potential of mesenchymal stem cells for the...
TRANSCRIPT
POTENTIAL OF MESENCHYMAL STEM CELLS FOR THE REPAIR OF DIABETIC
HEART FAILURE
SHOAIB AKHTAR
NATIONAL CENTRE OF EXCELLENCE IN
MOLECULAR BIOLOGY UNIVERSITY OF THE PUNJAB
LAHORE, PAKISTAN. (2011)
POTENTIAL OF MESENCHYMAL STEM CELLS FOR THE REPAIR OF DIABETIC
HEART FAILURE
A THESIS SUBMITTED TO
THE UNIVERSITY OF THE PUNJAB
IN FULFILLMENT OF THE REQUIRMENT
FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY IN MOLECULAR BIOLOGY
BY
SHOAIB AKHTAR
SUPERVISOR: DR. SHAHEEN N. KHAN
NATIONAL CENTER OF EXCELLENCE IN MOLECULAR BIOLOGY,
UNIVERSITY OF THE PUNJAB, LAHORE, PAKISTAN
(2011)
DEDICATIONS
I dedicate my thesis work
To my parents
Who always showed their trust in my
capabilities and their prayers and love
always rewarded me with success
My teachers
Who from Prep to PhD helped me in
seeing things beyond
CONTENTS
Chapter No. Title Page No.
LIST OF FIGURES ………………………………………………………………… v
LIST OF TABLES ………………………………………………………………….. vii
SUMMARY …………………………………………………………………………. viii
ACKNOWLEDGMENTS …………………………………………………….... xi
ABBREVIATIONS AND SYMBOLS ……………………………………….. xii
1. INTRODUCTION…………………………....................................... 1―5
2. REVIEW OF LITERATURE……………………………………………………. 6―27
2.1 AN INTRODUCTION TO STEM CELLS………………………. 6
2.2 Stem Cells…………………………………………………………….. 6
2.3 Types of Stem Cells………………………………………………. 6
2.3.1 Embryonic Stem Cells…………………………………………… 6
2.3.2 Adult Stem Cells…………………………………………………… 7
2.4 Bone Marrow……………………………………………………….. 7
2.4.1 Hematopoietic Stem Cells…………………………………….. 7
2.4.2 Mesenchymal Stem Cells………………………………………. 7
2.4.3 Endothelial Progenitor Cells…………………………………… 8
2.4.4 Multipotent Adult Progenitor Cells……………………….. 8
2.5 CARDIOVASCULAR SYSTEM………………………………….. 9
2.5.1 Heart……………………………………………………………………. 9
2.5.2 Microstructure of the Heart………………………………….. 10
2.5.3 Blood Circulation………………………………………………….. 12
2.6 CARDIOVASCULAR DISEASES………………………………… 13
2.6.1 Diabetes and Cardiovascular Diseases…………………. 14
2.6.2 Diabetic Cardiomyopathy……………………………………… 15
2.7 TREATMENT AND MANAGEMENT OF DCM…………... 19 2.7.1 Life Style……………………………………………………………….. 19
2.7.2 Glycemic Control…………………………………………………… 19
2.7.3 Dyslipidemia Treatment………………………………………… 19
2.7.4 Antihypertensive Treatment…………………………………. 20
2.8 SOME ADDITIONAL THERAPEUTIC STRATEGIES……... 20
2.8.1 Apelin and Cardiac Output……………………………………. 20
2.8.2 Kinins……………………………………………………………………. 20
2.8.3 Sarcoplasmic Reticulum Calcium ATPase (SERCA2).. 21
2.8.4 Antioxidants…………………………………………………………. 21
2.8.5 Erythropoietin………………………………………………………. 22
2.8.6 Cellular Therapy……………………………………………………. 25
2.8.7 Combining MSCs Transplanatation and EPO Treatment 26
3. MATERIALS AND METHODS 28―38
3.1 Animals………………………………………………………………… 28
3.2 Mouse Model for Diabetes…………………………………… 28
3.3 In vitro Study……………………………………………………….. 28
3.3.1 Cell Culture………………………………………………………….. 28
3.3.2 Flow Cytometry……………………………………………………. 28
3.3.2 Preconditioning of Diabetic MSCs…………….............. 29
3.3.3 Gene Expression Profiling of MSCs……………………….. 29
3.3.4 Hypoxic Stress………………………………………………………. 31
3.3.5 Superoxide Dismutase Assay………………………………… 32
3.3.6 Apoptosis……………………………………………………………… 32
3.3.7 In vitro Tube-forming Assay………………………………….. 32
3.3.8 Chemotactic Attraction…………………………………………. 33
3.3.9 Glucose Stress………………………………………………………. 33
3.4 In vivo Study…………………………………………………………. 34
3.4.1 Diabetic Mouse Model………………………………………….. 34
3.4.2 EPO Treatment……………………………………………………… 34
3.4.3 Transplantation and EPO Treatment…………………….. 34
3.4.4 RNA Extraction and cDNA Synthesis……………………… 35
3.4.5 Gene Expression Study…………………………………………. . 35
3.4.6 Tissue Procurement for Histological Studies………….. 36
3.4.7 Tunel Assay………………………………………………………….. 36
3.4.8 Immunostaining for eNOS…………………………………….. 37
3.4.9 Detection of Stem cells in Left Ventricular Tissue….. 37
3.4.9.1 Sirius Red Staining……………………………………………….. 37
3.4.9.2 Millar Analysis…………………………………………………….. 38
3.5 Statistical Analysis……………………………………………….. 38
4. RESULTS…………………………………………………………………………… 39―59
4.1 In vitro Studies……………………………………………………… 39
4.1.1 Characterization of MSCs……………………………………… 39
4.1.2 Stimulation of Cell Proliferation in Preconditioned Diabetic MSCs
………………………………………………..………………………………………. 40
4.1.3 Gene Expression Profiling of MSCs………………………… 42
4.1.4 Increased SOD Activity in Preconditioned MSCs……… 44
4.1.5 Effect of IGF-1 and FGF-2 Preconditioning on Apoptosis 45
4.1.6 Chemotactic Ability of Preconditioned Diabetic MSCs 46
4.1.7 In vitro tube-forming ability in diabetic MSCs………… 47
4.1.8 Real-time PCR gene Expression after Glucose Stress 49
4.2 In vivo Studies……………………………………………… 50
4.2.1 Effect of EPO treatment on Gene expression of Diabetic Heart
………………………………………………………………………………………… 50
4.2.2 Decreased Myocardial Cell Apoptosis……………………. 51
4.2.3 Enhancement of eNOS Expression…………………………. 52
4.3 Transplantation Studies……………………………………….. 54
4.3.1 Homing of MSCs…………………………………………………… 54
4.3.2 Reduction in Tissue Fibrosis………………………………….. 56
4.3.3 Hemodynamic Parameters……………………………………. 58
5. DISCUSSIONS…………………………………………………………………… 60―67
6. REFERENCES………………………………………………………............... 68―91
LIST OF FIGURES
Figure No. Page No.
CHAPTER 2
Fig. 2.1A Heart anatomy showing sulci 10
Fig. 2.1B Internal anatomy of the heart 10
Fig. 2.2 Microstructure of the heart tissue 12
Fig. 2.3 Some of the diabetes associated risk factors for HF 15
Fig. 2.4 Interacting pathways of ROS production and injury in diabetic cardiomyocytes 16
Fig. 2.5 The pathophysiological substrate of DCM 18
Fig. 2.6 Signal transduction pathways involved in EPO mediated
Cytoprotection 23
CHAPTER 4
Fig. 4.1 Mouse model of diabetes 39
Fig. 4.2 Flow cytometry of diabetic MSCs 40
Fig. 4.3A Cell proliferation after preconditioning of diabetic MSCs 41
Fig.4.3B Analysis of cell proliferation for (PCNA) expression comparing
VEGF and IGF-1/FGF-2 preconditioning of diabetic MSCs 42
Fig. 4.4A-D Gene expression profiling of MSCs 43
Fig. 4.4E Quantification of gene expression profiling of MSCs 44
Fig.4.5 Comparison of SOD activity among normal, diabetic untreated
and preconditioned MSCs under normoxia and hypoxia 45
Fig. 4.6 Flow cytometry for annexin-V-positive cells 46
Fig. 4.7 Mobilization of untreated and preconditioned MSCs to SDF-1α 47
Fig. 4.8A-D Preconditioned MSCs demonstrate better tube-forming ability
than untreated cells both under hypoxia and normoxia 48
Fig.4.8E Quantification of tube forming cells under hypoxic and
normoxic conditions 49
Fig. 4.9 Real-time RT-PCR gene expression analysis under conditions
of high-glucose stress 50
Fig. 4.10 Left ventricular mRNA expression of Bax, p16ᴵᴺᴷ⁴ᵃ and IGF-1
in different treatment groups of C57BL/6 male mice 51
Fig. 4.11 TUNEL assay for apoptosis in left ventricular heart sections
(40 X) of different treatment groups of C57BL/6 male mice 52
Fig. 4.12 Expression of eNOS in the left ventricular heart sections (20X)
of different treatment groups of C57BL/6 male mice 53
Fig. 4.13 Homing of GFP-positive MSCs in Left ventricular heart sections
(40X) of different treatment groups of C57BL/6 male mice 55
Fig. 4.14 Fibrosis as seen in left ventricle heart sections (40 X) of different
treatment groups of C57BL/6 male mice by sirius red staining 57
LIST OF TABLES
No. Page No
CHAPTER 3
Table.1 List of primers, their product size (bp) and sequence 5´—3´ 31
CHAPTER 4
Table.2 Cardiac parameters as determined by Millar analysis in different
treatment groups of C57BL/6 male mice 59
SUMMARY
Mesenchymal stem cells (MSCs) derived from bone marrow (BM) hold multilineage
differentiation potential which can be used to treat diabetic heart failure (HF). Yet,
hyperglycemia can lead to functional impairment of MSCs and would warrant an appropriate
treatment strategy to improve its functionality. Diabetes was induced in male C57BL/6 wild-
type mice by streptozotocin and MSCs were isolated 60 days after diabetes induction.
