genes, with a total length of 3kb, were used as molecular markers. Manual alignment was performed using the program MEGA V3.1. Data partitions were analyzed separately and in combination, by employing ML (maximum likelihood) and MP (maximum parsimony). In this report, a preliminary result was given and the synapomorphies in Hox sequences of Gerromorpha and Nepomorpha were listed.


47

The complete mitochondrial genome of damsel bug

Alloeorhynchus bakeri (Hemiptera: Nabidae)

Haiyu Liu, Hu Li, Jianyu Gao, Liangming Cao, Wanzhi Cai*

Department of Entomology, China Agricultural University, Yuanmingyuan West Road,


*corresponding author, E-mail: [email protected]

The first complete sequence of the mitochondrial DNA (mtDNA) of damsel bug Alloeorhynchus bakeri, has been completed and annotated in this study. The circular genome is 15, 851 bp in length with an A+T content of 73.5%, contains typical 37 genes that arranged in the same order as that of the putative ancestor of hexapods. Nucleotide composition and codon usage are near the means observed in other insect mitochondria sequenced to date. All protein-coding genes use standard initiation codons (methionine and isoleucine), except COI started with TTG. Canonical TAA and TAG termination codons are found in eight protein-coding genes, the remaining five (COI, COII, COIII, ND5, ND1) have incomplete termination codons (T or TA). Protein-coding genes of two strands present opposite CG-skew trends which is also reflected by the nucleotide composition and codon usage. Analysis of base composition at each codon position of the concatenated 13 PCGs showed that the third codon position (81.2%) was higher in A+T content than the first (68.5%) and second (66.3%) codon positions. All tRNAs have the typical clover-leaf structure, except the dihydrouridine (DHU) arm of tRNASer(AGN) forms a simple loop as seen in many other metazoa. Secondary structure models of the ribosomal RNA genes of A. bakeri are presented and are similar to those proposed for other insect orders. There are 6 domains, 45 helices and 3 domains, 27 helices in the secondary structures of rrnL and rrnS, respectively. The 1312 bp control region of A. bakeri was observed in the conserved location between the small ribosomal subunit and the tRNAIle gene and was composed of 75.7% A+T content, which was the most A+T-rich region of the mt-genome. It can be divided into four parts: (1) a 533 bp region that is bordered by rrnS, of which the G+C content (33.2%) is higher than the whole genome, and at the beginning of this region contains two 21 bp C-rich repetitive sequences (TCCCCCCTCCGGTGGTCGCTA); (2) a 39 bp region heavily biased toward A+T (89.7%); (3) a region composed of five


48

tandem repeats; (4) a region at the end of control region containing 4 potential stem-loop structures, the largest one with a stem of 20 bp and 21 bp loop.

Systematics, phylogeny and biogeography of the plant bug

tribes Monaloniini and Odoniellini.

Anna A. Namyatova

Saint-Petersburg State University, 199034, Saint-Petersburg, Russia


The tribes Monaloniini and Odoniellini are closely related groups within the subfamily Bryocorinae (Insecta: Heteroptera: Miridae) and currently comprise more than 250 species, mostly distributed in the Ethiopian, Oriental and Australasian regions. Monaloniini and Odoniellini were first erected by Reuter in 1892 and 1910 respectfully as divisions and since that 41 genera were described within the groups. The systematics, biogeography and host plant associations of these tribes are poorly known mostly due to limited existing collections. Some genera within the groups have never been revised and many species await description. Some representatives of the tribes are serious pests on economic crops and study of their biology is very important among the other problems. Also genus Felisacus Distant, 1904 which is, probably, represents the separate tribe has never been revised. The study will be based on the collection of Australian Museum and many European and North American collections. The work will be focused primarily on the phylogenetic analysis, including molecular data, the revision of the tribes, host plant associations of selected clades, and construction of the key for all genera.


49

The Mitochondrial Genome of Hackeriella veitchi (Hacker)

(Hemiptera: Coleorrhyncha) and Mitochondrial Phylogeny of

Hemiptera (Insecta: Paraneoptera)

Qiang Xie1†, Ying Cui1†, Jimeng Hua1†, Xin Yu1, Jianfu Zhou2, Jürgen Deckert3, Ming Li1, Pengzhi Dong1, Wenjun Bu1*

1Institute of Entomology, College of Life Sciences, Nankai University, 94 Weijin Road,

Tianjin, 300071, China

2College of Information Technical Science, Nankai University, 94 Weijin Road, Tianjin,

300071, China

3Humboldt-Universität zu Berlin, Museum für Naturkunde, Institut für Systematische

Zoologie, Invalidenstrasse 43, 10115 Berlin, Germany

†These authors contributed equally to this work

*Corresponding author: Wenjun Bu, e-mail: [email protected], Tel:

0086-22-23498957, Fax: 0086-22-23498957

The complete mitochondrial genome of Hackeriella veitchi (Hacker) (Hemiptera: Clypeorrhyncha) was firstly sequenced. The genome was a circular molecule of 15,793 bp containing the typical 37 genes that arranged in the same order as that of the typical hexapods mitochondrial genomes. Several neighbor genes overlap were observed. Especially ATP6/ ATP8 and ND4/ND4L overlap seven nucleotides ATGNTAA which was commonly observed in Hemiptera. 12 of the 13 protein coding genes used the usual initiation codons (ATA, ATG and ATT) while CO1 initiated with TCG. And two termination codons (TAA and T-tRNA) were used. 20 of the 22 tRNAs could be folded into typical secondary structure while the DHU arm was replaced with a simple loop in tRNASer(GCT) and tRNAArg.

The disputes about hemipteran phylogeny focus on the relationships between the suborders Archaeorrhyncha, Clypeorrhyncha and Prosorrhyncha (Coleorrhyncha + Heteroptera). In this study, twenty-six species of hemipterans were sampled. All of the nucleotide sequences of the protein coding genes and the amino acid sequences they code were used to infer the phylogeny of Hemiptera. Bayesian and maximum likelihood method were used in the analyses. The result supports that


50

Clypeorrhyncha rather than Archaeorrhyncha has more close relationship to Prosorrhyncha. But in the phylogeny of Heteroptera, it is hard to determine the relationships among them and the questioned monophylum of Nepomorpha. Mybe they were influenced by the density of sampling or/and lacking the mitochondrial data of Eniocephalomorpha, Dipsocoromorpha. Now obtained more mitochondrial data about Eniocephalomorpha, Dipsocoromorpha and other heteropteran infraorders are working. Then the phylongeny of Heteroptera may be well analyzed.

