prevalence of ticks and tick-borne pathogens from …

PREVALENCE OF TICKS AND TICK-BORNE PATHOGENS

FROM PUNJAB, PAKISTAN

By

Marriam Batool

2011-GCUF-05235

Thesis submitted in partial fulfilment of

the requirements for the degree of

DOCTOR OF PHILOSOPHY

IN

ZOOLOGY

DEPARTMENT OF ZOOLOGY

GOVERNMENT COLLEGE UNIVERSITY, FAISALABAD.

March 2018

i

DEDICATION

I dedicate this thesis to my beloved

Father and Mother

ii

DECLARATION The work reported in this thesis was carried out by me under the supervision of Dr.

Shabab Nasir, Assistant Professor, Department of Zoology, Government College University

Faisalabad, Pakistan.

I hereby declare that the title of thesis “Prevalence of ticks and tick-borne pathogens

from Punjab, Pakistan” and the contents of thesis are the product of my own research and no

part has been copied from any published source (except the references, standard mathematical or

genetic models / equations / formulas / protocols etc.). I further declare that this work has not

been submitted for award of any other degree/ diploma. The university may take action if the

information provided is found inaccurate at any stage.

Signature of the Student/Scholar

Name of Student: Marriam Batool

Registration No: 2011-GCUF-05235

iii

CERTIFICATE BY SUPERVISORY COMMITTEE

We certify that the contents and form of thesis submitted by Marriam Batool, Registration No.

2011-GCUF-05235 has been found satisfactory and in accordance with the prescribed format.

We recommend it to be processed for the evaluation by the External Examiner for the award of

degree.

Signature of Supervisor ………………….

Name: Dr. Shabab Nasir

Designation with Stamp……………………….

Member of Supervisory Committee

Signature ………………………………….

Name: Prof. Dr. Farhat Jabeen


Member of Supervisory Committee

Signature ………………………………….

Name: Prof. Dr Tayyaba Sultana


Chairperson

Signature with Stamp……………………………

Dean / Academic Coordinator

Signature with Stamp……………………………

iv

CERTIFICATE BY ETHICAL COMMITTEE,

DEPARTMENT OF ZOOLOGY

We certify that the contents and form of thesis submitted by by Marriam Batool, Registration

No. 2011-GCUF-05235 has been found satisfactory and in accordance with the prescribed

format. We recommend it to be processed for the evaluation by the External Examiner for the

award of degree.

Signature ………………….

Name: Prof. Dr. Salma Sultana


Signature ………………….

Name: Dr. Azhar Rasul


v

Plagiarism Undertaking

I solemnly declared that research work presented in the thesis titled “Prevalence of ticks and

tick-borne pathogens from Punjab, Pakistan” is solely my research work with no significant

contribution from any other person. Small contribution/help wherever taken has been duly

acknowledged and that complete thesis has been written by me.

I understand the zero tolerance policy of the HEC and Govt. College University Faisalabad

toward plagiarism. Therefore, I as an Author of above titled thesis declare that no portion of my

thesis has been plagiarized and any material used as reference is properly referred/cited.

I undertake that if I am found guilty of any formal plagiarism in the above titled thesis even after

the award of PhD degree, the University reserves the rights to withdraw/revoke my PhD degree

and HEC and the University has the right to publish my name on the HEC/University website on

which names of students are placed who submitted plagiarized thesis.

Student/Author Signature ----------------------

Name Marriam Batool

vi

LIST OF CONTENTS

Declaration ii

Certificate by supervisory committee iii

Certificate by ethical committee, Department of Zoology iv

Plagiarism undertaking v

List of contents vi-viii

List of tables ix-xi

List of figures xii-xiii

List of abbreviations xiv-xvii

Acknowledgements xviii

Abstract xix

Chapter 1 Introduction 1-6

Chapter 2 Review of Literature 7-32

2.1 Prevalence and identification of ticks 7-14

2.2 Tick-borne pathogens and diseases 14-23

2.3 Use of acaricides and medicinal plants to control ticks 23-32

Chapter 3 Materials and Methods 33-45

3.1 Study area 32-35

3.2. Collection and preservation of ticks 36

vii

3.3. Identification of ticks 36

3.4. Collection and identification of plant materials 36

3.5. Preparation of plants extract 37

3.6. Phytochemical analysis 39

3.6.1 Test for the confirmation of Flavonoids 39

3.6.2 Test for the confirmation of Terpenoids 39

3.6.3 Test for the confirmation of Alkaloids 39

3.6.4 Test for the confirmation of Tannins 39

3.6.5 Test for the confirmation of Saponins 39

3.6.6 Test for the confirmation of Steroids 39

3.6.6.1 Liebermann Burchard test 39

3.6.6.2 Salkowskis test 40

3.6.7 Test for the confirmation of Phenols 40

3.7 Bioassay 40

3.7.1 Preparation of stock solution of selected plants 40

3.7.2 Percent mortality 40

viii

3.7.3 Stock solution of selected acaricides 42

3.7.4 Percent mortality 42

3.8 DNA extraction 42

3.9 Using PCR for amplification of DNA of tick borne

pathogens 43

3.9 Statistical analysis 45

Chapter 4

Results & Discussion

46-107

4.1 Analytical characteristics of the population

46

4.2 Tick prevalence 46

4.3 Identification of tick species 61

4.4 Screening of ticks for tick-borne pathogens

74

4.5 Control of tick species 88

4.6 Phytochemical analysis 95

4.7 Prevalence of ticks in agro-ecological zones 96

4.8 Tick-borne pathogens 101

4.9 Tick control 106

ix

Summary 108-109

Conclusion 110

Recommendations 111

References 112-138

x

LIST OF TABLES

Table # Title Page #

3.1. Classification of selected plants of study 37

3.2. Specific primers sequence, PCR conditions and targeted

size of tick borne pathogens 44

4.1. Zone-wise tick prevalence (%) for overall data 47

4.2. . Animal-wise tick prevalence (%) for overall data 47

4.3. Season-wise tick prevalence (%) for overall data. 48

4.4. Animal-wise prevalence with respect to different seasons

for Southern zone 48


for Western zone 50


for Central zone 51

4.7.

Animal-wise prevalence with respect to different seasons

for Northern zone

52

4.8. Area-wise prevalence with respect to different Animals for

spring season 53

4.9. Zone-wise prevalence with respect to different animals for

summer season 54

4.10. Zone-wise prevalence with respect to different animals for

autumn season 55

4.11. Zone-wise prevalence with respect to different Animals for

winter season 56

xi

4.12. Season-wise prevalence with respect to different zones for

buffalo 57


cow 58


goat 59


sheep 60

4.16.

Prevalence of identified tick species in different farm

animals in Southern zone Punjab, Pakistan 68

4.17. Prevalence of identified tick species in different farm

animals in Western zone Punjab, Pakistan 69


animals in Central zone Punjab, Pakistan 70


animals in Northern zone Punjab, Pakistan 71

4.20. Analysis of variance for comparison of means 71

4.21. Means between animals, zones and tick species 72

4.22. Overall prevalence of tick-borne pathogens in agro-

ecological zones of Punjab, Pakistan 73

4.23. The overall prevalence of tick-borne pathogens in Southern,

Western, Central and Northern zones 74

xii

4.24.

Species of Babesia, Theleria, Anaplasmoisis and Ehrlichia

isolated from different tick species in Southern Zone

Punjab; Pakistan

77

4.25.


isolated from different tick species in Western Zone Punjab;

Pakistan

79

4.26.


isolated from different tick species in Central zone Punjab;

Pakistan

80

4.27.


isolated from different tick species in Northern zone

Punjab; Pakistan

82

4.28. Lethal concentration of selected plant extracts against tick

species 87

4.29. Lethal time of selected plant extracts against tick species 89

4.30. Lethal concentration of selected acaricides against tick

species 91

4.31. Lethal time of selected Acaricides against tick species 92

4.32. Qualitatively phytochemical analysis of selected plants 94

xiii

LIST OF FIGURES

Figure # Title Page #

1

Map of province Punjab in Pakistan and the districts from

where samples of tick were collected 35

2

(a) Calotropis procera, (b) Solanum nigrum, (c) Brassica

rapa (d) Trigonella foenum graecum (e) and Citrullus

colocynthis

37

3 Dorsal and ventral view of Hy. dromedarii 62

4 Dorsal and ventral view of Hy. truncatum (female) 63

5 Dorsal and ventral view of Hy. rufipes 63

6 Dorsal and ventral view of Hy. marginatum 64

7 Dorsal and ventral view Hylomma annatolicum 64

8 Dorsal and ventral view of Rhipicephalus appendiculatus 65

9 Dorsal and ventral view of Rhipicephalus sanguineus 65

10 Dorsal and ventral view of Boophilus microplus 66

11 Dorsal and ventral view Boophilus decoloratus 66

12 Dorsal and ventral view of Argas percicus 67

xiv

13 Agarose gel electropherosis for the presence of Anaplasma

and Ehrlichia spp. 84

14 Agarose gel electropherosis for the presence of Babesia and

Theileria spp 85

15 Agarose gel electropherosis for the presence of Babesia and

Theileria spp 86

16

Mortality (%) of tick species after 96 hrs in the different

concentration of plants extract

90

17 Mortality (%) of tick species after 72 hrs in the different

concentration of acaricides 93

xv

LIST OF ABBREVIATIONS

Acronyms Unsynchronized form

A. sativum Allium sativum

A. ovis Anaplasma ovis

A. centrale Anaplasma central

A. conyzoides Ageratum conyzoides

A Anus

A. marginale Anaplasma marginale

A. percicus Argus percicus

A.indica Azadirachta indica

AA Anus Aperture

A.absinthium Artemisia absinthium

AEZ Agro Ecological Zone

AG Anal Groove

AIT Adult Immersion Test

AO Anal Orifice

AP Adnal Plates

APSE Adnal Plates Square Ends

B. bigemina Babesia bigemina

B. bovis Babesia bovis

B. caballi Babesia caballi

B. decolratus Boophilus decolratus

B. microplus Boophilus microplus

B. rapa Brassica rapa

BLPRI Barani Livestock Production Research Institute

BPA Broad Prose Areas

C. adenocucaulis Cissus adenocucaulis

xvi

C. aurea Calpurnia aurea

C. colocynthis Citrullus colocynthis

C. didymobotrya Cassia didymobotrya

C. procera Calotropis procera

CA Caudal Appendages

CCHF Congo Hemorrhagic Fever Virus

Celisa competitive Enzyme-linked Immuno Sorbent Assay

CG Cervical Grooves

CG Caudal Grooves

CI Confidence Interval

CP Caudal Process

CS Curved Scutum

D. marginatus Dermacentor marginatus

D. metel Datura metel

DC Dark Conscutum

DF Dark Festoons

DMSO Dimethyl Sulfoxide

DS Dark sScutum

DSS Dark Setae on Spiracle

E Eyes Present

E. hirta Euphorbia hirta

EVPs Ethno-Veterinary Practices

GAS Genital Aperture Semicircular

GC–MS Gas Chromatography–Mass Spectrometry

GG Genital Groove

GO Genital Orifice

xvii

H. suaveolens Hyptis suaveolens

Hy. anatolicum Hyalomma anatolicum

Hy. dromedarii Hylomma dromedarii

Hy. marginatum Hyalomma marginatum

Hy. Rufipes Hylomma . rufipes

Hy. truncatum Hylomma truncatum

I. cicinus Ixodes ricinus

ISG Irregular Scapular Grooves

K. africana Kigelia Africana

LC Lethal Concentration

LG Pale Parma

LMP Long Mouth Part

LPT Larval Packet Test

LT Lethal Time

MG Marginal grooves

MG Maiden Groove

NAE Number of Animals Examined

NAI Number of Animals Infested

NARC National Agricultural Research Centre

NPP No of Poles Positive

NPT No of Poles Tested

NTC Number of Ticks Collected

O. sanctum Ocimum sanctum

OR Odd‟s Ratio

P. harmala Peganum harmala

PA Porose Area

PBL Pale Banded Legs

xviii

PCV Packed Cell Volume

Qpcr quantitative PCR

RAP Rounded Adnal Plates

Rh. appendiculatus Rhipicephalus appendiculatus

Rh. sanguineus Rhipicephalus sanguineus

S. nigrum Solanum nigrum

SC Sclerotized Conscutum

SC Sharp Capituli

SE Standard Error

SL Spurs on Legs

SMP Short Mouth Parts

SP Spiracular Plate

SSAP Small Sub Anal Plates

SSP Sparse Spot Distribution

T. annulata Theleria annulata

T. foenum-graecum Trigonella foenum- graecum

T. orientalis Theleria orientalis

T. ovis Theleria ovis

(TBDs) Tick-borne Diseases

TBPs Tick-borne Pathogens

TEC Total Erythrocyte Count

TLC Total Leukocytes Count

VSGA V Shape Genital Aperture

xix

ACKNOWLEDGEMENTS

First of all I would like to bow my head before “Almighty Allah” the Omnipotent, the Merciful,

the Beneficial who presented me in a Muslim community and also bestowed and blessed me with

such an intelligence to complete the research work successfully. Firstly, I would like to express

my sincere gratitude to my supervisor Dr. Shabab Nasir Department of Zoology, Govt. College

University Faisalabad, for the continuous support of my Ph.D study and related research, for his

patience, motivation, and immense knowledge. His guidance helped me in all the time of

research and writing of this thesis.

Respectful thanks to my supervisory committee Prof. Dr. Farhat Jabeen; Chairperson

Department of Zoology and Prof. Dr. Tayyaba Sultana Govt. College University Faisalabad for

their insightful comments and encouragement, but also for the hard question which incented me

to widen my research from various perspectives. I offer my heartfull thanks and gratitude to my

teachers Prof. Dr Salma sultana and Dr. Azhar Rasul whose kind and remarkable suggestion

help out to complete my thesis

I am extremely grateful to my parents for their love, prayers, caring and sacrifices for educating

and preparing me for my future. Also I express my thanks to my sisters, brothers and couzins

for their support and valuable prayers. My Special thanks go to my friend Aasma Noureen who

supported me in writing and incented me to complete this thesis successfully. I am also thankful

to the Mr. Zahid and Muhammad Sufian for their cooperative behavior during my research

work. Finally, my thanks go to all the people who have supported me to complete the research

work directly or indirectly. May Allah bless all these people with happy and pleasant lives

(Ameen).

Marriam Batool

xx

ABSTRACT

Ticks are the second to mosquitoes as vectors of a number of human and animals pathogens like

viruses, spirochetes, bacteria, rickettsia, protozoa and filarial nematodes etc. Important tick borne

diseases are Crimean Congo hemorrhagic fever, anaplasmosis, theileriosis and babesiosis that

cause mortality in humans and animals. So, this study was carried out to check the prevalence of

ticks and tick borne diseases in the Punjab, Pakistan. Three districts were selected from each of

four zones of Punjab. The total 120 livestock farms were randomly selected from 12 districts, 10

farms (05 urban and 05 rural) from each district. Tick species were collected in morning and

evening during 2016 to 2017 systematically from head to tail directions with the help of small

steel forceps. The tick samples were taken to research laboratory in clean and dry appropriately

labeled plastic bottles with muslin at the top for proper aeration. In the laboratory, the process of

preservation was carried out by keeping ticks into 70% methanol. On the basis of morphology

the collected ticks were distinguished microscopically with the help of dichotomous key. For

molecular studies, ticks from each species were individually used for the extraction of DNA.

Extracted DNA of ticks was stored at ‒20⁰C. The tick pathogens were confirmed by PCR using

specific primers. Different acaricides and plant extracts were used to control ticks. Prevalence of

tick and tick-borne pathogens were tested by χ2

tests and multiple logistic regressions model

which was performed in SPSS 21. To calculate the percent mortality the data were analyzed by

probit analysis using Minitab-15 statistical software. The total prevalence of tick-infected

animals was 36.52% (4382/12,000). The prevalence of tick was significantly least in the

Northern zone (33.47%) as compared to the Southern (36.33%), Western (35.83%) and Central

zones (40.43%). The total ten tick species i.e. Hylomma (Hy.) anatolicum (25.92%), Hy.

marginatum (14.05%), Hy. dromedarii (5.62%), Hy. truncatum (2.44%), Hy. rufipes (1.79%),

Rhipicephalus (Rh.) sanguineus (16.33%), Rh. appendiculatus (12.39%), Boophilus (B.)

microplus (14.2%), B. decolratus (5.15%) and Argus percicus (2.02%) were identified. Hy.

anatolicum and Hy. marginatum were the most abundant ticks spcies in all selected zones. Argas

percicus was found only in Central zone. The overall prevalence of ticks infestation in all

animals were 36.52% and it was significantly different in all animal species, like buffaloes

(37.53%), cows (42.41%), goats (36.14%) and sheep (29.00%). The prevalence of overall

evaluations of tick-borne pathogens in all agro-ecological zones was significantly different.

Highest prevalence was found in Ehrlichia spp. (16%) followed by Anaplasma spp. (9.1%),

Theileria spp. (9.03%) and Babesia spp. (4.14%). It was concluded that there is wider variety of

ticks and tick-borne pathogens in Pakistan. In case of control experiments, extracts of selected

plant (Calotropis procera, Citrullus colocynths, Brasica rapa, Solanum nigrum and Trigonella

foenum-graceum) also showed promising results along with acaricides.

1

Chapter 1

INTRODUCTION

Pakistan is basically an agricultural country with 21.2% contribution from agriculture

sector as Gross Domestic Production. The agricultural sector is believed to be the strength of the

rural economy as it provides employment to 45% of the workforce of the country. In Pakistan,

more than 70% of the population lives in rural areas and the majority depends up on livestock for

their subsistence (Mather & Abdullah, 2015). A variety of domesticated farm animal genetic

resources are present, generally referred as livestock, e.g., animals, like poultry, camel, goat,

sheep, buffaloes, cattle, horses and donkeys (Khan, 2004). In Pakistan‟s rural economy, the

livestock plays major role. Rural population (about 30-35 million) is involved in livestock raising

which helps them to obtain their earnings from it (Zulfiqar et al., 2012; Ashraf et al., 2013). In

Pakistan the dairy sector includes three kinds of producers, based on location and herd size,

small farmers producing more than 50% of the total milk, medium-sized producers recognized as

gowalas producing 29% of the whole milk and an efficient agricultural scheme producing ~ 20%

of the whole milk is known as large-scale producers (Jabbar et al., 2015; LDDDP, 2015).

The diseases which are related to parasites of different types are the prime disorder which

badly affects the production of animals. Parasites that live inside the animals called as endo-

parasites (hookworm and tapeworm) or ecto-parasites which attack on the body surface (ticks,

fleas, midges, mites, flies) (Admassu et al., 2015). Reptiles, amphibians, birds and mammals are

infected by ticks which are mandatory blood-sucking ectoparasites (Rajput et al., 2006; Aslam et

al., 2015; Ali et al., 2016). The economic and medical significance of ticks had long been

revealed due to their ability to transfer diseases to animals and humans. In order acarina ticks

make up the largest collection of creatures and belong to phylum arthropoda (Rajput et al.,

2006). Ticks are categorized into three families i.e. (Ixodidae, Argasidae and Nuttalliellidae) but

Argasidae (soft ticks) and Ixodidae (hard ticks) are of veterinary importance (Latif et al., 2012).

Hard ticks are the 80% of the world tick creatures, with the exemption of one tick specie in

family Nuttalliellidae while the residual are soft ticks (Guglielmone et al, 2010; Latif et al., 2012;

Ali et al., 2013). In domestic animals and humans, 10% of the total Ixodid and Argasid tick

species are known to spread disease (Jongejan & Uilenberg, 2004; Ali et al., 2013). Ixodid and

2

Argasid ticks vary in range of their morphological and biological characters. Hard ticks possess

sclerotized scutum, an apical hypostome, feed for prolonged periods in all life periods. Soft ticks

have a leathery skin; feed for short periods, their hypostome is situated anterior ventrally and

does not possess scutum (Mans & Neitz, 2004; Latif et al., 2012). Nuttalliella namaqua has been

designated as the „„missing link‟‟ among the tick families because it shared characteristics of

both Ixodid and Argasid tick families (Latif et al., 2012). According to a study from different

regions of Pakistan, the most commonly reported species of ticks were Rhipicephalus

(Boophilus) microplus (Rh.), Hyalomma (Hy.) anatolicum, Hy. marginatum, Rh. annulatus and

Rh. sanguineus (Durrani et al., 2008; Ramzan et al., 2008; Sajid et al., 2008).

The host is damage by ticks in two ways; directly by tick bites and indirectly by disease

spreading (Diyes & Rajakaruna, 2015). According to their life cycle, ticks are divided into three

groups, one host ticks, two host ticks and three host ticks. One-host ticks are the tick species that

persist on the host in two molting periods. In the two host species, the ecdysis of larvae to the

nymph stage take place on the host but after blood sucking nymphs deattach from the host,

sheds on the ground and then search a new host. Larvae and nymph leave the host for molting

and again find the host for feeding in case of three host tick life cycle (Mtshali et al., 2004; Ali et

al., 2013). The spreading of ticks is cosmopolitan, but occurs mostly in tropical and subtropical

areas (Durrani et al., 2008). Ticks of Pakistan are rich in number of genera and species. Because

Pakistan is a humid country which offers favourable environmental situations for multiplication

and growth of ticks (Durrani et al., 2008). The total rate of tick infestation (about 50%) has been

detected in Pakistan. Therefore, few studies showed the prevalence of tick taxonomy, infestation

and acaricidal activity (Durrani, 2008; Sajid et al., 2008, 2009a, b; Ali et al., 2016). For impact

the resistance and receptiveness of livestock to tick infestation numerous features like age, sex,

species, breed, season, photoperiod and management are responsible (Asmaa et al., 2014).

Grazing, muddy floor and tying of ruminants were found related with high infestation of tick in

animals (Sajid et al., 2009a; Iqbal et al., 2013). Likewise, factors of the risk related with tick

borne diseases (TBDs) have also been studied hardly (Ashraf et al., 2013; Iqbal et al., 2014;

Jabbar et al., 2015). Generally, hidden parts of the animals are damaged by ticks and cause

mortality and lower productivity. The incidence of TBD has increased and produced problems

related to health, over past two decades (Kaur et al., 2015). Harmful impacts of ticks to livestock

are irritation, stress, blood loss and depression of immune function. Because of the direct

3

diseases spread into the host, ticks are highly responsible for economic losses in term of reducing

quality of cow skin from twenty to thirty percent (Sultana et al., 2015).

Now a days, the most emerging infectious diseases are caused by zoonotic pathogens and

transmitted by tick vectors. As vectors of a number of human and cattle pathogens, ticks are

second to mosquitoes (Satta et al., 2011; Gosh & Nagar 2014; Kaur et al., 2015). Tick borne

infestation is a universal problem and an important hurdle in the health and production of

livestock which cause significant financial losses (Taswar et al., 2014; Kemal et al., 2016). Ticks

are important ectoparasites that are involved in transmition of different diseases e.g.

trypanosomiasis, babesiosis, theileriosis, anaplasmosis and toxicosis (Kaur et al., 2015). They are

the significant contributors of infectious diseases and cause mortality in livestock and humans

(Kamboj & Pathak, 2013). Tick-borne disease, anaplasmosis formerly known as gall sickness is

caused by a rickettsial microorganism (Kumar et al., 2015). The Symptoms of anaplasmosis

include abortion in pregnant animals, pyrexia, jaundice, anorexia, depression, progressive

anaemia, reduced milk production and death particularly in exotic breeds (Jabbar et al., 2015).

The theileriosis is transmitted by certain Ixodid ticks such as Hy. anatolicum anatolicum, Hy.

marginatum marginatum and Hy. anatolicum excavatum (Durrani et al., 2008; Kaur et al., 2015;

Akbar et al., 2014). Clinical indices of oriental theileriosis frequently comprise, jaundice,

lethargy, pyrexia, anaemia, weakness, mortality and miscarriage in female cattle (Aparna et al.,

2011; Islam et al., 2011). Babesiosis is also called the red-water disease and is caused by

different species of genus Babesia (Akbar et al., 2014; Jabbar et al., 2015). Major symptoms of

babesiosis include haemoglobinuria, anorexia, high fever, depression, icterus, abortion in

pregnant cows, and death may occur in serious cases (Durrani et al., 2008; Atif et al., 2012; Ali

et al., 2013; Jabbar et al., 2015). Due to ticks and tickborne diseases (TTBDs) the global loss was

expected to be between US$ 13.9 and 18.7 billion yearly (Gosh & Nagar, 2014). Economic

losses to animals production caused by ticks which affects the hosts in numerous methods such

as deterioration of the quality of skin, loss of blood and by transferring various viral and

protozoan diseases to other livestock (Ashfaq et al., 2015). Very few studies related to tick-borne

pathogens were done (Khan et al., 2013). So, there is a need to use modern tools like PCR for the

recognition of TBDs (Karim et al., 2017).

4

In Pakistan especially in Punjab; being the largest province with respect to the population

there is need to manage and control the ticks and TBPs (Nawaz et al., 2015; Adenubi et al.,

2016). In the world different chemical acaricides i.e. chlorinated hydrocarbons, synthetic

pyrethroids, organophosphates, formamidines and macrocyclic lactones have been used in order

to control ticks. But there are many disadvantages of using acaricides such as long residual effect

on milk and meat are risk for human health. These acaricides also contaminate environment and

water, so effects the non-targeting organisms (Brito et al., 2011; Gosh et al., 2015; Nawaz et al.,

2015). These issues urge the usage and promotion of substitute tick control resources. To control

ticks, many plants have been traditionally used worldwidely. Medicinal plants represent the most

prevalent and ancient form of medication (Nawaz et al., 2015). Because the plants are

environment friendly and have no residual influence. Plants material are the cheap source of

control and easily available to the poor owner of livestock.

Almost 80% of the world populations depend on old-style medicines for their health

which was assessed by the World Health Organization (Kharb et al., 2004; Sindhu et al., 2012).

Herbal drugs have commonly been used in the form of fruits and vegetables, and their extracts

can cure the diseases and care for health (Ullah et al., 2016). Therefore, the following plant

species were used in study to control ticks. Calotropis (C) procera L. is a perennial shrub, soft

wooded and is present in Pakistan, India and in other countries such as tropical Africa, Egypt and

Afghanistan (Najar & Khare, 2017; Shyma et al., 2014). It is usually recognized as “auk” in

Pakistan. The leaves and flower of this plant contain phytochemical compounds such as

alkaloids, flavonoids, terpenoids and saponins (Najar & Khare, 2017). The plants have been

described to keep anti-culex and anti-anopheles activity of mosquito (Elimam et al., 2009), anti-

mite, anti-acaricidal activity (Gosh et al., 2011; Iqbal et al., 2012; Shyma et al., 2014) and

repellant effects (Iqbal et al., 2012). C. procera is recognized to comprise cardiac glycosides that

are toxic to ticks (Al- Rajhy et al., 2003). Citrullus (C) colocynthis (L) is known as “bitter apple”

(Gurudeeban et al., 2010). In Pakistan and India, it is identified as “tumba” (Mahajan &

Kumawat, 2013; Hussain et al., 2014; da Silva & Hussain, 2017). The seeds of C. colocynthis

have nutritive qualities while the fruit pulp has therapeutic properties. Its fruit has been

commonly applied for the remedies of several infections comprising ulcer, diabetes, rheumatism,

paronychia and cancer. Because it is a high source of functionally significant therapeutics and

5

bioactive composites like triterpenes, cucurbitacins, glycosides and polyphenols (Hussain et al.,

2014) and anti-parasital (Farooq et al., 2008).

Trigonella (T) foenum-graecum L. belongs to the family Fabacecae. It is commonly

known as “maithe” in Pakistan and India. It is a legume widely cultivated in most areas of the

world due to its medicinal importance (Kor et al., 2013). This plant contains active components

such as alkaloids, flavonoids, steroids, saponins (Ullah et al., 2016). It is recognized to have

hypocholesterolaemic and hypoglycemic effects (Joshi & Rajni, 2007). It was also reported for

anti-inflammatory, anti-cancer (Hibasami et al., 2003), anti-diabetic and antioxidant effects (Kor

et al., 2013). Brassica (B) rapa commonly is known as “shaljam” in Pakistan. It belongs to

cruciferae family. It contains phytochemical compounds such as alkaloids, carbohydrates,

proteins and vitamins (Dinesh & Gopal, 2014). The stem and leaves are used in the treatment of

cancer (Coventry, 1923) its root barks have a natural insecticide that is effective against red

spider mites, aphids and flies (Allardice, 1993). Solanum (S) nigrum commonly is known as

“makoi” in Pakistan. It is native to Eurasia but widely distributed in American continent, Asia,

Australia, Europe and Africa. It has anti-inflammatory, anti-hyperlipidemic, antiseptic diuretic,

diaphoretic and antioxidant effects (Sindhu et al., 2012; Gosh et al., 2011).

There is still a deficiency of effective effort to examine distribution and incidence of

species of ticks causing livestock in Pakistan (Durrani et al., 2008). A number of the earlier

revealed research were limited to a lesser zone and did not study agro-ecological areas, sampling

strategies and manufacture organizations that are all aspects which can influence the ticks

prevalence and tick borne diseases (Jabbar et al., 2015). Furthermore, till now, there is no

research from Pakistan that discovered the recognized species of ticks from all over the Punjab,

Pakistan. It is hard to acquire precise and specific facts to plot the current prevalence and

spreading of ticks and TBPs. There is the lack of facts related to the prevalence of TBPs,

population dynamics and control of ticks.

Hypothesis

“The prevalence of ticks and tick-borne diseases varies regionally and plant extracts have

potential to control ticks and tick-borne diseases.”

6

Therefore, the present study was planned to investigate the prevalence of ticks, tick borne

pathogens and their control through acaricides and medicinal plants to attain the following

objectives

(i) Distribution of ticks across various topographical zones of the Province, Punjab.

(ii) Determination of potential of ticks in carrying pathogens of veterinary and public health

significance using advanced molecular tools.

(iii) Testing the efficacy of different commercial acaricides and plant extracts.

7

Chapter 2

REVIEW OF LITERATURE

Ticks are ectoparasites that are vectors of many animalas and human diseases. So, this

project was prepared to know their prevalence after identification of different tick species on

different animals, their control with acaricides and plant extracts and identification of pathogens

they carry in various agro-ecological zones of Punjab, Pakistan. This chapter comprising of the

following sections;

2.1 Prevalence and identification of ticks

2.2 Tick-borne pathogens and diseases

2.3 Use of acaricides and medicinal plants to control ticks

2.1 . Prevalence and identification of ticks

Rehman et al. (2017) conducted a research to find out the risk causes related with

abundant prevalence of tick in farms of animals and the distribution of ticks infesting ruminants

in the dry and semi-dry agro-ecological zones of Pakistan. Ticks were collected from nine

districts, 108 livestock farms and counted from 471 animals, comprising 194 buffaloes, 179

cattle, 18 sheep and 80 goats, including both arid and semi-arid agro-ecological regions. About

3,807 tick indicating four species were collected: Rh. microplus, Rh. turanicus, Hy. dromedarii

and Hy. anatolicum. For the first time, these species were reported from the study area. In the

arid regions Hy. anatolicum was the most plentiful species, while in the semi-dry regions Rh.

microplus was the predominant species. The rate of tick infestation in ruminants was 78.3%.

Examination of questionnaire statistics revealed that the higher tick prevalence in animals farms

related with the lack of rural poultry, not use of any acaricides, grazing and rural housing

systems were possible risk factors. They concluded that present study can be beneficial in the

arrangement of incorporated control methods for ticks and TBDs in Pakistan.

Riaz et al. (2017) carried out a study to check the variety and seasonal spreading of hard

ticks in goats and sheep by epidemiological survey in Multan (Pakistan). The collection of ixodid

ticks was done from randomly selected animals and on the basis of their morphological

characters identification of ticks was done. The results revealed that the rate of infestation of tick

observed in small ruminants was 48.0%. Sheep were mainly affected by ticks (50.0%) than goats

8

(43.6%). The prevailing tick species were Hy. anatolicum (52.2%) and Rh. sanguineus (17.4%).

The mixed infection in small ruminants observed was (30.4%). The tick prevalence in sheep and

goats varies according to age, sex and breed. The result revealed that tick prevalence was noted

maximum in Summer with respect to Winter season. They concluded from the study that more

infested sites were internal ear and external ear in sheep similarly internal ear was the most

infested site in goats.

Ali et al. (2016) carried out a study in river Ravi (Lahore) to illustrate epidemiological

characteristics of bovine infestation of tick. To check the tick infestation in bovines, they

examined about 532 buffaloes and 726 cattle. In cattle and buffaloes, the most prevalent tick

genera are Hyalomma and Boophilus. In bovines, the observed more affected gender were

females than males. According to age group the adults and youngs were more affected than old

in cattle and buffaloes. They concluded from the result that in bovines, the most appropriate

climatic conditions for ticks were Summer as compared to Winter, Spring and Autumn.

Kemal et al. (2016) carried out a study to find out the tick infestation rate and the related

risk factors in district Arbegona (Southern Ethiopia). About 2024 adult ticks were collected and

eight ticks species from three genera were recognized. A feedback form was also employed. The

results revealed that the incidence of infestation of tick was found to be statistically significant in

good, medium and poor body situation animal. They conclude from the result that the higher rate

of tick infestation was responsible for decreasing output, economic losses and causes harsh

effects on health of cattle.

Admassu et al. (2015) conducted a study in Dangila district (North West Ethiopia) to

estimate the infestation and identification of major Ixodid tick genra of cows. The tick infestation

rate was (56.2%) from randomly selected cattle. From the animal body parts, about 864 adult

ticks were collected, preserved with 70% alcohol and stereo-microscope was used to identify

upto genus level. Four genus namely; Hyalomma, Boophilus, Amblyomma, and Rhipicephalus

were identified from the total collected ticks and account for 37.5, 25.0, 23.1 and 14.4%,

respectively. Highest incidence of tick infestation was recorded in deprived body situation

livestock (62.9%) as compared to medium (59.4%) and good body situation (41.2%). They

9

concluded from this study that the prevalence of ticks can also be responsible for spreading of

TBDs and also cause physical damage to the skin.

Gharekhani et al. (2015) worked in Hamedan province, Iran on the identification of

Ixodid tick species on cattle and sheep. In 3 rural regions during the year of 2010 to 2011

sampling of tick was done on the complete body of sheep and cow. A total of 1534 hard tick

were collected in animals through which 62.1% were male and 37.9% female. The observed tick

infestation rate was in cattle ascompared to sheep. The results revealed that the dominant hard

tick species is Hy. marginatum.

Kaur et al. (2015) conducted a study on incidence of Ixodid ticks attacking cows and their

control through extracts of plant. Out of 2150 cattle, 1262 cows were found infected with ticks.

On the basis of seasonal trends, in rainy season rate of infestation of tick was higher as compared

to Summer and Winter. The prevalence of infestation of tick was found greater in female cows

than males. Ticks identification was carried out on the basis of their morphological characters,

identified ticks are Rh. microplus and Hemaphysalis bispinosa out of which the Rh. microplus

was rich. Due to acaricidal disadvantages like high cost, toxic to environment, non-

biodegradable, left residuals in animal body and above all development of resistance in ticks.

They concluded the importance of plant-based, effective anti-tick agent and less toxic, twenty

plants were selected in the present study that was used as anti-tick agent.

Ganjali et al. (2014) worked on the diversity of tick family Ixodidae and their distribution

in Iran. For this purpose, they randomly selected ticks from camels, cattle, sheep and goats. The

collected ticks were stored in 70% ethanol and examined under stereomicroscope for

identification. The results revealed that the presence of, Hy. Marginatum, Hy. dromedarii, Hy.

