procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear...
TRANSCRIPT
![Page 1: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/1.jpg)
procaryotes : a single circular chromosome typically 5.106 base pairs
eucaryotes : several linear chromosomestypically 3.109 base pairs
22 autosomal chromosome
pairs
2 sexual chromosomes
Example : human genome
+ about hundred circular
mitochondrial DNA molecules
telomere
centromere
DNA is organized in chromosomes
1
5 µm
![Page 2: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/2.jpg)
Structure and localization of chromosomes
Chromosomes are made of DNA and proteins (chromatin). Histones make DNA more compact and regulate its accessibility (nucleosomes). Transcription factors control gene expression. Replication factors catalyze DNA replication during the S phase of the cell cycle. Individual chromosomes can be observed during mitosis, one step of cell division (chromatin condensation). Centromeres are contact points between pairs of chromosomes. Telomeres are chromosome ends. A diploid (haploid) cell possesses 2 (1) set(s) of chromosomes
2
![Page 3: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/3.jpg)
Regulation of DNA accessibility play a crucial role during transcription and replication
From ENCODE, an encyclopedy of DNA elements : http://encodeproject.org/ENCODE/ 3
![Page 4: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/4.jpg)
DNA replication
DNA replication is semi-conservative
DNA polymerases
Replication origins
Assembly of the replication fork
Further readings : http://www.dnaftb.org/dnaftb/
http://www.dnareplication.net/
1 ADN 2 ADN
4
![Page 5: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/5.jpg)
DNA replication is semi-conservative
M. Meselson & P Stahl Proc. Nat. Ac. Sci. 1958
5
![Page 6: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/6.jpg)
6
The cell cycle
Gap 1
DNA Synthesis
Mitosis
Gap 2
In the resting state (G0), cells do not divide
G0
6
![Page 7: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/7.jpg)
Flow cytometry
Up to 8 fluorophores can be simultaneously analyzed
http://www.abcam.com/
Fluorescence level
Forward and side scattering is used to analyze cell size and granularity
Analysis rate ≈ 10000 cells/secSeveral analysis in parallel
7
![Page 8: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/8.jpg)
The Fluorescence Activated Cell Sorter (FACS)
8
![Page 9: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/9.jpg)
9
DNA synthesis is catalyzed by DNA-dependent DNA polymerases
dNTP template strand
strand to be synthesized
DNA polymerization takes place in the 5’ to 3’ direction DNA polymerase requires a template and a primer
dATPdTTP
dCTPdGTP
GGATCCTTAGAACCTTGGCCCGGGCCTAGGAATCTTGGAACCGGGCCC
DNA polymerase nucleotides
GGATCCCTAGGAATCTTGGAACCGGGCCC
template
primer5’ 5’
PPiPPi
PPi
PPiPPi
PPi
Stryer et al. Biochemistry, Freeman Edt9
![Page 10: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/10.jpg)
DNA replication is catalyzed by a DNA-dependant DNA polymerase in the 5 ’ to 3 ’ direction starting at double strand DNA or at a DNA-RNA hybrid A primase synthesize a RNA primer to initiate replication DNA polymerases are processive : processivity is the number of phosphodiester bonds that a single enzyme is able to catalyze before dissocation
DNA replication requires a primase to start
dNTP
template strand
strand to be synthesized
10
![Page 11: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/11.jpg)
11
Okazaki fragments
RNA primase
Leading and lagging strands
Size of Okasaki fragments : eukaryotes 200 bp
Alberts et al. MBOC, Garland Edt11
![Page 12: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/12.jpg)
12
5’3’
dNTPRNA primer
5’3’
NTPprimase
Replication fork
DNAPol
DNA helicase
DNA helicase
On the « leading strand », DNA is continuously synthesized
12
![Page 13: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/13.jpg)
13
5’ 3’
RNA primer
dNTP RNA primer
5’ 3’
NTP
DNAPol primase
5’ 3’
dNTP RNA primer
ligase
5’ 3’
RNA primer
RNAse and DNAPol
Replication fork
DNAPol
DNA helicase
DNA helicase
DNA helicase
DNA helicase
On the « lagging strand », DNA is synthesized discontinuously
13
