ppt - welcome to our family homepage

Evolution by Genome Duplication

http

://n

ews.

bbc.

co.u

k/1/

hi/s

ci/t

ech/

2225

91.s

tm

Itai YanaiDepartment of Biology

Technion – Israel Institute of Technology

Susumu Ohno and evolution by gene duplicationThe Drosophila genome

Homeotic mutationsHox genesWhat is an animal?

Genome Duplication during chordate evolutionGenome duplications happen(ed)The 2R hypothesisMethods of molecular archeology

Map-based (spatial) – S. cerevisiae and Arabidopsis examples

Tree-based (temporal)Recent progress suggests one genome duplication in vertebrate evolution.

Evolution by Genome Duplication

Mutations

DNA sequence

SELECTION)purifying or positive(

DRIFT

DNA sequence (Altered)

The engine :

The steering wheel :

The standard model of genome evolution

~800-1000 Mya

Metazoan phylogeny

Carroll S.B. et al. From DNA to Diversity (2001) Blackwell Science

What is the birth of creativity, novelty, diversity?

Or, how do you acquire new function while maintaining the old?Carroll S.B. et al. From DNA to Diversity (2001) Blackwell Science

GATCTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAGGTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGGTGCAATGGGAAGCTCTTCTGGAGAGTGAGAGAAGCTTCCAGTTAAGGTGACATTGAAGCCAAGTCCTGAAAGATGAGGAAGAGTTGTATGAGAGTGGGGAGGGAAGGGGGAGGTGGAGGGATGGGGAATGGGCCGGGATGGGATAGCGCAAACTGCCCGGGAAGGGAAACCAGCACTGTACAGACCTGAACAACGAAGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGCAGGAATGCTTTGTAGACACAGTAATTTGCTTGTATGGAATTTTGCCTGAGAGACCTCATTGCAGTTTCTGATTTTTTGATGTCTTCATCCATCACTGTCCTTGTCAAATAGTTTGGAACAGGTATAATGATCACAATAACCCCAAGCATAATATTTCGTTAATTCTCACAGAATCACATATAGGTGCCACAGTTATCC

CCATTTTATGAATGGAGTEvolutionbyDuplicationGATGAAAACCTTAGGAATAATGAATGATTTGCGCAGGCTCACCTGGATATTAAGACTGAGTCAAATGTTGGGTCTGGTCTGACTTTAATGTTTGCTTTGTTCATGAGCACCACATATTGCCTCTCCTATGCAGTTAAGCAGGTAGGTGACAGAAAAGCCCATGTTTGTCTCTACTCACACACTTCCGACTGAATGTATGTATGGAGTTTCTACACCAGATTCTTCAGTGCTCTGGATATTAACTGGGTATCCCATGACTTTATTCTGACACTACCTGGACCTTGTCAAATAGTTTGGACCTTGTCAAATAGTTTGGAGTCCTTGTCAAATAGTTTGGGGTTAGCACAGACCCCACAAGTTAGGGGCTCAGTCCCACGAGGCCATCCTCACTTCAGATGACAATGGCAAGTCCTAAGTTGTCACCATACTTTTGACCAACCTGTTACCAATCGGGGGTTCCCGTAACTGTCTTCTTGGGTTTAATAATTTGCTAGAACAGTTTACGGAACTCAGAAAAACAGTTTATTTTCTTTTTTTCTGAGAGAGAGGGTCTTATTTTGTTGCCCAGGCTGGTGTGCAATGGTGCAGTCATAGCTCATTGCAGCCTTGATTGTCTGGGTTCCAGTGGTTCTCCCACCTCAGCCTCCCTAGTAGCTGAGACTACATGCCTGCACCACCACATCTGGCTAGTTTCTTTTATTTTTTGTATAGATGGGGTCTTGTTGTGTTGGCCAGGCTGGCCACAAATTCCTGGTCTCAAGTGATCCTCCCACCTCAGCCTCTGAAAGTGCTGGGATTACAGATGTGAGCCACCACATCTGGCCAGTTCATTTCCTATTACTGGTTCATTGTGAAGGATACATCTCAGAAACAGTCAATGAAAGAGACGTGCATGCTGGATGCAGTGGCTCATGCCTGTAATCTCAGCACTTTGGGAGGCCAAGGTGGGAGGATCGCTTAAACTCAGGAGTTTGAGACCAGCCTGGGCAACATGGTGAAAACCTGTCTCTATAAAAAATTAAAAAATAATAATAATAACTGGTGTGGTGTTGTGCACCTAGAGTTCCAACTACTAGGGAAGCTGAGATGAGAGGATACCTTGAGCTGGGGACTGGGGAGGCTTAGGTTACAGTAAGCTGAGATTGTGCCACTGCACTCCAGCTTGGACAAAAGAGCCTGATCCTGTCTCAAAAAAAAGAAAGATACCCAGGGTCCACAGGCACAGCTCCATCGTTACAATGGCCTCTTTAGACCCAGCTCCTGCCTCCCAGCCTTCT