Schulzei Hy. anatolicum excavatum, Hy. asiaticum asiaticum, Hy. anatolicum anatolicum, Rh.

turacunis, Rh. bursa and Rh. sanguineus. They concluded that more investigations are important

to reveal the contribution of above tick species as vectors of different diseases.

Musa et al. (2014) conducted a research in Maiduguri (Nigeria) to check the incidence of

infestation of tick in different breeds of cows. The identified tick species from 205 cattle were

Boophilus microplus, Hyalomma spp, Rh. sanguineous, Amblyomma variegatum and

Ornithodorus spp. The tick infestation rate was significantly higher in males than females. In

10

Wadara and Kuri breed tick infestation was significantly higher. Under the tail/perineum, inner

thigh, external genitalia and the udder were the most tick-infested predilection sites. The

prevalence of tick infestation was lower in ears, eyes, neck, and all over the body. They

concluded through this study that prevalence of tick infestation among indigenous cattle was

high. It could hinder the rate of productivity and cattle production in Nigeria.

Soomro et al. (2014) carried out a study in the upper Sindh, Pakistan to estimate

incidence of ticks in buffaloes. The research was conducted related to host (age and species) and

study area to recognize and to calculate difference in the incidence of bovine infestation of tick.

Random selection method was adopted to collect samples from Kundi buffaloes. Main tick genus

was Hyalomma followed by Rhipicephalus. The rate of tick infestation in calves less than one

year was significantly higher than the adult livestock one to two years and greater than two years

livestock. Though, the location of the district was not related with the prevalence of tick

infestation. They concluded from results that the prevalence of ticks helps to understand for

development of the tactical and planned ticks control in local types of dairy animals.

Chhillar et al. (2014) conducted a research to check the prevalence of Ixodid ticks on

domestic cows and buffaloes in Haryana, India. A number of 867 ticks were gathered and

examined from 662 animals and the out of which 309 were affected with ticks of Ixodidae family

which belonged to three different genera. Identification of tick species of the three genera were

Rh. sanguineus (Latreille, 1806), Rh. (Boophilus) microplus, Rh. decoloratus, Hy. anatolicum

anatolicum, Hy. anatolicum excavatum and Dermacentor spp. They concluded from the study

that the most prevalent species of vector which affected cattle and buffaloes in this region were

Hy. anatolicum anatolicum and Rh. microplus. The periodic ticks prevalence and the related

management applications provided the basis for level of infestation.

Sharifinia et al. (2014) conducted a research in South West of Iran to show the existence

of hard tick and CCHF. In both fields of veterinary and medicine, many important arthropod-

borne diseases are caused by ticks, such as CCHF, Rocky Mountain spotted fever, lyme,

tularemia and as well as some types of encephalitis. Ticks were collected to identify the viral

infection and fauna of the hard ticks in livestock by random sampling. PCR method was

subjected to a sample of ticks for detection of viral infection. Ixodidae ticks (592) were collected

11

during the study period and seven known species i.e. Rh. sanguineus, Rh. bursa, Hy. dromedarii,

Hy. marginatum, , Hy. asiaticum, Hy. detritum and Hy. anatolicum were used for the detection of

the genome of CCHF virus, more than 20% of these ticks were examined. Through which 6.6%

species were found positive such as Hylomma. CCHF disease caused by hard ticks mainly infects

the large number of livestock. It is concluded from the result that all five species of Hyalomma

should act for the utmost CCHF vector. Precautionary measures could be used to overcome the

animal infestation and to diminish the transmission of CCHF on the basis of seasonal activity of

Ixodidae.

Patel et al. (2013) carried out a work on the economic effect of many tick species on

livestock. The research was conducted from July 2010 to June 2011 for observing the common

ticks.The overall prevalence of tick infestation rate was reported 60.07 % in cattle. The lowest

prevalence was observed 46.07% in January while the highest was recorded 75 % in September.

In Summer higher rate infestation of tick was observrd than in Winter season. According to age

the incidence of tick infestation was examined more in the animals of one year as compared to

the animals having age between one and three years. Similarly it was observed lowest in the

animals of animals of more than 3 years. Two tick species were recognized on the source of

morphological chracters i.e. Hy. anatolicum anatolicum and Boophilus microplus.

Katuri et al. (2013) worked on the investigation of site preference for the Ixodid ticks.

They gathered ticks out of 927 buffaloes and 1473 Cattle of four distinct villages, growing up

under unorganized farming and open grazing system. In both cattle and buffaloes, occurrence of

Rh. microplus was more than 50% of the ticks which is mostly found in abdomen followed by

neck in both cattle and buffalo. The dual infestation rate occurs 16% in cattle and 3 % in

buffaloes.The results were useful to determine the tick infestation rate in bovines based on their

site of predilection.

Singh and Rath (2013) planned a study in Punjab state (India) on epidemiology of hard

ticks in (N=4459) cows population belonging to eighteen districts of five foremost agro-climatic

areas from both sex and all age groups. The general prevalence of hard ticks and mix infestation

were Rh. microplus 58.06% and Hy. anatolicum anatolicum 50.16%. Highest rate of prevalence

Hy. anatolicum anatolicum and Rh. microplus were observed in sub mountain undulating region

12

(79.36%) and Western region (20.40%) correspondingly, between the several agro-climatic

regions. The results showed that Rh. microplus mainly existed in hot and humid environment

whereas, Hy. anatolicum anatolicum prefered arid and semi-arid environment. Through the age

wise distribution of groups, in calves having less than six months of age tick infestation rate was

maximum than six months to one year age group and minimum in greater as compared to one

year age group (55.02%). The observed infestation rate of ixodidae ticks was significantly higher

in males. They concluded that this study provides effective approach to control the ticks

management in bovines of the area.

Khan et al. (2013) studied different areas of Khyber Pakhtunkhwa, Pakistan to check the

prevalence of infestation of tick in buffalo and cattle. The present study was done on the basis of

two groups of climate; cold mountainous zone at an elevation of 1110m and hot dry zone at an

average of 500m beyond the sea level. In the same season at the different altitude, about 1223

(48.35%) cattle and 1306 (51.65%) buffaloes were observed and infestation of tick was

examined. Through the observation, consequences revealed that in the hot dry zone, the

infestation of ticks was higher at the lower elevations as compared to the cold hilly zones at

higher altitudes.

Perveen (2011) carried a study in the Northern, Pakistan to detect the dissemination and

identification of Ixodidae species on cattle. The most abundant species of tick was Amblyomma,

Boophilus microplus, Hyalomma dromedarii and Hyalomma anatolicum. However, cows were

subjected more at risk than buffaloes and ticks infestation rate was ranked third. Moreover,

buffalos, cows, sheep and goats harbored had more than one type of ticks, similarly, camels and

donkey harbored had only one type of tick. It is concluded from the result that this research will

help the farmers to increase farm productivity and will be aided in taking effective methods to

diminish infestation of tick and to improve controlling practices.

Durrani and Shakoori (2009) carried out a study to determine the optimum rearing

temperature and relative humidity for cows ticks Hyalomma in Punjab, Pakistan. From each

district they collected one hundred ticks of different genera. After identification the ticks of

Hyalomma genera were raised in research lab under the impact of moisture and variable

temperature. The incidence of Rhipicephalus (3.1%) and Hyalomma (12%) ticks in cattle were

13

observed. The bionomical study illustrated that during Spring pre oviposition period was longer

but in Autumn it was lowest. The egg production rate was higher at 34 0C and lowest at 15

0C.

The process of eggs hatching was maximum at 32 0C and 85% humidity. They concluded from

this study that the maximum numbers of eggs were produced with the rise in temperature while

the rate of development of ticks was not affected by variation in relative humidity.

Durrani et al. (2008) worked on bionomics of Hyalomma ticks in three different districts

of Punjab, Pakistan. In cattle, the observed lowest prevalence of Rhipicephalus was 3.1% and

highest prevalence of Hyalomma ticks was 12%. The study illustrated that preoviposition period

was maximum in Summer and minimum in Autumn. Variation in the development period of the

egg of Hyalomma occurred from season to season. At the temperature 1000C and 85% humidity

no oviposition was recorded. The rate of egg production was higher at 34 and lower at 150C. At

320C and 85% humidity, the process of eggs hatching was maximum .PCR test was used to

confirm Theileria infestation in the gut of ticks which demonstrated the lowest prevalence

(20.8%) for Hyalomma marginatum while it was highest (86.6%) for Hyalomma anatolicum.

Sajid et al. (2008) worked on the rate of hard ticks infestation in local ruminants of lower

Punjab, Pakistan. The purpose of this study in lower Punjab (Pakistan) was to find out the variety

and concentration of tick population infecting domestic animals. Randomly selected 700

buffaloes, 1050 cattle, 250 camels and 1400 goats and sheep were observed for the infestation of

tick. The recorded tick rate of infestation was greater in cows than in goat and buffaloes.

Hyalomma anatolicum was found in large number than Rhipicephalus sanguineus. They

concluded that effective measures were needed to control tick infestation rate to overcome the

economic losses.

Manan et al. (2007) carried out a research in boundary part of Peshawar to find out the

occurrence of Ixodid tick genra. In Parasitology Laboratory of Veterinary Research Institute,

Peshawar ticks were recognized for their types. They recorded that the infestation of tick was

influenced by status of body situation, month, age, effect of acaricides after treatment, housing

and feeding systems. The most prevalence of ticks were from genus Boophilus as compared to

Hyalomma, Rhipicephalus and Amblyomma. They concluded from the result that the infestation

of tick was more in late Summer and less in Winter. But they found that there was non-

14

significant impact of age, status of body situation and effect of acaricides after treatment on the

prevalence of ticks. Most of the ticks were found in tropical and subtropical areas during spring

and summer season. Most abundant tick species were found Boophilus microplus, Hyalomma

anatolicum and Hyalomma dromedarii. Highest prevalence was showed in cows followed by

buffaloes and prevalence was associated with sanitation of animals.

2.2 Tick borne pathogens and diseases

Karim et al. (2017) carried out a work on ticks and TBPs in livestock Pakistan. Samples

were morphologically recognized. Nineteen various species from three significant Ixodid tick

genera (Hyalomma, Haemaphysalis and Rhipicephalus) and couple of soft tick genera (Argas

and Ornithodorus) were detected. Out of these species of ticks, using a 454-sequencing stage the

bacterial diversity was determined by bacterial 16S rRNA gene sequencing. The remarkable

genera of bacteria were detected including, Corynebacterium, Rickettsia, Lactobacillus,

Lactococcus, Ralstonia, Clostridium, Enterobacter, Enterococcus and Staphylococcus. They

found 10% of total ticks were affected with rickettsial-specific amplicons. Evidence of infection

was observed in only Hy. dromedarii, Hy. anatolicum and Rh. microplus by using a quantitative

PCR (qPCR) assay. They concluded from the study that variety of pathogenic bacteria and ticks

in different tick species were present in Pakistan. Their results revealed confirmation for

T.annulata and Candidatus R. amblyommii infection in Hy. anatolicum, Hy. dromedarii and Rh.

microplus.

Hossain et al. (2016) worked on the prevalence of ecto-parasitic infestation in cows from

milk hut parts of Bangladesh. For this purpose they examined 400 cattle for ectoparasite from the

study zone. The result showed that the rate of prevalence was maximum in Rhipicephalus

sanguinus with respect to Boophilus microplus, Haematopinus eurysternus and Linognathus

vituli. They studied that in female the rate of infestation was significantly higher than male. The

ecto-parasitic infestation in weak animals was more common as compared to ordinary healthy

cattle. They also found that the prevalence was significantly higher in rainy season than Summer

and Winter.

Khan et al. (2016) carried out a research to find out the occurrence of Babesia (B.)

bigemina and B. boves in house hold dairies of district Bannu and Lakki Marwat, Southern part

15

of Khyber Pakhtunkhwa, Pakistan. They collected blood samples for a period of one year. They

examined thick and thin smear of blood in light microscope. The results revealed that total

prevalence of babesiosis were positive for B. bigemina and B. boves. They concluded that this

disease was more prone in Summer season than other season of the year.

Memon et al. (2016) conducted a research to check the epidemology of Theleria annulata

and its influence on buffaloes by clinical findings and microscopic examination in semi-urban

and city parts of Hyderabad, Pakistan. A number of 2400 buffaloes, 1845 were found infected

with ticks, 970 in semi-urban and 875 in urban areas of Hyderabad. By Giemsa-stained method,

out of 1845 tick infested bovine samples, 1680 were found positive for Theileria species. They

observed that infected buffaloes have clinical signs such as temperature, anorexia, lymph node

enlargement, loss of hair, open mouth with difficulty in breathing, projection of eyes, redness of

skin and feebleness. But, during the survey suspected buffaloes showed normal feed intake,

urination and defecation. In the peri-urban areas the incidence of the parasitic infection was

significantly higher as compared to urban areas. The result revealed from the study that peri

urban buffaloes were more vulnerable to theileriosis than the urban buffaloes. They concluded

from the hematological studies that Theileria annulata in buffaloes produced significantly effect

on erythrocyte and leukocyte indices, while, platelet indices remained unaffected from Theileria

annulata in buffaloes.

Demessie and Derso (2015) reviewed different microorganisms and ticks that caused tick

borne diseases. Babesiosis, anaplasmosis and theileriosis were most significant tick borne

diseases in ruminants in tropics zones. The pathogens Anaplasma marginale causes anaplasmosis

that is a rickettsial disease of blood. Babesiosis and theilerioses are tick- borne protzoal diseases

produced by the genus Babesia and Theileria. These diseases have world-wide distribution

affecting numerous species of mammals with a highest effect on cows. They observed that

ruminants with tick borne diseases had problems like reduce meat and milk production, cattle

type with greater genetics, mortality and vulnerable rise in miscarriage in addition to expenses

for cure and control efforts are demolishing the profits of cattle owner and population. They

concluded from the review that effective measures of tick borne diseases of animals were useful

to apply suitable precautionary and control measures.

16

Kumar et al. (2015) conducted a research in Jalandhar District of Punjab (India to check

the prevalence and seasonal occurrence of theleriosis in cows). For this study, 620 samples of

blood were gathered and identified.The overall incidence of theileriosis (9.35%) was noted by

Microscopic study of blood smears. They concluded from the study that the maximum

prevalence was recorded in Summer season.

Jabbar et al. (2015) conducted a study on bovines tick-borne diseases in Pakistan. This

present study briefly described a key on bovine TBDs and identified the breaks in knowledge of

bovine TBDs in Pakistan and understanding of these diseases and provided information to

improve instruments for the analysis and to regulate TBDs in this state.

Wamuyu et al. (2015) conducted a study for the molecular finding and characterization of

theileria that infects Connochaetes taurinus in the Maasai Mara National reserve (Kenya). The

main hosts of many species of Theleria are wild animal. In a few species including buffaloes, the

molecular description and identification of theileria has been studied. To distinguish the

relationship of the 18 small subunit of rRNA with known species of theleria, molecular-genetic

and phylogenetic analysis are used. It is revealed through the results that Connochaetes taurinus

were infected by three new theileria haplotypes. This research was conducted to check the

probability of theleria transmission between small domestic ungulates (sheep and goats) and

wildebeest.

Saad et al. (2015) worked on the zoonotic significance and prophylactic measure against

babesiosis. Large number of mammals was being affected by babesiosis worldwide that is a

vector borne infection produced by the different species of genus Babesia. All over the world,

babesiosis has zoonotic significance causing health hazards in human population and huge loss

to livestock industry. Ixodid ticks are the primary zoonotic vector of babesia. Prophylactic

measure against babesiosis in early times was delayed but due to development in research,

vaccines and the anti babesial drugs have been developed. This review highlights on rural

communities, the awareness of public sector, owners of animal husbandry and health department

about the risk of disease in KPK and control measure should be applied. Vaccines of low cost

should be designed for the prevention of babesiosis in cattles and human population.

17

Iqbal et al. (2014) conducted a study to check the incidence and effects of ectoparasitic

fauna on infesting goats in the district Toba Tek Singh, Punjab, Pakistan. They found the variety

of ectoparasites like ticks, lice, fleas, mites and flies. The prevalent species of ectoparasites were

Hy. anatolicum, Rh. microplus, Ctenocepahlides felis, Ctenocepahlides canis, Haematopinus

spp. , Damalinia spp. , Linognathus spp. , Psoroptes ovis, Sarcoptes scabei and Hypoderma ovis.

The prevalence of ectoparasites was not directly related with type of host, sex and age. During

Spring and Summer season the maximum frequency distribution of ticks and flies was examined,

while during the season of Winter the maximum prevalence of mites, fleas, and lice was

observed. Evaluation of biochemical parameters exhibited higher values in positive animals,

while a decrease was observed in hematological parameters due to infestation. They concluded

that the current study has important role for organizing effective measures to control

ectoparasites.

Javed et al. (2014) carried out a study in and around Lahore, Pakistan from March 2012

to February 2013 to check the prevalence and hematology of tick borne haemoparasitic diseases

in equines. Theileriosis was the most prevalent TBHD followed by anaplasmosis, babesiosis and

mixed infection in horses. Babesiosis was the most prevalent TBHD followed by mixed

infection, anaplasmosis and theileriosis in mules. It was revealed through statistical analysis that

species of TBHDs show significant difference among each other. All the equines showed that

due to tick infestation there was a remarkable increase in total leukocytes count (TLC) values

and slightly increase in total erythrocyte count (TEC) values from the healthy equines while

packed cell volume (PCV) remained in the normal range in horses and mules with a significant

association between them but PCV values slightly increased in donkeys with significant

difference in the values. In mules and donkeys, there was an increase in haemoglobin values but

decrease in horses than the healthy equines. The result revealed that there was a remarkable

difference in TLC and Hb values of all equines than the normal values of equines according to

the statistical analysis.

Sajid et al. (2014) carried out a research to find the occurrence in 700 buffaloes and 836

cows and risk issues for anaplasmosis in the populations of cows and buffaloes in the district

Khanewal, Punjab, Pakistan. To check the epizootiology of anaplasmosis, conventional optical

microscopy of Giemsa‟s stained blood films was used. The allocation of anaplasmosis, with an

18

overall prevalence was more in calves, females and buffaloes related to adults, cattle and males,

correspondingly. In studied animal population, anaplasmosis was observed and related with the

housing system, animal custody, breed, season and hygienic administration. Through this work

evidence of first report of anaplasmosis was collected about this region. They concluded from

the results that the data will not provide information to the dairy growers to adapt agricultural

practices however also will not provide effective measures to control the problem in the cattle

population of the district. To examine the anaplasma from haemoprotozoa such as Babesia and

Theileria, modern molecular tools are recommended.

Chen et al. (2014) worked on TBPs and related co-infections in Central China from ticks

of domestic animals. From April to December 2012, collection of ticks was done from domestic

animals including sheep, cattle and dogs from 10 villages of Xinyang. PCR and sequence

analysis were applied to check the TBPs and identifcation of ticks. About 308 ticks were

collected for the identification of tick and tick-borne pathogens. They concluded from the results

that ticks were abundant with both animals and humans pathogens. In these regions animals and

humans were at a high risk of piroplasmosis.

Bursali et al. (2013) carried a research to study the infestation of tick rate in humans in

the provinces of Kelkit Valley (Turkey). In this region, there was no taxanomic information

available about the tick species that infests humans. During the survey, 1,460 ticks were gathered

from humans who were infested by tick. In this region, a number of 19 species of ticks have been

identified on humans comprising 7 Hyalomma, 3 Rhipicephalus, 2 Haemaphysalis, 2 Argas, 2

Ixodes and Dermacentor species. For the first time, the prevalence of Dermacentor reticulatus

on humans was examined in Turkey.

Liyanaarachchi et al. (2013) worked on the particular zones of Sri Lanka to check the

epidemiology of ticks in farm animals. The main purpose of this work was to screen out the

variety of tick in farm livestock from particular parts of Sri Lanka. Moreover, the probability of

the overview of species of ticks into livestock from wild animals was also studied. During the

years 2009 and 2010, ticks were gathered in 30 places in the damp area and 30 places in the arid

area. In this study 18 tick species were recorded, representing a reasonable increase in tick

19

species described in animals in Sri Lanka. They concluded that unusual species of ticks were

found in livestock, which has been earlier stated only on wild livestock.

Ali et al. (2013) carried a research on cows and buffalo in Punjab, Pakistan to check the

epidemology of Theileria Annulata (Ixodid ticks). The ticks were collected from 30 animal farms

containing more than 25 animals (cow and buffaloes) in each. From 710 cattle and 320 buffaloes,

about 6263 ticks were collected. The epidemology of Hyalomma species was considerably

higher as compared to other genera of Ixodid ticks (p>0.05). The rate of infestation of ticks in

buffaloes (34%) was considerably lower as compared to cattles (70%). PCR outcomes revealed

that Theilleria annulata was identified in 40% Hy. dromedarii and 50% Hy. anatolicum ticks.

They concluded that species of Hyalomma are chiefly responsible for spread of Theilleria in

dairy animals.

Atif et al. (2013) conducted a research in three diverse districts of the Northern Punjab,

Pakistan to investigate seroprevalence of Anaplasma marginale infection between cows.

Multistage cluster random selection method was used to gather 1050 samples from selected

small frames and private animals farms. The competitive enzyme-linked immuno sorbent assay

(cELISA) was used to determine the prevalence of Anapalsma marginale infection. Between

dissimilar age groups and breed a significant relationship was found. In all studied districts, the

seroprevalence was significantly higher in small frames than private animals farms. They

concluded that Anaplasma marginale infection was more vulnerable to small holder‟s hybridized

cattle of more than four years of age in Summer season.

Shams et al. (2013) conducted a study in domesticated cattle of Khyber Pakhtunkhwa,

Pakistan to illustrate the specificity and sensitivity of PCR & microscopy in recognition of

babesiosis. From animal hospitals of district Karak and Kohat in Khyber Pakhtunkhwa Pakistan,

six hundred blood specimens of clinically supposed cattle were collected. Examination of thick

and thin smear slides was carried out through microscope. Through PCR using species specific

primers, extracted DNA from serum was amplified. Analysis of augmented product was done

after electrophoresis in ultra violet transilluminator. General incidence of Babesia was maximum

in cows (34.4%) as compared to cattles (27.5%) and calves (20.6%). Similarly through

microscopy overall prevalence was observed higher in cows as compare to cattle and calves.

20

They concluded from the study that PCR was more effective technique to detect babesiosis than

microscopy and suggested it for practical usage in Khyber Pakhtunkhwa Pakistan. To increase

the productivity of domesticated cattle definite measures shoud be taken out.

Atif et al. (2012) worked in Sargodha District, Pakistan to check the prevalence of

Anaplasma marginale, Babesia bigemina and Theileria annulata infections between cows. In

each month, samples were randomly gathered from particular small holders having 30 cows and

private animal farms having more than 50 cattle. The samples were gathered of indigenous and

hybridized cows of both sexes. A complete prevalence of haemoparasites 26.86% was revealed

by microscopic observation of the Giemsa stained blood smears. The infestation of Anaplasma

marginale was more than Theileria annulata and Babesia bigemina, respectively. Crossbred

cattle (29.1%) were more at risk of tick-borne diseases than the indigenous cows (17.7%).

Gender wise prevalence showed that female cows were more susceptible to TBDs as compared

to males. The transmission of tick borne diseases was higher in small holders as compared to

large animal farms. Through the Chi square analysis, association among selected tick borne

diseases and different breeds, season and farm size was observed. This research showed that

TBDs are predominant in the Sargodha district, Pakistan.

Moges et al. (2012) carried out a research in Chilga district, Northwest Ethiopia to show

species composition of hard ticks, change in climatic conditions and their distribution on cattle.

About 922 adult ticks were gathered and identified eight species from four genera. The most

abundant species of tick was Amblyomm variegatum while Amblyomm lepidum being the least

abundant. The quantity of ticks per cows was recorded smaller throughout the arid month while

the highest number was observed in the rainy season. Ticks distribution was more in dissimilar

body parts of the host like udder, groin, ear, mammary gland, neck, tail and anal part of which

udder; dewlap and tail areas were the main infected areas of the body as compared to face and

neck. Effective measures should take into account to diminish problems of tick infestation of

cattle.

Naz et al. (2012) carried out a work in Lahore-Pakistan to find out the epidemology of

theileriosis in small animals. To determine the incidence of theileriosis, a number of 529 animals

were chosen. Samples 59/529 were positive for theileria on microscopic investigation. The

21

incidence of Theileria spp. was recorded higher in sheep as compared to goats. Theileria

infection in goat was not affected by age sex and season. Age, season and sex had major effects

on theileria infection in sheep. Pyrexia was detected in about 85.71% sheep and 78.95% goat.

Singh et al. (2012) conducted a research in and around Ludhiana district (Punjab) to

check the prevalence of canine hepatozoonosis. From canines a number of 532 samples of blood

were gathered and observed during current study with the historical continual of high fever

existing at small veterniary clinics, Ludhiana, (Punjab). Gimsa stained technique was used to

examine the blood samples, peripheral blood smears exposed that 1.13% (6/532) of canines was

infested with hepatozoon canis that prevalence varies with dissimilar age groups. It was

concluded that the infestation of the parasite was comparatively maximum in females as

compared to male dogs.

Zulfiqar et al. (2012) worked in Southern Punjab for the identification of Babesia (B.)

bovis in blood specimens and its influence on the large ruminants. From Southern Punjab, six

districts including, Layyah, Multan, Bahawalnagar, Bhakar, Muzaffar Garh, and Vehari, from

large animals (144), containing cows (105) and buffaloes (39) blood samples were collected.

Through questionnaires, statistics on the qualities of animals and herds was gathered. Various

samples of blood and serum of calves and cows were calculated and compared with positive and

negative specimens for determination of the influence of B. bovis on the blood and serum profile

of infested ruminants. For B. bovis, 541-bp specific fragment were produced from 5 out of 6

sampling districts. They concluded from this study that it reveals the incidence of B. bovis first

time in large ruminant and this study will help to increase the livestock output by preventing the

disease babesiosis in the region.

Alim et al. (2011) carried out a study in Chittagong division, Bangladesh to check the

occurrence of hemoprotozoan diseases in cow population. In three consecutive seasons, samples

of blood were randomly chosen from 216 hybridized and 432 native cattle of four typical areas.

Giemsa's stained blood smear technique was used to examine the samples. In this study the

observation of the effect of geography, season, age and sex was carried out in cattle during this

study. In crossbred and indigenous cattle the overall prevalence of hemoprotozoan diseases was

observed 16.18 and 12.02% correspondingly, where babesiosis and anaplasmosis were prevalent.

22

The highest prevalence of babesiosis (9.25%) was noted in hilly area but found to be reliable in

all the four different areas. In Summer season the hemoprotozoan diseases were predominant

than Winter and rainy seasons. Adult cows were considerably (P<0.05) at risk to babesiosis as

compared to younger. Babesiosis in crossbred cow was statistically important so that female

ruminants were more vulnerable to hemoprotozoan infestation as compared to male. They

concluded that breed and season play important role to examine the hemoprotozoan diseases.

Satta et al. (2011) carried out a research to check the symbionts and pathogens in ticks.

They conducted a research in Sardinia, (Italy) on the distribution of tick species and existence of

tick transferred micro-organisms. From mammalian hosts, a number of 1485 adult ticks were

gathered. Ticks identification was carried out to determine the existence of Rickettsia species of

the spotted fever group, Leishmania species, Anaplasma phagocytophilum, Bartonella species,

Coxiella burnetii and Ehrlichia canis by PCR analysis. Only Hyalomma marginatum

marginatum produced negative results among all tick species examined. They revealed from the

results that recorded data provided information on tick-borne diseases and could be helpful to

understand the prevalence of ticks in Sardinia.

Irshad et al. (2010) studied on sheep and goats at National Agricultural Research Centre

(NARC) Islamabad and Barani Livestock Production Research Institute (BLPRI) Kherimurat

district Attock, Pakistan to check the epidemology of infestation of tick and theileriosis. For the

presence of ticks, about 662 animals (443 goats and 219 sheep) were monitored. Of these, goats

and sheep were observed infested with several tick species. Within two homesteads combined in

sheep and goats, the difference in incidence of ticks was significant (P≤0.01). In different months

of research, difference in the incidence at BLPRI was significant, while at NARC was non

significant. On the basis of their morphological characters ticks were recognized. Both in sheep

and goats the most plentiful tick infecting was found Rhipicephalus spp. They concluded from

the results that the infestation of theileriosis in goats was 3.8%, while in sheep it was 7.36%.

Qamar et al. (2009) carried out a research in buffaloes at Rahim Yar Khan, Pakistan to

illustrate the epidemology of blood protozoans. Five hundred blood samples were gathered to

examine the incidence of different blood protozoans such as trypnosoma, theileria and babesia in

23

buffalo's blood. The study showed that the most abundant blood protozoans was babesia, while

prevalence of theileria was second and trypnosoma was found to be least prevalent.

Prevalence of diseases and tick-borne pathogens were associated with season and

geographical areas. Most prevalence diseases were theleriosis, babesiosis, anaplasmoisis and

ehrlichiosis caused by Theleria, Babesia, Ehrlichia and Babesia species of pathogens. These

were mostly identified through PCR.

2.3 Use of acaricide and medicinal plants to control ticks

Avinash et al. (2017) carried out a study to demonstrate the acaricidal activity of extracts

of Azadirachta indica. On fresh larvae the acaricidal action of chloroform and hexane extracts of

leaf of neem and deltamethrin were observed through the use of larval packet test (LPT).

Azadirachta indica was very critical therapeutic plant. The most important ectoparasites of farm

animals are Rhipicephalus (Boophilus) microplus. Conservative tick manipulate is specially

based totally on the application of artificial chemical substances, but ticks are growing resistance

against the acaricides and also have several negative outcomes. The LC50 and LC90 have been

maximum for hexane leaf extract at 2139.34 and 8687.70 ppm, correspondingly. By means of

contemporary sensitive gas chromatography–massspectrometry (GC–MS) the composition of

chemical extracts was also evaluated. They concluded from the study that phytogenic mixtures

contain the acaricidal action and also ecological.

Zaman et al. (2017) reviewed literature about the plants reported for having acaricidal

and anthelmintic properties. Socio-economic and geo-climatic conditions provide a favorable

climate for parasitic population of cows in Pakistan. Livestock industry is mainly affected by

hard ticks and gastrointestinal nematodes. Hard ticks play vital role in destruction of livestock

industry. To control these parasites, stockholders depend on synthetic drugs. This study was

conducted to determine the effectiveness of the medicinal plants against ticks and gastrointestinal

nematodes. Disposition of researchers to evaluate medicinal plants as anthelmintic was higher as

compare to acaridicals. However, absorption of cutting verge skills in evaluation method of

medicinal plants was suggested.

24

Adenubi et al. (2016) carried out a study on the extracts of plant to control ticks of

medical and veterinary importance in developing countries. The present study carried out in

laboratory to check the tick-repellent or acaricidal activities of medicinal plants. The extracts of

plant were used to control the different stages of ticks. About 200 species of plants from different

countries act as control strategy and have acaricidal or tick-repellent properties by vitro assays.

The extracts of several plant parts were most effective such as control strategies. Species

containing Azadirachta indica, Pelargonium roseum, Lavendula augustifolia, Gynandropsis

gynandra and Cymbopogon spp. had virtuous larvicidal and acaricidal activity with 90–100%

effectiveness as compared to those of presently use acricides. Various energetic composites like

geraniol, citronellal, carvacrol, azadirachtin, and linalool have been separated. The rural

livestock farmers mainly used large amount of plant extract to control tick infestation rate. The

effective acricides are prepared by plant-based mixtures or it might be a good source of new

acaricide compounds to perform active control strategy of ticks.

Nyahangare et al. (2016) studied the severe oral toxicity of mammal and impact of

diluents on efficiency of Maerua edulis De Wolf against larvae of Rhipicephalus decoloratus

species. Serial dilution of 5, 10, 20, and 25 % were made to form standard solution. To make

standard solution 25%w/v cold water plus surface active agent, hot water plus surface active

agent, methanol or hexane was used. These stock solutions were used to extract ground leaves

separately. Twenty larvae of Rhipicephalus decoloratus tick were sited in filter papers saturated

with excerpts for each concentration and the process of incubation was done after 24 h and 48 h

to observe the mortality rate at 27∘C and 85–90% RH. It is observed that the rate of larval

mortality was not dissimilar from the amitraz-based control which was maximum in methanol-

extracted M. edulis treatments. The rate of mortality was also lower in cold water as compared to

hot water plus surfactants treatments .They concluded from the results that methanol or hot water

extract of M. edulis were effective medication to control tick.

Nyigo et al. (2016) carried out a study to evaluate the consequences of medicinal plant as

acaricide against Boophilus species. To check the acaricidal impact of plant extract, adult and

larval immersion tests had been used. The end result found out that methanol and ethanol

extracts from leaves confirmed low adulticidal and larvicidal mortality, respectively. A non-

extensive activity of mortality showed from different extracts of this plant. They concluded that

25

for subject trials it is not suggested, as a substitute to determine its opportunities mainly using

sparkling plant material additional research is needed.

Mirania et al. (2016) carried out a research in Tharparker, Sindh; Pakistan on the records

of ethno veterinary plants for the cure of several buffalo and cow diseases. In Sindh province,

people living in Tharparkar depend on customary methods to solve health complications of their

animals and have rich heritage of indigenous knowledge. Hence this research was carried out to

demonstrate the application of therapeutic plants, their method of preparation and usage of these

ways for the cure of several diseases in this part. Ethno veterinary data was generated by

observation, semi-structural interviews and emphasis on group negotiations. To illustrate the

kinds of herb used against specific disease and dose, way of drug management and drug

preparation, observations were prepared. A number of 35 species of plants were recorded more

effective against 15 common diseases. The widely used plants in the study part were Plantago

lanceolata, Brassica campestris, Trachyspermum ammi, Capparis deciduas, Phoenix dactylifera,

Nicotiana tabacum, Azadirachta indica and Capsicum annuum. The most frequently used

botanical family of plants was Apiaceae followed by Fabaceae. Fruits, rhizomes, latex, seeds,

leaves, bulbs and husk were the most commonly used plants parts. Most repeatedly methods used

for drug preparation were pulverization. In the preparation of traditional drugs plants are the

most widely used components. In the study area, farmer used the reported medicinal plant for the

treatment of cattle and buffaloes in different health problems. This study suggested that the

described species of plants can be exposed to scientific authentication in demand to commend

more active treatments and preparations.

Chawech et al. (2015) studied on Citrullus colocynthis (L.) Schrad to check the

antibacterial activity and chemical composition of extracts and compounds separated from it.

The main purpose of this work was the phytochemical analysis of several extracts of stems and

leaves. It was made with three increasing quantity of polar solvents such as (methanol, ethyl

acetate and n-hexane) of Citrullus colocynthis. The key objective of this study was application of

the agar disc well-diffusion process to examine the antibacterial action of several extracts and

ethyl acetate extract of leaves. It is revealed through the results that latent antibacterial was

observed in ethyl acetate extracts of leaves and stems related to other excerpts in counter to

verified Gram-positive and negative microbial strains. Leaf extract of C. colocynthis (Ethyl

26

acetate) recommended the recognition of eight other cucurbitacins through LC-MS analysis. The

importance of sugar moiety was characterized by antibacterial activities of the isolated

compounds. The highest significant minimum inhibitory concentrations (MIC) standards were

found for Gluco cucurbitacin E 1.25 mg/mL against both Bacillus cereus and Enterococcus

faecalis and the ethyl acetate excerpt 0.625 mg/mL against Bacillus cereus.