![Page 14: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/14.jpg)
14
The core of the eukaryote replication complex
Movies 5.1 (Molecules and Complexes) and 5.4 (Cell functions) Mol. Biol. Cell
Linda B. Bloom, University of Floridahttp://www.med.ufl.edu/IDP/BMB/bmbfacultypages/lindabloom.html
Eukaryote cells possesses several DNA polymerases (> 15) nucleus 250 kDa DNA primase, lagging strand nucleus 170 kDa leading strand
nucleus 260 kDa lagging strand, DNA repair
DNAPol
DNAPol
DNAPol primase
14
![Page 15: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/15.jpg)
15
Main components of the DNA replication complex
DNA polymerase – primase primer RNA synthesisDNA polymerase DNA synthesis, leading+lagging strands
Replication protein C* load PCNA on DNAProliferating cell nuclear antigen (PCNA) sliding clamp ensuring processivity
Topoisomerase Adjusts DNA supercoilingHelicase* Unwinds DNA into strands
Replication protein A single strand DNA binding proteinFlap endonuclease 1 removes RNA 5’-flapDna2RNase H1 removes RNADNA ligase 1 joins Okasaki fragments
* uses ATP The replisome
The catalytic core
Maga and Hübscher 1996 Biochemistry 35: 5764-5777Waga and Stillman 1994 Nature 269: 207-212Frouin et al. 2003 EMBO reports 4: 666-670Hübscher and Yeon-Soo Seo 2001 Mol. Cells 12: 149-157
Cyclin A, cyclin B1Cyclin dependent kinase 1, 2 (CDK1, CDK2)
+ 11 other proteins…
Temporal regulation
15
![Page 16: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/16.jpg)
16
The central role of PCNA
PCNA (proliferating cell nuclear antigen) is a homotrimeric protein that helps DNA polymerase processivity in eukaryotic cells. During the S-phase, it assembles around DNA and form a DNA clamp.
PCNA associates with RFC, DNA polymerases and , Fen1/Dna2, Lig1 (+ 15 other proteins !)
PCNA is also involved in DNA repair mechanisms
At 3’ OH end : RFC displaces Pol- and loads PCNA + Pol/At the flap structure :
RFA dissociates Pol from PCNAPCNA recruits Fen1/Dna2 which cleaves the flap
structurePCNA recruits Lig1 that joins the DNA fragments
PDB 1AXC
Maga and Hübscher 2003Journal of Cell Science 116: 3051-3060
16
![Page 17: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/17.jpg)
17
Replication is coordinated at replication factories
Visualization of DNA replication in living cells using GFP-PCNA FRAP experiments shows that PCNA is stably associated to replication factories
Essert et al. 2005 Mol. Cell Biol. 25 : 9350-59
PCNA
GFP
17
![Page 18: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/18.jpg)
18
Replication is coordinated at replication factories
Visualization of DNA replication in living cells using GFP-PCNA FRAP experiments shows that PCNA is stably associated to replication factories
Essert et al. 2005 Mol. Cell Biol. 25 : 9350-5918
![Page 19: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/19.jpg)
19
There are about 100-1000 replication origins per chromosome Replication origins are recognized by specific protein complexes : ORC ‘origin recognition complex) and MCM (minichromosome maintenance complex) Replication speed : 10-50 bp/s The onset of DNA replication is triggered by « cell division cycle dependant kinases » (CDK)
Replication starts at replication originsORC : origin replication complexMCM : minichromosome maintenance complexReplisome
1. Activation
2. Extension
3. Termination
19
![Page 20: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/20.jpg)
Les recombinaisons: modifications aléatoires et programmées du génome
ADN1 + ADN2 ADN3 + ADN4
Mécanisme moléculaire de la recombinaison homologue
La recombinaison de sites spécifiques
La conjugaison, mécanisme de la parasexualité bactérienne
La recombinaison VDJ, un des éléments de la diversité des anticorps
et des TCR
Le crossing-over durant la méiose accroît la diversité génomique de
la population
Les transposons et les virus, séquences d’ADN mobiles
20
![Page 21: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/21.jpg)
homology
cleavage
ligation
exchange
displacement
Holliday junction
cleavage
ligation
The mechanism of homologuous recombination
21
![Page 22: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/22.jpg)
ATP binding site
ATP hydrolysis
RecA proteins catalyze the exchange of DNA strands ...