Diabetic MSCs were characterized by flow cytometry for CD44 (97.7%), CD90 (95.4%), and
CD105 (92.3%).
In the present study two strategies, in vitro preconditioning with growth factors and in
vivo erythropoietin (EPO) treatment were used to improve the functionality of diabetic
MSCs. MSCs were preconditioned with insulin-like growth factor-1 (IGF-1) and fibroblast
growth factor-2 (FGF-2), 50 ng/mL each in combination for 1 h in serum-free Iscove’s
modified Dulbecco’s medium (IMDM). EPO was administered to 40 days diabetic mice at
1000 IU/Kg for five consecutive days through intra peritoneal route.
Since the transplanted MSCs in the diabetic heart are likely to experience both
ischemia and hyperglycemia, the preconditioned MSCs in vitro were subjected to hypoxia
and high glucose exposure in an attempt to imitate microenvironment of the diabetic heart.
This was followed by assessment for the effects of preconditioning on diabetic MSCs.
Preconditioning caused profound effects on the gene expression profile of diabetic MSCs by
downregulating p16ᴵᴺᴷ⁴ᵃ, p66ˢʱᶜ, p53, Bax, and Bak and upregulateing prosurvival (IGF-1,
FGF-2, Akt) and early cardiac differentiation markers (GATA-4, Nkx 2.5). In a parallel
treatment group the diabetic MSCs were treated with vascular endothelial growth factor
(VEGF) (50 ng/mL) owing to its known effects on cell survival and proliferation. The
comparison of gene expression profiling for the above markers between the two treatment
groups showed IGF-1/FGF-2 treatment group to be better than the VEGF treated group. The
expression of proliferating cell nuclear antigen (PCNA) gene, a marker of cell proliferation,
was also better in the IGF-1/FGF-2 treated group than that of VEGF. So IGF-1/FGF-2 based
preconditioning of diabetic MSCs was selected for experiments of hypoxic and high glucose
insults and all subsequent experiments.
Under conditions of hypoxic stress untreated diabetic MSCs showed low superoxide
dismutase (SOD) activity (36.9+3.1%) which improved significantly in the preconditioned
diabetic MSCs (52.3+2%). Similar improvements characterized by low number of annexin-
V-positive cells, better tube-forming ability, and increased migration to stromal cell-derived
factor-1α (SDF-1α) were witnessed in the preconditioned diabetic MSCs compared with the
untreated diabetic MSCs. Preconditioning also enhanced Ang-I and VEGF expression while
reduced the expression of p16ᴵᴺᴷ⁴ᵃ in the diabetic MSCs exposed to high glucose conditions.
In view of the reported cardio-protective effects of EPO sub set of experiments were
performed to study the effects of EPO on diabetic heart. Of the two groups of diabetic mice
the diabetic EPO-treated group received injections (i.p.) of EPO while the untreated group
received equal volume of normal saline injections (i.p.). Normal mice served as control. The
gene expression analysis of the left ventricular tissue on day six showed downregulation of
p16ᴵᴺᴷ⁴ᵃ and Bax genes and an upregulation of IGF-1 in the EPO treated group compared
with the untreated group. Tunel staining results showed significant reduction in myocardial
cell apoptosis in the EPO-treated group (4±0.3) compared with the untreated group (8±0.5).
EPO-treated group also showed better left ventricular endothelial nitric oxide synthase
(eNOS) expression than untreated group.
Owing to the observed beneficial effects of EPO on diabetic heart a combined
strategy of transplantation of preconditioned MSCs followed by EPO treatment was
employed to treat diabetic heart. Preconditioned diabetic MSCs were transplanted into the
left ventricle of diabetic mice with subsequent EPO treatment (preconditioned EPO-treated
group) and compared with the transplantation of untreated and preconditioned diabetic MSCs
alone. After four weeks of transplantation homing was highest in the preconditioned EPO-
treated group (45±3.5) followed by the preconditioned MSCs (25±2) and the untreated MSCs
(12±1.5) group. A significant reduction in left ventricular tissue fibrosis was observed in the
preconditioned EPO-treated group (6.67%±0.25%) compared with both the preconditioned
MSCs (10.59%±1.25%) and the diabetic untreated MSCs group (13.16%±0.5%).
The functional analysis of the diabetic hearts showed marked improvements in the
diabetic EPO-treated, preconditioned and preconditioned EPO-treated groups for the assessed
cardiac parameters. In particular, values of the end-systolic pressure (77.1+6.4mmHg) and
ejection fraction (26.9+0.62%) observed in the preconditioned EPO-treated group were
closest to the normal standard base line values of 90-110 mmHg and 44-62% respectively
compared with the other groups. EPO treatment thus showed improvement of diabetic heart
at several fronts characterized by a decrease in myocardial apoptosis, senescence, tissue
fibrosis and an increase in the expression of eNOS, homing of MSCs and heart functionality.
So the preconditioning of diabetic MSCs with IGF-1/FGF-2 growth factors signifies
an innovative strategy to improve the function of diabetes-impaired MSCs and the
transplantation of the preconditioned MSCs in the diabetic heart followed by in vivo EPO
treatment represents a novel combined strategy of its type to treat diabetic HF.
ACKNOWLEDGEMENTS
All the praises and than s be to ll h, the Lord of the n (mankind, jinn and all
that exists). It is because of His countless blessings that I managed to perform the research
work and write this thesis. All respects are for the Holy Prophet Muhammad on whom be
peace and blessings of the ord. He is the prophet well-informed the witness to ll h’s
commandments, the bringer of glad tidings, the warner unto those who are heedless, the
summoner of the erring to the way of ll h, the resplendent light which dispels the darkness
and shows the right path¹.
It is said that where there is a will there is a way out but in my case the will of doing
the research work was there but in the beginning I was unable to find a way out, for me it
was a herculean task but with llah’s blessings I was luc y enough to find such a supportive
clique who helped me in carrying out things pragmatically and gave me the confidence to
proceed with perseverance and commitment.
Today on the completion of my project I would like to extend my thanks to Dr.
Tayyab Husnain Director, National Centre of Excellence in Molecular Biology for his kind
cooperation. I would like to extend my profound thanks to the former Director CEMB, Dr.
Sheikh Riazuddin for his keen interest in the development of stem cells lab. and providing us
all the required research facilities. I am grateful to my research supervisor Dr. Shaheen N
Khan for her guidance and kind support during whole span of my research work. My special
gratitude to Dr. Mohsin Khan and Dr. Sadia Mohsin for their special interest in my work,
their technical expertise always helped me a lot to focus on my objectives. The cooperation
and help of my all colleagues especially Shareef Masoud, Tariq Awan, Azra, Ghazanfer,
Sulaiman, Mahmood, Ali, Fatima, Sana, Maria, and Ajaml is worth to mention. My special
thanks to staff of animal house, Mr. Nasir, Mr. Najeeb and Mr. Shahzad for giving due care
to animals during my research work.
I have no words to express my feelings for the support and encouragement of my
wife. It was her patience and hard work in taking full care of home matters during my
prolonged absence that kept the momentum of my work. My little daughters Saman and
Fatima showed immense patience while waiting for late hours. My deep sense of respect and
love to my brothers, Laiq-uz-Zaman, Saeed Akhtar and Suhail Akhtar for their every possible
help during my research. I take this opportunity to thank my all cousins for their good wishes
during the entire period of my research.
Working in CEMB was a great experience and I would always cherish my stay in this
esteemed institution and surely this experience of learning will always be a source of pride
for me.