Gosh et al. (2015) conducted a study to manipulate the acaricided resistant in animals

ticks, Rhipicephalus microplus from medicinal plant extracts. For trying out distinctive extracts,

the adult immersion test turned into adopted. Screening criterion primarily based on 72 h, 95 %

ethanolic extracts of Argemone mexicana complete plant and of Datura metel fruits had been

discovered powerful displaying extra as compared to fifty percent mortality of handled ticks. The

ninty five % ethanolic excerpts of both plants showed reproductive inhibitory and acaricidal

consequences on handled ticks. The LC90 values of Datura metel have been 7.13 and Argemone

mexicana 11.3 % had been determined, respectively. Phytochemical research confirmed the

existence of phenolics, flavonoids and terpenoids and alkaloids in Argemone mexicana complete

plant extracts and alkaloids and glucosides in Datura metel fruits. The effects discovered that

those botanicals may also play a big function to control ticks by decreasing the use of chemicals

and may be to achieve resistant tick population in surroundings responsive way.

Ohimain et al. (2015) research on the acaricidal activities of simple extracts of Ocimum

(O.) sanctum and Hyptis (H.) suaveolens towards Rhipicephalus sanguinneus. Solvent extract of

H. suaveolens precipitated LC50 at 175.00, 81.25 and 225.00 ppm, correspondingly from

chloroform, methanol and n-hexane extracts however O. sanctum showed mortalities for

chloroform, methanol and n-hexane extracts at 200.00, 137.50 and 287.50 ppm, respectively. In

the meantime, at 1 ppm the positive control became poisonous, while within the negative control

the tick turned into survived. The findigs discovered that solvent excerpts of H. suaveolens and

O. sanctum may be applied as acaricides for the management of canine tick Rhipicephalus

sanguinneus.

Nithya et al. (2015) carried a study on the activity of acaricide of shoot extracts of

Annona (A) squamosa, Azadirachta (A.) indica and Calotropis (C.) procera in vivo situation.

With methanol and water plants had been extracted and under in vivo circumstance the extracts

27

had been tested towards the cattle ticks. As tested individually the alcoholic and aqueous extracts

of A. indica showed highest mortality rate of ticks observed with the aid of A. squamosa and C.

procera. In combination of plant excerpts, on 5th day hot water excerpts of dried leaf powder

exhibited a hundred percent mortality of ticks even as ethanol and methanol excerpts confirmed

eighty three and eighty percent mortality, correspondingly. They concluded from the above

experimental results that the selected plant constituents have greater acaricidal pastime towards

farm animals ticks. They also conclude that the plant extracts in combinations are extra powerful

than single drug used.

Ullah et al. (2015) carried a research to assess the acaricidal efficacy of the aqueous

methanolic excerpts of fruit of C. colocynthis, rhizome of Curcuma longa and seed of Peganum

(P.) harmala. The activity of acaricidal plant excerpts was tested by larval immersion test in lab

against Rhipicephalus microplus. Acaricidal activity of every plant differs with specific exposure

times i.e., 24 hours and 6 days after exposure. Acricidal activities of plants were time and dose

dependent. The herbal components were appropriate for the poor farmers as a reasonably-priced

and wide spectrum antiparasitic. The mixture of flowers might be endorsed for use at farm stage

based on empirical suggestion of its anti-parasitic activity.

Nawaz et al. (2015) carried out a study to assess anti-tick activity of aquous extract of

Azadirachta indica, Morus alba and Dalbergia sisso against the larvae of Rhipicephalus

microplus. Acaricidal properties of vegetation and ivermectin were tested after 24h and six days

of remedy by using syringe test. LC50, LC90 and LC99 values had been observed for extract and

ivermectin. This considerable difference among LC50 values after 24 h and 6 days implied these

plants extract were greater poisonous after 6 days of treatment. Likewise, substantial difference

was found between LC90 and LC99 of plants extract and ivermectin. Time structured reaction of

water extract of plant was detected. They concluded from the results that extract of these plants

could be used to control ticks and for development as herbal acaricide.

Krishna et al. (2014) studied the activity of acaricide of the petroleum ether excerpt of

leaves of Tetrastigma leucosta through adult immersion test (AIT) against Rhipicephalus

(Boophilus) annulatus. At distinctive concentrations the percent mortality of adult, blocking off

of hatching of eggs and inhibition of fecundity were studied. The 10% concentration of the

28

extract confirmed 32% of adult tick mortality, 88.96% inhibition of fecundity and 50% inhibition

of hatching. After five days of remedy peak mortality rate was found. The rates of ticks mortality

were concentration dependent. Against Rhipicephalus annulatus, the LC50 of the extract were

10.46%. At least seven polyvalent compounds had been present in the HPTLC profiling of the

petroleum ether excerpt. They concluded from the result that the mortality of ticks and inhibition

of the fecundity were indication of synergistic effect of the bioactive additives.

Shyma et al. (2014) conducted a study on the methanolic extract of Azadirachta (A.)

indica, Datura (D.) stramonium, leaves of Calotropis (C.) procera, cloves of Allium (A.)

sativum, and Carica (C.) papaya for acaricidal activities against Rh. microplus. The rate of

mortality in adults was 12.5% within 15 days. The mortality of adult tick was maximum at the

highest concentration 66.67% for C. procera, 73.33% for D. stramonium, 80.00 % for A.

sativum, and 93.33 % C. papaya extracts. The Rate of inhibition of fertility of treated groups was

concentration dependent and differed mainly from the control group. However, calotropis, neem,

and datura were able to decreasing hatchability by 20, 50, and 70 %, correspondingly. They

concluded from the results that the excerpts of cloves of A. sativum and seed of C. papaya have

very significant acaricidal activities and could be alternative of Rh. microplus a potential

component of tick control strategy.

Mkangara et al. (2014) assessed the outcomes of medicinal plant Commiphora

swynnertonii stem bark extracts as acaricide against adult Amblyomma variegatum and

Rhipicephalus appendiculatus. Petroleum ether, ethyl acetate and methanol have been used as

solvent for plant extraction. The concentrations of extracts had been examined at 60, 70, 80, 90

and 100 mg/mL. All extracts showed acaricidal activity that was concentration and time

dependent. After 156 hours of exposure, the result confirmed that the petroleum ether extract

showed distinctly excessive acaricidal activity with LC50 of 72.31 and 71.67 mg/mL causing

mortality of Amblyomma variegatum was 100% and against Rhipicephalus appendiculatus was

87%. They concluded from the outcomes that Commiphora swynnertonii could be used for the

control of tick.

Parveen et al. (2014) studied the effectiveness of ethanolic excerpts acquired from the

aerial components of Ageratum (A.) conyzoides and Artemisia (A.) absinthium against Rh.

29

microplus through AIT in vitro. Five different treatments of the excerpt (1.25%, 2%, 5%, 10%,

and 20%) were used for bioassay. For every treatment, three replications had been used. In AIT,

the most mortality was observed for A. conyzoides (40%) and A. absinthium (66.7%) at 20%

concentration. The highest acricidal activity was observed in the excerpt of A. absinthium with

LC50 and LC95, respectively. Special concentrations of the excerpts were used to handle the egg

of the live ticks that became appreciably lower as compared to control ticks; subsequently, the

oviposition values and generative index of the handled ticks had been reduced extensively. They

concluded that A. absinthium has efficent activity of acaricide as compared to A. conyzoides and

can be beneficial in monitoring Rh. microplus.

Opiro et al. (2013) investigated the repellencey of four plant species extracts Cissus (C.)

adenocucaulis, Cassia (C.) didymobotrya, Kigelia (K.) africana and Euphorbia (E.) hirta on the

larvae of Rhipicephalus appendiculatus. The outcomes had been evaluated that three different

organic solvents of different polarities i.e hexane, methanol and dichloromethane have been used

to obtained extracts by way of the fingertip repellence bioassay. The research verified that each

one excerpts assessed showed a repellence impact that fluctuated from fourty three to eighty

eight percent. The application of dissimilar extraction solvents did not significantly vary

repellence impact, for all four plant species. The satisfying repellence percentages exhibited by

C. didymobotrya and K. africana. These shows the strong capacity of these flora for tick

manipulate in an incorporated tick management system for farm animals owned with the aid of

resource-terrible farmers in Northern Uganda.

Leschnik et al. (2013) carried out a research in Eastern Austria to illustrate the effect of

acaricidal action on tick prevalence and immunal response in tickborne pathogens in naturally

infected dogs. In this study, about thirty dogs were cured with fipronil plus S-methoprene,

permethrin, or supported as untreated control. Dogs were medically inspected and tested for

antibody reactions against Anaplasma phagocytophilum, Babesia canis and Borrelia burgdorferi,

over a period of 11 months. About 2/3 of all dogs had showed an optimistic immune reaction for

one or more pathogens. For canine babesiosis, only three dogs showed positive response whereas

the other dogs remained healthy. Application rate does not correlate with individual number of

ticks per dog. If owner did not use acaricides frequently, no effect on the number of contagions

could be observed while total of ticks was noticeably decreased through applying drugs. Clinical

30

disease caused by tick borne pathogens are rare in dogs exposed to tick-borne pathogens is rare

to make application of acaricide more effective, Extra educational teaching for dog owners about

the avoidance of TBDs was recommended.

Petro et al. (2012) conducted a study to illustrate the effectiveness of cypermethrin

against cow ticks in Tanzania. The laboratory evaluation was accompanied recommended by

FAO using laboratory reared tick species through larval packet test .The results showed that the

three weeks old larvae of Rhipicephalus appendiculatus were vulnerable to the technical grade of

cypermethrin. Two herds which were 3 kms apart from each other were treated with

recommended dose rate (0.01%) of vapco cypermethrin 10 EC once fortnightly while the other

herd was untreated. They concluded from the results that number of ticks reduced enormously in

the treatment group the vapco cypermethrin while the number of ticks remained less in the

control group throughout the study period. The maximum effectiveness was observed after

fourteen day dipping.

Sindhu et al. (2012) documented study to find out the ethno-veterinary applications to

cure parasitic infections in livestock. Visits of area, interviews and group negotiations were

planned to accumulate the records over a period of six months. A complete of 96 ethno-

veterinary practices (EVPs) has been recognized through which 66 had been primarily dependent

on medicinal plants and thirty on other natural and inorganic substances. About thirty five plants

from twenty three families had been recognized for the remedy of diverse sponging infections.

The pinnacle ten maximum often applied plants were: Ocimum basilicum, Aloe vera,

Azadirachta indica, Citrullus colocynthis, Brassica rapa, Nicotiana tabacum, Withania

coagulans, Ferula asafetida, Eruca vesicaria and Allium cepa. There was variety in the usage of

plants in their dose, way of instruction, portion used and signs. The maximum often revealed

remedies had been for the treatment observed by means of fly infestation, helminthiasis and tick

infestation. On a general foundation, farmers articulated their approval for the documented

EVPs. The present study provides information about these plants and its powerful use for

controlling parasitic infections regularly occurring inside the region by means of the local animal

husbandry. It was revealed through the result that regular usage of doses of plants and the use of

medical tactics would be helpful to the farmers, medical community and pharmaceutical

enterprise.

31

Brito et al. (2011) worked on the evaluation of the performance of acaricides utilized in

dairy herds elevated in the Brazilian SouthWestern Amazon to control the Rhipicephalus

microplus. A complete of 106 populations had been gathered from five cities, to evaluate the

efficacy of acaricide molecules. The adult immersion test (AIT) was used for control of

Rhipicephalus microplus. They concluded that the acaricide preparations had various impacts at

the tick populations observrd.

Zorloni et al. (2010) studied the efficacy of Calpurnia (C.) aurea extracts against the tick

infestation. In Southern Ethiopia; water, hexane and acetone leaf extracts of C. aurea had been

established for acaricidal and repellent properties against unfed adult ticks Rhipicephalus

pulchellus. In comparision to several other plants, the C. aurea excerpts did not have repulsive

possessions but alternatively it had moderate attractant ability. By twenty and ten percent acetone

excerpts, all ticks were either destroyed or their movement was harshly assigned after one μl of

excerpt changed into typically carried out on the stomach. At five% concentration, 85% of ticks

had been nevertheless influenced. A 10% aqueous solution additionally had an obvious

influence. The outcomes showed the efficiency of the conventional usage of this excerpt and

might lead to a product that could be applied commercial to prevent tick prevalence.

Durrani et al. (2009) carried out a research to check the behavior of therapeutic trials of

natural plant Calotropis procera and buparvaquone in hybrid cows after trial contagion with

Theileria annulata during the months of May to August, 2007. Extreme clinical reactions had

been recorded after experimental contamination. An association between medical responses and

piroplasm parasitemia and schizont parasitosis was also noted. The livestock were beared from

excessive fever, sub scapular lymph nodes and swelling of sub mandibular, weak spot, improved

respiratory and rhythm, anorexia, corneal opaqueness, condition loss and difficult hair covering.

By applying T. annulata particular primers N516/N517, 721-bp fragment of SSU rRNA was

changed into augmented from DNA of salivary glands and the inner organs of Hyalomma ticks.

The effects of therapeutic findings showed that the macrocytic hypochromic anaemia in

experimentally infested animals was improved by C. procera therapy. The end result revealed

that through the treatment of liver and kidney features with C. procera did not confirm

poisonousness at the dosage of 0.3 mg/Kg orally. They concluded from the study that the

effectiveness of C. procera was greater with respect to buparvaquone.

32

Kone et al. (2008) carried out a study to illustrate the use of medicinal plants for

veterinary purposes by rural communities of Northern West Africa. Ethno veterinary medicine is

the foremost alternative for the treatment of several diseases and disorders of their livestock.

Medicinal plants (55) were reported by breeders that belong to 40 genera and 30 families. Herbal

medication was mostly used as decoctions, crushed fresh plants or powdered plant material to

treat disorders of the eyes, gastrointestinal and respiratory tracts.

No doubt chemical control method is quick but it is harmful for animals and human

beings too. It is also a main cause of tick resistance, so now days most researchers are trying to

control with botanicals that are environment friendly and do not cause any harm to animals.

33

Chapter 3

MATERIALS AND METHODS

The study entitled “prevalence of ticks and tick borne pathogens from Punjab, Pakistan”

was conducted in Research Laboratory of the Department of Zoology, Government College

University Faisalabad.

3.1. Study Area

The research was focused to find the ticks prevalence, their management with plant

extract and acaricides and tick borne pathogens in livestock farms. The research work was

conducted from 2016 to 2017 in four different seasons (Autumn, Winter, Spring and Summer).

This study was carried out from four agro-ecological zones of Punjab, Pakistan, i. e.

Southern zone

a. Muzaffargarh

b. Bahawalpur

c. Rajan pur

Western zone

a. Khushab

b. Bhakar

c. Layyah

Central zone

a. Jhang

b. Gujranwala

c. Faisalabad

Northern zone

a. Rawalpindi

b. Attock

c. Chakwal

34

The study coveres four periods that are Autumn (August to October), Winter (November

to January), Spring (February to April) and Summer (May to July). The hottest month is June

having maximum temperature of 50°C. The coldest month of these areas is December having

minimum temperature of 0°C. From 12 districts as listed above the total 120 cattle farms were

chosen. Three districts were selected from each zone of Punjab. All the randomly selected

districts from all four zones of Punjab are important livestock farming zones. In province Punjab

the larger populations of livestock are found as compared to the other provinces of the country.

The total population of livestock in Punjab was estimated to be 175 million i.e. (cows, goats,

sheep and buffaloes) (Livestock Census, 2006). Mostly economy of the Southern zone of Punjab

is based on agriculture, the Cholistan desert falls in this zone. The districts of Western zone of

Punjab lying nearby to the Indus River. The geography is defined by the sand obtained from the

shifting flood bare deposits of the Indus. This zone consists of Layyah, Khushab and Bhakkar

districts which mostly covers the Thal desert. This area has a sizeable cement, sugar and textiles

industry and also rich in salt and coal. Though, poverty levels are much greater in this zone as

compared to Northern or Central Punjab. Central Punjab states to the flat surface that are

inhibited by the Southern verge of the Jhelum river down till the Sutlej river. Northern Punjab is

generally categorized as the mountainous, highland and hilly areas in the north of the province.

Bahawalpur is the biggest district of Punjab with a whole part of 24,830 Km, almost two-thirds

of the district is concealed by the Cholistan desert, which prolongs into the Thar Desert of India.

Bahawalpur and Rajun pur have the highest small animal population. Attock is the significant

cattle trade zone that links the Northern areas of country with the Southern areas.

https://en.wikipedia.org/wiki/Cholistan_Desert

https://en.wikipedia.org/wiki/Thar_Desert

https://en.wikipedia.org/wiki/India

35

Figure 1. Chart of Punjab region in Pakistan and the districts from where samples of tick were

gathered.

36

3.2. Collection and preservation of ticks

During four seasons of the year in morning and evening ticks were collected. From goats,

sheep, buffaloes and cows species of ticks were collected. Total ten (five urban and five rural)

livestock farms were haphazardly chosen from each designated district of the regions of Punjab.

In urban areas, every farm was at least ten kilometer apart from the other farm. Whereas in rural

parts, every farm was chosen from various villages which were at least 5km away from each

other. The designated 5-10 animals (if any animal was not available at the farms, then it was

observed from nearly farm) were systematically checked from farms through nearby analysis,

parting the furs in contrast to their usual way for the ticks identification. Species of tick were

gathered analytically from head to tail orders with the aid of tiny steel pincers with blunt tops

devoid of injuring their orifice. Ticks were placed in clean and dry appropriately labeled plastic

bottles covered with muslin cloth for proper aeration. Tick specimens were brought to research

laboratory for identification and PCR analysis. Complete record of the area, animal species, time

and season was maintained. In the laboratory, preservation process was done by keeping ticks

into 70% methanol for further investigation

3.3. Identification of ticks

Under low power and then high power amplification of microscope, collected ticks were

observed. According to the keys given by Mc Carthy (1967), Madder et al. (2004), Walker et al.

(2003) and Estrada-Pena et al. (2006) identification of various adult ticks were accomplished by

the aid of the structural and morphology features in the lab by dichotomizing and light

microscopes. Moreover, original explanations and representations of associated tick were also

checked (Apanaskevich & Horak, 2005). At the species level species of ticks were recognized

below a stereoscopic (OPTICA SZM-1 Italy) using 40-fold amplification. For the recognized

tick types, abbreviations were used as earlier recommended by Dantas-Torres (2012).

3.4. Collection and identification of plant materials

Five different plants i.e Trigonella foenum-graecum, Solanum nigrum, Calotropis

procera, Citrullus colocynthis and Brassica rapa were designated for the research (Table 3.1).

These plants were designated because these are easily available to the the owner of livestock

37

farms. From Department of Botany, Government College University, Faisalabad, the whole parts

of these plants were collected from the different areas of Jhang and identified. Fresh plant

materials were brought into the laboratory washed all plants with distilled water and dehydrated

under shade at room temperature for one month. After complete drying, the dried plants material

were crushed in mortar pestle, and then ground into fine powder by electric blender. The powder

was sifted by a mesh.

Table 3.1. Classification of selected plants of study

Sr No Scientific name Common

name

Family Genus Species English

name

1 Calotropis procera Auk Apocynaceae Calotropis Procera Milk weed

2 Brassica rapa Sarson Brassicaceae Brassica Rapa Mustard

3 Trigonella foenum-

graecum

Methi Fabaceae Trigonella foenum-

graecum

Fenugreek

4 Solanum nigrum Makoi Solanaceae Solanum Nigrum Black

nightshade

5 Citrullus colocynthis Khurtumma Cucurbitacea Citrullus colocynthis Bitter apple

3.5. Preparation of plants extract

To check the efficacy of the above mentioned plants, the plant extracts were prepared by

following process described by Gosh et al. (2015) with slight modifications. Five hundred (500)

grams of powdered material of all selected plants were individually added to methanol (1000ml)

in the beaker, covered it with aluminum foil and kept for seven days at room temperature. After

seven days was sifted through Whatman No.1 filter paper and dehydrated by rotatory evaporator.

The crude extract was measured separately and stored in glass jar at room temperature for the

application of acaricidal activity to control ticks.

38

(a) (b) (c)

(d) (e)

Figure 2. Medicinal plants used for plant extracts i.e (a) Calotropis procera, (b) Solanum nigrum,

(c) Brassica rapa (d) Trigonella foenum-graecum (e) and Citrullus colocynthis.

39

3.6. Phytochemical analysis

Plant extracts were further subjected to qualitative phytochemical analysis. This analysis

was carried out with the following standard methods;

3.6.1 Test for the confirmation of Flavonoids

One ml of ten percent solution of lead acetate was mixed in 1ml of methanolic plant

extract. The establishment of yellow precipitate showed the presence of flavonoids (Jabin &

Nasreen, 2016).

3.6.2 Test for the confirmation of Terpenoids

Methanolic extract (2 ml) of given plant was added in 2 ml of chloroform and vaporized

to desiccation. Then two ml of concentrated sulphuric acid was mixed and heated the solution for

two minutes. Establishment of grayish color showed the existence of terpenods (Bargah, 2015).

3.6.3 Test for the confirmation of Alkaloids

Two ml of methanolic extract was mixed with 2 ml of concentrated hydrochloric acid on

steam wash. Then few drops of Dragendroffs reagent were added. The formation of orange red

precipitate indicated the presence of alkaloids (Bargah, 2015).

3.6.4 Test for the confirmation of Tannins

Two ml of excerpt was stimulated in 2 ml of dH2O and then few drops of FeCl3 solution

were mixed. Occurrence of green swift was taken as positive test for tannins (Bargah, 2015).

3.6.5 Test for confirmation of Saponins

In a test tube 5 ml of distilled water and 5 ml of extract was shaken vigorously and

heated. The formation of smooth foam was considered as a positive for saponins (Bargah, 2015).

3.6.6 Test for confirmation of Steroids

3.6.6.1 Liebermann Burchard test

Two ml of methanolic extract was dissolved in 2 ml of chloroform CHCl3 and treated

with concentrated H2SO4 and CH3COOH. The formation of green color shows the existence of

steroids (Bargah, 2015).

40

3.6.6.2 Salkowskis test

Methanolic extract (2ml) of given plant was mixed in 2 ml of CHCl3 and added 2 ml of

concentrated H2SO4. A red color was formed in the lower CHCl3 layer that shows the existence

of steroids (Bargah, 2015).

3.6.7 Test for confirmation of Phenols

In 5 ml of distilled water 500 mg of extract was dissolved. Then few drops of 5 % ferric

chloride were added. The formation of green color shows the existence of phenols (Bargah,

2015).

3.7. Bioassay

3.7.1 Preparation of stock solution of selected plants

Stock solution was prepared by dissolving the plants extracts in dimethyl sulfoxide

(DMSO). Five different concentrations i.e. 0.75% (0.75 mg extract was mixed in 2.25 ml dist.

Water, then 0.075 ml of this solution is added in 9.925 DMSO), 1.5% (1.5 mg extract was mixed

in 2.25 ml dist. Water, then 0.15 ml of this solution is added in 9.85 DMSO), 3.00% (3 mg of

extract was mixed in 2.25 ml dist. Water, then 0.3 ml of this solution is added in 9.7 ml DMSO),

6.00% (6 mg of extract was mixed in 2.25 ml dist. Water, then 0.6 ml of this solution is added in

9.4ml DMSO)and 12.00% (12 mg of extract was mixed in 2.25 ml dist. Water, then 1.2 ml of

this solution is added in 8.8ml DMSO)of each extract were prepared in distilled water.

3.7.2 Percent mortality

The livestock farms were examined for the infestation of ticks and from the infested

buffaloes the adult ticks were separated for bioassays. All the plants extract were used against

adult ticks in the laboratory using standardized adult immersion test (AIT) with slight

modifications made by Gosh et al. (2015). Twenty tick species were immersed in 10 ml of

respective concentration in beaker with the help of small forceps and each group was tested in

replicate. Stirring the ticks with rod vigorously and after five minutes of immersion, the ticks

were removed from the beaker and put into the test tube and cover all these treated ticks with the

muslin cloth. Alive and dead ticks were counted after 24 hour (hr), 48 hr, 72 hr and 96 hrs. In

control group, ticks were dipped in distilled water and checked for mortality after each time

41

interval of 24 hrs. The percentage mortality was observed after each time interval of 24 hrs and

consecutively for four days.

42

3.7.3 Stock solution of selected acaricides

Acaricides cypermethrin (40% EC), emamectin (1.9% EC) and fiprnoil (5% SC) were

purchased from local market (Faisalabad). Five different concentrations 0.25%, 0.50%, 1.00%,

2.00% and 4.00% were prepared in distilled water to determine the mortality of ticks. The

solutions were homogenized by shaking.

3.7.4 Percent mortality

The number of twenty ticks was used in each group, and each group was tested in

triplicate (giving a total of 20 individuals per group). Before the application of each test, the tick

species were washed in a mesh with tap water and dehydrated on indulgent spongy paper. To

check the mortality of selected acaricides i.e. cypermethrin, emamectin and fipronoil adult

immersion test was used. The ticks were then randomly allotted to a treatment group and then

immersed in beaker for 5 min that contained a preset concentration of each acaricide. In the

control group ticks were dipped in distilled water only. After five minutes the ticks were

removed from the respective concentration, then dry in absorbent paper and placed into

recognized test tubes covered with muslin cloth. After four days the percent mortality of ticks

was calculated, only those ticks were considered alive that were still capable of movement

(Avinash et al., 2017).

3.8 DNA extraction

After identification of tick species on the bases of their morphological characters, the

ticks were stored and divided on the basis of locality of collection and host. The ticks of same

species and same host were placed together. Ticks from every species were individually used for

the DNA extraction. Filter paper were used to dry the tick species and homogenized in 1.5 ml

nontoxic ependorf then add 25µl proteinase K by using pasteurized pestle. The tubes incubated

in T mix shaking incubator (EHRET) at 60C0

temperature for one hour. For proper mixing used

adjustable speed RS-VA 10 vortexer (Bench Mixer). By using a commercial pure link mini kit

(Invitrogen), the DNA was extracted by following kit protocol. Extracted DNA of ticks was kept

at -20Co (Chen et al., 2014). The quality of extracted DNA was analyzed on agarose gel by

electropherosis. Ethidium bromide has been used to see DNA in gel. Extracted DNA samples

were loaded on 1% agarose gel and run for 60 minutes at 100 voltages. After one hour, gel was

43

examined under ultra violet light transilluminator and photographed using Syngene

documentation system.

3.9 Using PCR for magnification of DNA of tick borne pathogens

To amplify the DNA of Theleria and Babesia and other for Ehrlichia and Anaplasma spp.

two sets of PCR were performed. The total reaction volume for PCR was 25µl, which was

formed by adding 9.2 µl d3H2O, 2.5 µl dNTPs, 2.5 ul Taq buffer, 2 ul MgCl2, 3 ul F primers, 3 ul

R primers (working primer solutions were formed by adding 10ul from primers stock solution

and 190 ul d3H2O) and at the end Taq DNA 0.3 ul was added. Then added 2.5 ul templates in

22.5 µl master mix. A PCR was performed for Theleria and Babesia; two cycles of denaturation

(95 oC for 5 minutes and 2

nd for 1 minute), annealing (57

oC for 40 s) and extention at (72

oC for

fifteen second), followed by continuous two cycles with same situations of earlier cycle. The

annealing temperature abridged until approached 58oC. An additional 35 cycles were completed

during amplification process. All the conditions were the same, for Anaplasma and Ehrlichia,

only the temperature of initial annealing was changed (95°C-98°C) by following the PCR.

Negative and positive controls were used to check the results. A Thermal Cycler a C1000™ was

used for amplification of DNA (Ependroff). To determine and analyze the PCR results, agarose

gel electropherosis was performed. Agarose gels (1.5%) (WEALTEC Corp: mini GES) with

ethidium bromide dye were used for visualization of amplicon, below Ultra Violet light by

GeneSnap from SynGene version 7.12. For comparison of amplicon sizes, Gene Ruler (100-1000

bp) DNA molecule (Thermo Scientific™ Karlsruhe) was applied.

DNA amplification using specific primers

For each group (genus), individual PCR amplification reaction was carried out in 25 µl

with 100 ng of DNA, 10 pmol of onward and reverse primer for every species, 1U Taq DNA

polymerase, 2.5 mM MgCl2 & 200 µM of dNTPs. All amplification reactions were performed in

a thermal cycler. Specific primers and PCR situations were given in the table 3.2. PCR products

(10 µl) were loaded on agarose gel (1.5%), with DNA ladder electrophoresis was done at 120 V

for one hour. Gel was stained with ethidium bromide and photographed (Barghash et al., 2016).

44

Table 3.2. Specific primer sequences, PCR situations and targeted size of tick borne pathogens.

Pathogens Primer order (5’-3’) PCR situation Product

size (bp)

Theileria

annulata

F: ACTTTGGCCGTAATGTTAAAC

and

R: CTCTGGACCAACTGTTTGG

(Bilgic et al., 2010)

95°C for 5 min., 33 cycle at 94°C

for 30 sec., touchdown from

62°C-50°C for 30 sec., 72°C for 30

sec. and f. ext. at 72°C for 5 min.

312

T. ovis F: TCGAGACCTTCGGGT

and

R: TCCGGACATTGTAAAACAAA

(Altay et al., 2008)



62°C-50°C for 30 sec., 72°C for 30


520

T. orientalis F: CTTTTGCCTAGGATACTTCCT

and

R: ACGGCAAGTGGTGAGAACT

(Ota et al., 2009)



62°C-50°C for 30 sec., 72°C for 30


776

Babesia

bigemina

F: TAGTTGTATTTCAGCCTCGCG

and

R: AACATCCAAGCAGCTAHTTAG

(Ellis et al., 1992)


for 30 sec., 57°C for 30 sec.,

72°C for 30 sec. and f. ext. at 72°C

for 6 min.

639

B. bovis F: TTTGGTATTTGTCTTGGTCAT

and

R: ACCACTGTAGTCAAACTCACC

(Chansiri & Bagnara, 1995)




for 6 min.

448

B. caballi F:CGACACCAAGGATTTATTCGAGAA

and

R: ATTCCAAAGATTCACCCACAGC

(Guclu & Karaer, 2007)




for 6 min.

539

A. marginale F: GCTCTAGCAGGTTATGCGTC

and

R: CTGCTTGGGAGAATGCACCT





for 7 min.

265

A. ovis F: TGAAGGGAGCGGGGTCATGGG

and

R: GGTAATTGCAGCCAGGGACTCT

(Yousefi et al., 2017)




for 7 min.

347

A.Centrale F: CATAACTTTGTTGTTGTAAAGCCT

and

R: TTCCAGACCTTCCCTAACTA

(Shkap et al., 2002)




for 7 min

403

Ehrlichia spp. F: GGTTTATGGTGCTTTTCCTAGTGTTGA

R:

TTACAGATTTCTCAGGAGTATATGCCTCC

(Qiu et al., 2016)



64°C-50°C for 30 sec., 72°C for 30


480

460

E. spp.

Omatjenne

F: GGAATTCAGAGTTGGATCMTGGYTCAGR

biotin- R:

CGGGATCCCGAGTTTGCCGGGACTTYTTCT




64°C-50°C for 30 sec., 72°C for 30


Rickettsia

16S rRNA

F: GGGGGCCTGCTCACGGCGG and

R: ATTGCAAAAAGTACAGTGAACA

(Regnery et al., 1991)



64°C-50°C for 30 sec., 72°C for 30


380

45

3.9 Statistical analysis

The prevalence of ticks and tick-borne pathogens was determined in all planned agro-

ecological regions of Punjab, Pakistan by using logistic regressions and odd‟s ratio (OR) at 95%

confidence intereval (CI). All statistical analysis was determined using SPSS software package

(SPSS, 21). Analysis of variance technique was applied to find out the significant differences

between zone animals and tick species. Comparison of means was done using Least Significant

Difference (LSD) test at 5% level of significance. The percent mortality was analyzed by probit

analysis (Abbott, 1925; Finney, 1971), using Minitab-17 statistical software for determining

LC50, LT50 and related parameters.

46

Chapter 4

RESULTS & DISCUSSION

4.1. Analytical Characteristics of the Population

A number of 12,000 animals (2800 goats, 2800 sheep, 3200 buffaloes and 3200 cows)

were observed from 120 livestock farms in four different agro-ecological zones (Southern,

Western, Central and Northern) of Punjab, Pakistan differentiated by urban and rural locality.

Ticks were collected, identified and analyzed for the presence of pathogens.

The research work was divided in to four steps

1. Prevalence of species of tick from the selected zones of Punjab, Pakistan

2. Identification of collected tick species on the basis of their physiological

characters

3. Detection and identification of tick-borne pathogens by PCR analysis

4. Management of tick species with acaricides and medicinal plants extract

4.2 Tick Prevalence

From buffaloes, cows, goats and sheep ticks were collected during four seasons of the

year. From each selected district of the regions of Punjab total 10 cattle farms (five urban and

five rural) were randomly designated. During the present study the selected livestock farms were

randomly examined for collection of ticks. All the cattle farms, regardless of their topographic

site, were observed infested with one or multiple ticks species. The overall prevalence of tick-

infested livestock was observed 36.52% (4382/12,000) as shown in table 4.1.

47

Table 4.1. Zone-wise ticks prevalence (%) from Punjab.

Zones

Total Infected Prevalence

(%)

Odds Ratio Confidence Interval 95% P-value

Lower limit Upper limit

Southern 3000 1090 36.33 1.135 1.020 1.262 0.020

Western 3000 1075 35.83 1.110 0.998 1.235 0.054

Central 3000 1213 40.43 1.349 1.215 1.499 0.000

Northern 3000 1004 33.47

(P<0.05) significant

The utmost prevalence (40.43%) was noticed from Central zone whereas lowest

(33.47%) from Northern zone and data of prevalence for two other zones was displayed in 4.1

table. The highly significant (p<0.00) differences were noticed in Central zone whereas

significant (p<0.05) differences in Southern zone and the non-significant (p>0.05) differences in

Western zone.

Table 4.2. Animal-wise ticks prevalence (%) from Punjab.

Animal


(%)



Buffalo 3200 1201 37.53 1.471 1.320 1.640 0.000

Cow 3200 1357 42.41 1.803 1.619 2.007 0.000

Goat 2800 1012 36.14 1.386 1.239 1.550 0.000

Sheep 2800 812 29.00


In the current research a number of 12,000 cattles i.e. 2800 goats, 2800 sheep 3200

buffaloes and 3200 cows were haphazardly observed for tick collection. From 12,000 cattles

4382/12,000 (36.52%) livestock were identified infestation with ticks. The ticks prevalence in

buffaloes, cows, goats and sheep were observed (37.53, 42.41, 36.14 and 29.00%),

48

correspondingly as described in table 4.2. The highly significant (p<0.00) differences were

showed in the prevalence of all animals.

Table 4.3. Season-wise ticks prevalence (%) from Punjab.

Season


(%)

Odds

Ratio

Confidence Interval 95% P-value


Spring 3000 1239 41.30 2.936 2.614 3.297 0.000

Summer 3000 1676 55.87 5.282 4.704 5.930 0.000

Autumn 3000 887 29.57 1.752 1.554 1.974 0.000

Winter 3000 580 19.33


Table 4.3 revealed (prevalence %) season-wise for complete data. In this research the

highest prevalence was noticed in Summer, (55.87%) followed by Spring (41.30%), Autumn

(29.57) and lowest in Winter seasons (19.33%). The highly significant (p<0.00) differences were

detected in the ticks prevalence in all several seasons.