Research on the secondary structure of LSU nrRNA (28S) of

Hemiptera (Hexapoda: Insecta)

Ying Wang1, Yanhui Wang, Qiang Xie, Wenjun Bu

Insect Molecular Systematic Lab, Institute of Entomology, College of Life Science, Nankai

University, No. 94 Weijin Road, 300071, Tianjin, China


The LSU nrDNA (28S) is one of the most frequently sequenced molecular markers in phylogenetic studies. However, the lengths of certain regions in this gene are not conservative among different groups and sometimes the difference can be huge. We call these length variations as length variable regions or LVR for short. These variable regions can affect the accuracy of alignment. This phenomenon makes alignment a serious problem in Hemiptera. So it is necessary to get a more clear recognition of the distribution of variable regions in Hemiptera. That is to say, we must clarify the secondary structure of LSU nrRNA (28S) of Hemiptera.


51

Poster Presentation (List alphabetically, according to

first author's family name)

Assassins exposed: phylogeny and biogeography of new

species of bee killers, genus Apiomerus (Hemiptera:

Reduviidae)

Lily Berniker



True bugs of the new world genus Apiomerus Hahn 1831 (Hemiptera: Reduviidae: Harpactorinae), commonly known as bee killers or bee assassins, are extremely abundant and morphologically diverse. Despite this, to date only 105 species have been described of the more than 200 that are estimated to exist. Eight species groups have been proposed for the North and Central American fauna, and two of these groups, the pictipes and crassipes have been proposed as sister taxa (Szerlip 1980). The monophyly of these two groups, as well as their sister group relationship, is tested and a species level phylogeny is presented. This phylogeny is used to explore biogeographical patterns exhibited by members of the two groups.

A morphological study on fine structure of adult

metathoracic scent glands in Lygaeoidea (Hemiptera:

Heteroptera: Pentatomomorpha)

Bo Cai1, Xueqin Shi, Cuiqing Gao, Wenjun Bu

Institute of Entomology, College of Life Science, Nankai University, Tianjin 300071, China



52

We studied the cuticular structures of the adult metathoracic scent glands (MTGs) in Lygaeoidea. 97 species from 86 genera, 13 families of Lygaeoidea were examined by Scanning Electrom Microscope (SEM). The extent of evaporatorium, the shape of peritreme, the fine structure of the apex of peritreme, and the microsculpture of mushroom bodies were observed and analyzed. The morophology and function of these characters were discussed.

Miscellanea Miridologica. II.

New combinations and new synonymies in the subfamily

Mirinae

Chérot F. 1, 2 Costa, L.3, Touchet, M. 4

1 Département de l’Etude du Milieu naturel et agricole, DGO3 Agriculture, Ressources

naturelles et Environnement, Service public de Wallonie, 23 avenue Maréchal Juin, B-5030

Gembloux. Belgique. U.E. E-mail: [email protected]

2 Université Libre de Bruxelles, Laboratoire de Systématique et d’Ecologie animales, cp

160/13, Av. F.D. Roosevelt, 50. 1050 Bruxelles. Belgique. U.E.

3Museu Nacional, Quinta da Boa Vista, Rio de Janeiro 20940-040, Rio de Janeiro, Brazil.

4Systematic Entomology Laboratory, ARS, USDA, National Museum of Natural History,

Smithsonian Institution, MRC-0168, P.O. Box 3712, Washington DC 20013-7012, United

States of America.

Study of type material and additional specimens of several poorly known species of the nominal tribe Mirini (Insecta, Heteroptera, Miridae, Mirinae) preserved in collections the National Museum of Natural History, Washington D.C and the Museu Nacional, Rio de Janeiro, revealed a number of taxonomic problems and potential new synonymies.

Because a poster and the corresponding abstract is not considered published works according to Article 9.9 of the International Code of Zoological Nomenclature and because additional specimens of analyzed taxa are need for us to be certain of our tentative conclusions:


53

(1) We provide only a preliminary short discussion of potential new synonymies before their formal publication. Not any nomenclatorial act in the present work should be deemed as available;

(2) We make a call to the heteropterists for additional specimens of both sexes of the analyzed species. We would appreciate if entomologists having specimens of these taxa in their collections could contact the first author to arrange loan and possibly join our project.

The following nomenclatural changes are suggested:

Synonymies: Guianella CARVALHO, 1946 = Boliviomiris CARVALHO, 1987 (new subjective junior synonym) = Pilosicerus CARVALHO, 1992 (new subjective junior synonym).

Guianella pilosa MALDONADO & CARVALHO, 1981 (valid name) = Guianella antennalis (CARVALHO, 1987) (new subjective junior synonym) = Guianella rondoniensis (CARVALHO, 1992) (new subjective junior synonym).

Urucuiana CARVALHO & ROSAS, 1965 = Bahiamiris CARVALHO, 1975 (new subjective junior synonym), Urucuiana tuberculata CARVALHO & ROSAS, 1965 (valid name) = Urucuiana cajabiana (CARVALHO, 1977) (new subjective junior synonym).

New combinations: Guianella antennalis (new combination), Guianella rondoniensis (CARVALHO, 1992) (new combination), Urucuiana cajabiana (CARVALHO, 1975) (new combination), U. rubrornata (CARVALHO, 1975) (new combination).

Urucuiana tuberculata is quoted from French Guyana for the first time.