SHOAIB AKHTAR
¹ Adopted from the book “Muhammad The Ideal Prophet” by Saiyid Sulaiman Nadvi. Translated by Mohiuddin Ahmad.p.20. Islamic Book Foundation, Lahore; Pakistan
ABBREVIATIONS AND SYMBOLS
Acute Myocardial Infarction AMI
Adult Stem Cells ASCs
Advanced Glycation End Products AGEs
Alpha-Lipoic Acid α-LA
Base Pair bp
Blood Pressure B.P.
Bone marrow BM
4´, 6-Diamidino-2- Phenylindole DAPI
Diabetic Cardiomyopathy DCM
Embryonic Stem Cells ESCs
Endothelial Cells ECs
Endothelial Nitric Oxide Synthase eNOS
Endothelial Progenitor Cells EPCs
End-systolic Pressure ESP
EPO Receptor EPOR
Ejection Fraction EF
Erythropoietin EPO
Ethylene diamine tetra acetic acid EDTA
Fetal Bovine Serum FBS
Fibroblast Growth Factor-2 FGF-2
Fluorescein Isothiocyanate FITC
Free Fatty Acid FFA
Germ line Stem Cells GSCs
Glucose Transportation GLUT
Glyceraldehyde 3-Phosphate Dehydrogenase GAPDH
Heart Failure HF
Hematopoietic Stem Cells HSCs
High Glucose HG
Insulin-like Growth Factor-1 IGF-1
International Units IU
Intraperitoneal i.p.
Iscove’s Modified Dulbecco’s Medium IMDM
Kallikrein-Kinin System KKS
Kilogram kg.
Matrix MetalloProteinase2 MMP2
Mesenchymal Stem Cells MSCs
Metabolic Syndrome MetS
Min minute
Moloney Murine Leukemia Virus M-MLV
Multipotent Adult Progenitor Cells MAPCs
Myocardial Infarction MI
Nitric Oxide NO
Paraformaldehyde PFA
Polymerase Chain Reaction PCR
Proliferating Cell Nuclear Antigen PCNA
Protein Kinase C PKC
Quantitative PCR qPCR
Reactive Oxygen Species ROS
Recombinant Human EPO rHuEPO
Reverse Transcriptase-PCR RT-PCR
Sarcoplasmic Reticulum Calcium ATPase 2 SERCA2
Sodium 3-[1-{phenylaminocarbonyl}- 3,4-tetrazolium]-
-bis{4-methoxy-6-nitro} Benzene Sulfonic acid Hydrate XTT
Somatic Stem Cells SSCs
Stromal Cell-Derived Factor-1Alpha SDF-1α
Superoxide Dismutase SOD
Terminal deoxy nucleotidyl transferase-mediated TUNEL dUTP Nick End Labeling
UK Prospective Diabetes Study UKPDS
Vascular Endothelial Growth Factor VEGF
CHAPTER 1
INTRODUCTION
The spread of heart disease is rapid around the globe (Lloyd-Jones et al., 2010) and
the consequences of heart disease have been reported to be more dangerous among diabetics.
The number of diabetes affected people in the world is around 150 million which is
anticipated to touch the figure of 299 million by the year 2025. Among other diseases
cardiovascular diseases account for a considerable increase in incidence and risk of mortality
in the diabetic patients (Francia et al., 2009). Diabetes has also been previously reported as
one of the most frequent causes of cardiovascular complications among a large section of
population (Gaede et al., 2003) and one of the leading causes of deaths in diabetics (Candido
et al., 2003; Sowers et al., 2001; Mazzone et al., 2008). The development of diabetic
cardiomyopathy in the absence of established risk factors (Sarwar et al., 2010) is among
some recent findings seen as a consequence of diabetes.
Diabetes associated increase in oxidative stress can cause exceedingly high levels of
reactive oxygen species (ROS) within cells. The rise of free radicals and radical-derived
reactive species within the cells dictate the cellular response under conditions of
hyperglycemia-induced oxidative stress. This oxidative stress can slow down cells ability to
proliferate and instigate cellular senescence and apoptosis (Martindale & Holbrook, 2002;
Burch & Heintz, 2005). Thus the main pathophysiological mechanism which associates
hyperglycemia with certain diseases like atherosclerosis, nephropathy and cardiomyopathy is
production of oxygen derived free radicals (Francia et al., 2009).
Pathology of diabetic cardiomyopathy (DCM) is characterized by myocardial injury,
hypertrophy, interstitial fibrosis, structural and physiological changes of small coronary
vasculature, disturbance of the management of the metabolic cardiovascular load, and cardiac
autonomic neuropathy (Voulgari et al., 2010). Stem cells have the potential to revive diabetic
heart (Zhang, 2008). The results of the stem cells therapy however, depends on the prevailing
levels of ROS-induced oxidative stress and the microenvironment of the diabetic heart.
Proliferation and mobilization potential of stem cell is compromised due to the
development of oxidative stress (Thum et al., 2007; Sambuceti et al., 2009). In this scenario
the preservation of stem cell function to support its proliferation and differentiation is
possible through various strategies (Gallagher, 2007; Ohshima, 2009). Use of growth factors,
hypoxia, and anti-aging compounds are among some preconditioning strategies (Hahn et al.,
2008; Rosova et al., 2008) meant for enhancing potency of stem cell (Haider & Ashraf,
2008). Growth factor preconditioning has been recently documented to improve the
cytoprotective potential of stem cells and increase its effectiveness for cell therapy (Rosova
et al., 2008). Similarly previous studies have indicated that the antioxidant system can be
activated to provide protection against oxidative stress by preconditioning with antioxidants
(Orzechowski, 2003).
Among other cytokines, known to improve cellular functions, erythropoietin (EPO)
has also been documented for the improvement in different disease modalities such as
diabetes, neurodegeneration, renal and cardiovascular systems (Maiese et al., 2008). The
EPO administration has shown to decrease complications and increase cardiac functions in
diabetes (Silverberg et al., 2006). In conditions such as ischemic cardiac disease, EPO
administration improved cardiac function, inhibited cardiomyocyte apoptosis and enhanced
cardiac remodeling (Gao et al., 2007; Toma et al., 2007; Asaumi et al., 2007; Westenbrink et
al., 2007). Furthermore, studies have shown that EPO independently leads to angiogenesis
(Reinders et al., 2006; Li et al., 2007). These findings indicate the importance of EPO
administration in the improvement of diabetic myocardium, which may also help
preconditioned stem cells to perform better after being transplanted in the diabetic heart.
Mesenchymal stem cells (MSCs) are regarded as an important source for
cellular therapies (Kudo et al., 2003; Orlic et al., 2001) owing to their potential to
differentiate towards multilineage (Sharif et al., 2007; Krause, 2002). Yet, the available data
do not report any study known to date that characterizes the effect of diabetes on MSCs
function. This is particularly relevant to our quest for treatment of diabetic HF.
The present study reports that diabetes impairs MSCs function by increasing cell
senescence and death and downregulating the survival factors. To improve the function of
diabetes-impaired MSCs and provide protection from potential hypoxic and high glucose
insults a preconditioning strategy based on growth factors was employed. The diabetic MSCs
were preconditioned with insulin-like growth factor-1 (IGF-1) and fibroblast growth factor-2
(FGF-2). The preconditioning enhanced proliferation of MSCs, downregulated proapoptotic
factors, upregulated survival factors, enhanced their angiogenic ability and tolerance to
hypoxia and high glucose insults. The study thus identifies IGF-1 and FGF-2 based
preconditioning to be unique of its kind for the functional improvement of diabetes affected
MSCs.
In view of the documented cardio-protective role of EPO (Asaumi et al., 2007;
Ruifrok et al., 2008; Maiese et al., 2008), a pilot study was also done to investigate the
potential of EPO treatment on functional enhancement of the diabetic heart. The effects of
EPO treatment alone on the diabetic heart were first determined. For this purpose mice at
diabetic day 40 were divided into two groups which included diabetic untreated mice and
diabetic mice administered with injections of EPO (1000 IU /kg i.p.) for five consecutive
days. The normal mice group served as control. The gene expression analysis of the left
ventricular tissue on day six showed down regulation of p16ᴵᴺᴷ⁴ᵃ and Bax genes and
upregulation of IGF-1in the diabetic EPO-treated group compared with the diabetic untreated
group. Tunel staining also showed significant reduction in myocardial cell apoptosis in the
EPO-treated group compared with the untreated group. This was concomitant with a better
eNOS expression in the left ventricular tissue of the EPO-treated group compared with the
untreated group.
After the initial establishment of the beneficial effects of EPO on diabetic heart the
combined strategy of transplantation of preconditioned diabetic MSCs followed by EPO
treatment was employed. The transplanted mice groups at diabetic day 40 included mice
transplanted with untreated diabetic MSCs (diabetic untreated group), mice transplanted with
preconditioned diabetic MSCs (diabetic preconditioned group) and mice transplanted with
preconditioned diabetic MSCs and given EPO treatment (diabetic EPO-treated group). The
non-transplanted groups included normal, diabetic, diabetic sham, and diabetic EPO-treated
mice. Four weeks after transplantation Millar analysis of the various treatment groups was
done to assess heart functions. The combined strategy of transplantation of preconditioned
diabetic MSCs and EPO administration ensured significantly high homing of MSCs,
reduction in fibrosis and marked improvements in cardiac functions compared to all other
treatment groups.