Table 4.4. Animal-wise prevalence with respect to different seasons for Southern zone.

Season

Animal


(%)



Spring Buffalo 200 87 43.50 1.514 0.995 2.304 0.053

Cow

200 92 46.00 1.675 1.102 2.546 0.016

Goat

175 67 38.29 1.220 0.788 1.889 0.373

Sheep

175 59 33.71

Summer Buffalo 200 102 51.00 0.918 0.611 1.378 0.679

Cow

200 121 60.50 1.350 0.896 2.036 0.151

Goat

175 99 56.57 1.149 0.754 1.750 0.519

Sheep

175 93 53.14

49

Autumn Buffalo 200 57 28.50 1.224 0.772 1.941 0.391

Cow

200 73 36.50 1.765 1.127 2.764 0.013

Goat

175 47 26.86 1.127 0.698 1.821 0.625

Sheep

175 43 24.57

Winter Buffalo 200 37 18.50 0.977 0.580 1.644 0.929

Cow

200 41 20.50 1.110 0.666 1.850 0.690

Goat

175 39 22.29 1.234 0.734 2.075 0.428

Sheep

175 33 18.86


Table 4.4 showed the ticks prevalence in several seasons in Southern zone. The overall

prevalence was highest during Summer season in all animals. The prevalence of tick species in

buffaloes in this zone was highest in Summer season (51.00%) followed by Spring (43.50%),

Autumn (28.50%) and Winter (18.50%). In this zone the prevalence of ticks in cows was highest

in Summer season (60.50%) followed by Spring (46.00%), Autumn (36.50%) and was least in

Winter (20.50%). In case of goats and sheep, the tick prevalence in this zone was maximum in

Summer season (56.57 and 53.14%) followed by Spring (38.29 and 33.71%), Autumn season

(26.86 and 24.57%) and Winter (22.29 and 18.86%) respectively. The prevalence of ticks

showed highly significant (p<0.01) differences in Spring season in cows while non-significant

(p>0.05) differences were showed in case of buffaloes and goats. In Winter season non-

significant (p>0.05) differences in case of both buffaloes and goats whereas the highly

significant (p<0.01) differences were showed in cows. Therefore, in Summer and Autumn

seasons non-significant (p>0.05) differences were showed in all ruminants.

50

Table 4.5. Animal-wise prevalence with respect to different seasons for Western zone.

Season

Animal


(%)



Spring Buffalo 200 91 45.50 1.922 1.255 2.942 0.003

Cow

200 97 48.50 2.168 1.417 3.317 0.000

Goat

175 77 44.00 1.809 1.166 2.807 0.008

Sheep

175 53 30.29

Summer Buffalo 200 111 55.50 1.003 0.667 1.508 0.989

Cow

200 127 63.50 1.399 0.924 2.117 0.112

Goat

175 88 50.29 0.813 0.534 1.238 0.335

Sheep

175 97 55.43

Autumn Buffalo 200 65 32.50 2.072 1.281 3.350 0.003

Cow

200 69 34.50 2.266 1.405 3.655 0.001

Goat

175 43 24.57 1.402 0.840 2.338 0.196

Sheep

175 33 18.86

Winter Buffalo 200 37 18.50 1.362 0.783 2.370 0.274

Cow

200 33 16.50 1.186 0.674 2.085 0.554

Goat

175 29 16.57 1.192 0.666 2.132 0.554

Sheep

175 25 14.29


Overall highest tick prevalence was detected during Summer on all animals. The highest

prevalence in buffaloes was observed during Summer (55.50%) while lowest in Winter (18.50%)

seasons. In case of goats and sheep, the prevalence of ticks species in this zone was detected

least in Winter season (16.57 and 14.29%) and highest in Summer season (50.29 and 55.43%),

followed by Spring (44.00 and 30.29%) and Autumn season (24.57 and 18.86%), respectively.

The prevalence of ticks showed in Summer and Winter seasons non-significant (p>0.05)

differences were detected in all animals while highly significant (p<0.00) differences in Spring

season in case of all observed animals. The ticks prevalence in Autumn season showed highly

significant (p<0.00) differences in case of observed buffaloes and cows but non-significant

(p>0.05) differences were showed in goats (table 4.5).

51

Table 4.6. Animal-wise prevalence with respect to different seasons for Central zone.

Season

Animal


(%)



Spring Buffalo 200 101 50.50 2.480 1.617 3.805 0.000

Cow

200 109 54.50 2.912 1.897 4.471 0.000

Goat

175 81 46.29 2.095 1.348 3.257 0.001

Sheep

175 51 29.14

Summer Buffalo 200 127 63.50 1.606 1.062 2.428 0.025

Cow

200 131 65.50 1.753 1.156 2.656 0.008

Goat

175 101 57.71 1.260 0.826 1.921 0.283

Sheep

175 91 52.00

Autumn Buffalo 200 73 36.50 2.004 1.268 3.168 0.003

Cow

200 81 40.50 2.374 1.507 3.739 0.000

Goat

175 66 37.71 2.112 1.321 3.376 0.002

Sheep

175 39 22.29

Winter Buffalo 200 45 22.50 1.349 0.809 2.247 0.251

Cow

200 49 24.50 1.507 0.910 2.496 0.111

Goat

175 37 21.14 1.245 0.732 2.119 0.418

Sheep

175 31 17.71


The overall tick prevalence in buffaloes and cows in this zone was detected maximum in

Summer season (63.50% and 65.50%) followed by Spring (50.50% and 54.50%), Autumn

(36.50% and 40.50%) and was least in Winter (22.50% and 24.50%). In this zone the prevalence

of ticks in goats was noted highest in Summer season (57.71%) followed by Spring (46.29%),

Autumn (37.71%) and was least in Winter (24.50%). In case of sheep the tick species prevalence

in this zone was observed maximum in Summer season (52.00%) and was least in Winter season

(17.71%), respectively. The prevalence of ticks in Central zone non-significant (p>0.05)

differences were noticed in Winter seasons in all observed animals while in Spring and Autumn

season highly significant (p<0.00) differences were noticed in all examined animals as shown in

table 4.6.

52

Table 4.7. Animal-wise prevalence with respect to different seasons for Northern zone.

Season

Animal


(%)



Spring Buffalo 200 75 37.50 1.543 0.997 2.388 0.052

Cow

200 87 43.50 1.980 1.285 3.051 0.002

Goat

175 63 36.00 1.446 0.921 2.273 0.109

Sheep

175 49 28.00

Summer Buffalo 200 109 54.50 1.674 1.111 2.521 0.014

Cow

200 117 58.50 1.970 1.305 2.973 0.001

Goat

175 89 50.86 1.446 0.948 2.205 0.087

Sheep

175 73 41.71

Autumn Buffalo 200 53 26.50 2.383 1.389 4.086 0.002

Cow

200 73 36.50 3.799 2.248 6.419 0.000

Goat

175 49 28.00 2.570 1.485 4.449 0.001

Sheep

175 23 13.14

Winter Buffalo 200 31 15.50 1.506 0.817 2.775 0.189

Cow

200 57 28.50 3.273 1.857 5.768 0.000

Goat

175 37 21.14 2.201 1.210 4.006 0.010

Sheep

175 19 10.86


For the ticks prevalence in Spring season, highly significant (p<0.00) differences in cows

and significant (p>0.05) differences were observed in buffaloes. In case of goats in Spring season

non-significant (p>0.05) differences were found. In Summer and Autumn the highly significant

(p<0.00) differences were noticed in all animals except goats the non-significant (p>0.05)

differences were noticed in Summer season. In winter season the non-significant (p>0.05)

differences were observed in buffaloes while the highly significant (p<0.00) differences were

recorded in case of cows and goats table 4.7. The overall prevalence of tick species in buffaloes

in this zone was observed maximum in Summer season (54.50%) followed by Spring (37.50%),

in Autumn (26.50%) and was least in Winter (15.50%). In this zone the prevalence of ticks in

cows was highest in Summer season (58.50%) as shown in table 4.7.

53

Table 4.8. Area-wise prevalence with respect to different Animals for Spring season.

Animal

Zone Total Infected Prevalence

(%)



Buffalo Southern 200 87 43.50 1.283 0.860 1.915 0.222

Western

200 91 45.50 1.391 0.933 2.074 0.105

Central

200 101 50.50 1.700 1.142 2.533 0.009

Northern

200 75 37.50

Cow Southern 200 92 46.00 1.106 0.746 1.641 0.615

Western

200 97 48.50 1.223 0.825 1.813 0.316

Central

200 109 54.50 1.556 1.049 2.308 0.028

Northern

200 87 43.50

Goat Southern 175 67 38.29 1.103 0.715 1.702 0.658

Western

175 77 44.00 1.397 0.909 2.146 0.127

Central

175 81 46.29 1.532 0.998 2.351 0.051

Northern

175 63 36.00

Sheep Southern 175 59 33.71 1.308 0.830 2.062 0.248

Western

175 53 30.29 1.117 0.704 1.772 0.638

Central

175 51 29.14 1.058 0.665 1.682 0.813

Northern

175 49 28.00


Table 4.8 shows the prevalence of tick in buffaloes from Southern, Western, Central and

Northern zones were 43.50%, 45.50%, 50.50% and 37.50%, respectively. In case of buffaloes

non-significant (p>0.05) differences were noted in Southern, Western and Northern zones while

the highly significant (p<0.00) differences in Central zone. In case of cows the ticks prevalence

in Southern, Western, Central and Northern zones were observed (46.00, 48.50, 54.50 and

43.50%), respectively. In cows the non-significant (p>0.05) differences were observed in

Southern, Western and Northern zones whereas the significant (p<0.05) differences were

recorded in Central zone. The tick prevalence in case of goats and sheep were observed (38.29

and 33.71%), (44.00% and 30.29%), (46.29% and 29.14%), (36.00% and 28.00%), respectively

in Southern, Western, Central and Northern zones.

54

Table 4.9. Zone-wise prevalence with respect to different animals for Summer season.

Animal


(%)




Western

200 111 55.50 1.041 0.702 1.544 0.841

Central

200 127 63.50 1.452 0.973 2.168 0.068

Northern

200 109 54.50

Cow Southern 200 121 60.50 1.087 0.729 1.620 0.684

Western

200 127 63.50 1.234 0.825 1.846 0.306

Central

200 131 65.50 1.347 0.898 2.020 0.150

Northern

200 117 58.50

Goat Southern 175 99 56.57 1.259 0.826 1.918 0.284

Western

175 88 50.29 0.977 0.643 1.486 0.915

Central

175 101 57.71 1.319 0.865 2.011 0.198

Northern

175 89 50.86

Sheep Southern 175 93 53.14 1.585 1.039 2.418 0.033

Western

175 97 55.43 1.738 1.138 2.653 0.011

Central

175 91 52.00 1.514 0.992 2.309 0.054

Northern

175 73 41.71


In case of sheep significant (p<0.05) differences were recorded in Southern, Central,

Western and Northern zones whereas in buffaloes, cows and goats the non-significant (p>0.05)

differences were detected in Southern, Central, Western and Northern zones. Moreover, the

prevalence of ticks in buffaloes and cows in Southern (51.00 and 60.50%), Western (55.50 and

63.50%), Central (63.50% and 65.50%) and Northern zones (54.50 and 58.50%) were observed,

respectively. Therefore, in goats the ticks prevalence in Southern, Western, Central and Northern

zones were observed (56.57, 50.29, 57.71 and 50.86%), respectively. Ticks prevalence of in case

of sheep in Southern, Western, Central and Northern zones was observed (53.14, 55.43, 52.00

and 41.71%) respectively as showed in table 4.9.

55

Table 4.10. Zone-wise prevalence with respect to different animals for Autumn season.

Animal


(%)




Western

200 65 32.50 1.335 0.867 2.056 0.189

Central

200 73 36.50 1.594 1.041 2.441 0.032

Northern

200 53 26.50

Cow Southern 200 73 36.50 1.000 0.666 1.502 1.000

Western

200 69 34.50 0.916 0.608 1.380 0.676

Central

200 81 40.50 1.184 0.791 1.772 0.411

Northern

200 73 36.50

Goat Southern 175 47 26.86 0.944 0.590 1.510 0.811

Western

175 43 24.57 0.838 0.520 1.349 0.466

Central

175 66 37.71 1.557 0.993 2.441 0.054

Northern

175 49 28.00

Sheep Southern 175 43 24.57 2.153 1.233 3.759 0.007

Western

175 33 18.86 1.536 0.860 2.742 0.147

Central

175 39 22.29 1.895 1.077 3.334 0.027

Northern

175 23 13.14

(P<0.05) significant (p>0.05) non-significant differences

For prevalence of ticks in buffaloes, the significant (p<0.05) differences in Central zone

while the non-significant (p>0.05) differences were observed in Southern and Western zones. In

Central zone significant (p<0.05) differences in goats however in Southern and Western zone

non-significant (p>0.05) differences were observed. Ticks prevalence in buffaloes and cow in

Southern (28.50 and 36.50%), Western (32.50 and 34.50%), Central (36.50 and 40.50%) and

Northern zones (26.50 and 36.50%) were observed respectively. Moreover, in goats the ticks

prevalence in Southern, Western, Central and Northern zones were found (26.86%, 24.57%,

37.71% and 28.00%), respectively as showed in table 4.10.

56

Table 4.11. Zone-wise prevalence with respect to different Animals for Winter season.

Animal


(%)




Western

200 37 18.50 1.237 0.733 2.089 0.425

Central

200 45 22.50 1.583 0.954 2.627 0.076

Northern

200 31 15.50

Cow Southern 200 41 20.50 0.647 0.408 1.025 0.064

Western

200 33 16.50 0.496 0.306 0.804 0.004

Central

200 49 24.50 0.814 0.522 1.271 0.365

Northern

200 57 28.50

Goat Southern 175 39 22.29 1.070 0.643 1.778 0.795

Western

175 29 16.57 0.741 0.432 1.270 0.275

Central

175 37 21.14 1.000 0.599 1.671 1.000

Northern

175 37 21.14

Sheep Southern 175 33 18.86 1.908 1.038 3.506 0.037

Western

175 25 14.29 1.368 0.724 2.588 0.335

Central

175 31 17.71 1.768 0.956 3.267 0.069

Northern

175 19 10.86


Highly significant (p<0.00) differences were recorded in Western zone in cows while

non-significant (p>0.05) differences were detected in Southern, Central, Western and Northern

zones for tick prevalence in buffaloes and non-significant (p>0.05) differences were observed in

Southern and Central zones. In goats, non-significant (p>0.05) differences were recorded in all

Southern, Central, Western and Northern zones. Significant (p<0.05) differences in Southern

zone while non-significant (p>0.05) in Western and Central zones were observed in sheep. In

buffaloes, the prevalence of ticks in Southern and Western zones were recorded (18.50%), in

Central and Northern zones (22.50 and 15.50%), respectively. In case of cows, 20.50, 16.50,

24.50 and 28.50% ticks were observed in different zones as showed in table 4.11.

57

Table 4.12. Season-wise prevalence with respect to different zones for buffaloes.

Zone Season Total Infected Prevalence

(%)



Southern Spring 200 87 43.50 3.392 2.155 5.337 0.000

Summer

200 102 51.00 4.585 2.918 7.205 0.000

Autumn

200 57 28.50 1.756 1.097 2.812 0.019

Winter

200 37 18.50

Western Spring 200 91 45.50 3.678 2.339 5.783 0.000

Summer

200 111 55.50 5.494 3.493 8.642 0.000

Autumn

200 65 32.50 2.121 1.334 3.372 0.001

Winter

200 37 18.50

Central Spring 200 101 50.50 3.514 2.280 5.415 0.000

Summer

200 127 63.50 5.992 3.862 9.298 0.000

Autumn

200 73 36.50 1.980 1.276 3.072 0.002

Winter

200 45 22.50

Northern Spring 200 75 37.50 3.271 2.028 5.276 0.000

Summer

200 109 54.50 6.530 4.067 10.483 0.000

Autumn

200 53 26.50 1.966 1.198 3.225 0.007

Winter

200 31 15.50


The highest prevalence was detected in Central zone (63.5%) during Summer season and

lowest in Northern zone (15.50%) during Winter season as showed in table 4.12. The ticks

prevalence in buffaloes in all seasons and zones were observed highly significant (p<0.00).

58

Table 4.13. Season-wise prevalence with respect to different zones for cows.

Zones Season Total Infected Prevalence

(%)



Southern Spring 200 92 46.00 3.304 2.124 5.139 0.000

Summer

200 121 60.50 5.940 3.805 9.271 0.000

Autumn

200 73 36.50 2.229 1.424 3.489 0.000

Winter

200 41 20.50

Western Spring 200 97 48.50 4.766 2.993 7.588 0.000

Summer

200 127 63.50 8.804 5.494 14.107 0.000

Autumn

200 69 34.50 2.666 1.660 4.281 0.000

Winter

200 33 16.50

Central Spring 200 109 54.50 3.691 2.411 5.650 0.000

Summer

200 131 65.50 5.851 3.789 9.035 0.000

Autumn

200 81 40.50 2.098 1.367 3.219 0.001

Winter

200 49 24.50

Northern Spring 200 87 43.50 1.932 1.275 2.926 0.002

Summer

200 117 58.50 3.536 2.332 5.363 0.000

Autumn

200 73 36.50 1.442 0.947 2.197 0.088

Winter

200 57 28.50


Table 4.13 showed the highest prevalence was observed in Central zone (65.50%) during

Summer season and lowest in Western zone (16.50%) during Winter season. Moreover, the

prevalence of ticks in cows in all seasons Spring, Summer, Winter and Autumn and in zones

including Southern, Central and Western were observed highly significant (p<0.00) except

Northern zone in Autumn season non-significant (p>0.05) differences were detected.

59

Table 4.14. Season-wise prevalence with respect to different zones for goats.


(%)



Southern Spring 175 67 38.29 2.163 1.354 3.457 0.001

Summer

175 99 56.57 4.543 2.854 7.231 0.000

Autumn

175 47 26.86 1.280 0.786 2.087 0.321

Winter

175 39 22.29

Western Spring 175 77 44.00 3.956 2.404 6.508 0.000

Summer

175 88 50.29 5.092 3.099 8.367 0.000

Autumn

175 43 24.57 1.640 0.969 2.777 0.066

Winter

175 29 16.57

Central Spring 175 81 46.29 3.214 2.011 5.137 0.000

Summer

175 101 57.71 5.091 3.179 8.151 0.000

Autumn

175 66 37.71 2.258 1.405 3.630 0.001

Winter

175 37 21.14

Northern Spring 175 63 36.00 2.098 1.303 3.378 0.002

Summer

175 89 50.86 3.860 2.416 6.166 0.000

Autumn

175 49 28.00 1.450 0.888 2.369 0.137

Winter

175 37 21.14


The highest prevalence was detected in Central zone (57.71%) during Summer season

and lowest in Western zone (16.57%) during Winter season as showed in table 4.14. Moreover,

the ticks prevalence in goats highly significant (p<0.00) differences were detected in Southern,

Central, Western and Northern zones with respect to Spring and Summer seasons whereas in

Autumn season in Southern, Western and Northern zones non-significant (p>0.05) differences

were noted.

60

Table 4.15. Season-wise prevalence with respect to different zones for sheep.


(%)



Southern Spring 175 59 33.71 2.189 1.339 3.578 0.002

Summer

175 93 53.14 4.880 3.016 7.897 0.000

Autumn

175 43 24.57 1.402 0.840 2.338 0.196

Winter

175 33 18.86

Western Spring 175 53 30.29 2.607 1.531 4.438 0.000

Summer

175 97 55.43 7.462 4.446 12.523 0.000

Autumn

175 33 18.86 1.394 0.790 2.461 0.251

Winter

175 25 14.29

Central Spring 175 51 29.14 1.911 1.151 3.172 0.012

Summer

175 91 52.00 5.032 3.088 8.201 0.000

Autumn

175 39 22.29 1.332 0.787 2.255 0.286

Winter

175 31 17.71

Northern Spring 175 49 28.00 3.193 1.789 5.699 0.000

Summer

175 73 41.71 5.876 3.346 10.319 0.000

Autumn

175 23 13.14 1.242 0.650 2.374 0.511

Winter

175 19 10.86


The prevalence of ticks in goats highly significant (p<0.00) differences were noted during

Spring and Summer in all zones whereas during Autumn season from all zones non-significant

(p>0.05) differences were detected. The highest prevalence was observed in Western zone

(55.43%) during Summer season and lowest in Northern zone (10.86%) during Winter season as

shown in table 4.15.

61

4.3 Identification of tick species

Livestocks containing sheep, goats, buffaloes and cows were detected infected with

several ticks species, from four agro ecologic regions of Punjab. From four genera (Hylomma,

Rhiciphalus, Boophilus and Argas) ten species were identified. Identified species from the

selected regions from Punjab, Pakistan were Hy. anatolicum (Koch, 1844), Hy. dromedarii

(Koch, 1844), Hy. truncatum (Koch, 1844), Hy. marginatum (Koch, 1844) Hy. rufipes (Koch,

1844), Rh. (Boophilus) microplus (Canestrini, 1888), Boophilus decoloratus (Koch, 1844), Rh.

appendiculatus (Neuman, 1901), Rh. sanguineus (Latreille, 1806), and Argas percicus (Oken,

1818). In the all four zones Hy. anatolicum was the most common tick species, while the second

common tick species was Hy. marginatum in all the zone in ruminants except sheep. Hy.

dromedarii were present in the Southern, Central and Western except Northern zone. Hy.

truncatum and Hy. rufipes not present in Southern, Central and Northern zones but were existing

only in Western zone of Punjab, Pakistan. Rh. sanguineus and Rh. appendiculatus both were

existing in three zones but in Northern zone only Rh. sanguineus was found while Rh.

appendiculatus was not observed. Both species Boophilus decoloratus, Boophilus microplus

were observed in all three zones while Boophilus microplus was present in other zone but

Boophilus decoloratus was not observed in Northern zones. Argas percicus was not detected in

all three regions except Central region. The chracters on the basis of which identification was

made of ticks of different genera are followings.

Hylomma

Mouth parts elongated, 2nd

segments of palps elongate

Scutum light to dark brown

Eyes present and convex

Hooped legs

Coxae of first pair of legs with long, protruding posteriorly directed spurs

Boophilus

Mouth parts very short

Eyes present but not visible

62

Conscutum frequently so poorly sclerotized that the dark pattern of caeca can be seen

from above

Rhipicephalus

Mouth parts short to medium length

Scutum usually uniformally brown

Eyes present

Coxae of first pair of legs with long, protruding posteriorly directed spurs

Argas

Mouth parts are small, ventral and not evident from above . They comprise a Central

toothed hypostome and a pair of pulps.

Camerstomal fold is unclear.

On dorsal side of the body the various symmetrically organized discs are present.

The lateral side sharp by row of quadrangular cells on both dorsal and ventral sides.

Dorsal view Ventral view

Figure 3. Dorsal view of Hy. dromedarii (female) which representing ISG (Irregular Scapular

Grooves), DS (Dark Scutum), PBL (Pale Banded Legs), SSP (Sparse Spot Distribution),

CS (Curved Scutum). Ventral view representing SL (Spurs on first pair of legs), GO (Genital

Orifice), AG (Anal Groove), LMP (Long Mouth Part), GG (Genital Groove), S (Spiracle), AO

(Anal Orifice).

ISG

DS

PBL

SSD

CS GO

AG

LMP

GG

S

AO

63


Figure 4. Dorsal view of Hy. truncatum (female) representing the LM (Long Mouth Part), DS

(Dark Scutum), CS (Curved Scutum), BL (Banded Legs), and CD (Caudal Depression). Ventral

view representing the GAS (Genital Aperture Semicircular), A (anus) and AP (Adnal Plates).


Figure 5. dorsal view Hy. rufipes representing DS (Dark Scutum), BL (Banded Legs), LM (Long

Mouth),CS ( Curved Scutum), DSS (Dark Setae on Spiracle) and DF (Dark Festoons) and ventral

view representing the VSGA (V Shape Genital Aperture), A (anus), AG (Anal Groove).

1 2

DS

BL

S

DS

BL

LM CS

CD

GAS

A

A

AP

DS

BL

LM

CS

DSS DF

VSGA

A

AG

64


Figure 6. Dorsal view of Hy. marginatum representing the PA (Porose Area), E (Eyes Present),

BL (Banded Legs), LMP (Long Mouth Part), CS (Curved Scutumn), F (Festoons Present) and

ventral view representing the GA (Genital Aperture), SP (Spiracular Plate), AA (Anus Aperture)

and APSE ( Adnal Plates Square Ends).


Figure 7. Hylomma annatolicum dorsal view representing the E (Eyes Present), CG (Cervical

Grooves), LG (Lateral Grooves), PP (Pale Parma) and ventral view representing the

GA (Genital Aperture), A (Anus), RAP (Rounded Adnal Plates) and SSAP (Small Sub Anal

Plates).

PA

E

BL

LMP

CS

F

GA

SP

AA APSE

E

CG

LG

PP

GA

A

RAP

SSAP

65


Figure 8. Dorsal view of Rhipicephalus appendiculatus representing SMP (Short Mouth Parts),

SC (Sclerotized Conscutum) and ventral view representing CA (Caudal Appendages), GO

(Genital Orifice) and A(Anus).


Figure 9. Dorsal view of Rhipicephalus sanguineus representing SC (Sharp Capituli), CG

(Caudal Grooves), BPA (Broad Prose Areas), MG (Marginal Grooves) and ventral view

representing GA (Genital Aperture), AO (Anal Opening), GG (Genital Grooves), AP (Adnal

Plates) and CP (Caudal Process).

SMP

SC

CA

GO

A

SC

CG

BPA

MG

GA

AO

GG

AP

CP

66


Figure 10. Boophilus microplus dorsal view representing SM (Short Mouth), E (Eyes Present),

DC (Dark Conscutum), CA (Caudal Appendages) and ventral view representing the GG (Genital

Grooves), GA (Genital Aperture), AG (Anal Groove).


Figure 11. Boophilus decoloratus dorsal view representing SM (Short Mouth), CG (Cervical

Groove), MG (Maiden Groove) and ventral view representing LAP (Long Adnal Plates), SP

(Spiracle Plates), AO (Anal Orifice).

SM

E DC

CA

GA

GG

AG

SM

CG

MG

LAP

SP

AO

67


Figure 12. Dorsal view of Argas percicus representing Soft tick belonging to family Argasidae

Oval shape, Mouth are present on ventral side, Leathry integument, Eyes absent and on dorsal

side of the body various symmetrical arranged discs are prese and vental view representing

ventraly small mouth parts, Genital orifice, Anus

68

Table 4.16. Prevalence of identified tick species in different farm animals in Southern zone

Punjab, Pakistan.

Ticks species

Buffaloes

NAE/NAI/NTC

Cows

NAE/NAI/NTC

Goats

NAE/NAI/NTC

Sheep

NAE/NAI/NTC Tick

species

(%) 800/283/1265 800/327/1690 700/252/1375 700/228/790

Hy. anatolicum 265 534 376 215 27.14

Hy. marginatum 196 432 324 0 18.59

Hy. dromeddari 210 0 144 0 6.91

Hy. trunctaum 0 0 0 0 0

Hy. rufipes 0 0 0 0 0

Rh. sanguineus 234 256 154 153 15.56

Rh. appendiculatus 170 237 190 0 11.66

B. microplus 125 155 187 243 13.86

B. decolaratus 65 76 0 179 6.25 NAE= Number of animals examined, NAI= Number of animals infested, NTC= Number of ticks collected

In case of Southern zone, the most common tick species was Hy. anatolicum (27.14%)

followed by Hy. marginatum (18.59%) while the least was B. decolaratus (6.25%) as shown in

the table 4.16. Hy. trunctaum, and Hy. rufipes were not found in this zone. Hy. marginatum, Hy.

dromedarii were not found on sheep in this zone.

69

Table 4.17. Prevalence of identified tick species in different farm animals in Western zone

Punjab, Pakistan.

Ticks species Buffaloes

NAE/NAI/NTC

Cows

NAE/NAI/NTC

Goats

NAE/NAI/NTC

Sheep

NAE/NAI/NTC

Tick

species

(%) 800/304/1685 800/326/3005 700/237/2680 700/208/1312

Hy. anatolicum 356 678 687 381 24.21

Hy. marginatum 234 329 346 0 10.46

Hy. dromedarii 0 155 312 0 5.37

Hy. trunctaum 178 354 0 0 6.12

Hy. rufipes 193 198 0 0 4.5

Rh. Sanguineus 256 554 467 354 18.78

Rh.appendiculatus 237 473 394 189 14.89

B. microplus 155 155 336 265 10.49

B. decolaratus 76 109 138 123 5.13

NAE= Number of animals examined, NAI= Number of animals infested, NTC= Number of ticks collected

The highest prevalence of Hy. anatolicum (24.21%) followed by Rh. sanguineus

(18.78%), Rh. appendiculatus (14.89%) and the least was Hy. rufipes (4.5%) as shown in table

4.16. Hy. trunctaum, Hy. marginatum, Hy. dromedarii and Hy. rufipes were not found in sheep

in this zone. Hy. trunctaum and Hy. rufipes were not found in case of goats in this zone.

70

Table 4.18. Prevalence of recognized tick species in several farm animals in Central zone

Punjab, Pakistan.


NAE/NAI/NTC

Cows

NAE/NAI/NTC

Goats

NAE/NAI/NTC

Sheep

NAE/NAI/NTC

Tick

species

(%) 800/364/1265 800/370/1690 700/285/1475 700/212/790

Hy. anatolicum 356 478 158 149 21.85

Hy. marginatum 232 229 123 0 11.18

Hy. dromedarii 123 155 123 0 7.68



Rh. Sanguineus 178 215 234 154 14.96

Rh. appendiculatus 219 172 254 159 15.4

B. microplus 155 155 236 165 13.62

B. decolaratus 0 54 138 163 6.8

Argas percicus 0 232 209 0 8.45

NAE= Number of animals examined, NAI= Number of animals infested, NTC= Number of ticks collected

The highest prevalence of Hy. anatolicum (21.85%) followed by Rh. appendiculatus

(15.4%) and Rh. sanguineus (14.96%) and the least was B. decolaratus (6.8%) as shown in table

4.18. Hy. trunctaum, Hy. marginatum, Hy. dromedarii, Hy. rufipes and Argus percicus were not

found in sheep in this zone.

71

Table 4.19. Prevalence of recognized tick species in several farm animals in Northern zone

Punjab, Pakistan.


NAE/NAI/NTC

Cows

NAE/NAI/NTC

Goats

NAE/NAI/NTC

Sheep

NAE/NAI/NTC

Tick

species

(%) 800/268/702 800/334/925 700/238/659 700/164/430

Hy. anatolicum 206 378 237 181 36.89

Hy. marginatum 210 229 171 0 22.46

Hy. dromedarii 0 0 0 0 0



Rh. Sanguineus 131 126 0 84 12.55

Rh. appendiculatus 0 0 0 0 0

B. microplus 155 192 251 165 28.09 NAE= Number of animals examined, NAI= Number of animals infested, NTC= Number of ticks collected

Table 4.19 showed the prevalence of recognized species of ticks in several farm ruminants in

Northern zone Punjab, Pakistan. Even a single tick of Hy. dromedarii, Hy. trunctaum, Hy.

rufipes and Rh. appendiculatus were not recorded from the animals of Northern zone. The

highest prevalence of Hy. anatolicum (36.89%) and Hy. marginatum (22.46%) were detected

from Northern zone.

Table 4.20. Analysis of variance for comparison of means.

Source of variation Degrees of

freedom

Sum of squares Mean squares F-value

Animal

Zones

Species

Error

Total

3

3

9

128

143

244981

452267

1434041

1070741

3202030

81660

161828

159338

8365

9.76**

19.35**

19.05**

** = Highly significant (P<0.01)

Table 4.20 showed the highly significant diffrences in between all ticks species which

were collected from the studied agroecological zones on different animals.

72

Table 4.21. Means betwwen animals, zones and tick species

Animal Mean SD SE

Buffaloes 136.53 B 108.79 18.13

Cows 203.06 A 182.96 30.49

Goats 171.92 AB 163.31 27.22

Sheep 92.28 C 111.84 18.64

Zone

Southern 142.22 B 138.77 23.13

Western 241.17 A 186.47 31.08

Central 130.45 B 113.01 17.87

Northern 84.88 C 107.87 19.07

Species

Argas percicus 110.25 BC 127.65 63.83

B. decolaratus 93.42 C 58.53 16.90

B. microplus 193.44 B 56.71 14.18

Hy. anatolicum 352.19 A 171.00 42.75

Hy. dromeddari 76.38 C 99.05 24.76

Hy. marginatum 190.94 B 135.79 33.95

Hy. rufipes 24.44 C 66.78 16.70

Hy. trunctam 33.25 C 96.37 24.09

Rh. Appendiculatus 168.38 B 142.77 35.69

Rh. Sanguineus 221.88 B 139.54 34.89

Means sharing similar letter are statistically non-significant (P>0.05).

Table 4.21 showed the comparison of means of animals, zones and tick species. In case

of animals, the highest numbers of tick species were found from cows followed by buffaloes,

goats and sheep. While in case of zones the highest number of tick species were observed in

Western zone. The most commonly found tick species was Hy. anatolicum and least tick species

was Hy. rufipes.

73

4.4. Selection of ticks for tick-borne pathogens

Through PCR assay, 675 samples (Southern zone 271, Western zone 98, Central zone

186 and Northern 120) were screened for the existing of DNA TBPs i.e. Theileria, Babesia,

Anaplasma, and Ehrlichia species.

Table 4.22. Complete prevalence of tick-borne pathogens in agro-ecologic zones of Punjab,

Pakistan.

AEZ NPP/NPT Theileria

spp.

Babesia

spp.

Anaplasma

spp.

Ehrlichia

spp.

Prevalence

(%)

95%

Confidence

Interval

Southern 113/271 26 8 16 63 41.69% 35.76-47.82

Western 34/98 13 6 9 6 34.69% 25.36-44.98

Central 67/186 13 8 22 24 36.02% 29.13-43.37

Northern 45/120 9 6 15 15 37.5% 28.83-46.80

Total 259/675 61 (9.0%) 28 (4.1%) 62 (9.1%) 108 (16%) 38.37% 34.68-42.16

NPP= No of poles positive, NPT= No of poles tested. Fisher’s exact test shown significant difference

among four agro-ecologic zones.

The prevalence of overall evaluations of TBPs in all agro-ecologic zones was

significantly different. Highest prevalence was found of Ehrlichia spp (16%) followed by

Anaplasma spp. (9.1%), Theileria spp. (9.03%) and Babesia spp. (4.14%) as showed in table

4.22.

74

Table 4.23. The complete prevalence of TBPs in Southern, Western, Central and Northern

zones.

AEZ Name of species NPP/NPT Theileria

spp.

Babesia

spp.

Anaplasma

spp.

Ehrlichia

spp.