Exotic species of Aradidae and Miridae recently found in

Antwerp harbour

Chérot, F. 1, 2, Aukema B3, Bruers J.4 , Viskens G.4

1Département de l’Etude du Milieu naturel et agricole, DGO3 Agriculture, Ressources

naturelles et Environnement, Service public de Wallonie, 23 avenue Maréchal Juin, B-5030

Gembloux. Belgique. U.E. E-mail: [email protected]


54

2Université Libre de Bruxelles, Laboratoire de Systématique et d’Ecologie animales, cp

160/13, Av. F.D. Roosevelt, 50. 1050 Bruxelles. Belgique. U.E. E-mail: [email protected]

(Author for correspondence)

3Zoölogisch Museum, Afdeling Entomologie, Plantage Middenlaan 64, 1018 DH Ansterdam,

Nederland.E-mail: [email protected]

4Koninklijk Instituut voor Natuurwetenschappen, Afdeling Entomologie, Vautierstraat 29,

1000 Brussel. E-mail: [email protected]

Three exotic species of True Bugs (Insecta, Heteroptera) were recently found on trunks from Central Africa stored in Antwerp, the largest Belgian maritime harbour and the 17th largest in the world: Neuroctenus lestoni KORMILEV, 1966 (Aradidae), Fulvius anthocoroides (REUTER, 1875) and Fulvius subnitens (POPPIUS, 1909) (both Miridae, Cylapinae). Several data on taxonomy and World-scale distribution of these species are provided.

A Revision of Afrotropical, Oriental and Palaearctic species

of the genus Sirthenea SPINOLA (Heteroptera: Reduviidae,

Peiratinae)

Dominik Chłond1, Wanzhi Cai2

1University of Silesia, Faculty of Biology and Environmental Protection, Department of

Zoology, ul. Bankowa 9, 40-007 Katowice, Poland





Sirthenea Spinola, 1840 is one of the largest genus within the subfamily Peiratinae known from almost all zoogeographical regions. So far 11 species and one subgenus Monogmus Horváth, 1909 (distributed exclusively on Madagascar) are known from the Afrotopical Region: S. (S.) africana Distant, 1903; S. (S.) angolana Villiers, 1958; S. (M.) atrocyanea Horváth, 1909; S. (S.) bequaerti Schouteden, 1913; S. (S.) collarti Schouteden, 1931; S. (S.) flaviceps (Signoret, 1860); S. (S.) leonina


55

Horváth, 1909; S. (S.) leontovitchi Schouteden, 1931; S. (M.) picescens Reuter, 1887; S. (S.) rapax Horváth, 1909 and S. (S.) rodhaini Schouteden, 1913. In the Oriental Region 9 species have been recorded so far: S. (S.) bharati Sucheta & Chopra, 1988; S. (S.) caiana Chłond, 2008, S. (S.) clavata Miller, 1948; S. (S.) dimidiata Horváth, 1911; S. (S.) flavipes (Stål, 1855); S. (S.) nigra Cai & Tomokuni, 2004; S. (S.) nigripes Murugan & Livingstone, 1990; S. (S.) nigronitens (Miller, 1958) and S. (S.) nitida Chłond, 2008. 3 species are distributed in Palaearctic Region: S. (S.) flavipes (Stål, 1855); S. (S.) koreana Lee & Kerzhner, 1996 and S. (S.) melanota Cai & Lu, 1990, but only species from New World (Willemse, 1985) and China (Cai & Lu, 1990) have been revised so far. There are no detailed descriptions of morphology and informations about distribution and biology as well as a key helping to identify all species from the mentioned zoogeographical regions. The aim of the project is a revision of Afrotropical, Oriental and Palaearctic species of the genus Sirthenea on the basis of morphological characters as well as structures of the male and female external reproductive system.

Notes on biology of Platymeris rhadamanthus Gerstaecker,

1873 (Heteroptera: Reduviidae: Reduviinae)

Dominik Chłond1, Łukasz Junkiert2, Krzysztof Musik3

1University of Silesia, Faculty of Biology and Environmental Protection, Department of

Zoology, ul. Bankowa 9, 40-007 Katowice, Poland. E-mail: [email protected]; [email protected]; [email protected]

The genus Platymeris was established by Laporte in 1833 and with 13 described species is a medium-sized genus belonging to the subfamily Reduviinae. All known species of these assassin bugs are large-sized insects, distributed exclusively in Africa, but there is no information about their biology. Lack of these data and possibility of breeding of P. rhadamanthus Gerstaecker in our laboratory allowed to study the life history of this species. Our studies provides both an information about bionomy of P. rhadamanthus as well as a detailed descriptions and illustrations of its nymphs which is helping to identify the nymph of each instar. During the studies important biological behaviours e.g. predatory behaviour of adults and nymphs, mating, oviposition or canibalism were also observed.


56

World Catalogue of the Coreidae

Bill Dolling, Laurence Livermore, Mick Webb1

The Natural History Museum, UK


The production and progress of a new taxonomic catalogue on Coreidae (Hemiptera: Heteroptera) is discussed. The catalogue is being constructed using an online database and website (Species File) which will be used to generate a printed version. Digital images of the type specimens from major collections are being taken to produce a comprehensive, freely available, e-taxonomy resource.

Resin Gathering In Neotropical Resin Bugs (Hemiptera:

Reduviidae: Apiomerini): Functional And Comparative

Morphology

Dimitri Forero, Dong Hwan Choe, Christiane Weirauch



Apiomerini (Reduviidae: Harpactorinae) are often referred to as resin bugs because of their attraction to plant resins. They collect resins with their forelegs and use these sticky substances for prey capture or maternal care. The morphological structures involved in resin gathering, transfer, and storage remain virtually undocumented. We document these structures in Apiomerus flaviventris and relate them to resin gathering behaviors. To place them in a comparative context, we describe and document leg and abdominal structures in 14 additional species of Apiomerini that represent all but one of the 12 Recent genera in the tribe. Based on these morphological data in combination with the behavioral observations on A. flaviventris, we infer behavioral and functional hypotheses for the remaining genera within the tribe Apiomerini.