The results of the pilot study employing EPO treatment thus showed better effects on
the microenvironment of the diabetic heart and when used in conjunction with transplantation
of preconditioned diabetic MSCs improved the cardiac status of the transplanted mice.
Despite these considerable improvements involving use of combined strategy, the cardiac
functions of the diabetic mice were below the normal standard base line value, which was
understandable and can be associated with diabetes. It is therefore suggested that future
studies be aimed at either increasing the dose or duration of EPO treatment for up to seven
days. Further the analysis of heart function should be done after eight weeks to further
elucidate the functionality of the diabetic heart following this treatment strategy.
The present study thus identifies IGF-1/FGF-2 based preconditioning to be a novel
strategy to enhance the function of diabetes-impaired MSCs and transplantation of these
preconditioned MSCs together with EPO treatment represents a unique combined strategy of
its type not known yet to treat diabetic HF.
CHAPTER 2
REVIEW OF LITERATURE
2.1 AN INTRODUCTION TO STEM CELLS
2.2 Stem Cells
Stem cells are classified as a subset of cells that have the potential of self renewal and
differentiation in to one or more mature cell types (Verfaillie, 2002; Orkin & Zon, 2002;
Anderson et al., 2001). The division of stem cells during self renewal is symmetric i.e. one
stem cell produces two daughter stem cells while it is asymmetric during course of
differentiation. In asymmetric division stem cell produces a daughter stem cell and a
progenitor cell. The progenitor cell is committed towards a particular cell type and can
develop in to a mature differentiated cell type (Gomperts & Strieter, 2007).
2.3 Types of Stem Cells
Stem cells can be classified on the basis of various parameters such as their anatomy,
functions, transcription factors and proteins. However, the two broad divisions of stem cells
are embryonic stem cells (ESCs) and adult stem cells (ASCs). ESCs are found in embryo
while ASCs are found in different adult tissues (Mathur & Martin, 2004).
2.3.1 Embryonic Stem Cells (ESCs)
Blasotcyst have inner cell mass which provide a good source to derive ESCs at
around 5 days after fertilization and these ESCs are pluripotent. This means that they are able
to differentiate into three germ layers i.e. ectoderm, mesoderm and endoderm (Chambers &
Smith, 2004; Thomson et al., 1998). The development of embryo leads to the formation of
stem cells for reproduction and organogenesis termed as germ line stem cells (GSCs) and
somatic stem cells (SSCs) respectively. Although diversified from the ESCs the GSCs and
SSCs retain the property of self renewal. They either progressively restrict in to multiple
lineages or become unipotent (Fuchs et al., 2004; Rossant, 2004; Weissman, 2000).
2.3.2 Adult Stem Cells (ASCs)
After birth ASCs including GSCs and SSCs reside in a special microenvironment
called ―niche‖. The location and characteristics of this niche varies and depends on the tissue
types (Linheng & Ting, 2005). ASCs are also referred as progenitor cells so that they may
not be taken up as totipotent (Herzog et al., 2003; Krause et al., 2001). This naming is,
however, confusing in the sense that they might be thought of as committed progenitor cells
or transient multiplying cells, neither of which qualify the criteria for stem cells (Gomperts &
Strieter, 2007). ASCs are thus considered as multipotent or unipotent which can differentiate
in to one or more mature cell types (Fuchs & Segre, 2000; Alison et al., 2002). ASCs are
found in a variety of adult tissues including skin, muscle, intestine, testis, heart and bone
marrow.
2.4 Bone marrow (BM)
BM contains a heterogeneous set of different population of cells such as
hematopoietic stem cells (HSCs), mesenchymal stem cells (MSCs), endothelial progenitor
cells (EPCs) and multipotent adult progenitor cells (MAPCs).
2.4.1 Hematopoietic Stem Cells (HSCs)
The best characterized types among ASCs are the HSCs which are linˉ CD45⁺, Sca-
1⁺ (only in mice) and c-kit⁺ (Fuchs & Segre, 2000; Alison et al., 2002; McCulloch & Till
2005). HSCs can give rise to all types of mature blood cells.
2.4.2 Mesenchymal Stem Cells (MSCs)
MSCs are regarded as a potential tool for cellular therapy. MSCs represent a part of
multipotent adult stem cell population which if provided suitable culture conditions can
differentiate in to osteocytes, chondrocytes, adipocytes, myocytes, and cardiomyocytes i.e.
cells of mesodermal origin as well as in to hepatocytes and neuronal cells of non-mesodermal
lineages (Wagner et al., 2008). MSCs are known to express CD44, CD90, CD105, CD106,
but not CD45. However, there still exists lack of consensus regarding their receptors
profiling.
2.4.3 Endothelial Progenitor Cells (EPCs)
EPCs enter the peripheral blood after they leave bone marrow. They circulate and
home at various adult tissue sites. EPCs express markers such as CD34, VEGFR, and Ties-2
but are negative for CD45 (Asahar & Kawamoto, 2004; Urbich & Dlmmeler, 2004).
Recently flow cyotmetry studies on human EPCs isolated from adult peripheral blood,
adipose tissue and liver has demonstrated expression of CD105 on EPCs from these sources
(Tarnok et al., 2009). EPCs are known to play important role in regeneration of vasculature
in adult organ.
2.4.4 Multipotent Adult Progenitor Cells (MAPCs)
BM constitutes one of the sources for in vitro culturing of MAPCs (Jiang et al.,
2002). MAPCs may occur along with MSCs in the MSCs culture due to their adherent
nature. So MAPCs may represent a side population of MSCs. However MAPCs are different
in the sense that they can be grown indefinitely in the presence of few growth factors
(Gomperts & Strieter, 2007). The remarkable plasticity seen in both MSCs and MAPCs may
be attributed to their ability of cell fusion. Transdifferentiation is the term used for change in
phenotype of one cell into another type of cell which may be the result of cell fusion (Terada
et al., 2002; Ying et al., 2002).
ASCs play an important role in tissue homeostasis by supporting tissue regeneration
and replacing the cells lost due to injury and apoptosis. So a fine balance between both is
inevitable for normal functions to ta e place in an individual’s life span. The study of
mechanisms that govern this fine balance is crucial to our understanding of stem cell
regulation, cancer development and potential therapeutic use of stem cell (Linheng & Ting,
2005).
2.5 CARDIOVASCULAR SYSTEM
Cardiovascular system is comprised of heart and associated blood vessels by which
blood is pumped and distributed throughout the body. This distribution of blood occurs by
three important forms of blood circulations which are: pulmonary, systemic and coronary.
During which blood supplies nutrients, oxygen, hormones, salts, etc. vital for the functioning
of all body tissues and removes the wastes harmful for these tissues.
2.5.1 Heart
Human heart is a fibromuscular pumping organ that lies in the middle mediastinum
between the lungs. It is enclosed by a pericardium which consists of two components that
include a fibrous and a serous pericardium. Heart is somewhat conical in shape. The two
distinct parts of a heart include an apex and a base. An average adult heart is 12 cm long
from base to apex and a diameter of 8 to 9 cm at the broadest part. It weighs about 300g in
males and 250g in females (Standrings et al., 2008).
Heart comprise of four chambers. These are two atria and two ventricles. The division
of heart in to four chambers produces externally visible grooves called sulci (Fig.2.1A). The
two atria have weak contractility and empty blood in to ventricles which with their powerful
contraction pump blood to the arterial trunk. The figure 2.1B briefly describes the key
anatomical parts of the heart.
Figure 2.1 Anatomy of heart A. sulci B. internal anatomy.
2.5.2 Microstructure of the Heart
Heart consists of three layers. An outer thin epicardium, middle thick myocardium
and an inner thin endocardium. The epicardium and endocardium consist of simple squamous
epithelium and simple squamous endothelium respectively overlying a thin layer of areolar
tissue. The middle layer which is thickest called myocardium. The bulk of myocardium
consists of muscle cells called cardiac cells, cardiac myocytes or cadiomyocytes (Saladin,
2005). It should be noted that the muscles of the ventricle are spiral and this is the reason that
in the microscopic sections cardiac muscle fibres never appear linear in arrangement. Linear
arrangement is only seen in sections of papillary muscles and trabeculae carneae.