Structure of a RecA polymer
22
![Page 23: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/23.jpg)
… dans un seul sens
without RecA with RecA
Driving force : ATP hydrolysis
… in the 5’ to 3’ direction
23
![Page 24: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/24.jpg)
Recombination events in cells
Example Cells Effect Effector proteins
Crossing-over Meiotic cells genome RecA-D like ( germinal cells) rearrangements proteins
Virus integration Host cell genome dormancy Integraselytic/lysogenic Integration Host phases Factor
Conjugation Bacteria gene exchange Integrase
VDJ recombination lymphocytes antibody and Rag1-2 TCR diversity
Transposons all cells genome Transposasesrearrangements
24
![Page 25: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/25.jpg)
The two states of the bacteriophage Reversible recombination
DNA of the bacteriophage
DNA of E. coli
attP
attB
Recombinant DNA
IntegraseIntegration Host Factor
ExcisionaseIntegraseIntegration Host Factor
Example 1 : site-specific recombination of a virus
25
![Page 26: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/26.jpg)
Integrase mechanism
phage DNA
E. Coli DNA
attP
attB
recombinant DNA
pairing, double cleavage, double exchange, ligation
26
![Page 27: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/27.jpg)
Conformation 1 : phage and bacterial DNA separatedConformation 2 : phage and bacterial DNA fused
attB attP
bacterial DNA
phage DNA
27
![Page 28: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/28.jpg)
Biswas et al. (2005) A structural basis for allosteric control of DNA recombination by λ integrase Nature 435 : 1059-1066
integration
excision
Phage integration in bacterial genome
28
![Page 29: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/29.jpg)
Conjugation Reversible recombination
« female »
« male »
DNA
episome F
factor F
chromosome
Hfr chromosome
plasmide F ’
integration
excision
F’ plasmids often carry virulence factors
The F-factor allows gene exchange between bacteria
29
![Page 30: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/30.jpg)
ampicillineR
blasticidineR
gène cible blasticidineR
Recombinaison (double
crossing-over)
WT
PHG1A
phg1a phg1bphg1a/b
PHG1B
Anti-PHG1B
Anti-PHG1A
Benzhegal et al. 2002
Applications de la recombinaison : invalidation de gène par insertion
30
![Page 31: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/31.jpg)
Applications of recombination : the Cre-Lox system
Cre recombinase : a P1 phage enzyme that catalyzes recombination between two LoxP sequences :LoxP : ATAACTTCGTATAGCATACATTATACGAAGTTAT
Example : RIP-CreER transgenic mice have a tamoxifen inducible Cre-mediated recombination system driven by the rat insulin 2, Ins2, promoter. The transgene insert contains a fusion product involving Cre recombinase and a mutant form of the mouse estrogen receptor ligand binding domain. The mutant mouse estrogen receptor does not bind natural ligand at physiological concentrations but will bind the synthetic ligand, 4-hydroxytamoxifen. Restricted to the cytoplasm, the Cre/Esr1 protein can only gain access to the nuclear compartment after exposure to tamoxifen. When crossed with a strain containing a loxP site flanked sequence of interest, the offspring are useful for generating tamoxifen-induced, Cre-mediated targeted deletions. Tamoxifen administration induces Cre recombination in islet cells of the pancreas. About 100 loxP-flanked genes bearing strains are available at Jackson 31
![Page 32: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/32.jpg)
Light chain of antibodies
Example 2 : genetic rearrangements in B lymphocytes
recombination
RAG : recombination activating genesRSS : recombination signal sequences
splicing
32
![Page 33: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/33.jpg)
Transposons are mobile DNA sequences in genomes
excision insertiontranscriptiontraduction
transposase