57

The nomenclature of the structures forming the external

scent efferent system in Pentatomoidea (Heteroptera)

Petr Kment1, Jitka Vilímová2

1Department of Entomology, National Museum, Kunratice 1, CZ-148 00 Praha 4, Czech

Republic. E-mail: [email protected]

2Charles University in Prague, Faculty of Science, Department of Zoology, Viničná 7,

CZ-128 44 Praha 2, Czech Republic. E-mail: [email protected]

The occurrence of a unique combination of adult metathoracic scent glands (= MTGs) and larval dorso-abdominal scent glands represents an autapomorphy of the Heteroptera, distinguishing them from the remaining Hemiptera. Despite these features have rather limited usage in hypotheses about the phylogenetic relationships among pentatomoidean families (cf. Kment & Vilímová 2010: Zootaxa 2363: 1–59), they are very useful characters for taxonomy and phylogeny on lower ranks, especially among genus-group taxa. Based on an extensive review of the terminology used by previous authors, the following most appropriate basic terms are selected and generally suggested for description of the macrostructure and microsculpture of the MTGs:

The metathoracic scent apparatus consists of internal parts (i.e., principal scent glands, ducts of the principal scent glands, reservoirs, and lateral ducts of reservoir ending apically with valvular apparatus), and the thoracic scent efferent system. This is divided into the internal scent efferent system situated in metathorax and consisting of an internal orifice and a vestibule opening externally as ostiole, and the external scent efferent system which begins with an ostiole. Ostiole is a simple opening of variable shape (round, oval, guttiform, or slit-like) issuing on the metapleural surface in one plane approximately between the meso- and metacoxae. The ostiole delivers the MTG secretion out on the external surface of pleuron; it could be modified as an ostiolar groove opening in two planes (Tessaratomidae s. str.) or accompanied by dish-like periostiolar depression.

The peritreme is a variously shaped area of macroscopically smooth cuticle with a characteristic microsculpture (peritremal surface), which extends from the ostiole laterad and differs from the surrounding


58

evaporatorium. The peritremal surface is usually elevated above the surrounding pleuron or associated with variously shaped projections; the following basic shapes of the peritreme can be distinguished: auricle (p. ear-shaped, usually short, peritremal surface parallel with surrounding pleuron, only slightly elevated), spout (projection with peritremal surface perpendicular or oblique to pleuron surface, rarely parallel, always distinctly elevated above surrounding pleuron, rather short), groove (p. narrow and usually long, peritremal surface parallel to surrounding pleuron, median furrow well developed in most of its length, apex usually rounded), ruga (p. narrow and usually long, peritremal surface parallel to surrounding pleuron, median furrow short, developed only basally, apical half or more of the length ridge-shaped, apex usually pointed), disc (variously shaped disc widening laterad, peritremal surface parallel with surrounding pleuron and only slightly elevated above it, median furrow usually obsolete), and peritremal lobes (swollen anterior and posterior margins (lobes) of a slit-like ostiolar groove; Tessaratomidae s. str.).

The evaporatorium is a dull area of a characteristic microsculpture consisting of mushroom bodies (i.e. mycoid surface) surrounding the ostiole and the peritremal surface; its surface should be enlarged by gyrification. The mycoid surface is also developed on internal surface of the vestibule. The lustrous peritremal surface is never covered by mushroom bodies, its microsculpture is scale-like, thorn-like, hairy, wrinkled, or nearly smooth. The peritremal surface originates inside the metafurca and continues through the vestibule towards the ostiole and prolongs on variously shaped peritreme.

Lygaeoidea of Indonesia and neighbouring regions

Elod Kondorosy

University of Pannonia, Georgikon Faculty, Keszthely, Hungary


The Lygaeoidea fauna of the Indonesian Archipelago and the nearby territories was studied (except Colobathristidae).

The following regions were separately examined: Malaya (continental part of Malaysia); Sumatra and neighbouring islands (as Mentawai, Belitung etc.); Java (with Bali, Christmas and Cocos Islands); Kalimantan;


59

Lesser Sunda Islands (from Lombok to Timor); Sulawesi; Moluccas (Maluku, Ceram, Aru etc. islands); New Guinea (with neighbouring islands, as Biak, Waigeo, Salawati, Misool) and Solomons (with Bismarck and Louisiade Islands). Lygaeoidea fauna of these islands were compared with Philippines, Australian continent and New Caledonia and New Hebrides. In this work the fauna of the Asian continent and other Pacific islands were not covered.

After collecting all published faunistic data the unidentified material from several European museums was studied. A lot of new distributional records were found with many new species and genera. In this study some lygaeoid groups (Berytidae, Orsillinae, Heterogastridae, Plinthisini, Antillocorini and Myodochini) were examined only from the previously published data.

The aim of the study was to investigate how well-known the Lygaeoidea of these regions are, how great the percentage of endemic species is and to decide which subregion belongs to the Oriental or to the Australian Region depending on the range of Lygaeoidea.

In the above mentioned material I found 83 undescribed species (among them 41 belong to rhyparochromid tribe Drymini) and 26 undescribed genera. 50 previously described species were found in new subregions (altogether in 77 new areas).

The most researched areas seem to be Australia and the Philippines, followed by the Solomon Islands, New Caledonia and Moluccas – perhaps because of the museum material examined was rather poor. Most of the new species were found among the true bugs from Sulawesi – thanks to investigation of the rich material deposited in the museums of London and Leiden. Among the Indonesian islands the most researched is Kalimantan.

Not more than 50 % of the species are endemic with the exception of Australia, New Guinea and New Caledonia. Among the Indonesian regions Sulawesi Island is the richest in endemic species with more than 40% of the Lygaeoidea fauna. The percentage of endemic species is lowest in Malaya, about 15 %.

Among the regions with questionable zoogeographical position in the Lesser Sunda Islands 23 species are known. 5 of them are located in the area between these islands and Australia or Pacific islands, 7 between these islands and Asian continent or Greater Sunda Islands. Among the 58


60

species known in Sulawesi 4 are spread in eastern direction to Australia or New Guinea, 15 to the west to Asian continent or Greater Sunda Islands. The Moluccas region has 42 known species, from which 6 are present only here and in Australia, 7 are common with New Guinea, and 3 species have only Oriental connections.

To sum it up, the Oriental connection of Sulawesi is much stronger than the Australian. The Lesser Sunda Islands are slightly more closely related to the Oriental region, while the Moluccas clearly belong to the Pacific region based on investigation of the Lygaeoidea fauna.