Cardiac muscle cells are elongated in shape and branched at their ends containing one
or two nuclei. The average size of a normal cardiac muscle cell is 120µm long and 20-30 µm
in diameter. The arterial muscle cells are smaller in size as compared to the ventricular
muscle cells. Some 35 % of the cardiac cell volume is occupied by mitochondria indicative
of requirement for high oxidative metabolism. In this context cardiac muscle cells are
supplied by a heavy anastamosing complex of capillaries. This clearly shows why the cardiac
cells are sensitive to ischemic events. This complex of capillaries also provides a potential
means to develop collateral circulation in case of ischemic attacks. The ends of cardiac
muscle cells are joined together to form a complex and the adjacent cardiac cells are
connected with each other by gap junction complex. The forces of contraction of muscle cells
are strengthen by gap junctions and their complex networking establishes contractions as
syncytium. The contractile proteins arranged in sarcomere in the cardiac muscle cells are
responsible for this contraction. The sarcoplasmic reticulum lies in close association to the
sarcomere and is concerned with the storage, release and reaccmulation of calcium (Fig.2.2).
When calcium is released in to the sarcoplasm, it causes contraction which corresponds to the
systolic phase of the heart cycle. The reuptake of calcium by sarcoplasmic reticulum
produces relaxation that corresponds to the diastolic phase of the heart cycle (Standrings et
al., 2008).
Figure 2.2. Microstructure of the heart tissue.
2.5.3 Blood Circulation
Blood distributes nutrients, oxygen, hormones, etc. throughout the body as a result of
pumping action of the heart. It is this contraction of the heart which, together with the help of
great vessels and the complex network of the arteries, veins and capillaries, ensures an
efficient blood circulation. Pumping of the heart feeds a minor loop which takes blood
towards the lungs for oxygenation, constitute pulmonary circulation. While the major loop it
feeds, constitute systemic circulation for the distribution of the oxygenated blood. With few
limited exceptions the blood remains within these loops and does not usually leave the
circulation. This is what known as a closed type of blood vascular system.
During course of blood circulation the right atrium receives venous blood from
superior vena cava, inferior vena cave and the main venous inflow from the heart itself. The
venous blood enters the right ventricle through the atrioventricular orifice guarded by the
tricuspid valve. The contraction of the right ventricle forces the venous blood into the
pulmonary trunk through the pulmonary valve. The contraction of the right ventricle
particularly its apical trabecular component ensures closure of the tricuspid valve and
prevents blood to re enter in to the right atrium again. The left atrium receives all the
oxygenated blood coming from the lungs together with some coronary venous in flow.
Contraction of the left atrium causes the blood to enter left ventricle through the
atrioventricular orifice guarded by the mitral valve. The contraction of the left ventricle
rapidly increases pressure on its apical trabecular component which closes mitral valve. This
strong buildup of the pressure opens the aortic valve and ejects the blood into the aortic
sinuses and the ascending aorta. The blood is thus distributed to all parts of the body through
the arterial tree. The exchange of gases, nutrients and wastes then takes place at the level of
capillaries, after which the blood is again supplied back to the heart by venous system of our
body.
The complex vascular bed in the entire body generates a peripheral resistance which
helps us to know the reason for the massive structural organization of the left ventricle.
Although the ejection phase of the left ventricle is shorter than the right ventricle but the
pressure variation in the left ventricle is more than the right ventricle. So the heart be viewed
as far from a simple pumping organ (Standrings et al., 2008).
2.6 CARDIOVASCULAR DISEASES
The spread of heart disease is excessive in the developed world and spread of this
epidemic around the globe is also rapid (Lloyd-Jones et al., 2010). Among various factors
contributing to an increase in the prevalence of heart disease, diabetes is one of the major
contributors. Aging, obesity, and sedentary life style are some of the main factors that
contribute to a significant increase in the prevalence of diabetes.
2.6.1 Diabetes and Cardiovascular Diseases
In late 1800s it was recognized for the first time that diabetes is associated with
cardiac diseases (Gaede et al., 2003). Later, studies provided definite evidence of the role of
diabetes in HF and indicated the increased risk of HF in diabetics compared with the subjects
without diabetes (Kannel et al., 1974; Kannel & McGee, 1979). The cardiovascular
complications of diabetes have been reported to account for 80% of mortality in diabetics
(Amos et al., 1997) and are considered as one of the leading causes of deaths in diabetics
(Candido et al., 2003; Sowers et al., 2001; Mazzone et al., 2008). Hyperglycemia has also
been implicated to increase the mortality rate in patients of acute myocardial infarction. In
animal model diabetes has shown to enhance severity of acute myocardial infarction (AMI)
by causing an increase in infarct size and development of HF (Di Filippo et al., 2005; Frantz
et al., 2005; Liu et al., 2005; Marfella et al., 2004; Verma et al., 2002).
Diabetes induced damage to the cardiac muscle has been reported by both animal and
clinical data as mentioned above. The association of diabetes with some of the most known
risk factors for HF is established now. Among such risk factors include obesity,
hypercholestoremia, hyperlipidemia, hypertension, infarction, endothelial dysfunction,
coronary artery disease and activation of number of cytokine and cytokine system (Wang et
al., 2006) as depicted in Figure 2.3.
Although hypertension and coronary artery disease are mainly responsible for the
most of the myocardial abnormality such as LV hypertrophy and impaired contractility seen
in diabetics, the evidence of cardiomyopathy has been reported long ago to contribute to
myocardial dysfunction in absence of coronary artery atheroma (Fisher et al., 1986). The
development of DCM in the absence of established risk factors has also been recently
documented (Sarwar et al., 2010).
Figure 2.3. Some of the diabetes associated risk factors for HF. AGE: advanced glycation
end product. (Adopted from Wang et al., 2006).
2.6.2 Diabetic cardiomyopathy (DCM)
Rubler et al coined the phrase ― diabetic cardiomyopathy‖ and described diabetes as
the key factor that elicits changes at the cellular and molecular level and results in structural
and functional abnormalities of the heart (Rubler et al., 1972). Cardiomyopathy in type 1 or
type 2 diabetic patients is associated with a cluster of common features (Wang et al., 2006)
shown in Figure 2.4.
Figure 2.4. Interacting pathways of ROS production and injury in diabetic cardiomyocytes.
FFA: free fatty acid; FATP: free fatty acid transport protein; CPT-1: carnitine
palmitoyl transferase-1; AGE: advanced glycation end products; AT1R:
angiotensin 2 type 1 receptor; Glut: glucose transporter; SR: sarcoplasmic
reticulum. SRCA: sarcoplasmic reticulum Ca 2+-ATPase.(Adopted from Wang
et al., 2006).
The mechanisms at the molecular level which cause diabetic cardiomyopathy are
poorly known. The previous findings indicate that enhanced cardiac fibrosis (Tschope et al.,
2004; Westermann et al., 2007; Zhang et al., 2008) generation of ROS and cardiac
inflammation (Li et al., 2007; Tschope et al., 2005; Westermann et al., 2007) are some
important contributors leading to DCM. Enhanced dependence of diabetic cardiomyocyte on
fatty acid metablolism has been previously reported to be an uncertain but a suspect cause of
cardiomyopathy (Yagyu et al., 2003). This excessive dependence on fatty acid metabolism
can produce harmful effects on mitochondria (Di Paola & Lorusso, 2006) and one of the fatty
acid, palmitate has been described to induce apoptosis in cardiomyocytes (Sparagna et al.,
2004) and damage the contractile apparatus (Dyntar et al., 2001).
Hyperglycemia has been implicated in cardiomyopathy based on vast evidence
reported from diabetes type 1 and type 2 experimental models(An & Rodrigues, 2006). ROS
and AGEs comprise important components known to cause cellular injury as a result of
exposure to high glucose. The production of stable covalent modifications of proteins by
glucose or glucose metabolites leads to formation of AGEs. The protein adducts not only
contribute to ROS generation but can cause direct damages as well (Wang et al., 2006).
The recent studies also indicate hyperglycemia induced mitochondrial ROS to be a
major contributor in the development of DCM (Hayat et al., 2004 ; An & Rodrigues, 2006;
Boudina & Abel, 2010; Dobrin & Lebeche, 2010).
Pathology of DCM is characterized by myocardial damage, hypertrophy, tissue
fibrosis, structural and physiological changes of small coronary vessels, cardiac autonomic
neuropathy and disorder of the metabolic cardiovascular load. These modifications make it
difficult for the diabetic heart to recover from ischemic attack and increase its susceptibility
to ischemia. Arterial hypertension frequently coexists with and exacerbates cardiac
functioning, leading to the premature appearance of HF. (Voulgari et al., 2010).
In conclusion, the pathogenic contribution to the development of DCM includes
insulin resistance, increased formation of AGEs, Metabolic syndrome (MetS),
hyperglycemia, dyslipidemia, obesity, and presence of microangiopathy. Their interplay is
complex, since they can act in parallel and synergically and, at the same time, have a cause
and effect result. Thus, they should be equally predicted and effectively treated (Voulgari et
al., 2010). The contribution of the various factors in the development of DCM is depicted in
Figure 2.5.