Prevalence (95% CI)

Southern 113/271 26 8 16 63 41.69%, 35.76-47.82

Hy.anatolicum 95/201 23 5 12 55

Hy .marginatum 0/5 0 0 0 0

Hy. dromedarii 5/18 1 0 1 3

Rh. Sanguineus 3/11 0 1 2 0

Rh. appendiculatus 0/3 0 0 0 0

B. microplus 9/29 2 1 1 5

B. decolaratus ¼ 0 1 0 0

Western 34/98 13 6 9 6 34.69%, 25.36-44.98

Hy. anatolicum 14/37 7 2 5 0

Hy. marginatum 2/10 1 1 0 0




B. microplus 7/15 2 1 1 3

B. decolaratus 1/7 0 1 0 0

Central 67/186 13 8 22 24 36.02%, 29.13-43.37

Hy.anatolicum 24/79 4 3 2 15

Hy.marginatum 0/3 0 0 0 0




B. microplus 41/87 7 5 20 9


Northern 45/120 9 6 15 15 37.5%, 28.83-46.80

Hy.anatolicum 14/29 2 2 1 9

75

Hy.marginatum 0/2 0 0 0 0




B. microplus 29/73 7 3 13 6


Total 259/675 61 28 62 108 38.37%, 34.68-42.16

AEZ= Agro ecological zone, NPP= Number of poles positive, NPT= Number of poles tested

The overall infection ratio of (i.e. the infected tick pools proportion) TBPs (Table 4.23)

was maximum in Hy. anatolicum (43.10%), followed by B. microplus (42.15%), Rh. Sanguineus

(28.57%), Hy. dromedarii (28.20%), Hy. marginatum (10%), B. decolaratus (9.5%) and Rh.

appendiculatus (7.15%). In the Southern zone, the percentage of infected ticks was maximum in

Hy. anatolicum (47.26%) followed by B. microplus (31.03%), Rh. sanguineus (27.27%) and B.

decolaratus (2.5%), however in the Western zone, B. microplus ticks were found more

frequently infected (46.67%) followed by Hy. anatolicum (37.83%), Rh. sanguineus (35.71%),

Hy. dromedarii (33.3%), Hy. marginatum (30%) and B. decolaratus (14.28%). In the Central

zone, the percentage of infected ticks was maximum in B. microplus (47.12%) followed by Hy.

anatolicum (30.37%), Rh. sanguineus (20%) and Hy. dromedarii (16.67%), however in the

Northern zone, Hy. anatolicum ticks were observed more frequently infected (48.27%) followed

by B. microplus (39.72%), Hy. dromedarii (33.34%) and Rh. sanguineus (20%).

Hy. dromedarii ticks were mostly infested with Ehrlichia spp. (15.38%), followed by

Theileria (5.12%), Anaplasma (5.12%) and Babesia spp. (2.51%). Ticks Hy. anatolicum were

mostly infested with Ehrlichia spp. (23.16%), followed by Theileria (10.55%), Anaplasma

(5.86%) and Babesia spp. (3.51%), however Hy. marginatum were similar infested with

Theileria and Anaplasma (5%). Rh. sanguineus was infested with Theileria (8.57%) followed by

Babesia spp. (5.71%) and Anaplasma (4.28%) whereas Rh. appendiculatus was only infested

with Theleria spp. (7.14%). Ticks B. microplus were mostly infested with Anaplasma spp.

(17.15%), followed by Ehrlichia (11.27%), Theileria (8.8%) and Babesia spp. (4.9%) whereas B.

decolaratus ticks were only infested with Babesia spp (9.52%). Hy. dromedarii ticks were

infected with Ehrlichia (33.3%) and Anaplasma spp. (11.1%). But Hy. marginatum, and Rh.

76

appendiculatus and B. decolaratus ticks were not found infested with Anaplasma and Ehrlichia

spp. Complete prevalence of TBPs in agro-ecologic zones of Punjab, Pakistan. In the Southern

zone, the percentage of infested ticks was maximum in Hy. anatolicum (47.26%) followed by

Boophilus (B.) microplus (31.03%), Rh. sanguineus (27.27%) and B. decolaratus (2.5%),

however in the Western zone, B. microplus ticks were found more frequently infested (46.67%)

followed by Hy. anatolicum (37.83%), Rh. sanguineus (35.71%), Hy. dromedarii (33.3%), Hy.

marginatum (30%) and B. decolaratus (14.28%). The ticks of Southern zone were mostly

infested with Ehrlichia spp. (23.24%) followed by Theileria spp. (9.59%), Anaplasma spp.

(5.90%) and Babesia spp. (2.95%). The complete prevalence of TBPs in the Southern zone at

95% confidence interval was recorded 41.69% (35.76-47.82). %). The ticks of Western zone

were mainly infested with followed by Theileria spp. (13.26%), Anaplasma spp. (9.18%),

Ehrlichia spp. (6.12%) and Babesia spp. (6.12%). The complete prevalence of TBPs in the

Western zone at 95% confidence interval was observed 34.69% (25.36-44.98). In Central and

Northern zone the prevalence of tick borne pathogens were recorded at 95% confidence interval

(36.02% and 37.50% at 29.13-43.37 and 28.83-46.80), respectively.

In the Central zone, the percentage of infested ticks (Table 4.23) was observed higher in

B. microplus (47.12%) followed by Hy. anatolicum (30.37%), Rh. sanguineus (20%) and Hy.

dromedarii (16.67%), however in the Northern zone, Hy. anatolicum ticks were detected further

frequently infested (48.27%) followed by B. microplus (39.72%), Hy. dromedarii (33.34%) and

Rh. sanguineus (20%). %). The ticks of Central zone were mainly infested with Ehrlichia spp.

(12.90%) followed by Anaplasma spp. (11.82%), Theileria spp. (6.98%), and Babesia spp.

(4.30%). The overall tick-borne pathogens prevalence in the Northern zone at 95% confidence

interval was observed 36.02% (29.13-43.37). The ticks of Western zone were mainly infested

with Ehrlichia spp. and Anaplasma spp. (12.5%), Theileria spp. (7.50%), and Babesia spp.

(5.0%). The complete tick-borne pathogens prevalence in the Northern zone at 95% confidence

interval was recorded 37.5% (28.83-46.80). The complete prevalence of TBPs in all the zones at

95% confidence interval was observed 38.37% (34.68-42.16).

77

Table 4.24. Species of Babesia, Theleria, Anaplasmoisis and Ehrlichia isolated from different tick species in Southern Zone Punjab; Pakistan.

Diseases TBP species Hy.

anatolicum

Hy.

marginatum

Hy.

dromeddari

Rh.

sanguineus

Rh.

appendiculatus

B.

microplus

B.

decolaratus

Prevalence

(%)

Theleriosis T. annulata 18 0 1 0 0 2 0 21 (7.74%)

T. ovis 0 0 0 0 0 0 0 0 (0.36)

T. orientalis 5 0 0 0 0 0 0 5 (1.84%)

Babesiosis B. bigemina 2 0 0 0 0 0 0 2 (0.73%)

B. bovis 0 0 0 1 0 0 0 1 (0.36)

B. caballi 5 0 0 0 0 0 0 5 (1.84%)

B. occultans 0 0 0 0 0 0 0 0

Anaplasmoisis A. Centrale 5 0 0 0 0 0 0 5 (1.84%)

A. marginale 5 0 0 2 0 1 0 8 (2.95%)

A. ovis 3 0 0 0 0 0 0 3 (1.10%)

Ehrlichiosis E. sp. 1 27 0 2 0 0 3 0 32 (11.80)

E. sp.

Omatjenne

25 0 1 0 0 5 0 31 (11.43)

The estimates of overall prevalence of several Theleria species were significant while estimates prevalence of Babesia species

were not significantly different in Southern zone, Punjab (Table 4.24). Among Theleria species, highest prevalence was found in T.

annulata (7.74%) as compared to T. orientalis (1.84%). T. annulata was found only in Hy. anatolicum, Hy. dromedarii and B.

microplus whereas T. orientalis was identified only in Hy. anatolicum. T. annulata was primarily found in (7.74%) Hy. anatolicum.

B. bigemina and B. caballi were observed only in Hy. anatolicum whereas B. bovis was detected only in Rh. sanguineus. The

estimates of overall prevalence of several Anaplasma species were significantly different in this zone. The prevalence of A. marginale

(2. 95%) was observed maximum followed by A. Centrale (1.84%) and A. ovis (1.10%) in this zone among Anaplasma spp.

Prevalence of A. Central and A. marginale was found highest in Hy. anatolicum and A. marginale was identified in Rh. sanguineus

and B. microplus too. A. ovis was detected only in Hy. anatolicum. Ehrlichia species prevalence estimate in this zone was found

significantly different.

78

Table 4.25. Species of Babesia, Theleria, Anaplasmoisis and Ehrlichia isolated from different tick species in Western Zone Punjab; Pakistan.

Diseases TBP species Hy.

anatolicum

Hy.

marginatum

Hy.

dromedarii

Rh.

sanguineus

Rh.

appendiculatus

B.

microplus

B.

decolaratus

Total

Theleriosis T. annulata 5 2 0 1 0 3 0 11(11.22%)

T. ovis 0 0 0 0 0 0 0 0

T. orientalis 2 0 0 1 0 0 0 3 (3.06%)

Babesiosis B. bigemina 0 0 0 0 0 0 1 1 (1.02%)

B. bovis 2 1 0 1 0 0 0 4 (4.08%)

B. caballi 0 0 0 0 0 0 0 0

Anaplasmoisis A. Centrale 0 0 0 0 0 0 0 0

A. marginale 5 0 0 2 0 1 0 8 (8.16%)

A. ovis 0 0 1 0 0 0 0 1 (1.02%)

Ehrlichiosis E. spp.

ERm58

0 0 2 0 0 3 0 5 (5.10%)

E. spp. Firat 0 0 0 0 0 0 0 0

E. spp.

Omatjenne

0 0 1 0 0 0 0 1 (1.02%)

Among Theleria species, highest prevalence was found in T. annulata (10.20%) as compared to T. orientalis (3.06%). T.

annulata was found in Hy. anatolicum, Hy. marginatum, Rh. sanguineus and B. microplus whereas T. orientalis was identified in Hy.

anatolicum and Rh. sanguineus. Theleria species was mainly present in Hy. anatolicum. The estimates of overall prevalence of several

Babesia species were significantly different in this zone B. bovis was found highest (4.08%) as compared to B. bigemina and B.

occultans (1.02%). B. bovis was mainly present in Hy. anatolicum. B. bigemina was found only in B. decolaratus. The estimates of

overall prevalence of several Anaplasma species were significantly different in this zone; Punjab. The prevalence of A. marginale

(8.16%) was maximum than A. ovis (1.02%). Prevalence of A. marginale was noted highest in Hy. anatolicum and A. ovis was only

identified in Hy. dromedarii. Ehrlichia species prevalence estimate in this zone was also found significantly different as shown in

table 4.25.

79

Table 4.26. Species of Babesia, Theleria, Anaplasmoisis and Ehrlichia isolated from different tick species in Central zone Punjab; Pakistan.

Diseases TBP

species

Hy.

anatolicum

Hy.

marginatum

Hy.

dromeddari

Rh.

sanguineus

Rh.

appendiculatus

B.

microplus

B.

decolaratus

Total

Theleriosis T.

annulata

2 0 1 0 0 0 0 3 (1.6%)

T. ovis 0 0 0 0 0 2 0 2

(1.075%)

T.

orientalis

2 0 0 1 0 5 0 8 (4.30%)

Babesiosis B.

bigemina

3 0 0 0 0 3 0 6 (3.22%)

B. bovis 0 0 0 0 0 2 0 2

(1.075%)

B. caballi 0 0 0 0 0 0 0 0

Anaplasmoisis A.

Centrale

0 0 0 0 0 3 0 3 (1.6%)

A.

marginale

2 0 0 0 0 15 0 17

(9.13%)

A. ovis 0 0 0 0 0 2 0 2

(1.075%)

Ehrlichiosis E. spp.1 7 0 0 0 0 5 0 12

(6.45%)

E. spp.

Omatjenne

8 0 0 0 0 4 0 12

(6.45%)

80

The estimates of overall prevalence of several Theleria species were significantly

different in Central zone, Punjab (Table 4.26). Among Theleria species highest prevalence was

found in T. orientalis (4.44%) followed by T. annulata (1.66%) and T. ovis (1.11%). T. ovis was

found only in B. microplus. T. annulata was observed in Hy. anatolicum and Hy. dromedarii

whereas T. orientalis was identified in Hy. anatolicum, Rh. sanguineus and B. microplus.

Theleria species was highly found in B. microplus.The prevalence of Babesia species was

highest in B. bigemina (3.33%) as compared to B. bovis (1.11%). The species of B. bigemina

was found in Hy. anatolicum and B. microplus while B. ovis were found only in B. microplus . B.

coballi was not detected in this zone. The estimates of overall prevalence of several Anaplasma

species were significantly different in this zone, Punjab (Table 4.26). The prevalence of A.

marginale (9.44%) was maximum, followed by A. Centrale (1.66%) and A. ovis (1.11%) in this

zone. Prevalence of Anaplasma species was found highest in B. microplus. Both A. ovis and A.

Centrale was only detected in B. microplus. Ehrlichia species prevalence estimate in this zone

was found significantly different. The prevalence of both E. spp. 1 and E. spp. Omatjenne was

similar (6.45%) and these were mainly present in Hy. anatolicum.

81

Table 4.27. Species of Babesia, Theleria, Anaplasmosis and Ehrlichia isolated from different tick species in Northern zone Punjab; Pakistan.

Diseases TBP

species

Hy.anatolicum Hy.marginatum Hy.

dromeddari

Rh.

sanguineus

Rh.

appendiculatus

B.

microplus

B.

decolaratus

Total

Theleriosis T.

annulata

1 0 0 0 0 1 0 2 (1.66%)

T. ovis 0 0 0 0 0 1 0 2 (1.66%)

T.

orientalis

1 0 0 0 0 5 0 6 (5.00%)

Babesiosis B.

bigemina

2 0 1 0 0 2 0 5 (3.33%)

B. bovis 0 0 0 0 0 1 0 1 (0.83%)

B. caballi 0 0 0 0 0 0 0 0

Anaplasmosis A.

Centrale

0 0 0 0 0 2 0 2 (1.66%)

A.

marginale

1 0 0 1 0 10 0 12

A. ovis 0 0 0 0 0 1 0 1 (0.83%)

Ehrlichiosi

E. spp. 1 4 0 0 0 0 3 0 7 (5.83%)

E. spp.

Omatjenne

5 0 0 0 0 3 0 8 (6.66%)

82

The estimates of overall prevalence of several Theleria species were significantly

different in Northern zone, Punjab (Table 4.27). Among Theleria species highest prevalence was

found in T. orientalis (5%) followed by T. annulata (1.66%) and T. ovis (1.66%). T. ovis was

found only in B. microplus. T. annulata and T. orientalis were identified in Hy. anatolicum and

B. microplus. Theleria species was highly found in B. microplus. The prevalence of Babesia

species was highest in B. bigemina (3.33%) as compared to B. bovis (0.83%). The species of B.

bigemina was observed in Hy. anatolicum, Hy. dromedarii and B. microplus while B. ovis were

found only in B. microplus. B. coballi was not detected in this zone. The estimates of overall

prevalence of several Anaplasma species were significantly different in this zone, Punjab (Table

4.27). The prevalence of A. marginale (10%) was maximum, followed by A. Centrale (1.66%)

and A. ovis (0.83%) in this zone. Prevalence of Anaplasma species was found highest in B.

microplus. A. marginale was detected in Hy. anatolicum and Rh. sanguineus. Prevalence of

Ehrlichia species estimate in this zone was found significantly different (p> 0.01). The highest

prevalence was detected in E. spp. 1 (6.66%) as compared to E. spp. Omatjenne (5.83%). Both

species were found in Hy. anatolicum and B. microplus.

83

Figure 13. showed the Anaplasma and Ehrlichia spp. M represent the molecular marker. 1-4

samples were loaded in agarose gel for the analysis of pathogens. A. marginale, A. ovis and

Ehrlichia spp were observed in loaded samples.

In figure 13 365bp showed A. marginale, 347bp showed A. ovis and 480bp showed Ehrlichia

species.

84

Figure 14. Agarose gel electropherosis for the presence of Babesia and Theileria spp.

In figure 14 480bp showed Babesia, and 470bp showed Theileria.

85

Figure 15. shows the Babesia and Theleria species M represent the molecular marker. 1-7

samples were loaded in agarose gel for the analysis of pathogens. B. bigemina, B. bovis, B.

caballi, T. annulata, A. ovis and T. orientalis were observed in loaded samples. Lane 7 was

negative control.

86

4.5. Control of tick species

Table 4.28. Lethal concentration of selected plant extracts against Hy. anatolicum

Plant extracts Time

(hrs)

LC50±SE Confidence interval at

95%

P value


C. procera 24 12.25±2.26 9.14 21.39 0.04

48 10.77±2.53 7.42 24.98 0.39

72 5.91±1.02 3.97 8.62 0.25

96 2.57±0.92 0.11 4.26 0.07

B. rapa 24 11.87±2.04 8.99 19.56 0.02

48 9.60±1.93 6.83 17.87 0.26

72 5.66±1.07 3.54 8.5 0.07

96 2.47±0.81 0.39 3.95 0.05

S. nigrum 24 9.28±1.30 7.25 13.27 0.03

48 6.26±0.86 4.68 8.42 0.00

72 3.75±0.93 1.50 5.68 0.07

96 2.02±0.02 0.94 3.80 0.16

T. foenum-graecum 24 16.79±4.34 11.57 44.62 0.12

48 10.95±1.89 8.24 18.03 0.02

72 7.27±1.15 5.81 11.1 0.00

96 3.88±0.98 1.5 50.96 0.03

C. colocynthis 24 12.15±2.05 9.25 19.78 0.06

48 10.41±1.26 7.31 21.49 0.32

72 6.55±1.25 4.29 10.44 0.17

96 3.26±0.79 1.38 4.81 0.14

LC: Lethal Concentration; SE: Standard Error; CI: Confidence Interval

87

Different concentrations (0.75 or 1.5 or 3.00 or 6.00 or 12.00%) of selected plant extracts

were used to check the LC50 for tick species Hy. anatolicum. The table 4.28 shows that LC50

values of C. procera were 12.25, 10.77, 5.91and 2.57% for 24, 48, 72 and 96 hrs, respectively.

Above mentioned same concentrations of B. rapa were showed 11.87, 9.60, 5.66 and 2.47%

LC50 values after 24, 48, 72 and 96 hrs. S. nigrum showed the 9.28, 6.26, 3.75and 2.02% LC50

values were after 24, 48, 72 and 96 hrs time interval. Similar concentrations and time interval

were used for T. foenum graceum to evaluate LC50 values which were 16.79, 10.95, 07.27,

3.88% and 12.55, 10.41, 06.55and 3.26% for C. colocynthis. The result revealed that S. nigrum

showed the highest mortality in tick species and the time and dose dependent toxicological

effects on tick species.

88

Table 4.29. Lethal time of selected plant extracts against Hy. anatolicum

.

Plant extracts Conc.

(%)

LT50±SE

(hrs)

Confidence interval at

95% P value


C. procera 0.75 134.58±2.28 103.7 332.08 0.28

1.50 99.04±1.89 77.92 189.75 0.91

3.00 72.88±1.28 52.78 119.74 0.87

6.00 58.40±1.21 38.54 76.92 0.03

12.00 39.88±0.92 9.44 54.48 0.02

B. rapa 0.75 134.58±2.28 103.7 332.08 0.28

1.50 101.92±1.97 81.19 182.66 0.13

3.00 66.79±1.26 46.94 96.76 0.92

6.00 51.08±1.08 27.91 66.79 0.81

12.00 38.99±0.71 9.89 53.21 0.68

S. nigrum 0.75 107.90±1.34 94.96 145.6 0.22

1.50 92.65±1.76 68.96 294.99 0.96

3.00 61.91±1.28 35.43 92.17 0.84

6.00 32.99±0.88 36.41 52.18 0.89

12.00 5.42±0.60 263.08 34.36 0.95

T. foenum-graecum 0.75 100.58±1.84 0.00 0.00 1.00

1.50 97.45±1.24 79.02 156.47 0.97

3.00 89.40±1.04 71.59 144.37 0.82

6.00 65.06±0.88 45.17 91.48 0.83

12.00 54.55±0.10 36.35 69.23 0.97

C. colocynthis 0.75 134.58±2.28 103.7 332.08 0.28

1.50 107.77±1.34 83.58 226.16 0.97

3.00 84.35±1.71 61.09 258.84 0.96

6.00 55.57±0.57 35.86 71.88 0.81

12.00 41.77±0.49 9.43 57.19 0.63

LT: Lethal Time; SE: Standard Error; CI: Confidence Interval

89

Table 4.29 displays the lethal concentration of selected plant extracts against tick species.

Different time intervals (24 hrs or 48 hrs or 72 hrs or 96 hrs) were used to check the LT50 for tick

species Hy. anatolicum. The table 4.29 shows that LT50 values of C. procera at 0.75, 1.5, 3.00,

6.00 or 12.00 % were 134.58, 99.04, 72.88, 58.40and 39.88 hrs, respectively. Above mentioned

same concentrations of B. rapa were showed 134.58, 101.92, 66.79, 51.08 and 38.99 hrs LT50

values after 24, 48, 72 and 96 hrs. S. nigrum showed the 107.90, 92.65, 61.91, 32.99 and 5.42 hrs

LT50 values were at 0.75, 1.5, 3.00, 6.00 or 12.00 %. Similar concentrations and time interval

were used for T. foenum-graceum to evaluate LT50 values which were 100.58, 97.45, 89.40,

65.06 and 54.55 hrs and 134.58, 107.77, 84.35, 55.57and 41.77 hrs for C. colocynthis. The result

showed that S. nigrum exhibited the highest mortality in tick species and the time and

concentration dependent toxicological effects on tick species.

Figure 16. Mortality (%) of Hy. anatolicum after 24, 48, 72 and 96 hrs against different

concentration of plants extract

0

10

20

30

40

50

60

70

80

90

100

C

ontr

ol

0.7

5%

1.5

0%

3.0

0%

6.0

0%

12.0

0%

0.7

5%

1.5

0%

3.0

0%

6.0

0%

12.0

0%

0.7

5%

1.5

0%

3.0

0%

6.0

0%

12.0

0%

0.7

5%

1.5

0%

3.0

0%

6.0

0%

12.0

0%

0.7

5%

1.5

0%

3.0

0%

6.0

0%

12.0

0%

C. procera B. rapa S.nigrum T. foenum

graecum

C. colocynthis

% M

ort

ali

ty

Used Plants

24 hours 48 hours 72 hours 96 hours

90

The percent mortality of tick species Hy. anatolicum with different concentration (0.75,

1.5, 3.00, 6.00 and 12.00 %) of plants extract at different post treatment time intervals i.e. 24, 48,

72 and 96 hrs were shown in figure 16. As the time and concentration of extract increased, the

mortality of tick also increased. Percent mortality of tick species were time and concentration

dependent. After 96 hrs the percent mortality of tick species Hy. anatolicum was seen about 85%

for B. rapa and S. nigrum at 12.00 % concentration of extract. In C. procera percent mortality

was observed 83% after 96hrs at 12.00 % concentration of extract while in case of T. foenum-

graecum (74%) and C. colocynthis (83%) percent mortality was observed after 96hrs at 12.00 %

concentration of plants extract.

Table 4.30. Lethal concentration of selected acaricides against Hy. anatolicum.

Acaricides Time

(hrs)

LC50±SE Confidence interval at 95% P value


Cypermethrin 24 2.38±0.41 1.68 3.64 0.28

48 1.77±0.88 6.47 3.81 0.00

72 2.70±2.47 56.79 0.002 0.00

96 2.10±1.23 7.75 0.51 0.00

Emamectin 24 2.64±0.64 1.64 6.11 0.42

48 0.74±0.32 0.16 1.32 0.17

72 0.178±0.244 0.56 0.56 0.06

96 0.176±0.118 0.28 0.34 0.96

Fipronoil 24 83.59±12.42 64.65 147.12 0.73

48 0.76±0.19 0.28 1.12 0.50

72 0.31±0.14 0.12 0.55 0.91

96 0.15±0.12 0.33 0.33 0.85

LC: Lethal Concentration; SE: Standard Error; CI: Confidence Interval

Different concentrations (0.25 or.5 or 1.00 or 2.00 or 4.00%) of selected acaricides were

used to check the LC50 for tick species Hy. anatolicum. The table 4.30 shows that LC50 values of

Cypermethrin were 2.38, 1.77, -2.70, and -2.10% for 24, 48, 72 and 96 hrs, respectively. Above

mentioned same concentrations of Emamectin were showed 2.64, 0.74, 0.178 and 0.176 % LC50

values after 24, 48, 72 and 96 hrs. Fipronoil showed the 83.59, 0.76, 0.31 and 0.15 % LC50

91

values were after 24, 48, 72 and 96 hrs time interval. The result revealed that cypermethrin

showed the highest mortality in tick species Hy. anatolicum and the time and dose dependent

toxicological effects on tick species.

Table 4.31. Lethal time of selected Acaricides against Hy. anatolicum

Acaricides

Concen.

%

LT50±SE

hrs

Confidence interval at 95% P value


Cypermethrin 0.25 99.43±1.35 78.84 180.75 0.92

0.5 51.52±0.14 39.48 61.5 0.63

1.00 35.87±0.02 22.84 44.56 0.17

2.00 25.98±0.29 7.28 35.96 0.34

4.00 16.50±0.37 12.95 28.7 0.48

Emamectin 0.25 88.64±1.42 68.17 178.7 0.00

0.5 54.55±1.10 36.35 69.23 0.00

1.00 30.81±0.76 1.78 44.34 0.04

2.00 25.53±0.38 9.73 14.19 0.01

4.00 19.92±0.67 1.95 30.01 0.91

Fipronoil 0.25 88.64±1.42 68.17 178.7 0.01

0.5 53.74±0.38 38.02 66.59 0.01

1.00 8.20±0.09 43.04 28.87 0.60

2.00 23.62±0.94 5.48 32.95 0.72

4.00 0.28±0.18 240.77 17.18 0.95

LT: Lethal Time; SE: Standard Error

Different time intervals (24 hrs or 48 hrs or 72 hrs or 96 hrs) were used to check the LT50

for tick species Hy. anatolicum. The table 4.31 showed that LT50 values of cypermethrin at 0.25,

.50, 1.00, 2.00 or 4.00 % were 99.43, 51.52, 35.87, 25.98 and 16.50 hrs, respectively. Similar

concentrations and time interval were used for Emamectin to evaluate LT50 values which were

88.64, 54.55, 30.81, 25.53 and 19.92 hrs and 88.64, 53.74, 8.20, 23.62 and 0.28 hrs for Fipronoil

The result showed that Fipronoil exhibited the highest mortality in tick species Hy. anatolicum

and the mortality is time and concentration dependent toxicological effects on tick species.

92

Figure 17. Mortality (%) of Hy. anatolicum after 24, 48, 72 and 96 hrs against different concentration of

acaricides

Percent mortality of Hy. anatolicum tick species were recorded with the application of

different concentrations (.25, .5, 1.00, 2.00 & 4.00%) of acaricides i.e. cypermethrin, emamectin

and fipronoil. Mortality was recorded after different time intervals 24 hrs, 48 hrs, 72 hrs and 96

hrs. In case of all used acaricides i.e. cypermethrin, fipronoil and emamectin mortality was

recoded 100% after 96hrs of time interval and at 4.00% concentration of used acaricides. We

observed from the results that percent mortality was concentration and time dependent.

0

20

40

60

80

100

120

Con

tro

l

0.2

5%

0.5

0%

1.0

0%

2.0

0%

4.0

0%

0.2

5%

0.5

0%

1.0

0%

2.0

0%

4.0

0%

0.2

5%

0.5

0%

1.0

0%

2.0

0%

4.0

0%

Cypermethrin Emamectin Fipronoil

% M

ort

ali

ty

Acaricides tested in the study

24 hours 48 hours 72 hours 96 hours

93

4.6. Phytochemical analysis

Phytochemical analysis of five selected plants i.e C. procera, B. rapa, T. foenum-

graecum, S. nigrum and C. colocynthis presented in (table 4.26). The results revealed the

presence of medically active constituents in the studied plants. Flavonoids, terpenoids and

alkaloids were present in all studied plants while steroids were found in all except C. procera.

Phenols, saponins and tanins have been recognized for many biological effects. The methanolic

extracts of these plants are evaluated in-vitro for their acaricidal activity against ticks.

Table 4.32. Qualitative phytochemical analysis of selected plants.

Sr.

No

Selected

plant

species

Common

Name

Plant

Part

Alkaloids Flvonoids Steroids Terpenoids Tannins Saponins Phenols

1 C.

procera

Auk Leaves,

flowers

and

stem

+ ++ - + - + +

2 B. rapa Surso Leaves,

flowers

and

stem

++ +++ + ++ + - +

3 T. foenum

-graecum

Maithe

Leaves,

flowers

and

stem

+ ++ + + - ++ -

4 S. nigrum Makoi Leaves,

fruit

and

stem

++ +++ + - ++ ++ -

5 C.

colocynthis

Kurtuma Fruit + ++ + + + + +

Sign; + weak positive, ++ low weak, +++ strong positive; - absent

94

DISCUSSION

In tropical and subtropical zone of the world ticks are the most significant pest of

ruminants (Admassu et al., 2015). On animal and human health ticks and TBDs have a vast

effect. Animals condition is effected from ticks by biting stress that is responsible for the

production loss, physical injury, poisoning, and pathogens distribution comprising rickettsia,

protozoa, viruses, spirochetes, bacteria and filarial nematodes (Satta et al., 2011; Gosh & Nagar

2014; Jabbar et al., 2015; Kaur et al., 2015). However, financial crisis associated with ticks are

generally due to the diseases which they spread to the host (Sultana et al., 2015). Economic

losses related with niggling irritation which results in reduction of the value of skins and furs (up

to 20-30%) are also important (Sultana et al., 2015). The current study was conducted to evaluate

the tick prevalence, their control and the tick borne pathogens in four agro-ecological regions of

Punjab, Pakistan.

4.6. Prevalence of ticks in agro-ecologic zones

The results of current research showed that all the animals farms which studied were

observed infested with one or many species of ticks. Differences were existing in the ticks

prevalence infestation within farms of similar research zones. The ticks prevalence in Western

(35.83%), Central (40.43%), Southern (36.33%) and Northern zones (33.47%) was observed.

These differences in prevalence of ticks were because of the topographical situation, temperature

and weather situations of several research part of Province, Punjab (Iqbal et al., 2014). The ticks

prevalence in earlier study from Pakistan did not study the agro-ecologic regions and were

centered on specific area merely (Jabbar et al., 2015) or variations in the ticks prevalence had

been described in several parts of the related region (Iqbal et al., 203). The data with respect to

the ticks prevalence in several animals species were noted in various seasons of the year. The

ticks Prevalence of infestation on different animals species in dissimilar seasons of the year in

Summer, Spring, Autumn and Winter was found 55.30%, 41.30%, 29.57% and 19.33%

respectively.

The results of the present research showed the utmost prevalence of ticks infestation in

Summer season because in Summer the climate was warm and moist that maintained the

existence of infestation of tick. Though, all over the year the animals remained infested with

ticks. Difference in tick infestation might be because of topographical situations and weather

95

circumstances of several research areas. Dissimilar environmental effects comprising humidity,

rainfall and temperature support the survival of tick in any zone (Greenfield et al., 2011), several

additional factors such as season, status of nutrition in animals, host availability (Teel et al.,

1996; Alonso et al., 2007) and agricultural aplications (Sajid et al., 2011) also influence ticks

infestation rate. The outcomes of present study were in similar with the previous studies of

Ghosh et al. (2007), Durrani and Shakoori, (2009), Rony et al. (2010), Sultana et al. (2015) and

Ali et al. (2016) who also reported highest ticks infestation in Summer season. The outcomes of

present study was also in line with Mustafa et al. (2014) who described the prevalence of ticks

highly from June to August and Atif et al. (2012) who observed the maximum ticks infestation

in the research zones of Sargodha district Punjab, Pakistan, in the months of June and July. The

results of current study were also in agreement with the results of Kabir et al. (2011) who found

more prevalence of ticks in Summer (41.66%) followed by Winter season (31.5%) in

Bangladesh.

In the present study total 12,000 animals (2800 goats, 2800 sheep, 3200 buffaloes and

3200 cows) were observed in 120 livestock farms in twelve districts of Punjab, Pakistan. The

results showed that the total ticks prevalence in animals was 36.52% (4382/12,000). The present

research had been carried out in four different seasons in various agro-ecologic zones of Punjab

to observe the ticks prevalence in livestock. The prevalence results of present study were in

agreement with the results of Iqbal et al. (2013) who reported prevalence of tick species 31%

from Pakistan. Though, the findings of this research were in contradicted with the findings of

Mustafa et al. (2014) who observed tick prevalence 85% in Sargodha district Punjab, Pakistan.

This variance in the ticks prevalence could be due to the difference in weather and topographical

conditions of the research regions, research times, target populations and husbandry rehearses

(Iqbal et al., 2014). In Africa and Asia, ticks prevalence in livestock was plentiful than the other

continents (Sajid et al., 2011). Higher tick infestation in these continents is due to the warmer

weather which supports favorable situations for the ticks development, difference in housing

panaches, farming rehearses and tactics for tick management.

It was noted that the prevalence of ticks in the province Punjab had been growing

quickly in previous few years, which could be because of the resistance of acaricides (Sajid et

al., 2008; Sajid et al., 2009a; Ali et al., 2013; Mustafa et al., 2014; Tasawar et al., 2014). The

96

acaricides resistance had been reported by Abbas et al. (2014) in tropical and subtropical areas of

the world however; in Pakistan no study has yet reported resistance of acaricides (Jabbar et al.,

2015). The prevalence was significantly maximum in the Central region in present research

because of highly temperature that presented optimal conditions for the tick growth as compared

to the Northern area where temperature was low.

Ticks prevalence in the current study areas were observed in animals in following order

cows>buffaloes>goats>sheep (42.41>37.53>36.14>29.00%), respectively. It was obvious with

the findings that the tick prevalence was considerably different between species of animal in the

present study which was in similar with the earlier studies of Ghosh et al. (2007) and Sajid et al.

(2008) who described the ticks prevalence higher in cows as compared buffaloes from lower

Punjab, Pakistan. The outcomes of current study revealed that in animals the prevalence of ticks

was highest in cows as compared to buffaloes, that was in agreement with the earlier studies of

Rehman et al. (2004), Sajid et al. (2009a) and Ali et al. (2013) who also reported the higher

prevalence of ticks in cows than buffaloes in Pakistan. The higher ticks prevalence in cows than

buffaloes may be related with the drier residences and thinner skin of cow than the marshy

habitations and denser buffaloes skin (Sajid et al., 2009a), and heredities of host could also show

a part (Jonsson et al., 1998). The ticks prevalence in cows was found 42.41 % in the current

study areas of Punjab, Pakistan which was statistically in line with the results of Perveen et al.

(2011) and Khan et al. (2013) which reported prevalence of ticks in cows was 48.35%, in

Pakistan.

The outcomes of current research were indisagreement with the outcomes of Sajid et al.

(2008), Sajid et al. (2009a), Soomro et al. (2014), Sultana et al. (2015) and Ali et al. (2016) who

reported the prevalence of ticks in Pakistan 75.1%, 72.9%, 22.38%, 55.5%, 71.9%,

correspondingly. In the present research, the ticks prevalence was 37.53% in buffaloes which is

statistically at per with the findings of Sajid et al. (2008), who described 40.1%, Sajid et al.

(2009a) who reported 47.3% & Perveen et al. (2011) who also described 43.85% respectively in

Pakistan. The results of this findings were contradict with Mustafa et al. (2014) and Rehman et

al. (2017), who described prevalence of ticks in buffaloes 84.3% & 81.44% respectively, in

Punjab, Pakistan while the results of current study were somewhat different from Ali et al.