The aquatic and semiaquatic Heteroptera (Hemiptera) from

Argentina

María Cecilia Melo

Departamento Sistemática, Instituto de Limnologia “R.A. Ringuelet” (ILPLA), CCT La Plata

CONICET- UNLP. Av. Calchaquí km 23.5, ex Lab. YPF, (1888) Florencio Varela, Buenos

Aires, Argentina


Of the seven infraorders included in the suborder Heteroptera, only three comprise species that live over, within or near water bodies: Gerromorpha, Nepomorpha, and Leptopodomorpha. Most of the species in these groups are predators, and the family Corixidae also includes detritivores and microphagous scavengers.

The aquatic and semiaquatic Heteroptera inhabit all the continents except Antarctica, and are most diverse in the Neotropical and Oriental regions. They are especially abundant in tropical areas, although many genera are well adapted to cold climates, especially those of the families Saldidae and Corixidae.

In Argentina, this group of Heteroptera is not very diverse, although most of the families are represented by at least one species. The last formal checklist of the Gerromorpha and Nepomorpha from Argentina was published by Bachmann (1998) and contained 173 recorded species. After a thorough bibliographical review, my newest list contains 214 species (including the family Saldidae).


61

The following families have been recorded from Argentina: Belostomatidae (33 species), Corixidae (35 species), Gelastocoridae (11 species), Gerridae (18 species), Hebridae (3 species), Helotrephidae (2 species), Hydrometridae (4 species), Mesoveliidae (2 species), Naucoridae (32 species), Nepidae (15 species), Notonectidae (21 species), Ochteridae (1 species), Pleidae (5 species), Potamocoridae (1 species), Saldidae (6 species), and Veliidae (25 species).

Herein I give an account of the diversity of the aquatic and semiaquatic Heteroptera from Argentina, including biogeographic considerations, especially regarding endemic taxa.

Analysis of pentatomid and coreid feeding behavior using

electrical penetration graph techniques

Paula Levin Mitchell, Samuel Bernell Cooke, Sarah Elizabeth Johnson

Department of Biology, Winthrop University, Rock Hill, SC 29733, USA


Electrical penetration graph (EPG) techniques allow the recording of piercing-sucking feeding behaviors inside plant tissues. The insect and the plant material are incorporated into a simple electrical circuit with a voltage source and an input resistor, and voltage changes in the form of waveform output are correlated with ingestion and salivation behaviors in various target tissues. Systems using both AC and DC circuitry were initially developed for the study of aphid feeding, but have been applied successfully to various small insects, including other Sternorrhyncha (whiteflies, psyllids) as well as cicadellids, planthoppers, and spittlebugs. However, EPG studies of Heteroptera have been few, and published research to date has involved only the early developmental stages. Here we present results from EPG trials of Nezara viridula (L.) (Hemiptera: Pentatomidae) and Leptoglossus phyllopus (L.) (Hemiptera: Coreidae) using a newly developed AC-DC monitor (Bennett Electronics, Columbia, MO, USA) and WinDaq® software (Dataq Instruments, Akron, OH, USA).

Recordings of fifth instar N. viridula were used to compare feeding behavior on stems and pods of soybean, Glycine max L. (Merrill). Three waveform types (A, B, C) and two subtypes (B1, B2) have been identified


62

using AC circuitry; subtype B2 is associated exclusively with pod feeding and preliminary data indicate that B1 correlates with probes to xylem. In 9-h trials, significantly more time per insect was spent probing full bean pods than stem; duration of waveform B per insect was similarly extended, and duration per probe was longer on full pods. Full bean pod and pre-fill pods both differed significantly from stems in having a longer duration of waveform subtype B1 per probe.

Feeding by L. phyllopus third through fifth instars and adult males was monitored on pods of green bean (Phaseolus vulgaris L.) to determine if probing behaviors differed among developmental stages. Frequency and duration of feeding per insect, duration per probe, time until first probe, and length of pathway of each probe were compared in 9-h trials. Pathway measures the time spent moving the mouthparts through plant tissue to locate the feeding site. Feeding behaviors of third, fourth, and fifth instar nymphs and adult males on green beans were analyzed. Significant differences were found between juveniles and adults for probe frequency, time until first probe, and length of pathway, indicating that adults probe more frequently, begin feeding sooner, and locate the target tissue faster than nymphs.

Additional correlation analyses and comparisons of waveform types between the two species are in progress. A better understanding of heteropteran waveforms will allow EPG monitoring to be used as a potential tool for host plant resistance surveys and perhaps in studies of pathogen transmission.

True bug species diversity (Insecta, Heteroptera) of

Kellerwald-Edersee National Park (Germany): results of a

four-year initial survey

Carsten Morkel

Bartholomäusstrasse 24, 37688 Beverungen, Germany. www.umweltgutachten.com


Background


63

Kellerwald-Edersee National Park in the state of Hesse represents the largest Luzulo-Fagetum beech grove complex of Central Europe. Unique for its specific geology, revealing clay slate and greywacke as major rock types, the submountainous area contains small patches of primeval forest, which have always been without any forestry use.1 Dominated by deciduous beech and oak forest, additional habitats include coniferous forest, clearings, shrubs, pioneer forest, forest glades, meadows, heaths, springs, creeks, marshes, rocks and boulder fields. Since declared national park in 2004, the fauna of Heteroptera is evaluated to document its current status of biodiversity 2.

Material and Methods

Between 2005 and 2009, selected sites within the 57 km² area were investigated by the author. More than 50 field trips were conducted, covering all main habitat sets. Sampling methods included selective search and the use of sweep and aquatic nets as well as beating and brushing equipment. Additional material was obtained from pitfall and flight-interception traps.

Results

Altogether, 294 species of true bugs were discovered within Kellerwald-Edersee National Park, including several new state records and one new country record. Figure 1 displays species diversity within habitat sets, including the amount of species exclusively found within a given habitat set.


64

Fig. 1: True bug species numbers of habitat sets within Kellerwald-Edersee National Park.

