press report may2016 - normalesup.orgvorgogoz/press-reports/press_report_… · *corresponding...

11

Upload: others

Post on 19-Oct-2020

1 views

Category:

Documents

0 download

Report

Download

Embed Size (px):

TRANSCRIPT

Press report 2.VI.16Alex Peluffo - Orgogozo Lab

Neonatal monocytes exhibit a unique histone modification ......kine production, and antigen presentation. The O30 monocytes had less than 1 % (4 total) of H3K4me3 peaks associated

Multi-dimensional histone methylations for coordinated regulation … · 2019-03-20 · NucleicAcidsResearch,2017 5 A H3K4me3-N H3K4me3-H H3K9me3-N H3K9me3-H H3K27me3-N H3K27me3-H

Computational inference of H3K4me3 and H3K27ac domain …PeerJ4:e1750;DOI 10.7717/peerj.1750 (i.e., histone modifications). Recent advancements in next generation sequencing (NGS)

Oct4-Mediated Inhibition of Lsd1 Activity Promotes the ... · H3K4me1 at PpGe in F9 ECCs. We tested this prediction in P19 ECCs, in which Oct4 expression is strongly reduced post-differentiation

4000 2HGFigure 1 3000 Immortalized human astrocytes ...PAR02 PAR10 PAR40 MUT02 MUT10 MUT40 0 50 100 Enrichment of H3K4me3 peaks (%) P2 P10 P40 IDH1 R132H0 Parental H3K9me3 H3K36me3

Home | Development - Cdk8 is required for establishment of H3K27me3 and gene ... · chromatin (Chaumeil et al., 2008). Initially, this repressive compartment is spatially separated

4 male, 4 female LCLs HumanChimpanzeeRhesus Macaque Expression: RNAseq Active Gene Marks: Pol II (ChIPseq) H3K4me3 (ChIPseq) Repressed Region Mark: H3K27me3

Coupling of H3K27me3 recognition with transcriptional repression … · 2020. 10. 15. · with CPL2, a plant-specific Pol II carboxyl terminal domain (CTD) phosphatase, to . 40

The Chromatin-Modifying Enzyme Ezh2 Is Critical for the ... · 17/02/2015 · with inactive genes (Spivakov and Fisher, 2007). Ezh2 and H3K27me3-marked histones have been shown to

SUPPLEMENTARY INFORMATION An allosteric PRC2 inhibitor ... · SUPPLEMENTARY INFORMATION An allosteric PRC2 inhibitor targeting the H3K27me3 binding pocket of EED Wei Qi1,3, Kehao

WDR5-H3K4me3 epigenetic axis regulates OPN expression to … · lentiCRISPRv2 (Genscript, Piscataway, NJ) plasmids containing scramble (GGAAGACTTAGTCGAATGAT) or Spp1- specific ( GCAAATCACTGCCAATCTCA)

Cancer Research Review W4...ESR1 1, and the epigenome of histone H3 lysine 4 monomethylation (H3K4me1). The majority of the risk The majority of the risk- associated SNPs modulate

Research Paper Flow-dependent epigenetic regulation of ...inhibition of H3K27me3 by EZH2 siRNA or GSK126 (a specific EZH2 inhibitor) reduced H3K27me3 levels and monocyte adhesion to

Supplemental Figure 7(1) p u t SUPPLEMENTAL FIGURE 2 A B H3K4me3 loci Title Supplemental Figure 7(1).ai Created Date 20161030123200Z

H3K4me3 is crucial for chromatin condensation and mitotic …€¦ · 28/04/2017 · 62 reprogramming during Arabidopsis male gametogenesis. We show that loss of SDG2 barely 63 affects

Low‑omatin prArabidopsis endosperm using CUT&RUNEndosperm H3K27me3 Peaks A B C 2-2 SE 2 -2 S2 E -2 S2 E Distance (kb) Normalized Reads H3 H3K27me3 IgG CUT&RUN with Endosperm Nuclei

Gene Expression Differences Among Primates Are Associated ...Comparing expression proﬁles and H3K4me3-associated regions: Of the 14,526 genes with expression data and the 25,160

Advances in epigenetics link genetics to the environment ... · REVIEWRESEARCH by the ability of maternally deposited H3K27me3 to control DNA methylation-independent imprinting 42,43.An

Dynamics of H3K4me3 Chromatin Marks Take the Lead over ... · chromatin marks on genome expression. 2.2. Meristem and differentiated tissues share similar over-all distribution of

BIOCHEMISTRY Copyright © 2020 Coordinated regulation of ...BIOCHEMISTRY Coordinated regulation of cellular identity–associated H3K4me3 breadth by the COMPASS family Christie C

SDG2-Mediated H3K4me3 Is Crucial for Chromatin ... · SDG2-Mediated H3K4me3 Is Crucial for Chromatin Condensation and Mitotic Division during Male Gametogenesis in Arabidopsis1[OPEN]

€¦ · XLS file · Web view · 2012-10-07H4K20me3 H3K36me3 H3K27me3 H3K9me3 H3K4me3 Protein.Names Gene.Names Protein.Descriptions Uniprot Peptides..seq. Unique.Sequence.Coverage

1 Regions of very low H3K27me3 partition the Drosophila genome

Nature Genetics: doi:10.1038/ng...5 Supplementary Figure 4 Profiles of H3K27ac, H3K4me3 and H3K4me1 over methylation haplotype blocks for 12 human adult tissue types. X -axis denote

Sequential changes at differentiation gene promoters as they … · binding of Polycomb via its chromodomain to the trimethylated histone H3 Lys27 (H3K27me3) mark (Fischle et al.,

MeCP2 regulates gene expression through recognition of ... · unstable (group3, n=33,644), MeCP2 enrichment also showed a strong correlation with H3K27me3 while H3K9ac levels are

chroGPS 2.0: Visualization, functional analysis and comparison of … · -0.5 0.0 0.5 1.0-0.5 0.0 0.5 1.0 ASH1 CP190 CTCF EZ H3K23AC H3K27ME3 H3K36ME3 H3K4ME3H3K79ME2 H3K9ME2 H3K9ME3

A) B) - Nature · A) B) ty ty Position along gene Position along gene H3K4me3 H3K27me3 Supplemental Figure 1. Enrichment of H3K4me3 and H3K27me3 islands near transcription start sites

SU PPLEMENTAR Y INFORMATION10.1038... · Supplementary Figure 2. Genome browser representation of hESC ChIP-seq profiles at selected loci. Binding profiles for p300, H3K4me1, H3K27ac,

The effects of Alicine on ZNF703 Gene Expression in Gastric … · promoters with H3Kme1 or H3K4me3 labels suggesting Abstract—Cancer is the genetic disease of the somatic cells,

Genome wide ChIP-seq analysis of EZH2 mediated H3K27me3

Dexamethasone Treatment Effects on H3k27me3 Chromatin

Epigenetic Regulation of Angiogenesis by JARID1B …atvb.ahajournals.org/content/atvbaha/35/7/1645.full.pdf · gene expression.5,6 Modifiers of H3K4me3, ... expression in human umbilical

Transgenerational analysis of H3K4me3 and H3K27me3 by ChIP ...loca.fudan.edu.cn/lh/Doc/C18.pdf · Histone methylation is a kind of important epigenetic modiﬁca- ... two histone

Discovery and validation of sub-threshold genome-wide ...compbio.mit.edu/publications/148_Wang_eLife_16.pdf · Enhancer enrichment in QT/QRS loci (z-score) 127 human tissues b H3K4me1-defined