(2016), Sultanta et al. (2015), Soomro et al. (2014), Tasawar et al. (2014) and Khan et al. (2013),

97

who reported prevalence of ticks 62.03%, 51.03%, 52.5%, 24.75%, and 51.65%, respectively in

Pakistan. The ticks prevalence in goats was observed 36.14% which was statistically in similar

with the findings of Irshad et al. (2010) who described 41.43% ticks prevalence in goats in

Islamabad and Riaz et al. (2017) who reported (43.6%) ticks prevalence in goats in Multan

districs Punjab, Pakistan. The findings were not in contract with the result of Manan et al. (2007)

12.1%, Sajid et al. (2008) 51.6%, Perveen et al. (2011) 14.8%, Mustafa et al. (2014) 86.5% and

Rehman et al. (2017), 60% respectively in Pakistan. Ticks prevalence in sheep was observed

29.00% which was in contrast by the results of Manan et al. (2007), Irshad et al. (2010), Perveen

et al. (2011), Riaz et al. (2017) and Rehman et al. (2017) which described the prevalence of ticks

in sheep 12.8%, 43.37%, 3.3%, 11.1% and 50.0% respectively, in Pakistan. Aasma et al. (2014)

observed the prevalence of ticks infestation in cattle followed by goats buffaloes and sheep

which was (60.5%, 25.9%, 17.8% and 14.8%), respectively in Egypt.

In the current study total 10 different ticks species were identified i.e. Hy. anatolicum

(25.92%), Hy. marginatum (14.05%), Hy. dromedarii (5.62%), Hy. truncatum (2.44%), Hy.

rufipes (1.79%), Rh. sanguineus (16.33%), Rh. appendiculatus (12.39%), B. microplus (14.2%),

B. decolratus (5.15%) and A. percicus (2.02%) respectively. On the basis of morphologic

characters the ticks were recognized. The identification of ticks in present study revealed that Hy.

anatolicum species was most plentiful in study areas. It parasitized all the sheep, goats, buffaloes

and cows in all four agro ecological zones. The findings of current study were in agreement with

Sajid et al. (2008), Sajid et al. (2009a), Perveen et al. (2011), Ali et al. (2013), Iqbal et al. (2014),

Sultana et al. (2015), Karim et al. (2017), Riaz et al. (2017) and Rehman et al. (2017) who

observed the high infestation rate of Hy. anatolicum in Punjab, Pakistan. The results of present

research were also in agreement from the neighboring states such as in Iran (Ganjali et al., 2014;

Hosseini-Chegeni et al., 2013; Nasiri et al., 2010) and in India (Chhillar et al., 2014) that the

most abundant tick species was Hy. anatolicum. The results of current research revealed that the

species of tick B. microplus was observed from all the livestock species in all agro-ecological

regions which is in line with the results of khan et al. (1993), Gosh et al. (2007), Sajid et al.

(2009a), Irshad et al. (2010), Perveen et al. (2011), Iqbal et al. (2014), Mustafa et al. (2014),

Tasawar et al. (2014) and Karim et al. (2017) who also observed B. microplus in the region of

Punjab, Pakistan.

98

Hy. marginatum was also detected from the study area Punjab; Pakistan. The outcomes of

present research were in agreement with the outcomes of Gosh et al. (2007), Mustafa et al.

(2014) and Iqbal et al. (2015) who also observed the presence of Hy. marginatum in Punjab,

Pakistan. The result of current research was also in agreement by the results of Hosseini-Chegeni

et al. (2013) and Gharekhani et al. (2015) who observed Hy. marginatum from Iran. Hy.

dromedarii was observed in the present study but Hy. dromedarii is limited to Bhakar and

Bahawalpur district in the Southern and Western zone. The most part of Bhakar and Bahawalpur

district comprises on deserts where the production of camel was common and Hy. dromedarii

species of tick is particular to fodder on camel. Therefore, the existence of Hy. dromedarii in

cows, buffaloes and goats except sheep might be transferred from camel. The results of my

findings were similar with the findings of Hussain and Kumar, (1985), Siddiqi and Jan, (1986)

Gosh et al. (2007), Perveen et al. (2011), Rehman et al. (2017 & Karim et al. (2017) who

reported Hy. dromedarii species in Pakistan. In Western Punjab, Pakistan, only Hy. truncatum

and Hy.rufipes were found which was not reported in other zones these results were in line with

the study of Gosh et al. (2007) who described Hy. truncatum and Hy.rufipes from Pakistan and

also in contract with the results of Karim et al. (2017) who described Hy. truncatum in Punjab,

Pakistan.

The findings of our research were also in agreement with the outcomes of Paul et al.

(2017) who observed this in Nigeria from cattle population and Hosseini-Chegeni et al. (2013)

who observed from Iran. In present study Rh. sanguineous specie was identified which was in

line with the findings of Khan et al. (1993), Durrani et al. (2008), Sajid et al., (2008), Sajid et al.

(2009a), Mustafa et al. (2014), Karim et al. (2017) and Riaz et al. (2017) who also reported that

presence in Punjab, Pakistan. The outcomes of this research were also in agreement with the

outcomes of Islam et al., (2006) who observed from Bangladesh, Kabir et al. (2011), Musa et al.

(2014) described from Nigeria, Monfared et al. (2015), Gharekhani et al. (2015) who reported

from Iran, and Hossain et al. (2016) from Bangladesh who reported Rh. sanguineous species

from the livestock population. The Rh. appendicluatus was identified from the 3 zones expect

Northern zone which may be due to the difference in weather and geographical conditions.

Earlier this species was reported only in one study Gosh et al. (2007) in Pakistan. The Rh.

decolratus was identified from the current study areas but in previous study this species was not

described. The Argas percicus was identified from the infested cow and goats from Central

99

Punjab. The findings of the current research were in line by the results of Khan et al. (2001) who

described Argas percicus from Faisalabad. The outcomes were also in line with the outcomes of

Qamar et al. (2009) and Shahnaz et al. (2016) who observed Argas percicus from poultry in

Punjab, Pakistan. Our findings were in line with the results of Singh and Chhabra (1973) and

Chhabra and Donora (1994) who reported Argas percicus in the other countries of world.

4.7. Tick-borne Pathogens

A wider range of contagious agents are transferred in livestock and humans by ticks as

well as they cause direct harms to domestic animals than other parasites (blood suckling

arthropod) (Munderloh et al., 2005). The pathogens i.e. fungi, protozoa, bacteria and viruses

were transmitted by ticks (de La Fuente et al., 2015). In animals, ticks and TBPs become the

cause of global economic loss annually which was estimated in dollars in billions (13.9 billion-

18.7 billion US$) (de Castro, 1997; Jongejan and Uilenberg, 2004). During last few years, a

number of TBDs (> 16) of humans and animals (about 19) had been identified (Sonenshine &

Roe, 2014), the variety of TBDs had been reported like ehrlichiosis, borreliosis, anaplasmosis

and rickettsiosis (Dantas-Torres et al., 2012). For the recognition of various new pathogens,

currently recognized molecular biological tools (Doudier et al., 2010; Dantas-Torres et al., 2012;

Ehounoud et al., 2016) and latest molecular diagnostic methods, like PCR are known to be

effective technique to accurately evaluate prevalence of pathogen and to recognize co-infected

hosts (Lorusso et al., 2016; Bilgic et al., 2017). In the current study, total 675 species of ticks i.e.

(Hy. anatolicum= 341, Hy. marginatum= 20, Hy. dromedarii= 39, Rh. sanguineus= 35, Rh.

appendiculatus= 14, B. microplus= 204 and B. decolaratus= 21) tick pools (Southern 271,

Western 98, Central 186 and Northern 120) were analysed by PCR methods for the existence of

DNA TBPs i.e. Theileria, Babesia, Anaplasma, and Ehrlichia species. The PCR primers in 16S

rRNA gene, V1 hyper-variable region was targeted by Anaplasma/Ehrlichia and in 18S rRNA

gene, V4 hyper-variable region was targeted by Babesia/Theileria, and all members of these

genera to date have been found to be conserved (Gubbels et al., 1999; Bekker et al., 2002).

Tick-borne pathogens were found in 259 pools out of complete 675 tick pools DNA from

one or more ticks. In the current study the total prevalence of tick-borne pathogens were

(38.37%) in the study areas in Punjab, Pakistan. Highest prevalence of pathogens was found in

Ehrlichia spp. (16%), followed by Anaplasma spp. (9.1%), Theileria spp. (9.03%) and Babesia

100

spp. (4.14%) respectively. The findings of current research showed that the prevalence of

Ehrlichia spp. in the Southern (23.24%) was significantly higher than in the Western (2.21%),

Central (8.85%) and Northern zone (5.53%). In all agro-ecologic zones of Punjab, Babesia spp.

was the minimum prevalent tick-borne pathogens both in buffaloes and cows the study area was

endemic for TBDs, also reported by (Durrani et al., 2008). For the diagnosis of tick borne

diseases in the previous studies mostly researchers in Pakistan depend on blood smear analysis.

Like this, the blood smear method was used for the detection of TBPs and their genetics which

was based on morphologic analysis (Jabbar et al., 2015). However, the more specific and

sensitive advanced molecular methods like PCR assay was used to differentiate multiple

pathogens instantaneously. Therefore, in the current study the molecular techniques were used

for the identification of tick-borne pathogens to develop more dependable record for upcoming

studies.

In the present study, three Anaplasma species were detected i.e. A. Centrale, A. ovis and

A. marginale in seven species of ticks from four agro-ecological zones of the study zones. The

findings of the current research showed the highest prevalence of A. marginale as compared to

the other Anaplasma species. In this research A. marginale was identified in Hy. anatolicum, Rh.

microplus and Rh. sanguineus ticks through PCR from study area. The results of the present

research was in line with the results of Ashraf et al. (2013) and Atif et al. (2013) who reported A.

marginale in bovines by blood smears method in Pakistan, and also by PCR-restriction fragment

length polymorphism (RFLP)-based study and serological process (complement-enzyme linked

immuno sorbent assay) (cELISA). The outcomes of current research were also similar with other

areas of the world pathogen has been identified in Rh. microplus ticks reported by (Pesquera et

al., 2015; Ehounoud et al., 2016).

In Pakistan a latest research explained that the Hyalomma and Rhipicephalus ticks might

be the possible vectors in the diffusion of Anaplasma species and was also reported by (Jabbar et

al., 2015). A. marginale has a universal spreading in subtropical and tropical areas in buffaloes

and cattle. It is considered that one of the utmost abundant TBPs causing high mortality and

morbidity (Kocan et al., 2010). All around the world, including Pakistan the majority of clinical

cases are due to pathogens (Sajid et al., 2014). In the current research a considerably maximum

prevalence of A. marginale is in the Central zone as compared to other zones (Southern, Western

and Northern) could be related to B. microplus with the maximum prevalence, which is mainly

101

accountable for the diffusion of A. marginale. The outcomes of current research were in line with

the findings of Rehman et al. (2017) who described A. marginale in Hy. anatolicum and B.

microplus in Punjab, Pakistan. The results of present research indicated that DNA of A. ovis was

existing in 7 (1.03%) tick pools. The findings of this research were in agreement with the study

of Talat et al. (2005) who observed the presence of A. ovis in small animals from KPK province

and Rehman et al. (2017) who reported A. ovis in Punjab, Pakistan. The outcomes of current

research was in linet with the results of Noaman (2012), Jalali et al. (2013) and Aktas (2014)

who described A. ovis in other parts of the world such as in Turkey and Iran. A. ovis infestions

had been molecularly confirmed. In this research, A. ovis was observed in Hy. dromedarii, Hy.

anatolicum, and B. microplus ticks. However, in Iran Hy. anatolicum had been latest revealed as

one of the significant vectors in charge for the diffusion of bovine anaplasmosis (Noaman, 2012;

Jalali et al., 2013).

In the current study, two Ehrlichia species, i.e. Ehrlichia sp. 1 and Ehrlichia sp.

Omatjenne were detected in three tick species (Hy. anatolicum, Hy. dromedarii and B.

microplus). In domestic animals, life-threatening diseases were caused by emerging and re-

emerging tick-borne pathogens i.e Ehrlichia species (Cabezas-Cruz et al., 2015). The outcomes

of the current study are statistically at per with results of Rehman et al. (2017) who reported

Ehrlichia species from Pakistan. Currently, an occasion report designated that Ehrlichia canis

ensued as a co-infection in a canine blood sample with Babesia gibsoni, but, the researchers used

only the blood smear analysis and for further confirmation of the species had not used any

molecular method (Abbas et al., 2015). The disease ehrlichiosis was not observed due to lack of

clinical and laboratory-based diagnostic method. However, the result of current study was also in

line with the border countries which reported many Ehrlichia species in tick samples in China

(Wen et al., 2002; Wen et al., 2003) and in India (Rani et al., 2011; Das & Konar, 2013).

However, Ehrlichia species was first time discovered in Canadian cattle blood samples

(Gajadhar et al., 2010) and later in Brazil was found in haemolymph of Rh. microplus ticks (Cruz

et al., 2012; Aguiar et al., 2014). The results of the present study showed that DNA from

Ehrlichia spp. was existing in Hy. anatolicum (79 tick pools), Hy. dromedarii (6) and B.

microplus (23). Additionally, in Pakistan this new Ehrlichia genetic factor was widely circulated

in all the agro-ecologic zones. The initial sequencing findings attained for the Ehrlichia spp.

recommend the existence of a potential novel Ehrlichia spp. Though, further research is

102

necessary to check whether this new genetic type relates to a new Ehrlichia species or if it is a

type of an earlier described species. The findings of current study that Ehrlichia spp. 1 was the

most mutual Ehrlichia species followed by Ehrlichia spp. Omatjenne. The findings of this

research were in agreement with the findings of Rehman et al. (2017) who observed Ehrlichia

spp fom Pakistan. The result of this study was also in agreement with the results of Aktas et al.

(2011) who described Ehrlichia spp. Firat was primarily found from Hy. anatolicum ticks

together from an animal housing in Turkey. However, Ehrlichia spp. Omatjenne was detected

from Hy. anatolicum, Hy. dromedarii and B.microplus ticks from all zone except Western zone.

In previous study Ehrlichia spp. Omatjenne was reported from Namibia, Ehrlichia spp.

Omatjenne first time detected from Hy. truncatum tick (Allsopp et al., 1997). Our outcomes

were also in line with the results of Mtshali et al. (2004) and Aktas and Özübek, (2015) who

reported Ehrlichia spp. Omatjenne in blood samples from naturally infested cow. The results of

present study revealed that Hy. anatolicum ticks could be a strong vector responsible for the

diffusion of Ehrlichia spp.

The results of this research revealed the existence of three babesia species i.e. B. caballi,

B. bigemina and B. bovis in five species of ticks (Hy. anatolicum, Hy. marginatum, Hy.

dromedarii, B. microplus and Rh. sanguineus) from Punjab province. The results of this research

were in line with the results of Chaudhry et al. (2010), Atif et al. (2012), Zulfiqar et al. (2012),

Ahmad et al. (2014) and Hussain et al (2014) who reported B. bovis and B. bigemina in blood

samples of bovine in Pakistan. The major influence of animal babesiosis was on dairy

production, though, it was also reported from other animal species, comprising dogs, horses,

goats, sheep and pigs (Chaudhry et al., 2010; Carter & Rolls, 2015). B. bovis is predominant in

Asia, Central and South America, Africa, Australia and Europe, however B. bigemina has been

described from the Far East Africa too (Bram, 2016). In the current study B. bovis and B.

bigemina were least observed in the Northern zone. The findings of this resarch were in

agreement with the results of Rehman et al. (2017) who observed B. microplus in Pakistan. The

outcomes of this research was also in agreement with the outcomes of Figueroa et al. (2010) and

OIE (2010) who reported that Rh. microplus ticks was the main vector for the transmission of B.

bovis and B. bigemina pathogens. Though, earlier findings from Pakistan sure the danger of

babesiosis in several species of animals with difference in prevalence approximate within various

areas of the country. The results of this work were in agreement with the findings of Rehman et

103

al. (2017) who observed B. bovis and B. bigemina in Pakistan. Previously is reported in China

(Yu et al., 2016) through the sequence analysis. In South Africa in 1981 Babesia occultans was

first time identified from Hyalomma marginatum rufipes (Gray & De Vos, 1981). Subsequently,

for a long time, the topographical dissemination of this species was only found to sub-Saharan

African countries (Dipeolu & Amoo, 1984; Ros-García et al., 2011), but previously this species

had been recognized in Hyalomma ticks and cattle blood from Tunisia - Northern Africa (Ros-

García et al., 2011), Southern part of Italy (Decaro et al., 2013), the Balearic Islands, Spain (Ros-

García et al., 2012), and Turkey (Aktas & Ozubek, 2015). Furthermore, in India the parasite had

been found in blood samples gathered from dogs (Mandal et al., 2014). In the current study B.

bigemina and B. caballi were most in the Southern region which may be because of the presence

of Hylomma ticks. The results of this study were in agreement with the results of Ros-García et

al. (2011), Ros-García et al. (2012), Aktas et al. (2014) and Orkun et al. (2014), who described

Hylomma ticks as the significant vector of B. bigemina and B. caballi pathogens.

In Pakistan the most studied bovine tick-borne disease was theileriosis. In the current

research three species of Theileria (T. ovis, T. annulata and T. orientalis) were observed from

five species of tick (Hy. anatolicum, Hy. dromedarii, Hy. marginatum, B. microplus and Rh.

sanguineus) from Punjab province. The findings of current study were in line by the results of

Durrani et al. (2012), Khattak et al. (2012), Ali et al. (2013) and Shahzad et al. (2013) who

observed T. ovis and T. annulata pathogens except T. orientalis in animal and tick species in

Pakistan. The findings of current study revealed the prevalence of T. annulata was maximum

(5.33%), followed by T. orientalis (3.25%), and T. ovis (0.59%). Between these species, T.

annulata was the most infectious and has many types which are largely dispersed in dissimilar

topographical areas of the globe. T. annulata yielded a serious and hypothetically lethal disease

in cows, consequential in significant losse of economy in the dairy sector in Asia and Africa

(Bishop et al., 2009; Jabbar et al., 2015). In exotic and hybridized cows the disease was more

severe, where the case-mortality level could range up to 80%, than the local cows, where the

death ratio was commonly about 20% (Jabbar et al., 2015). The results of current research were

in agreement with the results of Ali et al. (2013), Karim et al. (2017) and Rehman et al. (2017)

who described T. annulata in Hy. dromedarii and Hy. anatolicum ticks detached from cows. The

outcomes of this research were in similar with the outcomes of Ali et al. (2013) who observed T.

annulata in Hy. dromedarii and Hy. anatolicum ticks in cattle and buffaloes in Punjab, Pakistan.

104

The findings of this research were in similar with the findings of Durrani and Kamal, (2008) who

reported T. annulata in Punjab, Pakistan. The results of this study showed that Hyalomma spp. is

primarily responsible for dispersion of Theileria infestions in the animals population in Pakistan.

The current research characterizes the indication of the existence of T. orientalis in Pakistan.

While T. orientalis infestions have been recognized in cow, water buffaloes and African

buffaloes from all the main regions of the world (Chaisi et al., 2013; Sivakumar et al., 2014), as

well as bordering countries of Pakistan, e.g. Sri Lanka (Sivakumar et al., 2014) and India

(Aparna et al., 2011; Kakati et al., 2015). In previous studies T. orientalis was reported in several

countries comprising in India (Aparna et al., 2011), in Korea (Baek et al., 2003), in China (Liu et

al., 2011), in Japan (Yokoyama et al., 2012), in New Zealand (McFadden et al., 2011) and in

Australia (Islam et al., 2011; Eamens et al., 2013). It is indistinct how T. orientalis was presented

into Pakistan, but it might be wondered that this could have followed by the introduction of cows

from the Government of Victoria in Australia (Jabbar et al., 2015), wherever the pathogen

prevaled (Perera et al., 2014).

Thousands of dairy livestock were introduced to Pakistan and samples of blood from

these livestock are not observed by applying molecular techniques to check the piroplasms

earlier to transfer (Jabbar et al., 2015). Furthermore, it had earlier been recommended that in

cattle the prevalence and concentration of T. orientalis should be considered upon entrance to

Pakistan (Jabbar et al., 2015). Including this, there is a substantial prohibited live animal

transportation between India and Pakistan where it had been earlier observed (Appleby et al.,

2008; Kakati et al., 2015). In exotic animals the unintentional introduction of ticks in the

worldwide movement of live livestockhas also played a vital part for the transmission of species

of tick and tick-borne diseases (de La Fuente et al., 2015). The outcomes of current research

were in line with the results of Durrani and Kamal, (2008) who observed that T. orientalis was

mostly transferred by Haemaphysalis ticks that have been observed from bovines in Pakistan.

Therefore, the T. orientalis pathogen has been observed in Rh. microplus in Vietnam (Khukhuu

et al., 2011), in India (Kakati et al., 2015) and Dermacentor nuttalli in Mongolia (Altangerel et

al., 2011).

105

4.8. Tick control

Ticks are the important ectoparasite in many tropical and sub-tropical countries of the

world. In Pakistan the livestock is also at risk from being infected with several species of tick as

well as tick borne diseases that cause important economic loses. It shows one of the foremost

restrictions to cost-effective production. It is the vector of significant pathogens due to its direct

parasitic actions. Primary process of tick control is the use of synthetic acaricides so, it would be

vital to develop tactics to reserve the efficiency of existing acaricides. An extensive variety of

acaricides, such as arsenical, organophosphates, chlorinated hydrocarbons, synthetic pyrethroids

and carbamates are being applied for controlling cattle ticks (George et al., 2008). As acaricides

cause resistance development in ticks, environmental pollution, health hazards in animals and

human beings, so this study was proposed to check the efficacy of medicinal plants along with

acaricides. In the current study acaricides and medicinal plants were used to control species of

tick Hy. anatolicum.

The acaricides which used were cypermethrin, emamectin, fipronoil and medicinal plants

including C. procera, B. rapa, S. nigrum, C. colocynthis and T. foenum-graecum. These are most

abundantly used worldwide. In this study the results in vitro bioassays by adult immersion test

showed an efficacy of 100% cypermethrin, fipronoil and emamectin against the ticks.

Cypermethrin act on the membrane of nerve cells through re-polarization and close the Na+

channel gates. This action powerfully interrupts the nervous impulses transmission. Emamectin

and fipronoil works as a chloride channel activator by binding gamma aminobutyric

acid (GABA) receptor and glutamate-gated chloride channels disrupting nerve signals within

arthropods (Tingel et al., 2003; Barbara et al., 2005; Singh et al., 2012). At low concentrations

insects undergo hyperactive and at high concentrations paralyzed and die. The result obtained

strongly suggests that as the concentration of solution and time interval increased the percent

mortality also increased. These findigs are in similar with the previous researchers (Petro et al.,

2012 & Brito et al., 2011).

But with chemical acaricides, control of ticks had become difficult due to the

development of resistance (Rajput et al., 2006). However, these chemicals were also lethal and

costly (Abbas et al., 2014). Insecticide resistance and toxicity problems had forced researchers to

find an alternate to use plants as acaricides. Numerous secondary metabolites are produced from

plants to defend themselves from the constant attack of naturally occurring pathogens, pests and

https://en.wikipedia.org/wiki/Gamma_aminobutyric_acid

https://en.wikipedia.org/wiki/Gamma_aminobutyric_acid

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1635821/#B39

106

insects. (Nithya et al., 2015). Over the earlier few years, the extracts of plant had been

extensively used to control ticks, mosquitoes and pests etc. It also kept several bio-efficacies

such as ovicidal, repellent and acaricidal activities. In developing countries about 80%

populations depend out on traditional medicines for treatment of various abnormartilies in

domestic animals as well in humans (FAO, 2004). In Asia more than 6500 species of medicinal

plants have been recognized (Rahuman, 2008). In contrast to artificial acaricides, natural herbal

mixtures have no residual effect, friendly flora and fauna, can easily biodegradable. The plants

have a variety of chemically active components which can disturb the life cycle of the insects,

and the plants recognize as an incorporated measure of ethno-veterinary rehearses (Habeeb 2010;

Zaman et al. 2012). The probability of using medicinal plants for the control of insects of

veterinary significance has been reviewed that a few plants were recognized as most encouraging

acaricide against ticks (Ghosh & Ravindran, 2014). The results of current study of

phytochemical analysis in selected plants i.e. C. procera, C. colocynths, B. rapa, S. nigrum and

T. foenum-graceum showed significant phytochemical compounds includings flavonoids,

alkaloids, terpenoids, steroids, tanins and saponins.

The previous readings also described the presence of phytochemical or bioactive

compounds in selected plants (C. procera, C. colocynths, B. rapa, S. nigrum and T. foenum-

graceum) (Mishra et al., 2016; Nora et al., 2015; Patil et al., 2015; Tiwari et al., 2014; Benariba

et al., 2013; Saddiqe et al., 2013; Shrivastava et al., 2013; Najafi et al., 2010 & Ahmad et al.,

2001). The results of current study of plant extract of selected plants C. procera, C. colocynths,

B. rapa, S. nigrum and T. foenum-graceum showed significant mortality against the cattle ticks

Hy. anatolicum. These selected plants were included in the study on the source of their described

acaricidal actions, easily available in the studied area and cost of their usage. The extract of all

these plants contained strong anti-tick activity. The mortality data of selected plants showed

percent mortality in following order S. nigrum>B. rapa>C. procera> C. colocynthis> T. foenum

graecum. The findings of present study showed that mortality of tick was time and concentration

dependent. The findings of present study were in line with the results of Morsy et al. (2001) who

observed the efficacy of B. rapa and C. procera extracts.

Hydroethanolic extract of root showed up to 20 % mortality in Rh. microplus after 72 hrs

of treatment reported by Gosh et al. (2011). Al-Rajhy et al. 2003 described the acaricidal activity

107

of C. procera against camel tick Hy. dromedarii and they observed that the acaricidal activity is

due to the inhibition of Na+, K+-ATPase in ticks. The findings of this study were in agreement

with the findings of Nithya et al. (2015) and Shyma et al. (2014) who observed the acaricidal

activity of C. procera against the tick B. microplus and this activity were related with time and

concentration dependent. The results of this study were in line with the results of Durrani et al.

(2009) who described that the animals infested with Theleria annulata also treated with C.

procera and animals were recovered from the treatment of C. procera. They observed the

activity of this plant against all forms of diseases. The latex of C. procera were contained the

anthelmintic activity reported by Iqbal et al. (2012). Reported the anthelmintic efficacy and for

the cure of parasitic infection (Murti et al., 2015) and (Cavalcante et al., 2016) also described C.

procera for the cure of parasites in small ruminants.

In Pakistan the previous studies reported that B. rapa and C. colocynthis had anti-

microbial and anti-parasitic activity through (Jabbar et al., 2006; Farooq et al., 2008; Hussain et

al., 2008; Sindhu et al., 2010 and Dilshad et al,. 2008). Mirania at al. (2016) reviewed that C.

colocynthis were also used to control ecto and endo-parasites of cattle and buffaloes. C.

colocynthis B. rapa were used to control the helminthiasis and infestation of different parasites

such as ticks, fly and lice described by Sindhu et al. (2012) and Babar et al. (2012) from Bhaker,

Pakistan reported B. rapa and C. colocynthis as parasitic activity to control ticks and

gastrointestinal parasites from animals. (Ullah et al., 2015) reprted that C. colocynthis have anti-

tick and parasitic activity and also assess its acaricidal activity to control Rh. microplus. The

results of current study were also in agreement with the results of Sindhu et al. (2012) who

described that T. foenum-graecum is used to control infestation of tick.

108

Chapter 5

SUMMARY

Ticks are cosmopolitan in spreading but mostly present in tropical and subtropical areas

of world. Pakistan is a tropical country which offers favourable environmental circumstances for

growth and development of ticks. Tick animals of Pakistan are rich in number of genera and

species. A total of 12,000 ruminants (2800 goats, 2800 sheep, 3200 buffaloes and 3200 cows)

were observed from 120 livestock farms from selected 12 districts, covering four agro-ecological

zones of Punjab, Pakistan comprised in the study differentiated by urban and rural locality. Ticks

were collected from selected animals during four seasons (Spring, Summer, Autumn and Winter)

of the year and stored in 70% methanol. Gathered ticks were observed under low power and then

highest power amplification of microscope. Identification of different adult ticks was

accomplished with the aid of the anatomical and morphologic features in the research lab using

dichotomizing and compound microscopes with respect to the guide. Ticks were identified at the

species level under a stereoscopic (OPTICA SZM-1: Italy) with 40-fold amplification. The total

prevalence of tick-infected animals was 36.52% (4382/12,000). Tick prevalence was

considerably least in the Northern zone (33.47%) than the 36.33% Southern, 35.83% Western

and 40.43% Central zones, respectively. The overall ten species of ticks were identified i.e. Hy.

anatolicum 25.92%, Hy. marginatum 14.05%, Hy. dromedarii 5.62%, Hy. truncatum 2.44%, Hy.

rufipes 1.79%, Rh. sanguineus 16.33%, Rh. appendiculatus 12.39%, B. microplus 14.2%, B.

decolratus 5.15% and A. percicus 2.02%. Hy. anatolicum and Hy. marginatum were the most

pravelent ticks spcies in all selected zones. Argas percicus was found only in Central zone. Hy.

truncatum and Hy. rufipes were observed only in Western zone. In all the selected districts

multiple species of ticks were found. . The total prevalence of infestation of ticks in all ruminants

was 36.52% and it was considerably dissimilar in all species of animal. It was obsrved in

buffaloes, cows, goats and sheep 37.53%, 42.41%, 36.14%, 29.00%, respectively. After

identification of ticks, 675 species of ticks i.e. (Hy. anatolicum= 341, Hy. marginatum= 20, Hy.

dromedarii= 39, Rh. sanguineus= 35, Rh. appendiculatus= 14, B. microplus= 204 and B.

decolaratus= 21) tick pools (Southern zone 271, Western zone 98, Central zone 186 and

Northern 120) were screened for the existence of DNA TBPs by PCR assay i.e. Theileria,

Babesia, Anaplasma, and Ehrlichia species. The prevalence of overall evaluations of TBPs in all

109

agro-ecologic zones was significantly different. Highest prevalence was found in Ehrlichia spp

(16%) followed by Anaplasma spp. (9.1%), Theileria spp. (9.03%) and Babesia spp. (4.14%).

There was no arithmetical significant difference detected between the Southern zone (41.69%,

CI: 35.76-47.82), Western zone (34.69%, CI: 25.36-44.98), Central zone 36.02%, CI: 29.13-

43.37) and Northern zone 37.5%, CI: 28.83-46.80) in the overall tick-borne pathogens

prevalence. The 3 species of anaplsma (A. Centrale, A. marginale and A. ovis) and 3 species of

babesis namely (B. bigemina, B. bovis and B. caballi) were identified. Moreover, 3 species of

theleria (T. annulata, T. ovis and T. orientalis) and 2 species of ehrlichia (E. sp 1 and E. sp.

Omatjenne) were identified from four agro-ecologic zones of Punjab, Pakistan. The infection

ratio of overall of TBPs was maximum in Hy. anatolicum (43.10%), followed by B. microplus

(42.15%), Rh. Sanguineus (28.57%), Hy. dromedarii (28.20%), Hy. marginatum (10%), B.

decolaratus (9.5%) and Rh. appendiculatus (7.15%). In the Southern zone, the percentage of

infested ticks was higher in Hy. anatolicum (47.26%) followed by B. microplus (31.03%), Rh.

sanguineus (27.27%) and B. decolaratus (2.5%), however in the Western zone, B. microplus

ticks were found more frequently infested (46.67%) followed by Hy. anatolicum (37.83%), Rh.

sanguineus (35.71%), Hy. dromedarii (33.3%), Hy. marginatum (30%) and B. decolaratus

(14.28%). In the Central region, the percentage of infested ticks was highest in B. microplus

(47.12%) followed by Hy. anatolicum (30.37%), Rh. sanguineus (20%) and Hy. dromedarii

(16.67%), however in the Northern region, Hy. anatolicum ticks were observed more frequently

infested (48.27%) followed by B. microplus (39.72%), Hy. dromedarii (33.34%) and Rh.

sanguineus (20%). It was concluded that there is broad diversity of ticks and TBPs is existent in

Pakistan as compared to especially in previous studies reported. The ticks were mostly controlled

by chemicals but in present study the significantly results showed that ticks can be controlled by

the extracts of selected plant (C. procera, C. colocynths, B. rapa, S. nigrum and T. foenum-

graceum) used in the study. It is estimated that the consequences of this research will be suitable

in the development of incorporated control policies for ticks and TBDs in Pakistan.

110

Conclusion

The research was aimed to check the prevalence of ticks and tick-borne pathogens in

Punjab, Pakistan.

Following conclusions were drawn from this study

From the different animal species i.e. buffaloes, cows, goats and sheep of Punjab, ten tick

species belonging to four genera i.e. Hy. anatolicum followed by B. microplus, Hy.

marginatum, Hy. dromedarii, Rh. sanguineus, Rh. appendiculatus and B. decolaratus,

Hy. rufipes, Hy. truncatum and Argas percicus were found. From the study results, we

revealed that Argas percicus was found only in Central zone of Punjab, while Hy. rufipes,

Hy. truncatum were found only in Western zone. We concluded that Hy. anatolicum

followed by B. microplus, Hy. marginatum were most dominant ticks on infected animals

of these zones.

The results revealed that the prevalence of tick infestation was related with ruminants

types, season and research zone. Highest tick prevalence was observed in Summer season

followed by Spring, Autumn and Winter.

The results of PCR assay confirmed the presence of Theleria, Babesia, Anaplasmoisis

and Ehrlichia species isolated from several species of ticks from all selected zones of

Punjab. Hy. anatolicum and B. microplus are the main vectors of these pathogens.

The use of acaricides (cypermethrin, emamectin and fipronoil) revealed 100% mortality

against Hy. anatolicum.

The use of extracts of selected plants (C. procera, B. rapa, C. colcynthis, S. nigrum and

T. foenum-graceum) showed significant mortality (85%) against Hy. anatolicum.

Phytochemical analysis of selected plants showed significant presence of phytochemical

compounds (flavonoids, alkaloids, terpenoids, steroids, tanins and saponins).

It is concluded that the chance of drug resistance against plants extract is lower than the

chemical acaricides. Consequently, medicinal plants extract are used for the management

of livestock parasitism. In developing countries this method is appropriate to control ticks

and much more economical as compared to using acaricides.

111

Recommendations

After a comprehensive study on the ticks prevalence, tick-borne pathogens and control

measure it could be recommended that

More sensitive analytical techniques (RLB) should be used to investigate epidemiological

research.

Awareness about the ticks and tick-borne pathogens should be given to livestock owners

to reduce infestation.

The mode of transmission of different pathogens should be investigated through

experimental studies.

The combined livestock husbandry with an open farming system and rural poultry should

be stimulated in small dairy owners to meet the challenge of optimum environmental

conditions in Pakistan.

In Pakistan CCHF virus is prevalent and its main vector i.e. Hyalomma ticks, is spread

throughout the country. Hence, however eradicating ticks physically, attention should be

assumed to the possible danger to humans due to the potential existence of CCHF virus in

the ticks. More significantly, alertness programs should be arranged to notify farmers

about the prospect of CCHF transmission through ticks. Furthermore, ticks should be

observed for the existence of CCHF virus.

Since the most of the recognized Ehrlichia species cause human diseases, it is

recommended that more research should be conducted to identify about their vector-

competence of different tick species, the pathogenicity of the identified Ehrlichia species

and latent suggestions to the health of animal and human. Moreover, human and

veterinary sciences should deliberate ehrlichiosis between the differential diagnoses when

tick-borne diseases are doubted.