Evolution by Gene Duplication Susumu Ohno, 1970

“natural selection merely modified,while redundancy created”

http://books.nap.edu/books/0309084768/html/235.html

It is said that “necessity is the mother of invention”. To be sure, wheels and pulleys were invented out of necessity by the tenacious minds of upright citizens. Looking at the history of mankind, however, one has to add that “leisure is the mother of cultural improvement”. Man’s creative genius flourished only when his mind, freed, from the worry of daily toils, was permitted to entertain apparently useless thoughts. In the same manner, one might say with regard to evolution that “natural selection merely modified, while redundancy created”. Natural selection has been extremely effective in policing allelic mutations which arise in already existing gene loci. Because of natural selection, organisms have been able to adapt to changing environments, and by adaptive radiation many new species were created from a common ancestral form. Yet, being an effective policeman, natural selection is extremely conservative by nature. Had evolution been entirely dependent upon natural selection, from a bacterium only numerous forms of bacteria would have emerged. The creation of metazoans, vertebrates and finally mammals from unicellular organisms would have been quite impossible, for such big leaps in evolution required the creation of new gene loci with previously nonexistent functions. Only the cistron which became redundant was able to escape from the relentless pressure of natural selection, and by escaping, it accumulated formerly forbidden mutations to emerge as a new gene locus.

- Susumu Ohno, Evolution by Gene Duplication (1970)

A new function is created by duplicatingan old gene and modifying the copy.

GenomeChromosomeSegment

Gene cluster

Gene

Domain (exon)

Short indels

Duplications occur at all genomic scales!A

ppar

ent F

requ

enc y

DNA sequence

DNA sequence (Altered)

The steering wheel :

Single nucleotide changes, short insertions or deletions, inversions, recombinations, domain duplication, gene duplication, cluster duplication, segment duplication, chromosome duplication, genome duplication,