Figure 2.5. The pathophysiological substrate of DCM: in diabetes, hyperglycemia, excess
FFA release, and insulin resistance, cause adverse metabolic events that affect
the cardiac myocytes. Hyperglycemia is associated with decreased glucose
transportation (GLUT), uptake, and oxidation, as well as increased formation of
AGEs and increased activation of protein kinase C (PKC). Excess FFA release is
followed by cardiac lipotoxicity, i.e. increased cardiac lipid accumulation and
increased generation of reduced ROS at the level of the electron transport chain.
Together with insulin resistance and impaired insulin action and signaling, these
metabolic paths augment vasoconstriction, produce and further aggravate arterial
hypertension, increase inflammation with liberation of leukocyte-attracting
chemokines, increase production of inflammatory cytokines, and augment
expression of cellular adhesion molecules. Thrombosis is further promoted,
together with platelet activation. (Adopted from Voulgari et al., 2010).
2.7 TREATMENT AND MANAGEMENT OF DCM
2.7.1 Life style
Obesity in both type 1 and type 2 diabetics is an important issue in the management
of DCM. Important management measures, therefore, include increase in physical activity,
reduction in fat consumption and total energy intake. These changes in life styles have been
shown to significantly reduce the incidence and magnitude of DCM (Guang et al., 2002; Hu
et al., 2004). Reduction in magnitude of DCM has also been reported following cessation of
smoking, which also reduces absolute risk of cardiovascular deaths in the diabetic subjects
compared with the non diabetics (Stamler et al., 1993; Kempler, 2005).
2.7.2 Glycemic Control
The UK Prospective Diabetes Study (UKPDS) indicates a reduction in risk for MI
and HF in type 2 diabetic patients following exposure to glycemia over time (UKPDSG,
2000). Good glycemic control thus represents another important approach towards
management of DCM. An analysis of multicenter, population based prospective study in
newly diagnosed type 2 diabetes patients, also indicates decrease in incidence of both risk for
myocardial infarction (MI) and DCM (Hanefeld et al., 1996; Meier & Hummel, 2009).
2.7.3 Dyslipidemia Treatment
Use of cholesterol lowering agents in diabetic patients is associated with a decrease in
incidence of coronary heart disease as indicated by a double-blind, randomized, placebo-
controlled, multicenter clinical trial study (Haffner, 1997). A similar study using gemfibrozil
also reported a decrease in incidence of DCM and major cardiovascular events in diabetic
patients (Robins et al., 2001).
2.7.4 Antihypertensive Treatment
The use of antihypertensive medicines to keep tight control of blood pressure (B.P.)
(<155/85mm Hg) in patients of hypertension has been reported to be associated with
decrease in cardiovascular risk and HF. A randomized control study indicates some 24%
reduction in cardiovascular risk related to diabetes and 56% reduction in risk of HF following
tight control of hypertension (UKPDSG, 1998). Another study employing strategy of
lowering B.P. in diabetic patients indicates reduction in fatal and nonfatal macrovascular and
microvascular complications (Holman, 1998).
2.8 SOME ADDITIONAL THERAPEUTIC STRATEGIES:
2.8.1 Apelin and Cardiac Output
In conditions of pressure overload such as DCM, apelin plasma levels have been
associated with compensatory mechanism to maintain cardiac output. In one such study
conducted in streptozotcin-induced diabetic rats the myocardial expression was found to be
down regulated as against its plasma levels after increase of pressure over load. Similar
findings were seen in diabetic patients in another parallel study (Falcão-Pires et al., 2010). So
apelin may represent a possible target for treatment of conditions due to pressure overload.
2.8.2 Kinins
The Kallikrein-kinin system (KKS) has been shown to protect from inflammation,
fibrosis, and apoptosis in myocardial disease. Kinins which are vasoactive peptides are part
of KKS and recent observations indicate their role in different aspects of remodeling,
inflammation and angiogenesis. Formation of new blood vessels, recruitment of EPCs in the
ischemic areas and endothelial dysfunction are some of the novel functions of KKS. The
KKS therefore has potential to treat DCM and myocardial ischemia (Savvatis et al., 2010).
2.8.3 Sarcoplasmic Reticulum Calcium ATPase (SERCA2)
It has been previously indicated that the reduction of SERCA2 expression plays a
significant role in the myocardial dysfunction of DCM (Rodrigues et al., 1998). A recent
study carried out in this perspective on streptozotocin induced male diabetic mice focused on
the activation of SERCA2 expression by administring resveratrol. The data demonstrate that
in DCM, where the expression of SERCA2 is reduced, resveratrol enhances the expression of
the SERCA2 and improves cardiac function (Sulaiman et al., 2010).
2.8.4 Antioxidants
Role of ROS in the development of DCM has been previously documented (Devereux
et al., 2000; Singh et al., 2001). ROS induced matrix metalloproteinase2 (MMP2) activation
has been implicated in conditions of acute loss of myocardial contractile functions. In a
recent in vivo study in STZ-induced diabetic rats the use of sodium selenate or pue Omega 3
fish oil with antioxidant vitamin E has demonstrated prevention of diabetes induced
functional changes. These agents could have therapeutic benefits in DCM (Aydemir-Koksoy
et al., 2009).
The suppression of mitochondrial oxidative stress and mitochondrion-dependent
myocardial apoptosis was aimed in another study with the administration of antioxidant α-
lipoic acid (α-LA) to check progression of DCM. In a streptozotocin-induced diabetic rat
model α-LA was administered (100 mg/ g i.p. per day) for 12 wee s. ntioxidant α-LA
effectively attenuated mitochondrion dependent cardiac apoptosis and exerted a protective
role against the progress of DCM. This activity of α-LA was concomitant with an increase in
manganese SOD activity and glutathione content of myocardial mitochondria (Li et al.,
2009).
2.8.5 Erythropoietin (EPO)
EPO is a hematopoietic cyto ine which was initially termed as ―hemopoietine‖. The
ability of EPO to stimulate erythropoiesis was first demonstrated in 1906 by the
revolutionary study of Carnot and DeFlandre. Recent studies indicate the presence of EPO
receptors (EPOR) on nonhematopoietic organs including heart (Parsa et al., 2003; Calvillo et
al., 2003). The direct involvement of EPO on cardiomyocytes has been strengthened by the
findings of EPOR on myocardial tissues of various species including man (Wright et al.,
2004; Deeping et al., 2005). The discovery prompted a keen interest of the researchers to
discern nonhematopoietic functions of EPO. This is evident from some recent studies which
demonstrate tissue protective effects of EPO and its role in prevention of vascular and tissue
damage in conditions of acute ischemia in different organs including heart (Ruschitzka et al.,
2000; Fliser & Haller, 2007; Lipsic et al., 2006). The protective role of EPO at the cellular
level involves multiple signal transduction pathways and is depicted in the figure 2.6. Recent
insights in to mechanism involved in cytoprotection of H9C2 cells, both perfused and in situ
rat hearts, reveal an upregulation of Akt, ERK1/2 and JAK1-STAT signal pathways (Parsa et
al., 2003; Bullard et al., 2005). Besides this EPO has been implicated in enhancing release of
nitric oxide (NO) which carries significance in prevention of cardiovascular diseases. NO
released, eNOS being the predominant form in the vascular system, from the intact
endothelial cells is known to cause vascular relaxtion and provide antiproliferative and
antithrombotic functions. Ruschitzka et al. (2000) generated transgenic EPO overexpressing
polyglobulic mice. These mice were observed for survival and cardiovascular functions to
determine role of NO. It was found that blood pressure, heart rate and cardiac output of
transgenic mice remained unaltered despite high hematocrit values as compared to the non-
transgenic littermates. The EPO overexpressing mice had a six fold increase in levels of
eNOS. The transgenic mice did not develop hypertension, MI, stroke or thromboembolism
apparently because of the constitutive expression of eNOS associated with high NO
bioavailability.
Figure 2.6. Signal transduction pathways involved in EPO mediated cytoprotection.
(Adopted from Maiese et al., 2008).
Initial findings in late 90s demonstrated protective role of EPO in ischemic brain
injuries (Sadamoto et al., 1998; Sakanaka et al., 1998). Protective role of EPO against
ischemia-reperfusion injuries of heart tissue was elucidated in number of subsequent studies
such as those carriedout by Calvillo et al. (2003) and Tramontano et al. (2003). Similarly
Moon et al. (2003) demonstrated reduction in infarct size following intravenous
administration of EPO (3000 I.U. /kg) at the time of coronary ligation in a myocardial
ischemia model. In an experimental setup of isolated perfused rat hearts, Cai et al. (2003)
reported improvement in left ventricular function and reduction in apoptosis of
cardiomyocytes 24 h after EPO administration. Four independent studies evaluating role of
EPO in post MI left ventricular dysfunction also confirm the useful effects of EPO on
microvascularization and cardiac function (Li et al., 2006; Hirata et al., 2006; Toma et al.,
2007; Prunier et al., 2007). EPO has been described to preserve cardiac function in cases of
chronic HF and myocardial ischemia largely by neovascularization and inhibition of
apoptosis (Ruifrok et al., 2008). Recently in a mice model of coronary ligation, EPO has
been shown to decrease infarct size, inhibit left ventricular remodeling, enhance angiogenesis
and improve cardiac function (Ueda et al., 2010).