The acaricidal resistance in ticks should be evaluated in Pakistan.

The alternative sources like medicinal plants (whole arial parts at flowering stage) should

be used to control infestation of ticks in animals

The farmer can also use concentrated aqueous extract of these plants to control ticks.

The movement of animals particularly from bordering areas into the country should be prohibited.

The imported animals should be screened out for the presence of TBD before entering in

Pakistan.

112

REFERENCES

Abbas, R. Z., Zaman, M. A., Colwell, D. D., Gilleard, J., & Iqbal, Z. (2014). Acaricide resistance

in cattle ticks and approaches to its management: The state of play. Veterniary

Parasitology, 203(1-2), 6-20.

Abbas, G., Mughal, M. N., Munir, A., & Azeem, W. (2015). Lahore canine fever in a racing

greyhound. Advances in Animal and Veterinary Sciences, 3, 332-333.

Abbott, W. S. (1925). A method of computing the effectiveness of an insecticide. Journal of

Economic Entomology, 18(2), 265-267. https://doi.org/10.1093/jee/18.2.265a

Adenubi, O. T., Fasina, F. O., McGawa, L. J., Eloff, J. N., & Naidoo, V. (2016). Plant extracts to

control ticks of veterinary and medical importance: A review. South African Journal of

Botany, 105, 178-193.

Admassu, B., Yeneneh, H., Shite, A., Haile, B., & Mohammed, S. (2015). Prevalence and

identification of major Ixodid tick genera of cattle in Dangila district, Awi Zone, North

West Ethiopia. Acta Parasitologica Globalis, 6(2), 129-135.

Aguiar, D. M., Ziliani, T. F., Zhang, X., Melo, A. L. T., Braga, I. A., Witter, R., Freitas, L. C.,

Rondelli, A. L. H., Luis, M. A., Sorte, E. C. B., Jaune, F. W., Santarém, V. A., Horta, M.

C., Pescador, C. A., Colodel, E. M., Soares, H. S., Pacheco, R. C., Onuma, S. S. M.,

Labruna, M. B., & McBride, J. W. (2014). A novel Ehrlichia genotype strain

distinguished by the TRP36 gene naturally infects cattle in Brazil and causes clinical

manifestations associated with ehrlichiosis. Ticks Tick Borne Diseases, 5, 537-44.

Ahmad, I., Khawja, A., Shams, S., Ayaz, S., Khan, S., & Akbar, N. 2014. Detection of

babesiosis and identification of associated ticks in cattle. International Journal

Bioassays, 3, 3195-3199.

Ahmed A. H., Kamal I. H., & Ramzy, R. M. (2001). Studies on the molluscicidal and larvicidal

properties of Solanum nigrum L. leaves ethanol extract. Journal of the Egyptian Society

of Parasitology, 31(3), 843-52.

Akbar, H., Rashid, M. I., Shehzad, W., Saeed, K., & Oneeb, M. (2014). Parasitic Challenges to

booming dairy industry of Pakistan. Science International, (Lahore), 26(3), 1201-1204.

javascript:;

https://doi.org/10.1093/jee/18.2.265a

113

Aktas, M., & Ozubek, S. (2015). Molecular and parasitological survey of bovine piroplasms in

the black sea region, including the first report of babesiosis associated with Babesia

divergens in Turkey. Journal of Medical Entomology, 52, 1344-50.

Aktas, M., Altay, K., & Dumanli, N. (2011). Molecular detection and identification of

Anaplasma and Ehrlichia species in cattle from Turkey. Ticks and Tick Borne Diseases,

2, 62-65.

Aktas, M., Vatansever, Z., & Ozubek, S. (2014). Molecular evidence for trans-stadial and

transovarial transmission of Babesia occultans in Hyalomma marginatum and

Rhipicephalus turanicus in Turkey. Veterniary Parasitology, 204, 369-371.

Ali, S., Ijaz, M., Durrani, A. Z., Maqbool, A., Ali, M. M., & Mehmood, K. (2016).

Epidemiological aspects of bovine tick infestation in the river Ravi region, Lahore.

Pakistan Journal of Zoology, 48(2), 563-567.

Ali, Z., Maqbool, A., Muhammad, K., Khan, M. S., & Younis, M. (2013). Prevalence of

Theileria annulata infected hard ticks of cattle and buffalo in Punjab, Pakistan. Journal

of Animal and Plant Sciences, 23(1), 20-26.

Alim, M. A., Das, S., Roy, K., Masuduzzaman, M., Sikder, S., Hassan, M. M., Siddiki, A. Z., &

Hossain, M. A. (2011). Prevalence of hemoprotozoan diseases in cattle population of

Chittagong division, Bangladesh. Pakistan Veterinay Journal, 32(2), 221-224.

Allardice. P. (1993). A - Z of Companion Planting. Cassell Publishers Ltd.

Allsopp, M., Visser, E. S., du Plessis, J. L., Vogel, S. W., & Allsopp, B. A. (1997). Different

organisms associated with heartwater as shown by analysis of 16S ribosomal RNA gene

sequences. Veterniary Parasitology, 71, 283-300.

Alonso, D. M. A., Lopez, S. B. J., Leme, D. L. A. C., & Rodriguez, V. R. I. (2007). Infestacion

natural de hembras de Boophilus microplus Canestrini, 1887 (Acari: Ixodidae) en dos

genotipos de bovinos en el tropico humedo de Veracruz, Mexico. Veterniary Mexico, 38,

503-509.

Al-Rajhy, D. H., Alahmed, A. M., Hussein, H. I., & Kheir, S. M. (2003). Acaricidal effects of

cardiac glycosides, azadirachtin and neem oil against the camel tick, Hyalomma

dromedarii (Acari: Ixodidae). Pest Management Sciences, 59, 1250-1254.

114

Altangerel, K., Battsetseg, B., Battur, B., Sivakumar, T., Batmagnai, E., Javkhlan, G.,

Tuvshintulga, B., Igarashi, I., Matsumoto, K., Inokuma, H., & Yokoyama, N. (2011).

The first survey of Theileria orientalis infection in Mongolian cattle. Veterniary

Parasitology, 182, 343-348.

Altay, K., Aktas, M., Dumanli, N., & Aydin, M. F. (2008). Evaluation of a PCR and comparison

with RLB for detection and differentiation of Theileria sp. MK and other Theileria and

Babesia species of small ruminants. Parasitology Research, 103, 319-23.

Aparna, M., Ravindran, R., Vimalkumar, M. B., Lakshmanan, B., Rameshkumar, P., Kumar, K.

G. A., Promod, K., Ajithkumar, S., Ravishankar, C., Devada, K., Subramanian, H.,

George, A. J., & Ghosh, S. (2011). Molecular characterization of Theileria orientalis

causing fatal infection in crossbred adult bovines of South India. Parasitology

International, 60, 524-529.

Apanaskevich, D., & Horak, I. (2005). The genus Hyalomma Koch, 1844. II. Taxonomic status

of H. (Euhyalomma) anatolicum Koch, 1844 and H. (e.) excavatum Koch, 1844 (Acari,

Ixodidae) with redescriptions of all stages. Acarina 13, 181-197.

Appleby, M., Cussen, V., Garcés, L., Lambert, L., & Turner, J. (Eds.). (2008). Long distance

transport and welfare of farm animals. CAB International, London, 480p.

Ashfaq M., Razzaq, A., Shamsheer-ul-Haq., & Muhammad, G. (2015). Economic analysis of

dairy animal diseases in Punjab: a case study of Faisalabad district. The Journal of

Animal & Plant Sciences, 25(5), 1482-1495.

Ashraf, Q. U. A., Khan, A. U., Khattak, R. M., Ali, M., Shaikh, R. S., Ali, M., & Iqbal, F.

(2013). A report on the high prevalence of Anaplasma spp. in buffaloes from two

provinces in Pakistan. Ticks and Tick-borne Diseases, 4, 395-398.

Aslam, B., Hussain, I., Zahoor, M. A., Mahmood, M. S., & Rasool, M. H. (2015). Prevalence of

Borrelia anserina in Argas ticks. Pakistan Journal of Zoology, 47, 1125-1131.

Asmaa, N. M., ElBably, M. A., & Shokier, K. A. (2014). Studies on prevalence, risk indicators

and control options for tick infestation in ruminants. Beni-suef University Journal of

Basic and Applied Chemistry, 3, 68-73.

Atif, F. A., Khan, M, S., Iqbal, H. J., Arshad, G. M., Ashraf, E., & Ullah, S. (2012). Prevalence

of Anaplasma marginale, Babesia bigemina and Theileria annulata infections among

115

cattle in Sargodha district, Pakistan. African Journal of Agricultural Research, 7(22),

3302-3307.

Atif, F. A., Khan, M. S., Roheen, T., Muhammad, F., Younus, M., Avais, M., & Ullah, S. (2013).

Seroprevalence of anaplasma marginale infection among cattle from three districts of

the Northern Punjab, Pakistan. Journal of Animal and Plant Sciences, 23(4), 995-998.

Avinash, B., Supraja, N., Prasad, T. N. V. K. V., & Priya, C. S. (2017). Evaluation of acaricidal

activity of Azadirachta indica extracts against Rhipicephalus (Boophilus) microplus and

its GC-MS analysis. International Journal of Science, Environment and Technology,

6(1), 980-992.

Babar, W., Iqbal, Z., Khan, M. N., & Muhammad, G. (2012). An inventory of the plants used for

parasitic ailments of animals. Pakistan Veterniary Journal, 32(2), 183-187.

Baek, B. K., Soo, K. B., Kim, J. H., Hur, J., Lee, B. O., Jung, J. M., Onuma, M., Oluoch, A. O.,

Kim, C. H., & Kakoma, I. (2003). Verification by polymerase chain reaction of vertical

transmission of Theileria sergenti in cows. Canadian Journal of Veterinary Research

journal, 67, 278-82.

Barbara, G. S., Zube, C., Rybak, J., Gauthier, M., & Grünewald, B. (2005). Acetylcholine,

GABA and glutamate induce ionic currents in cultured antennal lobe neurons of the

honeybee, Apis mellifera. Journal of comparative physiology, 191, 823-836.

Bargah, R. K. (2015). Preliminary test of phytochemical screening of crude ethanolic and

aqueous extract of Moringa pterygosperma Gaertn. Journal of Pharmacognosy and

Phytochemistry, 4(1), 07-09.

Barghash, S. M., Darwish, A. M., & Abou-ElNaga, T. R. (2016). Molecular Characterization and

Phylogenetic Analysis of Trypanosoma evansi from Local and Imported Camels in

Egypt. Journal of Phylogenetics & Evolutionary Biology 4, 3. DOI: 10.4172/2329-

9002.1000169

Bekker, C. P., de Vos, S., Taoufik, A., Sparagano, O. A., & Jongejan, F. (2002). Simultaneous

detection of Anaplasma and Ehrlichia species in ruminants and detection of Ehrlichia

ruminantium in Amblyomma variegatum ticks by reverse line blot hybridization.

Veterinary Microbiology, 89, 223-238..

116

Benariba, N., Djaziri, R., Bellakhdar, W., Belkacem, N., Kadiata, M., Malaisse, W. J., & Sener,

A. (2013). Phytochemical screening and free radical scavenging activity of Citrullus

colocynthis seeds extracts. Asian Pacific Journal of Tropical Biomedicine, 3(1), 35-40.

Bilgic, H. B., Bakırcı, S., Kose, O., Unlu, A. H., Hacılarlıoglu, S., Eren, H., Weir, W., &

Karagenc, T. (2017). Prevalence of tick-borne haemoparasites in small ruminants in

Turkey and diagnostic sensitivity of single-PCR and RLB. Parasites & Vectors, 10, 211.

Bilgic, H. B., Karagenc, T., Shiels, B., Tait A., Eren, H., & Weir, W. (2010). Evaluation

of cytochrome b as a sensitive target for PCR based detection of T. annulata carrier

animals. Veterniary Parasitology, 174, 341-347.

Bilgic, H. B., Karagenc, T., Simunza, M., Shiels, B., Tait A., Eren, H., & Weir, W. (2013).

Development of a multiplex PCR assay for simultaneous detection of Theileria

annulata, Babesia bovis and Anaplasma marginale in cattle. Experimental Parasitology,

133(2), 222-229.

Bishop, R., Odongo, D., Mann, D., Pearson, T., Sugimoto, C., Haines, L., Al., E. (2009).

Theileria. In: Nen, V., Kole, C. (Eds.), Genome Mapping and Genomics in Animal-

Associated Microbes. Berlin Heidelberg: Springer, pp. 191-231.

Bram, R. A. (2016). World Animal Review. URL

http://www.fao.org/docrep/004/x6538e/x6538e02.htm (accessed 5.2.16).

Brito, L. G., Barbieri, F. S., Rocha, R. B., Oliveira, M. C. S., & Ribeiro, E. S. (2011). Evaluation

of the efficacy of ecaricides used to control the cattle tick, Rhipicephalus microplus, in

dairy herds raised in the Brazilian SouthWestern Amazon. Veterinary Medicine

International, 6 pages.

Bursali, A., Keskin, A., & Tekin, S. (2013). Ticks (Acari: Ixodida) infesting humans in the

provinces of Kelkit Valley, a Crimean-congo hemorrhagic fever endemic region in

Turkey, Experimental & Applied Acarology, 59(4), 507-15.

Cabezas-Cruz, A., Zweygarth, E., Broniszweska, M., Passos, L. M. F., Ribeiro, M. F. B.,

Manrique, M., Tobes, R., & de la Fuente, J. (2015). Complete Genome Sequence of

Ehrlichia mineirensis, a Novel Organism Closely Related to Ehrlichia canis with a New

Host Association. Genome Announcement, 3(1), e01450-14.

doi: 10.1128/genomeA.01450-14

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3650576/

117

Carter, P. D., & Rolls, P. (2015). Babesiosis: Blood Parasites: The Merck Veterinary Manual, 5,

2-16.

Cavalcante, G. S., De Morais, S. M., Andre, W. P., Ribeiro, W. L., Rodrigues, A. L., De Lira,

F. C., Viana, J. M., & Bevilaqua, C. M. (2016). Chemical composition and in vitro

activity of Calotropis procera (Ait.) latex on Haemonchus contortus. Veterniary


Chaisi, M. E., Collins, N. E., Potgieter, F. T., & Oosthuizen, M. C. (2013). Sequence variation

identified in the 18S rRNA gene of Theileria mutans and Theileria velifera from the

African buffalo (Syncerus caffer), Veterinary Parasitology, 191, 132-137.

Chansiri, K., & Bagnara, A. S. (1995). The structural gene for carbamoyl phosphate synthetase

from the protozoan parasite. Babesia bovis. Molecular Biochemistry Parasitology, 74,

239-43.

Chaudhry, Z. I., Suleman, M., Younus, M., & Aslim, A. (2010). Molecular detection of Babesia

bigemina and Babesia bovis in crossbred carrier cattle through PCR. Pakistan Journal of

Zoology, 42(2), 201-204.

Chawech, R., Mhalla, D., Trigui, M., Mihoubi, M., Fabre, N., & Jarraya, R. (2015). Chemical

composition and antibacterial activity of extracts and compounds isolated from Citrullus

colocynthis (L.) Schrad. Journal of Pharmacognosy and Phytochemistry, 4(4), 197-203.

Chen, Z., Liu, Q., Liu, J., Xu, B., Lv, S., Xia, S., & Zhou, X. (2014). Tick-borne pathogens and

associated co-infections in ticks collected from domestic animals in central China.

Parasites & Vectors, 7, 237.

Chhabra, R. E., & Donora. N. (1994). Ectoparasites of poultry in Zimbabwe and their control.

Zimbabwe Veterniary Journal, 25, 26-32.

Chhillar, S., Chhilar, J. S., & Kaur, H. (2014). Investigations on some hard ticks (Acari:

Ixodidae) infesting domestic buffalo and cattle from Haryana, India. Journal of

Entomology and Zoology Studies, 2(4), 99-104.

Coventry. B. O. (1923). Wild Flowers of Kashmir Raithby, Lawrence and Co. London. A nice

little pocket guide to 50 wildflowers of Kashmir.

Cruz, A. C., Zweygarth, E., Ribeiro, M. F. B., da Silveira, J. A. G., de la Fuente, J., Grubhoffer,

L., Valdés, J. J., & Passos, L. M. F. (2012). New species of Ehrlichia isolated from

118

Rhipicephalus (Boophilus) microplus shows an ortholog of the E. canis Major

immunogenic glycoprotein gp36 with a new sequence of tandem repeats. Parasite &

Vectors, 5, 291.

da Silva, J. A. T., & Hussain, A. I. (2017) Citrullus colocynthis (L.) Schrad. (colocynth):

Biotechnological perspectives. Emirates Journal of Food and Agriculture, 29(2), 83-90.

Dantas-Torres, F., Chomel, B. B., & Otranto, D. (2012). Ticks and Tick-borne diseases: a One

Health perspective. Trends Parasitology, 28, 437-446.

Das, M., & Konar, S. (2013). Clinical and hematological study of canine Ehrlichiosis with other

hemoprotozoan parasites in Kolkata, West Bengal, India. Asian Pacific Journal of

Tropical Biomedicine, 3, 913-915.

de Castro, J., 1997. Sustainable tick and tickborne disease control in livestock improvement in

developing countries. Veterniary Parasitology, 71, 77-97.

de La Fuente, J., Kocan, K. M., & Contreras, M. (2015). Prevention and control strategies for

ticks and pathogen transmission. Revue Scientifique Et Technique, 34, 249-64.

Decaro, N., Larocca, V., Parisi, A., Losurdo, M., Lia, R. P., Greco, M. F., Miccolis, A.,

Ventrella, G., Otranto, D., & Buonavoglia, C. (2013). Clinical bovine piroplasmosis

caused by Babesia occultans in Italy. Journal of Clinical Microbiology, 51, 2432-4.

Demessie, Y., & Derso, S. (2015). Tick borne hemoparasitic diseases of ruminants: A Review.

Advances in Biological Research, 9 (4), 210-224.

Dilshad, S. M. R., Rehmana, N. U., Iqbal, Z., Muhammad, G., Iqbal, A., & Ahmad, N. (2008).

An inventory of the ethnoveterinary practices for reproductive disorders in cattle and

buffaloes, Sargodha district of Pakistan. Journal Ethnopharmacology, 117, 393-402

Dinesh, S., & Gopal, G. (2014). A comparative phytochemical screening of various plants of

India. Journal of Medical Pharmaceutical and Allied Sciences, 02, 37-46.

Dipeolu, O. O., & Amoo, A. (1984). The presence of kinetes of a Babesia species in the

haemolymph smears of engorged hyalomma ticks in Nigeria. Veterniary Parasitology,

17, 41-46.

Diyes, G. C. P., & Rajakaruna, R. S. (2015). Diversity and distribution of tick species infesting

goats with two new host records from Sri Lanka. Journal of National Science

Foundation of Sri Lanka, 43(3), 225-234.

119

Doudier, B., Olano, J., Parola, P., & Brouqui, P. (2010). Factors contributing to emergence of

Ehrlichia and Anaplasma spp. as human pathogens. Veterniary Parasitolog, 167, 149-

154.

Durrani, A. A., Maqbool, A., Mahmood, N., Kamal, N., & Shakoori, A. R. (2009).

Chemotherapeutic trials with Calotropis procera against experimental infection with

Theileria annulata in Cross Bred Cattle in Pakistan. Pakistan Journal of Zoology, 41(5),

389-397.

Durrani, A. Z., & Shakoori, A. R. (2009). Study on ecological growth conditions of cattle

Hyalomma ticks in Punjab, Pakistan. Iranian Journal Parasitology, 4(1), 19-25.

Durrani, A. Z., Ahmad, M., Ashraf, M., Khan, M. S., Khan, J. A., Kamal, N., & Mumtaz, N.

(2008). Prevalence of theileriosis in buffaloes and detection through blood smear

examination and Polymerase Chain Reaction test in district Lahore. Journal of Animal

and Plant Sciences, 18, 2-3.

Durrani, A. Z., & Kamal, N., 2008. Identification of ticks and detection of blood protozoa in

friesian cattle by polmerase chain reacton test and estimation of blood parameters in

district Kasur, Pakistan. Journal of Animal Health and Production, 40, 441-447.

Durrani, A. Z., Shakoori, A. R., & Kamal, N. (2008). Bionomics of Hyalomma ticks in three

districts of Punjab, Pakistan. Journal of Animal and Plant Sciences, 18(1), 17-23.

Eamens, G. J., Gonsalves, J. R., Jenkins, C., Collins, D., & Bailey, G. (2013). Theileria

orientalis MPSP types in Australian cattle herds associated with outbreaks of clinical

disease and their association with clinical pathology findings. Veterinary Parasitology,

191, 209-217.

Ehounoud, C. B., Yao, K. P., Dahmani, M., Achi, Y. L., Amanzougaghene, N., Kacou, N.,

Douba, A. N., Guessan, J. D., Raoult, D., Fenollar, F., & Mediannikov, O. (2016).

Multiple Pathogens Including Potential New Species in Tick Vectors in Côte d‟Ivoire.

PLOS Neglected Tropical Diseases, 10(1), e0004367. doi:

10.1371/journal.pntd.0004367.

Elimam, A. M., Elmalik, K. H., & Ali, F. S. (2009). Larvicidal, adult emergence inhibition and

oviposition deterrent effects of foliage extract from Ricinus communis L. against

120

Anopheles arabiensis and Culex quinquefasciatus in Sudan. Tropical Biomedicine, 26,

130-139.

Ellis, J., Hefford, C., Baverstock, P. R., Dalrymple, B. P, Johnson, A. M. (1992). Ribosomal

DNA sequence comparison of Babesia and Theileria. Molecular and Biochemical


Estrada-Peña, A., Bouattour, A., Camicas, J. L., Guglielmone, A., Horak, I., Jongejan, F., Latif,

A., Pegram, R., & Walker, A. R. (2006). The known distribution and ecological

preferences of the tick subgenus Boophilus (Acari: Ixodidae) in Africa and Latin

America. Experimental and Applied Acarology, 38, 219-235.

Estrada-Pena, A., Bouattour, A., Camicas, J., Walker, A., 2004. Ticks of Domestic Animals in

the Mediterranean Region. A Guide to Identification of species. University of Zaragoza,

Spain.

FAO, (2004). Pakistan Livestock Sector Survey Report No. 32/74/Pak/7, pp: 11-14. FAO/World

Bank Cooperative Programme, Italy.

Farooq, Z., Iqbal, Z., Mushtaq, S., Muhammad, G., Iqbal, M. Z., & Arshad, M. (2008).

Ethnoveterinary practices for the treatment of parasitic diseases in livestock in Cholistan

desert (Pakistan). Journal Ethnopharmacology, 118, 213-219.

Figueroa, J., L‟Hostis, M., Camus, E., 2010. Bovine babesiosis. In: Lefevre, P.-C., Blancou, J.,

Chermette, R., Uilenberg, G. (Eds.), Infectious and Parasitic Diseases of Livestock:

Bacterial Diseases, Fungal Diseases, Parasitic Diseases. Lavoisier, Paris, France, pp.

1819-38.

Finney, D. J. (1971) Probit Analysis. 3rd Edition, Cambridge University Press, Cambridge.

Gajadhar, A. A., Lobanov, V., Scandrett, W. B., Campbell, J., & Al-Adhami, B. (2010). A novel

Ehrlichia genotype detected in naturally infected cattle in North America. Veterniary


Ganjali, M., Dabirzadeh, M., & Sargolzaie, M. (2014). Species diversity and distribution of ticks

(Acari: Ixodidae) in Zabol Country, Eastern Iran. Journal of Arthropod-Borne Diseases,

8(2), 219-223.

George, J., Pound, J., & Davey, R. (2008). Acaricides for controlling ticks on cattle and the problem

of acaricidal resistance. In: Bowman, A., Nuttall, P. (Eds.), Ticks: Biology, Disease and

Control. Cambridge, UK, pp. 408-423.

121

Gharekhani, J., Gerami-Sadeghian, A., Sadeghi-Dehkordi, Z., & Youssefi, M. (2015).

Determination of hard tick species (Acarina: Ixodidae) on sheep and cattle in Hamedan

Province, Iran. Journal of Coastal Life Medicine, 3(8), 612-615.

Ghosh, S., & Nagar, G. (2014). Problem of ticks and tick-borne diseases in India with special

emphasis on progress in tick control research. Journal of Vector Borne Diseases, 51,

259-270.

Ghosh, S., & Ravindran, R. (2014). Progress in the development of plant bopesticides for the

control of arthropods of veterinary importance. Advances in Plant Biopesticides, 207-

241.

Ghosh, S., Bansal, G. C., Gupta, S. C., Ray, D., Khan, M. Q., Irshad, H., Shahiduzzaman, M.,

Seitzer, U., & Ahmed, J. S. (2007). Status of tick distribution in Bangladesh, India and

Pakistan. Parasitology Research, 101 Suppl, S207-16.

Ghosh, S., Sharma, A. K., Kumar, S., Tiwari, S. S, Rastogi, S., Srivastava, S., Singh, M., Kumar,

R., Paul, S., Ray, D. D., Chaudhri, P., & Rawat, A. K. S. (2011) In vitro and in vivo

efficacy of Acorus calamus extract against Rhipicephalus (Boophilus) microplus.

Parasitology Research, 108, 361-370.

Gosh, S., Tiwari, S. S., Kumar, B., Srivastava, S., Sharma, A. K, Kumar, S., Bandyopadhyay, A.,

Julliet, S., Kumar, R., & Rawat, A. K. (2015). Identification of potential plant extracts

for anti-tick activity against acaricide resistant cattle ticks, Rhipicephalus (Boophilus)

microplus (Acari: Ixodidae). Experimental and Applied Acarology, 66(1), 159-71.

Gray, J. S., & De Vos, A. J. (1981). Studies on a bovine Babesia transmitted by Hyalomma

marginatum rufipes Koch, 1844. Onderstepoort. Journal of Veterniary Research, 48,

215-23.

Greenfield, B. P. J. (2011). Environmental parameters affecting tick (Ixodes ricinus) distribution

during the Summer season in Richmond Park, London. The International Journal of

Student Research, 4(2, 1), 140-148.

Gubbels, J. M., de Vos, A. P., van der Weide, M., Viseras, J., Schouls, L. M., de Vries, E., &

Jongejan, F. (1999). Simultaneous detection of bovine Theileria and Babesia species by

reverse line blot hybridization. Journal of Clinical Microbiology, 37, 1782-9.

122

Guclu, H. Z., & Karaer, K. Z. (2007). Detection of Babesia caballi (Nuttall, 1910)

and Theileria equi (syn Babesia equi, Laveran, 1901) by polymerase chain reaction

(PCR) in show and sport horses in the region of Ankara. Turkish Journal of

Parasitology, 31(2), 89-93.

Guglielmone, A. A., Robbins, R. G., Apanaskevich, D. A., Petney, T. N., & Estrada-Pena A.

(2010). The Argasidae, Ixodidae and Nuttalliellidae (Acari: Ixodida) of the world: a list

of valid species names. Zootaxa, 2528, 1-28.

Gurudeeban, S., Satyavani, K., & Ramanathan, T. (2010). "Bitter Apple (Citrullus colocynthis):

An Overview of Chemical Composition and Biomedical Potentials". Asian Journal of

Plant Sciences, 9(7), 394-401.

Habeeb, S. M. (2010) Ethno-veterinary and medical knowledge of crude plant extracts and its

methods of application (traditional and modern) for tick control. Journal of World

Applied Sciences, 11, 1047-1054.

Hibasami, H., Moteki, H., Ishikawa, K., Katsuzaki, H., Imai, K., Yoshioka, K., Ishii, Y., &

Komiya, T. (2003). "Protodioscin isolated from fenugreek (Trigonella foenumgraecum

L.) induces cell death and morphological change indicative of apoptosis in leukemic cell

line H-60, but not in gastric cancer cell line KATO III." International Journal of

Molecular Medicine, 11(1), 23-26.

Hossain, M., Bhuiyan, M. D. U., & Digonto, M. T. H. I. (2016). Epidemiology of Ecto-Parasitic

Infestation of Cattle in Milk Shed Areas of Baghabari of Shahjadpur Upazila of

Sirajgonj District, Bangladesh. The Journal of Advances in Parasitology, 3(2), 56-60.

Hosseini-Chegeni, A., Hosseini, R., Tavakoli, M., Telmadarraiy, Z., & Abdigoudarzi, M. (2013).

The Iranian Hyalomma (Acari: Ixodidae) with a key to the identification of male species.

Persian Journal of Acarology, 2(3), 503-529.

Hussain, A. I., Rathore, H. A., Sattar, M. Z. A., Chatha, S. A. S., Sarker, S. D., & Gilani, A. H.

(2014). Citrullus colocynthis (L.) Schrad (bitter apple fruit): A review of its

phytochemistry, pharmacology, traditional uses and nutritional potential. Journal of

Ethnopharmacology, 155(1), 54-66.

https://www.google.com.pk/url?sa=t&rct=j&q=&esrc=s&source=web&cd=8&cad=rja&uact=8&ved=0ahUKEwj506Wp3cDWAhUJfRoKHUS6CUIQFghLMAc&url=http%3A%2F%2Fwww.jml2012.indexcopernicus.com%2FTurkiye%2BParazitoloji%2BDergisi%2Cp4236%2C3.html&usg=AFQjCNGW0KtX7EL4GgHdUfKu9aRg1uQ4uw

https://www.researchgate.net/scientific-contributions/10415212_Kengo_Ishikawa

123

Hussain, S. I., & Kumar, G. A. (1985). The incidence of ticks (Ixodidea: Ixodidae) infesting

sheep and goats in Sind province, Pakistan. Pakistan Journal of Zoology, 17, 89-97.

Iqbal, A., Sajid, M. S., Khan, M. N., & Khan, M. K. (2013). Frequency distribution of hard ticks

(Acari: Ixodidae) infesting bubaline population of district Toba Tek Singh, Punjab,

Pakistan. Parasitology Research, 112, 535-541.

Iqbal, A., Siddique, F., Fatima, N., & Saleem, I. (2015). Tick infestation in sheep: prevalence,

associated determinants and in vivo chemotherapeutic control in Central Punjab,

Pakistan. Scholar’s Advances in Animal and Veterinary Research, 2(1), 41-54.

Iqbal, A., Siddique, F., Mahmood, M. S., Shamim, A., Zafar, T., Rasheed, I., Saleem, I., &

Ahmad, W. (2014). Prevalence and impacts of ectoparasitic fauna infesting goats (Capra

hircus) of district Toba Tek Singh, Punjab, Pakistan. Global Veterinaria, 12(2), 158-164.

Iqbal, F., Khattak, R. M., Ozubek, S., Khattak, M. N. K., Rasul, A., & Aktas, M. (2013).

Application of the reverse line blot assay for the molecular detection of Theileria and

Babesia sp. in sheep and goat blood samples from Pakistan. Iranian

Journal of Parasitology, 8, 289-295.

Iqbal, Z., Babar, W., Sindhu, Z. D., Abbas, R. Z., & Sajid, M. S. (2012). Evaluation of

anthelmintic activity of different fractions of Azadirachta indica A. Juss seed extract.

Pakistan Veterinary Journal, 32, 579-583

Irshad, N., Qayyum, M., Hussain, M., & Khan, M. Q. (2010). Prevalence of tick infestation and

theileriosis in sheep and goats. Pakistan Veterniary Journal, 30(3), 178-180.

Islam, M. K., Alim, M. A. Tsuji, N., & Mondal, M. (2006). An investigation into the distribution,

host- preference and population density of ixodid ticks affecting domestic animals in

Bangladesh. Tropical Animal Health Production, 38, 485-490.

Islam, M. K., Jabbar, A., Campbell, B. E., Cantacessi, C., & Gasser, R. B. (2011). Bovine

theileriosis an emerging problem in south-eastern Australia. Infection Genetic

Evoloution, 11, 2095-2097.

Jabbar, A., Abbas, T., Sandhu, Z. U. D. U., Saddiqi, H. A., Qamar, M. F., & Gasser, R. B.

(2015). Tick-borne diseases of bovines in Pakistan: major scope for future research and

improved control. Parasites & Vectors, 8, 283.

124

Jabbar, A., Raza, M. A., Iqbal, Z., & Khan, N. (2006). An inventory of the ethnobotanicals used

as anthelmintics in the Southern Punjab (Pakistan). Journal Ethnopharmacology, 108,

152-4.

Jabin, F., & Nasreen, S. (2016). Phytochemical analysis of some medicinal plants. International

Journal of Applied Research, 2(8), 293-295.

Jalali, S. M., Khaki, Z., Kazemi, B., Bandehpour, M., Rahbari, S., Razi Jalali, M., & Yasini, S. P.

(2013). Molecular detection and identification of Anaplasma species in sheep from

Ahvaz, Iran. Iranian Joural Veterniary Research, 14, 50-56.

Javed, K., Ijaz, M., Ali,M. M., Khan, I., Mehmood, K., & Ali, S. (2014). Prevalence and

hematology of tick borne hemoparasitic diseases in equines in and around Lahore.

Pakistan Journal of Zoology, 46(2), 401-408.

Jongejan, F., & Uilenberg, G. (2004). The Global importance of ticks. Parasitology, 129, 3-14.

Jonsson, N. N., Mayer, D. G., Matschoss, A. L., Green P. E., & Ansell, J. (1998). Production

effects of cattle tick (Boophilus microplus) infestation of high yielding dairy cows.

Veterniary Parasitology, 78, 65-77.

Joshi, R., & Rajni, M. (2007). "Lipid profile of rats fed on domestically processed fenugreek.

Journal of Food Science and Technology, 44(5), 542-544.

Kabir, M. H. B., Mondal, M. M. H., Eliyas, M., Mannan, M. A., Hashem, M. A., & Debnath, N.

C. (2011). An epidemiological survey on investigation of tick infestation in cattle at

Chittagong district, Bangladesh. African Journal Microbiology Research, 5, 346-352.

Kakati, P., Sarmah, P. C., Ray, D., Bhattacharjee, K., Sharma, R. K., Barkalita, L.M., Sarma, D.

K., Baishya, B. C., Borah, P., & Stanley, B. (2015). Emergence of oriental theileriosis in

cattle and its transmission through Rhipicephalus (Boophilus) microplus in Assam, India.

Veterniary world, 8, 1099-104.

Kamboj, A., & Pathak, H. (2013). Crimean-Congo hemorrhagic fever: a comprehensive review.

Veterinary World, 6(10), 812-817.

Karim, S., Budachetri, K., Mukherjee, N., Williams, J., Kausar, A., Hassan, M. J., Adamson, S.,

Dowd, S. E., Apanskevich, D., Arijo, A., Sindhu, Z., Kakar, M. A., Khan, R. M. D.,

125

Ullah, S., Sajid, M. S., Ali, A., & Iqbal, Z. (2017). A study of ticks and tick-borne

livestock pathogens in Pakistan. PLOS Neglected Tropical Diseases, 11(6), 1-17.

Katuri R. N., Das, G., Chalhotra S. K., & Singh A. K. (2013). Analysis of site of prediliction for

the ticks of family ixodidae. International Journal of Food, Agriculture and Veterinary

Sciences, 3(2), 42-46.

Kaur, D., Jaiswal, K., & Mishra, S. (2015). Studies on Prevalence of ixodid ticks infesting cattle

and their control by plant extracts. Journal of Pharmacy and Biological Sciences. 10(6),

01-11.