A modified model of genome evolution

Mutationsofdifferent

kinds

SELECTION)purifying or positive(

DRIFT

GATCTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAGGTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGGTGCAATGGGAAGCTCTTCTGGAGAGTGAGAGAAGCTTCCAGTTAAGGTGACATTGAAGCCAAGTCCTGAAAGATGAGGAAGAGTTGTATGAGAGTGGGGAGGGAAGGGGGAGGTGGAGGGATGGGGAATGGGCCGGGATGGGATAGCGCAAACTGCCCGGGAAGGGAAACCAGCACTGTACAGACCTGAACAACGAAGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGCAGGAATGCTTTGTAGACACAGTAATTTGCTTGTATGGAATTTTGCCTGAGAGACCTCATTGCAGTTTCTGATTTTTTGATGTCTTCATCCATCACTGTCCTTGTCAAATAGTTTGGAACAGGTATAATGATCACAATAACCCCAAGCATAATATTTCGTTAATTCTCACAGAATCACATATAGGTGCCACAGTTATCCCCATTTTATGAATGGAGGATGAAAACCTTAGGAATAATGAATGATTTGCGCAGGCTCACCTGGATATTAAGACTGAGTCAAATGTTGGGTCTGGTCTGACTTTAATGTTTGCTTTGTTCATGAGCACCACATATTGCCTCTCCTATGCAGTTAAGCAGGTAGGTGACAGAAAAGCCCATGTTTGTCTCTACTCACACACTTCCGACTGAATGTATGTATGGAGTTTCTACACCAGATTCTTCAGTGCTCTGGATATTAACTGGGTATCCCATGACTTTATTCTGACACTACCTGGACCTTGTCAAATAGTTTGGACCTTGTCAAATAGTTTGGAGTCCTTGTCAAATAGTTTGGGGTTAGCACAGACCCCACAAGTTAGGGGCTCAGTCCCACGAGGCCATCCTCACTTCAGATGACAATGGCAAGTCCTAAGTTGTCACCATACTTTTGACCAACCTGTTACCAATCGGGGGTTCCCGTAACTGTCTTCTTGGGTTTAATAATTTGCTAGAACAGTTTACGGAACTCAGAAAAACAGTTTATTTTCTTTTTTTCTGAGAGAGAGGGTCTTATTTTGTTGCCCAGGCTGGTGTGCAATGGTGCAGTCATAGCTCATTGCAGCCTTGATTGTCTGGGTTCCAGTGGTTCTCCCACCTCAGCCTCCCTAGTAGCTGAGACTACATGCCTGCACCACCACATCTGGCTAGTTTCTTTTATTTTTTGTATAGATGGGGTCTTGTTGTGTTGGCCAGGCTGGCCACAAATTCCTGGTCTCAAGTGATCCTCCCACCTCAGCCTCTGAAAGTGCTGGGATTACAGATGTGAGCCACCACATCTGGCCAGTTCATTTCCTATTACTGGTTCATTGTGAAGGATACATCTCAGAAACAGTCAATGAAAGAGACGTGCATGCTGGATGCAGTGGCTCATGCCTGTAATCTCAGCACTTTGGGAGGCCAAGGTGGGAGGATCGCTTAAACTCAGGAGTTTGAGACCAGCCTGGGCAACATGGTGAAAACCTGTCTCTATAAAAAATTAAAAAATAATAATAATAACTGGTGTGGTGTTGTGCACCTAGAGTTCCAACTACTAGGGAAGCTGAGATGAGAGGATACCTTGAGCTGGGGACTGGGGAGGCTTAGGTTACAGTAAGCTGAGATTGTGCCACTGCACTCCAGCTTGGACAAAAGAGCCTGATCCTGTCTCAAAAAAAAGAAAGATACCCAGGGTCCACAGGCACAGCTCCATCGTTACAATGGCCTCTTTAGACCCAGCTCCTGCCTCCCAGCCTTCT

The Drosophila genome

Adams, M.D. et al. Science 2000 287 2185-2195

~120-megabase euchromatic* portion was sequenced

euchromatic= *true chromatin=

non repetitivegenome regions

Misra et al. Genome Biology 2002 3(12):research0083.1-0083.22

Drosophila has >13,000 genes

Homeotic mutants

Normal fly

Extra set of wings!Ubx (Ultrabithorax) gene mutant

Antennae are transformed into legs!Antp (Antennapedia) gene mutant


Drosophila homeobox genes as example of gene duplication

Eight homeobox (Hox) genes regulate the identity of regions within the adult and embryo.

Embryo


Adult

The Hox genes are paralogs with a highly conserved homeobox domain


The Hox genes are transcription regulators and the Homeobox domain is DNA-binding domain.

Multiple alignment of the homeobox domain:

Vertebrates have 4 Hox clusters


Human chromosomes


Evolution of Metazoan Hox genes

What is an animal?

Textbook definition: an organism that feeds, moves and responds to stimuli.

From the book of “Bunny Suicides”

The phylotypic stage

The top row shows an early stage common to all groups, the second row shows a middle stage of development, and the bottom row shows a late stage embryo.

Haeckel's 1874 version of vertebrate embryonic development.

The zootype defines the spatial order of anterior expression limits of the Hox cluster and some other genes.

An animal is an organism that displays a particular spatial pattern of gene expression (zootype)