example : Tn5 transposon and transposase 33
![Page 34: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/34.jpg)
no specific insertion sites frequency of mobility: 10-6 per generation Abundance variable in genomes (10% in drosophila, 40% in men)
coat proteins use receptors to enter the cells
type I transposons (retrotransposons)
type II transposons
ARNm
resolvasetranscriptase réverse
transcriptase réverse
resolvase
cDNA
ARNm
transposase
activité derestriction activité
d'intégration
ADN excisé
DNA viruses
RNA viruses
Viruses and transposonsTransposons Viruses
34
![Page 35: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/35.jpg)
entrée du viruspar fusion avecla membrane plasmiquegràce à des récepteursde la surface cellulaire
Pour les virus à ARNcopie en ADN par unetranscriptase réverseviraleContrôle de la cellule Intégration dans le génome
Silence expressionDormance
Productions de protéines etacides nucléiques virauxpar la cellule et enpaquetagede nouveaux virusDestruction de la cellule
Fast viruses
Slow viruses
Fast and slow viruses
35
![Page 36: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/36.jpg)
The presence of transposons allows gene duplication, inversion or excision by homologous recombination
DELETION INVERSION
DUPLICATION
36
![Page 37: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/37.jpg)
example of a diploid organism with 2 pairs of homologous chromosomes
MITOSIS
MEIOSIS
FECUNDATION
diploid
4 haploids
gametes
2 diploids
diploid
diploid
2 haploids
Mitosis, meiosis and fecundation
37
![Page 38: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/38.jpg)
DNA replication
decondensation of chromosomes
separation of daughter cells (cytokinesis)
Chromosome condensationcentromere
s
Sister chromatides
separation of sister chromatides
Mitotic spindle
Mitosis : 1 diploid -> 2 diploids
38
![Page 39: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/39.jpg)
DNA replication
separation of homologous
chromosomes
gametes
Chromosome condensationcentromere
Sister chromatids
Pairing of homologous
chromosomes
synaptolemalcomplex
1st mitosis
2nd mitosis
Meiosis : 1 diploid -> 4 haploids
39
![Page 40: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/40.jpg)
« Crossing over »
Transmission de l ’ADN mitochondial
transmission presque exclusivement par la mère
simple
double
séquences homologuesfréquence : 1/107 paires de bases
chromosome paternel
chromosome maternel
Epigénétique
Certains gènes sont inactivés par méthylation, l ’état de méthylation peut être transmis aux cellules filles Exemple : inactivation d ’un des chromosomes X chez les femmes
Transmission non-mendélienne
40
![Page 41: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/41.jpg)
réplication de l ’ADN
ségrégation des chromosomes homologues
gamètes
condensation des chromosomescentromère
chromatides sœurs
appariement des chromatides
homologues et crossing-over
Complexe synaptolemal
1ière mitose
2ième mitose
Recombinaison durant la méiose
41
![Page 42: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/42.jpg)
Chez E. coli, la recombinaison homologue a lieu à des sites spécifiques appelés « chi site » dont la séquence est GCTGGTGG, situés environ toutes les 4000 paires de baseChez E. coli, la recombinaison est catalysée par l ’action de quatres protéines RecA, RecB, RecC et RecD
L’ADN simple brin est généré par l ’action d ’une hélicase et d’une endonuclease du complexe RecBCD
42
![Page 43: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/43.jpg)
DNA repair
Molecular origin of DNA mutations
General repair mechanisms
The p53 protein controls DNA damage at a specific checkpoint
of the eukaryote cell cycle
43
![Page 44: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/44.jpg)
Sources of DNA damage
Replication errors: DNA polymerase frequency 1/107
Molecular damages to DNA:
Origin DNA damage number/cell.day Possiblerepair
Exogenous sun (1h/day) T-T dimers 6-8.104 Ychemical adducts 102-105 N