Kemal, J., Tamerat, N., & Tuluka, T. (2016). Infestation and identification of ixodid tick in

cattle: the case of Arbegona district, Southern Ethiopia. Journal of Veterinary Medicine,

8 pages. doi.org/10.1155/2016/9618291

Khan, A., Mushtaq, M. H., Ahmad, M., Tipu, Y., & Khan, A. (2013). Tick infestation rate in

cattle and buffalo in different areas of Khyber Pakhtunkhwa. Journal of Veterinary

Animal Sciences, 3, 31-35.

Khan, A., Mushtaq, M. H., Ahmad, M., Tipu, Y., Khan, A., & Munibullah. (2016). Tick

infestation rate in cattle and buffalo in different areas of Khyber Pakhtunkhwa, Pakistan.

Journal of Animal and Plant Sciences, 3(1-2), 31-35.

Khan, A., Rehman., A. U., Hisham, M., Khan, A. Z., Rehman., H. U., Khan, M. I., Quershi, M.

F., & Ameen, M. A. (2016). Burden of babesiosis among domestic cattle of Southern

Khyber Pakhtunkhwa, Pakistan. Journal of Entomology and Zoology Studies, 4(5), 305-

307.

Khan, M. N., Hayat, C. S., Iqbal, Z., Hayat, B., & Naseem, A. (1993). Prevalence of ticks on

livestock in Faisalabad. Pakistan Veterniary Journal, 13, 182-184.

Khan, M. N., Khan, L. A., Mahmood, S., & Qudoos, A. (2001). Argas persicus infestation:

prevalence and economic Significance in poultry. Pakistan

Journal of Agricultural Sciences, 38, 3-4.

Khan, M., Zahoor, A., Jahangir, M. & Mirza, M. A. (2004). Prevalence of blood parasites in

cattle and buffaloes. Pakistan Veterinary Journal, 24, 193-194.

126

Kharb, S., & Singh, V. (2004) Nutriceuticals in health and disease prevention. Indian Journal

Clinical Biochemical, 19(1), 50-3.

Khattak, R. M., Rabib, M., Khan, Z., Ishaq, M., Hameed, H., Taqddus, A., Faryal, M., Durranis,

S., Gillani, Q. U. A., Allahyar, R., Shaikh, R. S., Khan, M. A., Ali, M., & Iqbal, F.

(2012). A comparison of two different techniques for the detection of blood parasite,

Theileria annulata, in cattle from two districts in Khyber Pukhtoon Khwa Province

(Pakistan). Parasite, 19, 91-95.

Khukhuu, A., Lan, D. T. B., Long, P. T., Ueno, A., Li, Y., Luo, Y., Macedo, A. C. C. de,

Matsumoto, K., Inokuma, H., Kawazu, S.-I., Igarashi, I., Xuan, X., & Yokoyama, N.

(2011). Molecular epidemiological survey of Theileria orientalis in Thua Thien Hue

Province, Vietnam. Journal of Veterinary Medicine Science, 73, 701-5.

Kocan, K. M., de la Fuente, J., Blouin, E. F., Coetzee, J. F., & Ewing, S. A. (2010). The natural

history of Anaplasma marginale. Veterniary Parasitology, 167, 95-107.

Koné, W. M., & Atindehou, K. K. (2008). Ethnobotanical inventory of medicinal plants used in

traditional veterinary medicine in Northern Côte d'Ivoire (West Africa). South African

Journal of Botany, 74(1), 76-84.

Krishna, T. P. A., Krishna, T. P. A., Chithra, N. D., Deepa,

P. E., Darsana, U., Sreelekha, K. P.,

Juliet, S., Nair, S. N., Ravindran,

R., Kumar, K. G. A., & Ghosh, S. (2014). Acaricidal

activity of petroleum ether extract of leaves of Tetrastigm leucostaphylum (Dennst.)

Alston against Rhipicephalus (Boophilus) annulatus. The Scientific World Journal, 6

pages. doi.org/10.1155/2014/715481

Kumar, V., Kaur, P., Wadhawan, V. M., Pal, H., Sharma, H., & Kumar, P. (2015). Theileriosis in

cattle: prevalence and seasonal incidence in Jalandhar district of Punjab (India).

International Journal of Recent Scientific Research, 6(3), 2998-2999.

Latif, A. A., Putterill, J. F., de Klerk, D. G., Pienaar, R., & Mans, B. J. (2012). Nuttalliella

namaqua (Ixodoidea: Nuttalliellidae): first description of the male, immature stages and

re-description of the female. PLOS ONE, 7(7), e41651.

doi: 10.1371/journal.pone.0041651

https://www.hindawi.com/50419460/










127

Leschnik, M., Feiler, A., Duscher, G. G., & Joachim, A. (2013). Effect of owner-controlled

acaricidal treatment on tick infestation and immune response to tickborne pathogens in

naturally infested dogs from Eastern Austria. Parasites & Vectors, 6, 62.

doi: 10.1186/1756-3305-6-62

Liu, A. H., Guan, G. Q., Liu, J. L., Liu, Z. J., Leblanc, N., Li, Y. Q., Gao, J. L., Ma, M. L., Niu,

Q. L., Ren, Q. Y., Bai, Q., Yin, H., & Luo, J. X. (2011). Polymorphism analysis of

Chinese Theileria sergenti using Allele-Specific Polymerase Chain Reaction of the major

piroplasm surface protein gene. http://dx.doi.org/10.1645/GE-2444.1.

Livestock and Dairy Development Department Punjab. (2015). Punjab Livestock Policy paper.

Lahore.

Liyanaarachchi, D. R., Jinadasa, H. R. N., Dilrukshi, P. R. M. P., & Rajapakse, R. P. V. J.

(2013). Epidemiological study on ticks in farm animals in selected areas of Sri Lanka.

Tropical Agricultural Research, 24(4), 336-346.

Lorusso, V., Wijnveld, M., Majekodunmi, A. O., Dongkum, C., Fajinmi, A., Dogo, A. G.,

Thrusfield, M., Mugenyi, A., Vaumourin, E., Igweh, A. C., Jongejan, F., Welburn, S. C.,

& Picozzi, K. (2016). Tick-borne pathogens of zoonotic and veterinary importance in

Nigerian cattle. Parasites & Vectors, 9, 217. doi: 10.1186/s13071-016-1504-7

Madder, M., Horak, L., & Stoltsz, H. (2004). Ticks: Tick identification. Licensed under a

creative commons attributes license.

Mahajan, S. S., & Kumawat, R. N. (2013). Study of seed dormancy in colocynth (Citrullus

colocynthis L.) with after-ripening of fruits, seed extraction procedures and period of seed

storage. National Academy Science Letters, 36(4), 373-378.

Manan, A., Khan, Z., Ahmad, B., & Abdullah. (2007). Prevalence and identification of ixodid

tick genera in frontier region Peshawar. Journal of Agricultural and Biological Science,

2(1), 21-25.

Mandal, M., Banerjee, P. S., Garg, R., Ram, H., Kundu, K., Kumar, S., & Kumar, G. V. (2014).

Genetic characterization and phylogenetic relationships based on 18S rRNA and ITS1

128

region of small form of canine Babesia spp. from India. Infection Genetic Evoloution,

27, 325-331.

Mans, B. J., & Neitz, A. W. (2004). Adaptation of ticks to a blood-feeding environment:

evolution from a functional perspective. Insect Biochemistry and Molecular Biology, 34,

1-17.

Mather, T. N., & Abdullah, G. A. (2015). Building molecular biology capacity for preventing

tick-transmitted diseases in Pakistan. Pakistan – United States

Science and Technology Cooperation Program, 11, 23-15.

McFadden, A. M. J., Rawdon, T. G., Meyer, J., Makin, J., Morley, C. M., Clough, R. R., Tham,

K., Mullner, P., & Geysen, D. (2011). An outbreak of haemolytic anaemia associated

with infection of Theileria orientalis in naive cattle. Veterniary Journal, 59, 79-85.

McCarthy, V.C. 1967. Ixodid Ticks (Acarina, Ixodidae) of West Pakistan. University of

Maryland.

Memon, M. I., Memon, N., Kachiwal, A. B., Memon, M. R., & Bhutto, B. (2016). Prevalence of

theileriosis and its impact on haemotological values in naturally infected buffaloes at

Hyderabad. Pakistan Journal of Agricultural Engineering and Veterinary, 32(1), 85-94.

Mirania, A. H., Akhtara, N., Shaha, M. G., Memona, A. A., & Jatoib, A. S. (2016).

Documentation of ethnoveterinary plants for the treatment of different cattle and buffalo

ailments in Tharparker, Sindh, Pakistan. The Journal of Ethnobiology and Traditional

Medicine, 120, 1219-1230.

Mishra, D. R., Mandloi, S., Yadav, N., & Choithani, J. (2016). Phytochemical analysis of

Trigonella foenum-graecum and its antibacterial activity against Staphylococcus aureus.

World Journal of Pharmacy and Pharmaceutical Sciences, 5(6), 1408-1423.

Mkangara, M., Erasto, P., & Chacha, M. (2014). Acaricidal Activity of Commiphora

Swynnertonii (Burtt) stem bark extracts against adult Rhipicephalus Appendiculatus

Newman and Amblyomma Variegatum. American Journal of Research Communication,

2(9), 82-92.

129

Moges, N., Bogale, B., & Fentahun, T. (2012). Hard ticks (Ixodidae): species composition,

seasonal dynamics and body site distribution on cattle in Chilga district, Northwest

Ethiopia. Asian Journal of Agricultural Sciences, 4(5), 341-345.

Monfared, A. L., Mahmoodi, M., & Fattahi, R. (2015). Prevalence of ixodid ticks on cattle,

sheep and goats in Ilam County, Ilam Province, Iran. Journal of Parasitic Diseases,

39(1), 37-40.

Kor, M. N., Didarshetaban, M. B., & Pour, H. R. S. (2013). Fenugreek (Trigonella foenum-

graecum L.) As a Valuable Medicinal Plant. International journal of Advanced

Biological and Biomedical Research, 1(8), 922-931.

Morsy, T. A., Rahem M. A., & Allam, K. A. (2001). Control of Musca domestica third instar

larvae by the latex of Calotropis procera (Family: Asclepiadaceae). Journal of the

Egyptian Society of Parasitology, 31(1), 107‐110.

Mtshali, M. S., DeWall, D. T., & Mbati, P. A. (2004). A sero epidemiological survey of blood

parasites in cattle in the north-eastern Free State, South Africa. Journal of Veterinary

Research, 71, 67-75.

Munderloh, U. G., Jauron, S. D., & Kurtti, T. J. (2005). The tick: a different kind of host for

human pathogens. In: Goodman, J. L., Dennis, D. T., Sonenshine, D. E. (Eds.), Tick-

Borne Diseases of Humans. ASM Press, Washington, DC, pp. 37-64.

Murti, Y., Sharma, S., & Mishra, P. (2015). In vitro anthelminthic activity of calotropis procera

(AIT.) R. BR. leaves. Asian Journal Pharmacology Clinical Research, 8, 188-190.

Musa, H. I., Jajere, S. M., Adamu, N. B., Atsanda, N. N., Lawal, J. R., Adamu, S. G., & Lawal

K. (2014). Prevalence of tick infestation in different breeds of cattle in Maiduguri,

Northeastern Nigeria. Bangl. Journal of Veterniary Medicine, 12(2), 161-166.

Mustafa, I., Shabbir, R. M. K., Subhani, M., Ahmad, I., Raza, A., Jamil, S., Muqaddas, H.,

Shabbir, R. G., Ghani, A., Mahmood, T., Aslam, M., Khan, M. R., Asif, S., Malik, I. U.,

Raza, A. B. M., Aqeel, M. A., Qayyum, M., Waqas, A., & Ahmed, H. (2014). Seasonal

activity of tick infestation in goats and buffalo of Punjab Province (District Sargodha),

Pakistan. Kafkas Üniversitesi Veteriner Fakültesi Dergisi, 20(5), 655-662.

130

Najafi, S., Sanadgol, N., Nejad, B. S., Beiragi, M. A., & Sanadgol, E. (2010). Phytochemical

screening and antibacterial activity of Citrullus colocynthis (Linn.) Schrad against

Staphylococcus aureus. Journal of Medicinal Plants Research, 4(22), 2321-2325.

Najar, A. A., & khare, S. (2017). Improvement of quality control parameters for the

Standardization of calotropis procera L. Leaf and flower. International Journal of

Pharma and Bio Sciences, 8(1), 433-439.

Nasiri, A., Telmadarraiy, Z., Vatandoost, H., Chinikar, S., Moradi, M., Oshaghi, M., Salim

Abadi, Y., & Sheikh, Z. (2010). Tick infestation rate of sheep and their distribution in

abdanan county ilam province, iran, 2007-2008. Iran. Journal of Arthropod-Borne

Diseases, 4, 56-60.

Nawaz, M., Sajid, S. M., Ahmed, Z., Waqas, M., Ahmed, T., Hussain, A., Mohi-ud-Din, A.,

Shamim, A., Zubair, M., & Khalid, I. (2015). Anti-tick activity of leaves of Azadirachta

indica, Dalbergia sisso and Morus alba against Rhipicephalus microplus (Acari:

Ixodidae). Acta Parasitologica Globalis, 6(1), 60-64.

Naz, S., A. Maqbool, A., Ahmed, S., Ashraf, K., Ahmed, N., Saeed, K., Latif, M., Iqbal, J., Ali,

Z., Shafi, K., & Nagra, I. A. (2012). Prevalence of theileriosis in small ruminants in

Lahore. Pakistan. Journal of Veterniary Animal Sciences, 2, 16-20.

Nithya, V., Kamalam, M., & Umakanthan, T. (2015). Screening of indigenous medicinal plants

for their acaricidal activity against cattle ticks under in vivo condition. International

Journal of Pharmaceutical Sciences and Research, 6(7), 3049-3052.

Noaman, V. (2012). Identification of hard ticks collected from sheep naturally infected with

Anaplasma ovis in Isfahan province, Central Iran. Comparative Clinical Pathology, 21,

367-369.

Nora, N. B., Hamid, K., Snouci, M., Boumediene, M., & Abdellah, M. (2015). Phytochemical

and antibacterial screening of Citrullus colocynthis of South-west Algeria. Journal of

Chemical and Pharmaceutical Research, 7(5), 1344-1348.

Nyahangare, E. T., Mvumi, B. M., & Maramba, T. (2016). Acute oral mammalian toxicity and

effect of solvents on efficacy of Maerua edulis (Gilg. & Ben.) De Wolf against

Rhipicephalus (Boophilus) decoloratus Koch, 1844 (Acarina: Ixodidae), Tick Larvae.

BioMed Research International, 8 pages.

131

doi.org/10.1155/2016/7078029

Nyigo, V. A., Mdegela, R. H., Malebo, H. M., Mabiki, F. P., & Fouche, G. (2016). Evaluation of

acaricidal efficacy of Synadenium glaucescens (Euphorbiaceae) against Boophilus

species. Journal of Medicinal Plants Research, 10(21), 278-285.

Ohimain, E. I., Angaye, T. C. N., Bassey, S. E., & Izah, S. C. (2015). Acaricidal activities of

Hyptis suaveolens and Ocimum sanctum against African dog tick (Rhipicephalus

sanguinneus). European Journal of Medicinal Plants, 8(3), 149-156.

OIE, 2010. Bovine babesiosis. In: OIE Terrestrial Manual. World Organisation for Animal

Health (OIE), Paris, France, pp. 1-15.

Opiro, R., Osinde, C., Okello-Onen, J., & Akol, A. M. (2013).Tick-repellent properties of four

plant species against Rhipicephalus appendiculatus Neumann (Acarina: Ixodidae) tick

species. E3 Journal of Agricultural Research and Development, 3(2), 017-021.

Orkun, O., Karaer, Z., Çakmak, A., & Nalbantoğlu, S. (2014). Identification of tick-borne

pathogens in ticks feeding on humans in Turkey. PLOS Neglected Tropical Diseases,

8(8), e3067. doi.org/10.1371/journal.pntd.0003067

Ota, N., Mizuno, D., Kuboki, N., Igarashi, I., Nakamura, Y., Yamashina, H., Hanzaike, T., Fujii,

K., Onoe, S., Hata, H., Kondo, S., Matsui, S., Koga, M., Matsumoto, K., Inokuma, H. &

Yokoyama, N. (2009). Epidemiological survey of Theileria orientalis infection in grazing

cattle in the eastern part of Hokkaido, Japan. Journal of Veterinary Medical Science

71(7), 937-944.

Parveen, S., Godara, R., Katoch, R., Yadav, A., Verma, P. K., Katoch, M., & Singh, N. K.

(2014). In vitro evaluation of ethanolic extracts of Ageratum conyzoides and Artemisia

absinthium against cattle tick, Rhipicephalus microplus. The Scientific World Journal,

Article ID 858973, 6 pages. doi.org/10.1155/2014/858973

Patel, G., Shanker, D., Jaiswal, A. K., Sudan, V., & Verma, S. K. (2013). Prevalence and

seasonal variation in ixodid ticks on cattle of Mathura district, Uttar Pradesh. Journal of

parasitic diseases, 37(2), 173-176.

Patil, D., Patil, A., Vadera, K., & Ansari, A. (2015). Standardization and quality control

parameters of aerial parts (Leaves and Stem) of Trigonella foenum- graecum L.-An

132

important medicinal plant. Journal of Chemical and Pharmaceutical Research, 7(3), 163-

170.

Paul, B. T., Mustapha, K. U., Musa, N., Gadzama, M. A., Ali, M., Mbaya, A. W., & Biu, A. A.

(2017). Experimental studies on the reproductive biology of Hyalomma truncatum

(Acari: Ixodidae) in Maiduguri, Nigeria. Journal of Parasitology and Vector Biology,

9(5), 57-63.

Perera, P. K., Gasser, R. B., Firestone, S. M., Anderson, G. A., Malmo, J., Davis, G., Beggs, D.

S., & Jabbar, A. (2014). Oriental theileriosis in dairy cows causes a significant milk

production loss. Parasite & Vectors, 7, 73. doi: 10.1186/1756-3305-7-73

Perveen, F. (2011). Distribution and identification of ixodid tick species on livestock in Northern

Pakistan. Journal of Agricultural Science and Technology, 1, 73-80.

Pesquera, C., Portillo, A., Palomar, A. M., & Oteo, J. A. (2015). Investigation of tick-borne

bacteria (Rickettsia spp., Anaplasma spp., Ehrlichia spp. and Borrelia spp.) in ticks

collected from Andean tapirs, cattle and vegetation from a protected area in Ecuador.

Parasite & Vectors, 8, 46. doi.org/10.1186/s13071-015-0662-3

Petro, Y., Kasege, P., Kilasara, D., Kawiche, E., Temba, V., Kaunda, E., & Sungi, I. (2012). The

efficacy of cypermethrin (vapco cypermethrin against cattle ticks in Tanzania. Journal of

Biology, Agriculture and Healthcare, 2(11).

Qamar, M. F., Sulehria, A. Q. K. & Zahra, N. (2009). Prevalence of Argas persicus in rural

poultry at Lodhran, Pakistan. Biologia (Pakistan), 55 (1&2), 87-92.

Qamar, M. F., Sulehria, A. Q. K., Raza, I., Abass, S. & Maqbool, A. (2009). Prevalence of blood

protozoans in buffaloes at Rahim Yar Khan, Pakistan. Biologia (Pakistan), 55(1&2), 73-

77.

Qiu, H., Kelly, P. J., Zhang, J., Luo, Q., Yang, Y., Mao, Y., Yang, Z., Li, J., Wu, H.,

& Wang, C. (2016). Molecular Detection of Anaplasma spp. and Ehrlichia spp. in

Ruminants from Twelve Provinces of China. Canadian Journal of Infectious Diseases

and Medical Microbiology, 9 pages. doi: 10.1155/2016/9183861

Rahuman, A. A., & Venkatesan, P. (2008). Larvicidal efficacy of five cucurbitaceous plant leaf

extracts against mosquito species. Parasitology Research, 103(1), 133-139.










133

Rajput, Z. I., Hu, S., Chen, W., Arijo, A. G., & Xiao, C. (2006). Importance of ticks and their

chemical and immunological control in livestock. Journal of Zhejiang University-

Science B, 7(11), 912-921.

Ramzan, M., Khan, M. S., Avais, M., Khan, J. A., Pervez, K., & Shahzad, W. (2008).

Prevalence of ecto parasites and comparative efficacy of different drugs against tick

infestation in cattle. Journal of Animal and Plant Sciences, 18, 17-19.

Rani, P. A. A., Irwin, P. J., Coleman, G. T., Gatne, M., & Traub, R. J. (2011). A survey of canine

tick-borne diseases in India. Parasite and Vectors, 4, 141.

doi.org/10.1186/1756-3305-4-141

Ravindran, R., Juliet, S., Gopalan, A. K. K., Kavalimakkil, A. K., Ramankutty , S. A., Nair, S.

N., Narayanan, P. M., & Ghosh, S. (2011). Toxicity of DMSO, Triton X 100 and Tween

20 against Rhipicephalus (Boophilus)annulatus. Journal of parasitic diseases, 35(2), 237–

239. DOI 10.1007/s12639-011-0054-3

Regnery, R., Spruill, C. L., & Plikaytis, B. D. (1991). Genotypic identification of Rickettsiae and

estimation of intraspecies sequence divergence for portions of two Rickettsial Genes.

Journal of Bacteriology, 173(5), 1576-1589.

Rehman, A., Nijhof, A. M., Sauter-Louis, C., Schauer, B., Staubach, C., & Conraths, F. J.

(2017). Distribution of ticks infesting ruminants and risk factors associated with high

tick prevalence in livestock farms in the semi arid and arid agro-ecological zones of

Pakistan. Parasites & Vectors, 10(1), 190.

Rehman, W. U., Khan, I. A., Qureshi, A. H., & Hussain, S. (2004). Prevalence of different

species of ixodidae (hard-tick) in Rawalpindi and Islamabad, Pakistan. Journal of

Medicine Research, 43, 52-55.

Riaz, M., Tasawar, Z., & Ullah, M. Z. (2017). An epidemiological survey on diversity and

seasonal distribution of hard ticks in sheep and goats in Multan, Pakistan. Journal of

Biodiversity and Environmental Sciences, 10(3), 50-61.

Rony, S. A., Mondal, M. M. H., Begum. N., Islam, M. A., & Affroze, S. (2010). Epidemiology

of ectoparasitic infestations in cattle at Bhawal forest area, Gazipur. Bang. Journal

Veterniary Medicine, 8, 27-33.

https://www.researchgate.net/journal/0975-0703_Journal_of_parasitic_diseases

134

Ros-García, A., García-Pérez, A. L., Verdera, J., Juste, R. A., & Hurtado, A. (2012). Monitoring

piroplasms infection in three cattle farms in Minorca (Balearic Islands, Spain) with

previous history of clinical piroplamosis. Veterniary Parasitology, 190, 318-325.

Ros-García, A., M‟Ghirbi, Y., Bouattour, A., & Hurtado, A. (2011). First detection of Babesia

occultans in Hyalomma ticks from Tunisia. Parasitology, 138, 578–82.

Saad, F., Khan, K., Ali, S., & Akbar, N. U. (2015). Zoonotic significance and prophylactic

Measure against babesiosis. International Journal of Current

Microbiology and Applied Sciences, 4(7), 938-953.

Saddiqe, Z., Maimoona, A., & Khalid, S. (2013). Phytochemical analysis and anthelmintic

activity of extracts of aerial parts of Solanum nigrum L. Biologia (Pakistan), 59(2), 205-

211.

Sajid, M. S., Iqbal, Z., Khan, M. K. N., Muhammad, G., Needham, G., & Khan, M. K. N. (2011).

Prevalence, associated determinants, and in vivo chemotherapeutic control of hard ticks

(Acari: Ixodidae) infesting domestic goats (Capra hircus) of lower Punjab, Pakistan.

Parasitology Research, 108, 601-609.

Sajid, M. S., Iqbal, Z., Khan, M. N., & Muhammad, G. (2008). Point prevalence of hard ticks

(Ixodids) infesting domestic ruminants of lower Punjab, Pakistan. International Journal

of Agriculture and Biology, 10, 349-51.

Sajid, M. S., Iqbal, Z., Khan, M. N., & Muhammad, G. (2009a). In vitro and in vivo efficacies of

Ivermectin and Cypermethrin against the cattle tick Hyalomma anatolicum anatolicum

(Acari: Ixodidae). Parasitology Research, 105, 1133-1138.

Sajid, M. S., Iqbal, Z., Khan, M. N., Muhammad, G., & Khan, M. K. (2009b). Prevalence and

associated risk factors for bovine tick infestation in two districts of lower Punjab,

Preventive Veterinary Medicine, 92, 386-391.

Sajid, M. S., Siddique, R. M., Khan, S. A., Iqbal, Z., & Khan, M. N. ( 2014). Prevalence and risk

factors of anaplasmosis in cattle and buffalo populations of district Khanewal, Punjab,

Pakistan. Global Veterinaria, 12(1), 146-153.

135

Satta, G., Chisu, V., Cabras, P., Fois, F., & Masal, G. (2011). Pathogens and symbionts in ticks:

a survey on tick species distribution and presence of tick- transmitted micro-organisms

in Sardinia, Italy. Journal of Medical Microbiology, 60, 63-68.

Shahnaz, Z., Chaudry, F. R., Shamim, A., Zafar, M. A., Hasan, M., Iqbal, M. F., & Riaz, A.

(2016). Research soft tick (Argas persicus) infestation at government layer farms of

Pothwar region of Punjab, Pakistan. Journal of Entomology and Zoology Studies, 4(4),

664-667.

Shahzad, W., Noor, H., Ahmad, M., Munir, R., Saghar, M. S., Mushtaq, M. H., Ahmad, N.,

Akbar, G., & Mehmood, F. (2013). Prevalence and Molecular Diagnosis of Babesia ovis

and Theileria ovis in lohi sheep at livestock experiment station (LES), Bahadurnagar,

Okara, Pakistan. Iranian Journal of Parasitology, 8, 570-578.

Shams, S., Ayaz, S., Ali, I., Khan, S., Gul, I., Gul, N., & Khan, S. N. (2013). Sensitivity and

Specificity of PCR & Microscopy in detection of Babesiosis in domesticated cattle of

Khyber Pakhtunkhwa, Pakistan. International Journal of Advancements in Research &

Technology, 2(5), 37-41.

Sharifinia, N., Rafinejad, J., Hanafi-Bojd, A. A., Chinikar, S., Piazak, N., Baniardalani, M.,

Biglarian, A., & Sharifinia, F. (2014). Hard ticks (Ixodidae) and Crimean-Congo

Hemorrhagic Fever Virus in South West of Iran. Acta Medica Iranica, 53(3), 177-181.

Shkap, V., Molad, T., Fish, L., & Palmer, G. H. (2002). Detection of the Anaplasma Centrale

vaccine strain and specific differentiation from Anaplasma marginale in vaccinated and

infected cattle. Parasitology Research, 88, 546-552.

Shrivastava, A., Singh, S., & Singh, S. (2013). Phytochemical investigation of different plants

parts of Calotropis procera. International Journal of Scientific and Research

Publications, 3(8), 1-4.

Shyma, K. P., Gupta, J. P., Ghosh, S., Patel, K. K., & Singh, V. (2014). Acaricidal effect of

herbal extracts against cattle tick Rhipicephalus (Boophilus) microplus using in vitro

studies. Parasitology Research, 113(5), 1-8.

Siddiqi, M. N., & Jan, A. H. (1986). Ixodid ticks Ixodidae of N.W.F.P. Pakistan. Pakistan

Veterniary Journal, 6, 124-6.

136

Sindhu, Z. U. D., Iqbal, Z., Khan, M. N., Jonsson, N. N., & Siddique, M. (2010). Documentation

of ethno-veterinary practices used for treatment of different ailments in selected a hilly

area of Pakistan, International Journal of Agriculture & Biology, 12, 353-358.

Sindhu, Z. U. D., Ullah, S., Abbas, R. Z., Iqbal, Z., & Hameed, M. (2012). Inventory of ethno-

veterinary practices used for the control of parasitic infections in district Jhang, Pakistan.

International Journal of Agriculture & Biology, 14, 922-928.

Singh, A. K., Tiwari, M. N., Prakash,

O., & Singh, M. P. (2012). A current review of

cypermethrin-induced neurotoxicity and nigrostriatal dopaminergic neurodegeneration.

Current Neuropharmacology, 10(1), 64-71.

Singh, A., & Chhabra, R. E. (1973). Incidence of arthropod pests of domesticated animals and

birds Indian. Animal Sciences, 43, 393-397.

Singh, H., Singh, N. K., & Rath, S. S. (2012). Occurrence of canine hepatozoonosis in and

around Ludhiana district (Punjab). Indian Journal of Canine Practice, 4(1), 64-66.

Singh, N. K. & Rath, S. S. (2013). Epidemiology of ixodid ticks in cattle population of various

agro-climatic zones of Punjab, India. Asian Pacific Journal of Tropical Medicine, 947-

951.

Sivakumar, T., Hayashida, K., Sugimoto, C., & Yokoyama, N. (2014). Evolution and genetic

diversity of Theileria. Infection Genetic Evoloution, 27, 250-263.

Sonenshine, D. E., & Roe, R. M. (Eds.), 2014. The biology of ticks. Oxford University Press,

New York.

Soomro, M. H., Soomro, S. P., Bhutto, M. B., Akbar, Z., Yaqoob, M., & Arijo, A. G. (2014).

Prevalence of Ticks in Buffaloes in the Upper Sindh Pakistan. Buffalo Bulletin, 33(3),

323-327.

Sultana, N., Shamim, A., Awan, M. S., Ali, U., Hassan, M. U., & Siddique, R. M. (2015). First

pilot study on the prevalence of tick infestation in livestock of tehsil Hajira, Rawalakot,

Azad Kashmir. Advances in Animal and Veterinary Sciences, 3(8), 430-434.

Talat, R., Khanum, T., & Hayat, A. (2005). Studies on mammalian haematozoan parasites of

NWFP Pakistan. Pakistan Journal of Biological Sciences, 8, 726-729.

https://www.ncbi.nlm.nih.gov/pubmed/?term=Singh%20AK%5BAuthor%5D&cauthor=true&cauthor_uid=22942879

https://www.ncbi.nlm.nih.gov/pubmed/?term=Tiwari%20MN%5BAuthor%5D&cauthor=true&cauthor_uid=22942879

https://www.ncbi.nlm.nih.gov/pubmed/?term=Prakash%20O%5BAuthor%5D&cauthor=true&cauthor_uid=22942879

https://www.ncbi.nlm.nih.gov/pubmed/?term=Singh%20MP%5BAuthor%5D&cauthor=true&cauthor_uid=22942879

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3286848/

137

Tasawar, Z., Nasim, S., & Lashari, M. S. (2014). The Prevalence of ixodid ticks on buffaloes at

private animal farm Bibipur, Multan. Global Veterinaria, 12(2), 154-157.

Teel, P. D., Marin, S. L., & Grant, W. E. (1996). Simulation of host parasite landscape

interactions: influence of season and habitat on cattle fever tick (Boophilus sp.)

population dynamics. Ecological Modeling, 84, 19-30.

Tingle, C. C. D., Rother, J. A., Dewhurst, C. F., Lauer, S., & King, W. J. (2003). Fipronil:

environmental fate, ecotoxicology and human health concerns. Reviews

of Environmental Contamination and Toxicology, 176, 1-66.

Tiwari, D. A., Singh, S., & Singh, S. (2014). Chemical analysis of leaf extracts of Calotropis

procera. International Journal of Scientific and Research Publications, 4(1), 1-3.

Ullah, A., Hassan, S., Khan, M. I., Rizwan, M., Ullah, Z., & Shah, M. (2016). Antioxidant,

phytotoxic and cytotoxic activity of methanolic extract of Trigonella foenum-graecum.

Journal of Coastal Life Medicine; 4(5), 386-389.

Ullah, S., Khan, M. N., Sajid, M. S., Iqbal, Z., & Muhammad, G. (2015). Comparative efficacies

of Curcuma longa, Citrullus colocynthis and Peganum harmala against Rhipicephalus

microplus through modified larval immersion test. International Journal of Agriculture

& Biology, 17, 216-220.

Walker, A., Bouattour, A., Camicas, J., Estrada- Pena, A., Horak, I., Latif, A., Pegram, R., &

Preston, P. (2003). Ticks of Domestic Animals in Africa. A Guide to Identification of

Species. Bioscience Reports, London, UK.

Wamuyu, L., Obanda, V., Kariuki, D., Gakuya, F., Makanda, M., Otiende, M., & Ommeh, S.

(2015). Molecular detection and characterization of theileria infecting wildebeest

(Connochaetes taurinus) in the Maasai Mara National Reserve, Kenya. Pathogens, 4,

626-638.

Wen, B., Cao, W., & Pan, H. (2003). Ehrlichiae and Ehrlichial diseases in China. Animals of

the New York Academy of Sciences, 990, 45-53.

Wen, B., Jian, R., Zhang, Y., & Chen, R. (2002). Simultaneous detection of Anaplasma

marginale and a new Ehrlichia species closely related to Ehrlichia chaffeensis by

sequence analyses of 16S ribosomal DNA in Boophilus microplus ticks from Tibet.

Journal of Clinical Microbiology, 40, 3286-90.

138

Yokoyama, N., Sivakumar, T., Ota, N., Igarashi, I., Nakamura, Y., Yamashina, H., Matsui, S.,

Fukumoto, N., Hata, H., Kondo, S., Oshiro, M., Zakimi, S., Kuroda, Y., Kojima, N.,

Matsumoto, K. & Inokuma, H. (2012). Genetic diversity of Theileria orientalis in tick

vectors detected in Hokkaido and Okinawa, Japan. Infection, Genetics and Evolution, 12,

1669-1675.

Yousefi, A., Rahbari, S., Shayan, P., Sadeghi-dehkordi, Z., & Bahonar, A. (2017). Molecular

detection of Anaplasma marginale and Anaplasma ovis in sheep and goat in west

highland pasture of Iran. Asian Pacific Journal of Tropical Biomedicine, 7(5), 455-459.

Yu, P. F., Niu, Q. L., Liu, Z. J., Yang, J. F., Chen, Z., Guan, G. Q., Liu, G. Y., Luo, J. X., & Yin,

H. (2016). Molecular epidemiological surveillance to assess emergence and re-

emergence of tick-borne infections in tick samples from China evaluated by nested

PCRs. Acta Tropical, 158, 181-188.

Zaman, M. A., Iqbal, Z., Sandhu, Zia-ud-Din., Abbas, R. Z., & Qamar, M. F. (2012).

International Journal of Agriculture & Biology, 00: 000-000

Zorloni, A., Penzhornb, B. L., & Eloffa, J. N. (2010). Extracts of Calpurnia aurea leaves from

Southern Ethiopia attract and immobilise or kill ticks. Veterinary Parasitology, 168(1-2),

160-4.

Zulfiqar, S., Shahnawaz, S., Ali, M., Bhutta, A. M., Iqbal, S., Hayat, S., Qadir, S., Latif, M.,

Kiran, N., Saeed, A., Ali, M., & Iqbal, F. (2012). Detection of Babesia bovis in blood

samples and its effect on the hematological and serum biochemical profile in large

ruminants from Southern Punjab. Asian Pacific Journal of Tropical Biomedicine, 2(2),

104-8.

http://www.sciencedirect.com/science/journal/22211691

https://www.ncbi.nlm.nih.gov/pubmed/20004522

prevalence of ticks and tick-borne pathogens from …

Documents