Slack et al. Nature 361 (1993), 490-492

Slack et al. Nature 361 (1993), 490-492

Origin of the zootype on the evolutionary tree


CCATTTTATGAATGGAGTEvolutionbyGenomeDuplicationGATGAAAACCTTAGGAATAATGAATGATTTGCGCAGGCTCACCTGGATATTAAGACTGAGTCAAATGTTGGGTCTGGTCTGACTTTAATGTTTGCTTTGTTCATGAGCACCACATATTGCCTCTCCTATGCAGTTAAGCAGGTAGGTGACAGAAAAGCCCATGTTTGTCTCTACTCACACACTTCCGACTGAATGTATGTATGGAGTTTCTACACCAGATTCTTCAGTGCTCTGGATATTAACTGGGTATCCCATGACTTTATTCTGACACTACCTGGACCTTGTCAAATAGTTTGGACCTTGTCAAATAGTTTGGAGTCCTTGTCAAATAGTTTGGGGTTAGCACAGACCCCACAAGTTAGGGGCTCAGTCCCACGAGGCCATCCTCACTTCAGATGACAATGGCAAGTCCTAAGTTGTCACCATACTTTTGACCAACCTGTTACCAATCGGGGGTTCCCGTAACTGTCTTCTTGGGTTTAATAATTTGCTAGAACAGTTTACGGAACTCAGAAAAACAGTTTATTTTCTTTTTTTCTGAGAGAGAGGGTCTTATTTTGTTGCCCAGGCTGGTGTGCAATGGTGCAGTCATAGCTCATTGCAGCCTTGATTGTCTGGGTTCCAGTGGTTCTCCCACCTCAGCCTCCCTAGTAGCTGAGACTACATGCCTGCACCACCACATCTGGCTAGTTTCTTTTATTTTTTGTATAGATGGGGTCTTGTTGTGTTGGCCAGGCTGGCCACAAATTCCTGGTCTCAAGTGATCCTCCCACCTCAGCCTCTGAAAGTGCTGGGATTACAGATGTGAGCCACCACATCTGGCCAGTTCATTTCCTATTACTGGTTCATTGTGAAGGATACATCTCAGAAACAGTCAATGAAAGAGACGTGCATGCTGGATGCAGTGGCTCATGCCTGTAATCTCAGCACTTTGGGAGGCCAAGGTGGGAGGATCGCTTAAACTCAGGAGTTTGAGACCAGCCTGGGCAACATGGTGAAAACCTGTCTCTATAAAAAATTAAAAAATAATAATAATAACTGGTGTGGTGTTGTGCACCTAGAGTTCCAACTACTAGGGAAGCTGAGATGAGAGGATACCTTGAGCTGGGGACTGGGGAGGCTTAGGTTACAGTAAGCTGAGATTGTGCCACTGCACTCCAGCTTGGACAAAAGAGCCTGATCCTGTCTCAAAAAAAAGAAAGATACCCAGGGTCCACAGGCACAGCTCCATCGTTACAATGGCCTCTTTAGACCCAGCTCCTGCCTCCCAGCCTTCT

Susumu Ohno and the 2R hypothesis

“It is our contention that the ancestors of reptiles, birds, and mammals have experienced at least one tetraploid evolution either at the stage of fish or at the stage of amphibians” (1970)

“A mammalian ancestor might have gone through at least one round of tetraploid evolution at the stage of fish” (1973)



Evolution by gene duplication, Ohno (1970)

Distribution of chromosome number in fishes is bi-modal

At least 7 Hox clusters in zebrafish

Amores et al. (1998) Science 282 1711-1714

1. Dosage relationship of functionally related genes2. Each structural gene is accompanied by duplication of its own

regulator

Much more on evolution of gene function in the next lecture...

Problems genome duplication solves:

Science v. 291, pp 1304-1351

Evidence 1: Large segments of conserved synteny are indeed present

Synthenic regions of human chromosome 11 on other human chromsomes


Evidence 2: Vertebrates have 4 copies of the Hox cluster

Detected genome duplication events

genomeduplication

Van de Peer et al. Nature Reviews Genetics (2009)

The “one-to-four” rule:

The human genome contains up to four paralogs of many Drosophila genes.

Spring J. FEBS Letters 400 (1997) 2-8

Examples of the ‘one-to-four’ rule

Spring J. Nature Genetics (2002) 31 128-129

How to turn 5 genes into 9 by a 2R model

Wolfe, K.H. Nature Reviews Genetics (2001) 2 333-341

Things Fall Apart, or

Methods for detecting genome duplications

• Spatial – Map-based approachusing knowledge of the order of genes along complete genomes

• Temporal – Tree-based approachusing the molecular clock to estimate the age of the duplication

Ken WolfeGenome Duplication archaeologist par excellence

Map-based approachA systematic search for duplicated regions in S. cerevisiae

3 separate diagonals indicate 3 distinct regional duplications

Interspersed within the clusters are gene that are not duplicated (result of regional duplications)

Wolfe K.H. and Shields D.C. Nature (1997) 387 708-713

55 duplicate regions were identified


• 376 pairs of homologous genes

• Covering ~50% of the genome

How did these 55 duplicated regions arise?