Among typical habitat representatives documented to occur within all habitat sets except for rocks and bolders, locally or supra-regionally remarkable species, leading to comparatively high species diversity, were identified as follows: Old growth deciduous forest and forest glades contain Acalypta musci, Physatocheila costata, Loricula distinguenda, L. exilis, L. ruficeps, Phytocoris hirsutulus and Pinthaeus sanguinipes. The primeval forest relict Aradus serbicus was recorded for the first time for Germany 3. Most remarkable within pioneer forest, shrubs and clearings are Physatocheila smreczynskii, Deraeocoris olivaceus, D. trifasciatus, Globiceps sphaegiformis, Psallus falleni, P. montanus and Rhynocoris annulatus.

Dwellers of anthropogenic, coniferous forest including pine, spruce, larch and fir are Parapsallus vitellinus, Dichrooscytus intermedius, D. rufipennis, Orthotylus fuscescens, Deraeocoris annulipes and Psallus lepidus. Species of springs, creeks and ponds are Cryptostemma alienum and the boreomontane Saldula c-album, both inhabiting the gravel banks of wild creeks. Marshes and swamps contain Dictyla convergens, Tytthus

45

25

159 9

52

57

54

24

48

66

0

27 0

1

37

0

20

40

60

80

100

120

Semi-natural &Old-growth Forest

Forest Glades

ShrubsPioneer Forest

Clearings

Anthropogenic,coniferous

Forest

RocksBolders

SpringsCreeksPonds

MarshesSwamps

MeadowsPasturesFallows

ThermophilousGrassland &

Heath

Habitat set

Sp

eci

es

(n)

Recorded in at least one additional habitat set

Recorded exclusively within habitat set


65

pygmaeus, Rhopalus maculatus, Eurydema dominulus and Rhacognathus punctatus. Meadows, pastures and fallows are mainly colonized by eurytopic species, but also contain Europiella alpina, Macrotylus solitarius, Pachytomella parallela and Pithanus maerkelii as remarkable representatives. Thermophilous grassland and heath are inhabited by Acetropis carinata, Strongylocoris luridus, Gampsocoris punctipes, Drymus pilicornis, Geocoris grylloides, Ischnocoris angustulus, Macrodema microptera, Megalonotus dilatatus, M. hirsutus, Nysius helveticus, Ceraleptus lividus, Enoplops scapha, Gonocerus juniperi, Aelia klugii, Chlorochroa juniperina and Sciocoris umbrinus.

Conclusion

Heteropteran species diversity of Kellerwald-Edersee National Park appears higher than expected. Among a subset of remarkable, endangered or rarely found true bugs, one species is representing a primeval forest relict within Central Europe. The number of species already documented is estimated >90%, with up to 30 additional taxa expected to occur in the area at present. Subsequent research should complete the documentation of the area´s true bug community, monitor changes of heteropteran assemblages within habitats based on quantitative data and study the ecology of selected species.

References

1) Delpho, M. & W. Lübcke, 2007: In the kingdom of quaint beeches. 128 pp. Cognitio, Niedenstein

2) Nationalparkamt Kellerwald-Edersee, 2009: Nationalparkplan für den Nationalpark Kellerwald-Edersee. Cognitio, Niedenstein

3) Morkel, C., in prep.: First records of Heterotoma merioptera (SCOPOLI, 1763) and Aradus serbicus (HORVÁTH, 1888) (Heteroptera: Miridae et Aradidae) from Germany This contribution is supported by the administration of

Kellerwald-Edersee National Park.


66

Review of the genus Globiceps Le Peletier & Serville, 1825

(Heteroptera: Miridae)

Anna A. Namyatova

Saint-Petersburg State University, 199034, Saint-Petersburg, Russia


The genus Globiceps is a purely palaearctic and highly polymorphic group currently including 26 species. Most of the papers concerning the genus include only descriptions and diagnoses for one or two species. The only key for most of the species was provided by Wagner in 1974 and after that seven new species were described by different authors. The preparation of workable keys and diagnoses are complicated as considerable polymorphism in external characters and genitalia structures leads to difficulties in distinguishing of species. Three subgenera currently exist within the group with one of them having unclear diagnosis. In the present communication diagnoses for two distinct subgenera and 23 valid species, including new one are discussed. Reliable distinctions were found mostly in external view and paramere structure. Also one subgenus and several species are considered as junior synonyms.

The genus Weberiella De Carlo, 1966 (Insecta: Heteroptera:

Belostomatidae) revisited: new considerations of

back-brooding behavior in Belostomatinae

José Ricardo Inacio Ribeiro1, Ana Lia Estévez, Alan Lane de Melo

1Campus São Gabriel, Ciências Biológicas, Universidade Federal do Pampa, Brazil


Belostomatinae sensu Lauck & Menke includes the genera Abedus Stål, Belostoma Latreille, Diplonychus Laporte, Hydrocyrius Spinola, and Limnogeton Mayr. Male giant water bugs of Belostomatinae brood eggs attached to their backs by their mates. Among the Belostomatinae, species of Abedus, Belostoma, Diplonychus, Hydrocyrius, and Limnogeton have