Although the studies investigating role of EPO on heart under diabetic conditions are
limited, yet these indicate beneficial effects of EPO administration. In diabetic and non
diabetic subjects with severe and resistanat congestive HF, EPO administration has been
reported to decrease fatigue and increase LV ejection fraction. This improved the health
status of the patients and significantly increased their early discharge from hospital
(Silverberg et al., 2006). In vitro studies of Chong et al. (2007) report strong cytoprotective
effects of EPO which enhanced survival of endothelial cells (ECs) exposed to high glucose.
A recent study has focused on evaluating the role of EPO treatment in DCM and as claimed
represents first of its kind in demonstrating beneficial effects of a recombinant human EPO
(rHuEPO) treatment on chronic non-ischaemic cardiac tissue injury in mice diabeitic model.
Shushakova et al. (2009) have demonstrated that chronic rHuEPO treatment, in a mouse
model of diabetes exhibiting clinical features of DCM characterized by fibrosis and
contractile dysfunction inhibits cardiac fibrosis and protects cardiac tissue.
The findings mentioned above are clearly suggestive of beneficial effects of EPO in
different heart ailments and thus holds significance to treat diabetic HF.
2.8.6 Cellular Therapy
Reduction in number of cardiomyocytes is evident in many forms of both paediatric
and adult heart diseases. Repopulating such hearts with new cardiomyocytes can potentially
reverse cardiac diseases. Different approaches have been adopted in this respect. These
involve transplantation of skeletal myoblasts, cardiomyocytes, mobilization and
transplantation of stem cells (Rubart & Field, 2006). Recently the discovery of resident
cardiac stem cells has given a new insight into our understandings regarding regenerative
capability of heart (Bearzi et al., 2007).
Previous data indicate that bone marrow cells constitute a collection of stem and
progenitor cells and are most extensively studied in animal and clinical studies designed for
cardiac repair (Fazel et al., 2006; Haider & Ashraf, 2005). In addition endometrial stem cells,
circulating blood-derived progenitors, induced pluripotent stem cells, umbilical cord cells
and mononuclear cells are some of the diverse cell types which have also been proposed for
heart repair (Voulgari et al., 2010).
In the repertoire of bone marrow cells, MSCs represents a common source of adult
stem cells. Cardiomyognic differentiation of MSCs has been demonstrated in both in vivo
and in vitro studies (Shake et al., 2002; Toma et al., 2002; Wang et al., 2000). MSCs have
also been documented for their paracrine effects. The effects of media of MSCs culture has
been shown to be similar to MSCs therapy. Similarly in a murine model of hind limb
ischemia, enhancement of tissue repair was attributed to secretion of multiple cytokines such
as VEGF, FGF-2 and placental growth factor (PIGF) by MSCs (Kinnaird et al., 2004). Basic
characteristics of MSCs such as ease in acquisition, isolation, and expansion together with
low immunogenicity make them suitable for potential clinical applications (Mishra, 2008).
Extensive studies in animals and clinical studies conducted during the last decade
indicate the feasibility and potential of cell based therapy for cardiac repair (Anversa et al.,
2007; Sanchez & Garcia-Sancho, 2007) which can be potentially used in the treatment of
DCM to restrict consequences of decrease contractile functions and compliance of damaged
ventricles. Patients receiving stem cell therapy should be in early stage of HF. The therapy,
however, is not an alternate to heart transplantation and foremost objective is to avoid or
delay organ transplantation (Voulgari et al., 2010). Besides these limitations and the low
regenerative potential of human heart, the efforts to remuscularize the damaged heart are in
progress. Some of the main strategies employed for heart repair use adult stem cells and
pluriipotent stem cells, cellular reprogramming and tissue engineering which are expected to
treat or prevent HF in a better way (Laflamme & Murry, 2011).
2.8.7 Combining MSCs Transplantation and EPO Treatment
The ischemic myocardium has been described to be hostile environment for the
transplantation of MSCs and warrants strategies to improve its survival and engraftment
(Haider & Ashraf, 2008). Among various strategies include transplantation of MSCs
combined with EPO treatment. Previous studies have shown that the combined strategy
enhances efficiency of stem cells in different disease conditions. A study describes that EPO
can help in synergistic way with MSCs to enhance post ischemic neurogenesis (Esneault et
al., 2008). Similarly Zhang et al. (2006) demonstrated that EPO increases the therapeutic
potential of MSCs and improved angiogenesis and cardiac function. Recently Zhang et al.
(2007) have reported that combinating EPO and Intramyocardial delivery of bone marrow
cells effectively enhanced cardiac repair by reducing fibrotic area and enhancing capillary
density. Apart from its role in wide range of processes in cardiovascular pathophysiology, the
clinical trials involving use of EPO for the HF and renal failure reveal contradictory results
(Mastromarino et al., 2011). Moreover the literature survey indicates that studies which
could explore potential of EPO treatment for diabetic heart combined with MSCs
transplantation are missing.
The present study, therefore, aims to characterize the effects of preconditioning on
diabetes-impaired MSCs and evaluate the potential of EPO treatment for improvement in
cardiac status of the diabetic mice after transplantation of preconditioned MSCs. The
application of this combined approach for improvement in cardiac status of the diabetic mice
is viewed as a pioneer study of its type known to date and holds significance for future
strategies to treat diabetic HF.
CHAPTER 3
MATERIALS AND METHODS
3.1 Animals
The recommendations and procedural guide lines for the use and care of laboratory
animals were carefully observed throughout the experimental period as approved by the
Institutional Committee of the National Center of Excellence in Molecular Biology, Pakistan.
3.2 Mouse Model for Diabetes
Six to 8 weeks old C57BL/6 male wild-type mice were treated with intra peritoneal
injections of streptozotocin (55mg/kg) for five consecutive days to induce diabetes as
previously described (Leiter & McNeill, 1999). Owing to the rapid metabolization of
streptozotocin within 24 h mice were housed with absorbent bedding and given free access to
water and food. Blood glucose levels of mice were measured at day 16 after the first injection
and only those mice were included in the study that had blood glucose levels > 300mg/dL.
3.3 In vitro Study
3.3.1 Cell Culture
Isolation of MSCs was done from bone marrow as described earlier (Khan et al.,
2009). Cells were isolated from femur and tibia bones of 60-day diabetic C57BL/6 mice and
cultured in Iscove’s modified Dulbecco’s medium (IMDM) at 37°C in humidified air with
5% CO₂. IMDM used for cell culture was supplemented with streptomycin (100 µg/mL),
penicillin (100U/mL) and 20% fetal bovine serum (FBS). Non-adherent cells were removed
by changing the medium at 48 h post plating and then every 3 day afterward.
3.3.2 Flow Cytometry
MSCs of diabetic mice (N=6) were analyzed for CD34, CD45, CD44, CD90 and CD
105 by flow cytometry. MSCs were incubated with CD34PE, CD45FITC, CD44PE,
CD90FITC, and CD105FITC antibodies (BD Biosciences) for 30 min in dark at room
temperature. Specific fluorescence of 10,000 cells was examined by using Cell Quest Pro
software on FACScalibur (Becton Dickinson).
3.3.2 Preconditioning of Diabetic MSCs
IGF-1 and FGF-2 growth factors (Santa Cruz Biotechnologies) were selected for
preconditioning. The two growth factors were used in different concentrations alone as well
as in combination. This was followed by selection of an optimum preconditioning regimen
based on cell proliferation assay using XTT as per manufacturer’s instruction (Roche).
Briefly, the assay was carriedout in a 96-well plate. Some 4×10³ diabetic MSCs were plated
in each well containing IMDM supplemented medium in a humidified incubator at 37°C with
5% CO₂ and left overnight. Cells were preconditioned under serum free conditions with IGF-
1 and FGF-2 in different concentrations (ng/mL) for 1 h and cell proliferation was quantified
at 48 h by measuring absorbance values at 450 nm using Spectra max PLUS 384 (Molecular
Devices). Absorbance values at 650 nm were also taken as reference wavelength.
Corresponding experiments involved preconditioning of diabetic MSCs with vascular
endothelial growth factor (VEGF) (Santa Cruz Biotechnologies) which is also known for its
potential to protect from hyperglycemia. For this purpose cell proliferation with VEGF
preconditioning was quantified for proliferating cell nuclear antigen (PCNA) by real time
polymerase chain reaction on a 7500 Real-Time PCR system (Applied Biosystems).