By successive duplications

Simultaneously by a single duplication of the entire genome (tetraploidy)

-OR-

Triplicated regions are not observed!

If duplications were successive, then about 7 of the 55 duplications would be expected to be in triplicated regions

The duplicates are not duplicated again

Duplication

Duplication of duplicate

Chrom. XVI

Chrom. VII

centromere

centromere

50 of the 55 duplicated regions conserve the orientation with respect to the centromere.


What does this signify?

mutual exchange of segments between nonhomologous chromosomes

http://www.ucl.ac.uk/~ucbhjow/bmsi/bmsi_7.html

Reciprocal translocation

• ~100 million years ago, two ancestral diploid yeast cells each containing about 5000 genes fused to form a tetraploid.

• The species then became diploid (decay of sequence identity) and most (85%) of the duplicate copies were deleted.

• Current species with a haploid diploid life cycle and 5,800 genes that include many duplicates.

S. cerevisiae is a paleoploid


K. Waltii illuminates the way

S. cerevisiae and K. waltii diverged roughly 150 million years ago,before the genome duplication event.

Kellis et al. Nature (2004) 428 617-624

Gene and region correspondence with K. waltii reveals genome duplication

Kellis et al. Nature (2004) 428 617-624

• Identified a total of 253 duplicate blocks, containing 75% of K. waltii genes and 81% of S. cerevisiae genes.

• Duplicate blocks tile 85% of each K. waltii chromosome in the pattern expected for WGD.

• Segmentally duplicated regions in the Arabidopsis genome.• Much of the genome is in pairs (not in triplicates, etc.).• There is evidence that most (60–70%) flowering plants have a polyploid ancestry

Arabidopsis Genome Initiative. Nature 408, 796–815 (2000).Masterston, Science 264, 421–423 (1994).

The Map-based approach also suggests a genome duplication in the Arabidopsis genome

Genes duplicated simultaneously should show the same history

Duplication 1

Duplication 2

Wolfe, K.H. Nature Reviews Genetics (2001) 2 333-341

Temporal Tree-based approach

When the human genome was estimated at 80,000 genes the “one-to-four” hypothesis was reasonable but now that the estimate is at 35,000.

The ‘one-to-four’ rule does not hold up

Makalowski W. Genome Research (2001) 667-670

...and in 2009, only 25,000.

Arguments against 2R

1. The “one-to-four” rule has not been upheld by genome sequence data

2. Phylogenetic trees for four-membered human gene families do not show the excess of ((AB),(CD)) topologies expected under a 2R model.