(base modification)radioactivity single strand breaks 2-4.104 Y(natural double strand breaks ? ±background)
Endogenous temperature single strand breaks 2-4.104 Yfree radicals adducts/breaks 104 Ymetabolites adducts 102 Yviruses genome integration ? Ntransposons ? ? 44
![Page 45: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/45.jpg)
DNA repair mechanisms
Damage type Repair
T-T dimers
Adducts
Single strand breaks
Double strand breaks
Restriction
Excision
Synthesis
Ligation
Excision
Recombination
Ligation
or direct ligation
Recognition
45
![Page 46: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/46.jpg)
The COMET assay to measure DNA damages
also called single cell gel electrophoresis (SCGE)
46
![Page 47: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/47.jpg)
Ames test (Salmonella-his reversion-test ) for mutagenicity
This experiment employed six strains of Salmonellatyphimurium histidine auxotroph mutants, deficient in the synthesis of histidine, an amino acid necessary for bacterial growth. The histidine auxotrophs will only grow in a medium containing sufficient histidine supplement. To revert to histidine production (prototrophy), or become his+,a reverse mutation must occur in the original his- mutation (found in one of the genes involving histidine biosynthesis). When plated onto an agar media containing a trace (1/1000 dilution) of histidine, only his+ revertants will grow to form a visible colony.
The presence of visible colonies signifies a reverse mutation. Each of the six bacterial strains carries a different type of mutation (Table 1), making it possible to assess the type of mutation caused by the chemical under examination. When a chemical mutagen is introduced into the bacterial population on a filter disc, a higher number of revertants will appear, signalling the chemical causes genetic mutations.
The Ames test includes using liver extract to simulate mammalian metabolic activity which may alter non-mutagenic chemicals to become mutagenic. The liver extract is generally obtained from rats treated with Aroclor 1254 to induce the presence of detoxifying enzymes.
Brian Krug: Ames Test: Chemicals to Cancer
Strain # S. typhimurium Type of Mutation Detected Strain Name1 TA98 detect frame-shift mutations2 TA100 detect base pair substitutions3 TA102 detect excision repair4 TA104 detect base-pair substitutions5 TA1534 detect frame-shift mutation6 TA1530 detect base pair substitutions
Inhibition zone
growth ring
chemical to be tested
47
![Page 48: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/48.jpg)
Exemple of repair : thymine dimers
Tymine dimer repair enzyme : specific DNA endonuclease
(induced by UV light)
48
![Page 49: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/49.jpg)
benzo[a]pyrene (BP)
Metabolism et carcinogenicity of Benzo[a]Pyrene
benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide
CYP1A1, CYP1A2epoxide hydrolase
the diol epoxide covalently binds to DNA (adduct)
Increased DNA
mutations & cancer
Benzo[a]pyrene is a product of incomplete combustion at temperatures between 300 and 600 °C. aromatic
molecule (L)
Aryl hydrocarbon
ReceptorAhR
AhR-L
induction of specific mRNA (AhRE)
AhR-L
GrowthDifferentiationMetabolism
(toxicity)
P450 cytochromes (phase I) : CYP1A1, CYP1A2, CYP1B1, CYP2S1
Phase II enzymes : GST, UGT(detoxification mechanism)
translocation to the nucleus
AhRE AhRE
49
![Page 50: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/50.jpg)
Shimizu et al. (2000) PNAS 97 : 779-782Benzo[a]pyrene carcinogenicity is lost in mice lacking the aryl hydrocarbon receptor
Dossier INSERMDioxines dans l’environnement. Quels risques pour la santé ? http://ist.inserm.fr/basisrapports/rapport.html
Individual susceptibility to xenobiotics. Exemple of CYP genes
50
![Page 51: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/51.jpg)
The rad genes in yeast