67

presented males that exclusively care eggs. Recent investigations into relationships among Neotropical Belostomatinae giant water bugs have led authors to recognize Belostomatinae clade, which is characterized mainly by back-brooding behavior. These now include representatives of Weberiella De Carlo, which is the last genus to be described, with males of W. rhomboides (Menke, 1965) being reported carrying eggs on their backs for the first time. We investigate the placement of Weberiella in Belostomatinae and revisited the relationships among the genera of this subfamily (with Appasus Amyot and Serville, Benacus Stål, and Kirkaldyia Montandon now ressurected) by including modifications or clarifications of both somatic and male genitalic characters, as well as the egg-bearing male phenomenon reported to the genus Weberiella. A comparative morphological study of these genera and six outgroup taxa yielded putative homology hypotheses coded as 69 characters of the head, thorax, male genitalia, and some behavioral traits concerning mating systems in Belostomatinae for 30 terminal taxa. The dataset was analysed using maximum parsimony. Branch support was evaluated based on clade posterior probabilities by using a Bayesian algorithm. The analysis conducted revealed 2,520 equally most-parsimonious trees. A strict consensus tree, which is that obtained also by successive weighting, is as follows: (Hydrocyrius (Limnogeton (W. rhomboides, (Belostoma, Abedus) (Appasus, Diplonychus)))). The monophyly of Belostomatinae as currently defined is not refuted. Our hypothesis concurs with Mahner in the placement of Belostoma as a sister group to Abedus (Belostomatini). Weberiella rhomboides appeared as the sister group of the above-formed Palaearctic group of genera because the insinuating vestigial arms on apical portion of the phallotheca may be a synapomorphy, instead of a homoplasy. It seems reasonable to conclude that members of W. rhomboides could not hunt actively very far from the clutch and they could be neither true kinobionts nor inhabit that extremely dynamic and very often unstable biotope (kinon) if they were emergent-brooders. Even though members of Lethocerinae stay close to the clutch to care it, it does not mean that they are in a lower level of efficiency that back-brooders. Species of Lethocerinae are great flyers and they probably can choose a good place to establish for laying and care eggs, to guarantee a suitable habitat with the adequate prey size when offspring hatches. Adults have enough reserves even to starve some days. Back-brooders also may have great nutricional reserves in their fat bodies. Encumbered males have restricted movements, but they do not need large movements into the water to catch preys because they are ambushed hunters. In both cases,


68

when food is scarce, they move to another body water. The capacity to find a proper place for descendants seems to be one of the successful adaptations in parental care behavior.

Inventory researche of Heteroptera in Sarawak, Malaysia

Masaaki Tomokuni

Department of Zoology, National Museum of Nature and Science, Tokyo

3-23-1 Hyakunin-cho, Shinjuku-ku, Tokyo, 169-0073 Japan


As a state of Malaysia, Sarawak occupies the northwestern part of Borneo, the third largest island and one of the biodiversity hotspots in the world. But unfortunately, the biodiversity in Sarawak has been extinguished rapidly by interminable human activities such as industrial logging, expansion of oil palm plantations, residential developments, and so on. In addition, the taxonomical study of the Heteroptera from Sarawak is still in alpha-state. Therefore inventory researches in this area are now become urgent subjects for better understanding of its biodiversity.

Through my research in Sarawak since 1998 I found several interesting species of Heteroptera as shown herein. Most of them were new to Sarawak or even to Borneo. An outline of the Japan-Malaysia cooperative project, “Canopy Biology Program”, are also presented along with that of two series of the heteropterous collection housed in Forest Research Centre and Sarawak Museum, both in Kuching.

Revision of the Rhinocylapus-group (Heteroptera: Miridae:

Cylapinae)

Andrzej Wolski

Institute of Plant Protection-National Research Institute, Sośnicowice Branch, Poland



69

The tribe Rhinomirini sensu Gorczyca (2000) was divided by the author (Gorczyca 2000) into two groups of genera: Rhinomiris- and Rhinocylapus-group (the latter containing Proamblia Bergroth, Rhinocylapidius Poppius, and Rhinocylapus Poppius). Unlike the Rhinomiris-group, which has recently been revised (Gorczyca & Chérot 1998), the taxa belonging to the Rhinocylapus-group have hitherto been known mostly from the original descriptions. Detailed studies of the external morphology and the male genitalia of the above genera, have fully confirmed that they are closely related and they form, together with the genus Mycetocylapus Poppius, distinct, well defined group within the subfamily Cylapinae. Of the 11 currently recognized species, 10 are restricted to the Oriental Region. Only one species (Mycetocylapus pacificus Carvalho) occurs, apart from Sulawesi, also in the Caroline Is. and Papua New Guinea. As a result of this study, which is part of the revision of the Oriental cylapines, taxonomic revision of the mentioned genera is presented. New species of the genus Rhinocylapus are described. The systematic position of the Rhinocylapus-group within the subfamily Cylapinae is briefly discussed.

Mesozoic Fossil Heteroptera from China

Weiting Zhang1, Yunzhi Yao1, Dong Ren1, Wanzhi Cai1,2, David A. Rider3

1Key Lab of Insect Evolution & Environmental Changes, Capital Normal University, Beijing

100037, China. E-mail: [email protected]; [email protected]


Beijing 100094, China. Email: [email protected].

3Department of Entomology, North Dakota State University, Fargo, North Dakota 58105,

USA. E-mail: [email protected]

In recent years, we recorded Late Mesozoic Heteroptera from China, referring 9 families 33 genera 34 species. Among the 9 families, Rhopalidae, Vetanthocoridae, Primipentatomidae and Venicoridae respectively represent the first fossil record in the world. Miridae, and Cydnidae are the oldest in geological history. Cydnidae, Ochteridae and Naucoridae respectively represent the first fossil record from China.

The earliest known fossil Pentatomomorpha insects were found in late Triassic strata in midwest China and England. 14 families 158 genera fossil


70

Pentatomomorpha insects have been reported. A cladistic analysis based on the combination of fossil and extant morphological characters clarified the phylogenetic status of the new family Venicoridae and allowed the reconstruction of the intersuperfamily and interfamily relationships of the Infraorder Pentatomomorpha. Phylogenic analysis showed that Venicoridae locating between Aradoidea and Trichophora, may be as the direct ancestor to Trichophora. Pentatomoidea is a monophyletic group. Piesmatidae should be treated as a superfamily. In Pentatomoidea，

Primipentatomidae fam. nov. locates between Urostylididae and the remaining families. Cydnidae which is a family in traditional sense may be a paraphyletic group. In Coreoidea (sensu lato), both Lygaeoidea and Idiostoloidea are monophyletic groups. Pachymeridiidae that was considered as the direct ancestor to Pachymeridiidae in the past, was classified into Idiostoloidea. Coreoidea (sensu stricto) and Pyrrhocoroidea are sister groups.

