practice exam2 mol gen 2010

8/8/2019 Practice Exam2 Mol Gen 2010

1/5


2/5

7. In lac operon, the natural inducer that binds repressor is:

Lactose

Mannose.

Allolactose.

Glucose.

Galactose.

8. -A mutation that permanently activates adenylate cyclase to

produce cAMP will have the following effect(s).

The expression of the lac operon does not change.

Lac operon will not be transcribed in the presence of lactose alone.

The lac operon will be transcribed in the presence of glucose alone.

The lac operon will be transcribed in the presence of glucose and lactose.

The presence of cAMP prevents the formation of active repressor from repressor

subunits.

9. -Which modification of DNA is inversely correlated with geneactivity?

Acetylation.

Methylation.

Phosphorylation.

Dephosphorylation.

Deamination.

10. -The role of TFIIA in the process of transcription is to:

Stabilize the TFIID DNA interaction.

Provide an appropriate interaction site for the binding of RNA polymeraseII.

Destabilize non-specific RNA polymerase II DNA interaction.

Phosphorylate RNA polymerase II

11. -Which of the following are common ways to modulate the

function of regulatory transcription factors.

A- Binding of hormones.

B- Protein-protein interaction.

C- Phosphorylation.

A only

A and B

A and CC and B

A, B and C

12. Unlike the 5' end of a prokaryotic mRNA, the 5' end of a eukaryotic

mRNA

a. retains the nucleoside 5'-triphosphate.

b. is modified by addition of a methylguanosine cap.

c. is modified by the addition of a polyadenylate cap.

d. only contains a few (three or four) bases before the AUG.

e. has a consensus sequence to specify the start of translation.


3/5

13. An E. coli strain has a mutation in the RNA Pol core enzyme that

prevents association with sigma factor. This is expected to cause an inability

of the enzyme to

a. catalyze elongation of RNA.

b. recognize operators.

c. recognize promoters.d. recognize terminators.

14. It has the highest percentage of modified bases.

a. hnRNA

b. mRNA

c. rRNA

d. snRNA

e. tRNA

15. It represents the largest percentage by weight of cellular RNA.

a. hnRNAb. mRNA

c. rRNA

d. snRNA

e. tRNA

16. Pick the type of mutation illustrated by the following nucleotide

changes.

Thr Ser Leu Asp Stop

wild-type ACU AGU UUA GAU UGA

mutant ACU AGU UUU GAU UGA

a. nonsense mutation

b. read through mutation

c. silent mutation

d. frameshift mutation

e. missense mutation

17. Prokaryotic RNA Polymerase

a. binds only the template strand of DNA.

b. has a 3' -> 5' exonuclease activity.

c. uses dNTPs as substrates.

d. requires a primer.

e. requires a sigma factor for promoter recognition

18. The aminoacyl-tRNA synthetases all:

a. are specific for one tRNA and one or a few cognate amino acids.

b. use GTP to activate the amino acids for formation of the aa-tRNA.

c. recognize the correct tRNA by the sequence of the anticodon.d. activate the amino acids for peptide bond formation.


4/5

e. interact with the ribosomes during the initiation phase of protein synthesis.

19. A mutation in the lac repressor protein eliminates its binding to the lac

operator. The mutant strain displays:a. an inability to express the lactose operon-encoded genes under any circumstances.

b. an inability to express the lactose operon-encoded genes unless lactose is present

and glucose is absent.

c. the same level of expression of the lactose operon-encoded genes under all

circumstances.

d. the highest level of expression of the lactose operon-encoded genes only when

glucose is absent whether or not lactose is present.

e. the highest level of expression of the lactose operon-encoded genes only when

glucose is absent and lactose is present

20. What do DNA-binding proteins of the leucine zipper, helix-loop-helix,and zinc finger families have in common?

a. An amphipathic helix with a leucine-lined hydophobic surface

b. A small domain that protrudes from the surface of the protein and binds DNA

c. A conserved cysteine and histidine-containing motif

d. Ability to bind to DNA only as tetramers

e. Recognition of the same DNA sequence in the major groove of DNA.

21. The indicated gene has a mutation that eliminates the 3' splice site of intron

#2. What is the most likely structure of the mature mRNA in the mutant cells?


5/5

22. The sequence of the 5`region of a bacterial gene (the non template

strand is shown) and several of its mutants which exhibit altered transcription

activity is presented below. A DNA fragment which has either the wild type

promoter region or one of its alternate forms, was transcribed in vitro, the

amount of specific transcription was measured and the data are presented in

the table below. Explain the role of each mutation in determining the level oftranscription found in the table.

5`TCTGGCGGTGTTGACATAAATACCACTGGGGTGATACTGAGACATCAG 3`

T G T T

MUTANT # 1 2 3 4

Wild type 100

Mutant 1 16

Mutant 2 24

Mutant 3 297Mutant 4 100

practice exam2 mol gen 2010

Documents