A systematic study was conducted in yeast to identify genes responsible for the cell sensitivity to radiation 55 “rad” genes were found. Most of these genes have counterparts in the human genome. From current estimates, 240 genes are involved in DNA repair in humans
51
![Page 52: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/52.jpg)
P Perego (2000) Yeast Mutants As a Model System for Identification of Determinants of Chemosensitivity. Pharmacol Rev 52: 477–491
52
![Page 53: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/53.jpg)
Cell cycle checkpoints
APOPTOSIS
p53
APOPTOSIS
Retinoblastoma protein (Rb)
APOPTOSIS
Anaphase Promoting Complex (APC)
Apoptosis is an organized (programmed) cell death mechanism
53
![Page 54: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/54.jpg)
Apoptosis
Apoptosis is one form of programmed cell death, often observed in higher eukaryotes during development, selection of immune system cells, and cancer prevention by NKC
Apoptosis can be triggered by intracellular processes, such as DNA damages, or by extracellular molecules, for instance activation of the Fas receptor by the Fas ligand, or the secretion of permeabilizing molecules by NKC.
Apoptosis involves mitochondrial inactivation and the release of cytochrome c in the cytosol.
The lack of ATP induces phosphatidyl serine exposure to the plasma membrane (the “eat-me” signal) and cell blebbing.
Cell fragments are internalized by macrophages and digested. No inflammation (activation of the innate immune system) occurs .
See movie 18.1 apoptosis54
![Page 55: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/55.jpg)
The p53 protein holds the cell cycle at the G1/S checkpoint in the presence of DNA damage
p53 is a tetrameric 393 aa protein
p53 consists of 3 domains :
1 100 200 300 393
transcription activation domain
DNA binding domain
regulatory domain
NLSphosphorylations
The transcription activation domain interacts with the Mdm2 protein that triggers p53 degradation.
The DNA binding domain interacts with a specific DNA sequence that controls p21CIP expression
The conformation and the localization of p53 is controlled by phosphorylation and acetylation
acetylations
p53 DNA binding domains in complex with DNA
55
![Page 56: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/56.jpg)
TRANSCRIPTION of p21 inhibitor
Pcdk2
cyclineEp21
p53synthesis degradation
p53-PDNA polymerase
ADN intact damagedChk inactive activep53 absent bound to DNA
(mdm2) (phosphorylated)p21 repressed expressedCDK active inactiveCycle G1S G1 stop
p53-UbMdm2
+
Double strand break
Single strand break (30 to 40 bases lacking)
Base mispairing
Chk1/2 +
Mdm2 = murine double minute oncogeneChk = checkpoint kinasep21= CIP (cdk2 inhibiting protein) = WAF1 (Wild Type p53-activated fragment)
56
![Page 57: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/57.jpg)
p53 mutations are found in 50% of human cancers
Arg248
Arg175, 249, 273, 282, Gly245
Mutation frequency
Séquence primaire de p53
These mutations decrease p53 interaction with DNA, which eliminates the G1/S restriction point controlled by the Cdk2-cyclinE complex 57
![Page 58: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/58.jpg)
4. Natural Killer Cells and cancer prevention
Natural Killer Cells (NKC) are components of the (innate) immune systems. They are cytotoxic against tumor cells and cells infected by viruses. They also play an important role in graft rejection.
NKC are sensitive to the molecules present at the surface of the cells. All cells in the body express MHC-I complexes that present fragments of endogenous proteins synthesized in the cell. Any change in the nature of MHC-I or in the surface concentration of MHC-I leads to NKC activation
Upon activation, NKC bind to the target cell and locally release perforin and granzyme molecules at the plasma membrane of the target cell, which triggers apoptosis.