Origin time of Pentatomomorpha may be tracked back to Middle or Early Triassic，which is earlier than the existing fossil records. The center of origin located in Center Asia. Bugs underwent three times large-scale adaptive radiation during their evolution. In the fist time ocurred during Late Triassic and Early Jurassic, bugs moved from Center Asia to Europe and south Asia, arrived in Hunan province and Guangxi Zhuang Autonomous Region, China, and then went to the north, arrived in Northeast China and West Inner Mongolia in the Middle Jurassic; In the second time occured during Late Jurassic and Early Cretaceous, bugs migrated in two lines: (1) Europe - Mongolia - Northeast China, (2) Europe - (North Africa) - South America - Antarctica - Australia. In the third time occured during Late Cretaceous and Palaeocene, these bugs quickly moved from Eastern Asia to Europe again, and then transferred to Greenland, and then entered into North America, then divided into two lines, one line went along the east coast of North America from north to south, the other one went along the west coast of North America, eventually formed the present-day distribution pattern.

Jiulongshan and Yixian Formations of northeast China yielded many Heteroptera fossils, which provide solid material foundation for studying the role played by Heteroptera in Late Mesozoic ecosystem. Habitats of Mesozoic Heteroptera include soil habitat, plant habitat, aquatic habitat, tidal zone. Feeding types include phytophagy, predacity, and polyphagia. Their habitat diversity suggests a quite wide distribution range and a broad


71

niche. In ecosystem, bugs lying in the middle of food chain, mainly occupy the second and the third trophic levels and act as primary consumer and secondary consumer. They play an irreplaceable role in keeping the concatenation of food chain and ensuring the smooth proceeding of material cycle and energy flow.

Exotic coreid bugs introduced into China

Weibing Zhu

Shanghai Institute of Plant Physiology and Ecology, Shanghai Institute for Biological

Sciences, Chinese Academy of Sciences, 300 Fenglin Road, 200032 Shanghai, China


In December of 2009, Leptoglossus occidentalis, one famous invasion coreid bug, was intercepted by Tianjin Entry-Exit Inspection and Quarantine Bureau. This species was originally native to the warm-temperate western USA but now it could be found in most countries in European, even in Japan in 2008. The invasion of exotic species is a growing worldwide phenomenon in recent years due to the increase of human trade, tourism and scientific communications across countries. It is an important threats or potential problems to biodiversity, agriculture and forestry.


72

Author’s Index

Abdul Manan Shaikh, 31

Aiping Liang, 45

Alan Lane de Melo, 66

Alice Exnerová, 35

Ana Lia Estévez, 9, 66

Andrzej Wolski, 68

Anna A. Namyatova, 48, 66

Arshad Azmi, 31

Aukema B, 8, 53

Ballal, C. R., 36

Baorong Wan, 44

Bill Dolling, 8, 56

Bindu, K., 36

Bo Cai, 8, 51

Bruers J., 8, 53

Carsten Morkel, 62

Chérot F., 8, 52

Chérot, F., 8, 53

Christiane Weirauch, 18, 56

Chuanren Li, 44

Costa, L., 8, 52

Cuiqing Gao, 8, 20, 25, 51

David A. Rider, 69

D'Haese C., 20

Dimitri Forero, 8, 56

Dominik Chłond, 8, 54, 55

Dong Hwan Choe, 8, 56

Dong Ren, 9, 69

Elod Kondorosy, 58

Eric Guilbert, 20

Ernst Heiss, 26, 27

Fedor V. Konstantinov, 23

Golub V.B., 29

Guanyang Zhang, 37

Guoqing Liu, 33, 34

Haiyu Liu, 45, 47

Haoyang Wu, 46

Hongliu An, 44

Hu Li, 43, 45, 47

Hui Liu, 43, 45

Hyojoong Kim, 21

Jakob Damgaard, 20

Jianfu Zhou, 49

Jianxin Cui, 41

Jianyu Gao, 45, 47

Jimeng Hua, 22, 49

Jing Wang, 46

Jitka Vilímová, 40, 57

John T. Polhemus, 31

José Ricardo Inacio Ribeiro, 9, 66

Jürgen Deckert, 49

Kanykova E.V., 29

Kateřina Hotová Svádová, 35

Kazutaka Yamada, 21, 36

Krzysztof Musik, 55

Laurence Livermore, 8, 56

Li Xi, 22, 25

Liangming Cao, 47

Lily Berniker, 51

Łukasz Junkiert, 8, 55

Mallik B. Malipatil, 28

María Cecilia Melo, 60

Masaaki Tomokuni, 68

Mick Webb, 56

Min Li (J), 25, 46

Min Li (S), 22

Nasreem, A., 36

Nasreen Memon, 31


73

Nasser, M., 36

Nickolay N. Vinokurov, 29

Ondřej Balvín, 40

Pablo Matías Dellapé, 24

Papáček M., 38

Paula Levin Mitchell, 9, 61

Pavel Štys, 17, 35

Pengzhi Dong, 49

Petr Kment, 8, 57

Poorani, J., 36

Qiang Xie, 25, 46, 49, 50

Ram Keshari Duwal, 33

Randall T. Schuh, 35

Richard J. Packauskas, 37

Samuel Bernell Cooke, 9, 61

Sarah Elizabeth Johnson, 61

Satoshi Kamitani, 43

Seunghwan Lee, 21, 33

Sunghoon Jung, 21

Tadashi Ishikawa, 43

Thomas J. Henry, 24

Tomáš Ditrich, 38

TomohideYasunaga, 33

Touchet, M., 8, 52

Vikolai N. Vinokurov, 39

Viskens G., 53

Wanzhi Cai, 9, 18, 27, 32, 39, 43, 45, 47,

54, 69

Wei Song Hwang, 38

Weibing Zhu, 71

Weiting Zhang, 9, 41, 69

Wenjun Bu, 20, 22, 25, 46, 49, 50, 51

Xiaoshuan Bai, 27

Xiaoxuan Tian, 25, 46

Xin Yu, 49

Xu Zhang, 33

Xuan Lam Truong, 32

Xueqin Shi, 8, 51

Yang Liu, 46

Yanhui Wang, 50

Ying Cui, 25, 49

Ying Wang, 50

Yunling Ke, 22

Yunzhi Yao, 9, 41, 69

Zhaohui Luo, 39

Zhaozhi Lv, 39

Zhonghua Fan, 34

proceedings of the 4th -...

Documents