A B C D


CCATTTTATGAATGGAGT2Rornot2R?GATGAAAACCTTAGGAATAATGAATGATTTGCGCAGGCTCACCTGGATATTAAGACTGAGTCAAATGTTGGGTCTGGTCTGACTTTAATGTTTGCTTTGTTCATGAGCACCACATATTGCCTCTCCTATGCAGTTAAGCAGGTAGGTGACAGAAAAGCCCATGTTTGTCTCTACTCACACACTTCCGACTGAATGTATGTATGGAGTTTCTACACCAGATTCTTCAGTGCTCTGGATATTAACTGGGTATCCCATGACTTTATTCTGACACTACCTGGACCTTGTCAAATAGTTTGGACCTTGTCAAATAGTTTGGAGTCCTTGTCAAATAGTTTGGGGTTAGCACAGACCCCACAAGTTAGGGGCTCAGTCCCACGAGGCCATCCTCACTTCAGATGACAATGGCAAGTCCTAAGTTGTCACCATACTTTTGACCAACCTGTTACCAATCGGGGGTTCCCGTAACTGTCTTCTTGGGTTTAATAATTTGCTAGAACAGTTTACGGAACTCAGAAAAACAGTTTATTTTCTTTTTTTCTGAGAGAGAGGGTCTTATTTTGTTGCCCAGGCTGGTGTGCAATGGTGCAGTCATAGCTCATTGCAGCCTTGATTGTCTGGGTTCCAGTGGTTCTCCCACCTCAGCCTCCCTAGTAGCTGAGACTACATGCCTGCACCACCACATCTGGCTAGTTTCTTTTATTTTTTGTATAGATGGGGTCTTGTTGTGTTGGCCAGGCTGGCCACAAATTCCTGGTCTCAAGTGATCCTCCCACCTCAGCCTCTGAAAGTGCTGGGATTACAGATGTGAGCCACCACATCTGGCCAGTTCATTTCCTATTACTGGTTCATTGTGAAGGATACATCTCAGAAACAGTCAATGAAAGAGACGTGCATGCTGGATGCAGTGGCTCATGCCTGTAATCTCAGCACTTTGGGAGGCCAAGGTGGGAGGATCGCTTAAACTCAGGAGTTTGAGACCAGCCTGGGCAACATGGTGAAAACCTGTCTCTATAAAAAATTAAAAAATAATAATAATAACTGGTGTGGTGTTGTGCACCTAGAGTTCCAACTACTAGGGAAGCTGAGATGAGAGGATACCTTGAGCTGGGGACTGGGGAGGCTTAGGTTACAGTAAGCTGAGATTGTGCCACTGCACTCCAGCTTGGACAAAAGAGCCTGATCCTGTCTCAAAAAAAAGAAAGATACCCAGGGTCCACAGGCACAGCTCCATCGTTACAATGGCCTCTTTAGACCCAGCTCCTGCCTCCCAGCCTTCT

4 intervening genes (allow for a maximum of 30)

A paralogon of size 2 (sm = 2)

A paralogon of size 3 (sm = 3)

Paralogons are defined as paralog pairs separated by at most 30 intervening genes

Based upon McLysaght et al. Nature Genetics (2002) 31 200-204

Modified from McLysaght et al. Nature Genetics (2002) 31 200-204

Paralogons on human chromosome 17

McLysaght et al. Nature Genetics (2002) 31 200-204

Distribution of sizes of paralogons found in the human genome

Large-scale duplications must be invoked to explain paralogons:Test with a random shuffling model

Any paralogon with sm 6 was very likely to have been formed by a single duplication



Dating the duplications with respect to divergence from fly

outgroup


Excess duplications in the 0.4-0.7 D date range


The majority of genes making up paralogons fall in the age class 0.4–0.7 D

1. Human genome contains many more paralogons than expected by chance

2. A burst of gene duplication occurred during early chordate evolution

3. A widespread deletion of genes must have subsequently occurred (as in yeast and arabidopsis)


One genome duplication seems to have occurred

Gu X. et al. Nature Genetics (2002) 31 205-209

Another study, based upon 749 gene families ,came to a similar conclusion

The authors emphasized both genome and segmental duplications

Durand D. TIGs (2003) 19 2-5

Evolution of the chordate lineage with fly as an outgroup

Genome duplication estimates

Aury et al. Nature (2006) 444 171-178

In the unicellular eukaryote Paramecium tetraurelia, a ciliate, most of the nearly 40,000 genes arose through at least three successive whole-genome duplications

Representation of the successive duplications of the Paramecium genome. The exterior circle displays all chromosome-sized scaffolds, and the three interior circles show the reconstructed sequences obtained by fusion of the paired sequences from each previous step. Red lines link pairs of genes with a BRH match, and blue lines link pairs of genes with a non-BRH match that were added on the basis of syntenic position. Only the BRHs that link two genes in the same paralogon are represented. The position of an ancestral block is unrelated to the position of its constituents in the previous circle.

Aury et al. Nature (2006) 444 171-178

A model for gradual gene loss after genome duplications deduced from differential retention of genes in Paramecium.

• Paleopolyploidy events therefore seem to be exceedingly rare

• However, polyploidy is extremely common, 2-3% of speciation events.

• This would suggest that, although descendants of WGD events do not survive often, when they do survive their evolutionary lineage can be very successful.

Genome Duplications and Organismal Complexity

Van de Peer et al. Nature Reviews Genetics (2009)

The End

From the book of Bunny Suicides

ppt - welcome to our family homepage

Documents

genome duplication http

cluster duplication

domain duplication

segment duplication

chromosome duplication

vertebrate evolution

old gene

new gene locus