In addition, NKC are able to recognize and kill cells with antibodies bound at their surface (adaptative immune system). Antibodies directed against surface antigens are indeed often present in cancers.
Defects in NKC production severely increases the risk of cancer
Tumor cells develop inhibitors that prevent NKC activation
See movie 24.4 killer T cells58
![Page 59: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/59.jpg)
proteins
DNA (desoxyribonucleic acid)
mRNA (ribonucleic acid)
Transcription factors
DNA state sensors
Repairenzymes
Replication factors
Apoptosis factors (mitochondrial inactivation, caspases)
p53
CELL DIVISION
CELL APOPTOSIS = CELL DEATH
UNCONTROLLED CELL DIVISION = CANCER
DNA repair mechanisms and cell fate
Radiations DNA damage apoptosisRapidly dividing cells are more sensitive to radiations 59
![Page 60: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/60.jpg)
2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)
Indirect carcenogenicity of dioxin
Dioxins occur as by-products in the manufacture of organochlorides, in the incineration of chlorine-containing substances such as PVC, in the bleaching of paper, and from natural sources such as volcanoes and forest fires.
Dioxins build up primarily in fatty tissues over time. The major source of dioxins is food, especially from animals. TCDD has a half-life of approximately 8 years in humans.
TCDD activates the AhR and thus induces CYP expression. This either increases or reduces carcinogenicity of other aromatic molecules such as Benzo[a]Pyrene and 7,12-dimethylbenz[a]anthracene, respectively.
Travailleurs exposés aux phénoxy-herbicides et aux chlorophénols. Exposition : 3 à 389 pg/g de matières grasses Teneur du lait maternel en France : 16,5 ± 5 pg/g de matières grasses Dossier INSERM Dioxines dans l’environnement.
60
![Page 61: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/61.jpg)
22 paires de chromosomes autosomaux homologues Ci
p/Cim
2 chromosomes sexuels Xm/Yp
Père 22 paires de chromosomes autosomaux homologues Ci
p/Cim
2 chromosomes sexuels Xm/Xp
Mère
22 chromosomes autosomaux Ci
p ou Cim
1 chromosome sexuel Xm ou Yp
spermatozoïdes
22 chromosomes autosomaux Ci
p ou Cim :
1 chromosome sexuel Xm ou Xp
ovules
22 paires de chromosomes autosomaux homologues Ci
p ou Cim / Ci
p ou Cim
2 chromosomes sexuels Xm ou Yp/ Xm ou Xp
Enfant
246 = 1013 possibilités
Transmission des caractères parentaux chez l ’homme
61
![Page 62: Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal](https://reader033.vdocuments.us/reader033/viewer/2022052504/5519132155034626428b48f4/html5/thumbnails/62.jpg)
Un gène
génotypephenotype
allèles
lignées puresA/A a/a F f
A/a A/a F F
A/A a/a A/a F f F0.25 0.25 0.5
hybride de 1ière génération
hybrides de 2de génération
Deux gènes
A/a B/b A/a B/b F G F G
hybride de 1ière génération
B/B B/b b/b
A/A FG FG Fg
A/a FG FG Fg
a/a fG fG fg
B/B B/b b/bA/A 1/16 1/8 1/16
A/a 1/8 1/4 1/8
a/a 1/16 1/8 1/16
indépendants
gènes portés par deux
chromosomes différents (ou éloignés cf
crossing-over)
B/B B/b b/bA/A 1/4 0 0
A/a 0 1/2 0
a/a 0 0 1/4
liésgènes portés par le même chromosome
AB/ab
B/B B/b b/bA/A 1/4-2e e e2
A/a e 1/2-2e2 e
a/a e2 e 1/4-2e
crossing-over
e : fréquence de crossing-over, dépend de la distance entre les gènes (cMg :: e = 0.01)
Génétique mathématique
62