3.3.3 Gene Expression Profiling of MSCs
The three groups of MSCs that included preconditioned diabetic MSCs, untreated
diabetic MSCs and normal MSCs were used for RNA extraction using trizole reagent
(Invitrogen Corporation). RNA samples were subsequently quantified by ND-1000
spectrophotometer (NanoDrop Technologies). Moloney Murine Leukemia Virus (M-MLV)
reverse transcriptase (Invitrogen Corporation) was used to synthesize cDNA from 1 µg of
RNA sample. cDNA samples were then used for reverse transcriptase-PCR (RT-PCR)
analysis for different proapoptotic, prosurvival, and cardiac markers which included IGF-1,
FGF-2, Akt, p16ᴵᴺᴷ⁴ᵃ, p66ˢʱᶜ, p53, Bax, Bak, GATA-4, and Nkx 2.5. RT-PCR analysis was
carriedout on a GeneAmp PCR system 9700 (Applied Biosystem) and glyceraldehydes 3-
phosphate dehydrogenase (GAPDH) was used as an internal control. The details of different
primers used with the description of their product size (bp) and sequences (5ˊ–3ˊ) have been
mentioned in Table 1. The RT-PCR products run on 2.5% agarose gel were quantified using
Quantity One ® 1-D Analysis Software, version 4.4 (Bio-Rad Laboratories, Inc.) as per
recommended guidelines with the quantity of the ladder (Fermentas) used as standard.
Table 1. List of primers, their product size (bp) and sequence 5´—3´.
Genes Product Size(bp)
Sequence (5´—3´)
GAPDH (f) 370 CTCTTGCTCTCAGTATCCTTG
GAPDH (r) GCTCACTGGCATGGCCTTCCG
β-Actin (f) 106 GCTGTGTTGTCCCTGTATGC
β-Actin (r) GAGCGCGTAACCCTCATAGA
IGF-1 (f) 166 AGGCTATGGCTCCAGCATTC
IGF-1 (r) AGTCTTGGGCATGTCAGTGTC
FGF-2 (f) 154 TGTCTATCAAGGGAGTGTGTGC
FGF-2 (r) CAACTGGAGTATTTCCGTGACC
Akt (f) 151 CCTCAAGAACGATGGCACCT
Akt (r) CAGGCAGCGGATGATAAAGG
p16ᴵᴺᴷ⁴ᵃ (f) 196 GCTCAACTACGGTGCAGATTC
p16ᴵᴺᴷ⁴ᵃ (r) TCGCACGATGTCTTGATGTC
p66ˢʱᶜ (f) 194 TGACTTCAATACCCGGACTCAG
p66ˢʱᶜ (r) TGAGGTTAAGGCTGCTGGTAGA
p53 (f) 157 AGCATCTTATCCGGGTGGAAG
p53 (r) CCCATGCAGGAGCTATTACACA
Bax (f) 152 TGGAGATGAACTGGACAGCA
Bax (r) CAAAGTAGAAGAGGGCAACCAC
Bak (f) 182 CAGGACACAGAGGAGGTCTTTC
Bak (r) TAGCGCCGGTTAATATCATCTC
Ang I (f) 143 GACACCTTGAAGGAGGAGAAAG
Ang I (r) GTGTCCATGAGCTCCAGTTGT
VEGF (f) 200 ACCCCGACGAGATAGAGTACAT
VEGF (r) CTTCTAATGCCCCTCCTTGT
PCNA (f) 720 GGTTGGTAGTTGTCGCTGTA
PCNA (r) CAGGCTCATTCATCTCTATCG
GATA-4 (f) 197 CCTCTCCCAGGAACATCAAA
GATA-4 (r) ACCCATAGTCACCAAGGCTG
Nkx 2.5 (f) 147 GGTCTCAATGCCTATGGCTAC
Nkx 2.5 (r) GTTCACGAAGTTGCTGTTGG
3.3.4 Hypoxic Stress
Diabetic MSCs (both untreated and preconditioned) were exposed to hypoxic stress
with H₂O₂ (100 µM) in serum free medium for 90 min followed by 1 h recovery in serum-
supplemented medium. After the recovery period the two sets of diabetic MSCs were
analyzed for parameters such as superoxide dismutase (SOD) activity, apoptosis, in vitro tube
forming ability, and chemotactic attraction to evaluate the effects of preconditioning.
3.3.5 Superoxide Dismutase (SOD) Assay
SOD activity helps cells to cope with the oxidative stress. The two sets of MSCs
(both untreated and preconditioned) were analyzed for SOD activity using SOD activity
colorimetric assay kit (Abcam) as per recommended protocol. Briefly, after 24 and 48 h of
recovery period the cells of the two sets of MSCs were lysed with lysis buffer. SOD activity
from 10 µg samples of the total protein extract was measured by taking absorbance values at
450 nm using Spectra max PLUS 384 (Molecular Devices).
3.3.6 Apoptosis
Flow cytometric analysis for number of apoptotic cells in the two sets of diabetic
MSCs (untreated and preconditioned) was carriedout on FACScalibur (Becton Dickinson)
using fluorescein isothiocyanate (FITC) Annexin-V it as per manufacturer’s instructions
(Abcam).
3.3.7 In vitro Tube-forming Assay
Matrigel was first thawed on ice to avoid premature polymerization before plating.
Then to a pre-cooled 48-well tissue culture plate (Corning), aliquots of 50 µL matrigel were
plated into each well. The culture plate was then placed in an incubator at 37°C for about 30
minutes for polymerization of the matrigel. The two sets of diabetic MSCs (untreated and
preconditioned) were trypsinized with trypsin / Ethylene diamine tetra acetic acid (EDTA)
and plated on matrigel-coated wells at 1.5×10⁴ cells/well. The cells were incubated at 37°C
in 5% CO₂ and examined under a phase-contrast microscope (IX-51 Olympus) at 6, 24, and
48 h to evaluate the effect of preconditioning on development of tube like structures.
3.3.8 Chemotactic Attraction
Preconditioning effect on mobilization of diabetic MSCs towards chemotactic signals
was studied as described earlier (Kucia et al., 2004). Briefly, to a 6-well transmembrane
culture plate (Costar) 2 mL of serum free medium was added in the lower chamber and
supplemented with 50ng/mL of stromal cell-derived factor-1α (SDF-1α; Upstate
Biotechnology). The wells without SDF-1α supplementation containing serum free medium
alone served as control. Diabetic MSCs (both untreated and preconditioned) in concentration
of 5×10⁴ cells/well were plated on the upper chamber after hypoxia treatment and examined
at 24 h for migration towards SDF-1α. The migrated cells were stained with 4´, 6-diamidino-
2- phenylindole (DAPI) and counted in 10 high power fields using an inverted microscope
IX-51 (Olympus).
3.3.9 Glucose Stress
To analyze the effect of preconditioning on the ability of diabetic MSCs to tolerate
hyperglycemia, diabetic MSCs (untreated and preconditioned) were given exposure to high
glucose stress (30 mmol/mL) for 1 h under serum free conditions followed by 1 h recovery in
serum supplemented medium. RNA extracted from the representative groups were used for
Quantitative PCR (qPCR) analysis of mRNA expression of Ang-I, VEGF, and p16ᴵᴺᴷ⁴ᵃ in a
reaction volume of 25 µL using Maxima SYBR Green qPCR Master Mix (Fermentas) on
IQ5 Multi color Real-Time PCR Detection System (Bio-Rad).
3.4 In vivo Study
3.4.1 Diabetic Mouse Model
Diabetes was induced in C57BL/6 male mice using streptozotocin as mentioned
previously. Mice at 40 days being diabetic were included in the study for EPO treatment and
transplantation experiments with age and sex match animals as control were carriedout.
3.4.2 EPO Treatment
In the first phase of the experiments recombinant human EPO (Cheil Jedang
Corporation) alone was used to assess its effects on diabetic myocardium. The mice were
divided into three groups (N=6). These included normal control (group -1), diabetic untreated
(Group-2) and diabetic EPO-treated (Group-3). The mice in the treated group were given
injections (1000 IU/Kg i.p.) of EPO for five consecutive days while control and untreated
groups received injections of normal saline. On day six mice were euthanized and tissue
procurement carried out for subsequent RNA extraction and histological studies.
3.4.3 Transplantation and EPO Treatment
In the second phase of experiments, transplantation of MSCs was done. The mice
were divided into six groups (N=6). Four non-transplanted groups of mice included normal
mice (Group-1), sham operated diabetic mice (Group-2), the diabetic mice injected with
normal saline (Group-3) and the diabetic-EPO treated mice (Group-4). The remaining three
groups included diabetic mice transplanted with untreated MSCs (Group-5), diabetic mice
transplanted with preconditioned MSCs (Group-6) and the diabetic mice transplanted with
preconditioned MSCs and given EPO treatment (Group-7). Some 20,000 MSCs (both
untreated and preconditioned) at passage-1 from sixty days diabetic GFP transgenic male
mice were transplanted at two random sites in the left ventricles of the respective non GFP
groups of diabetic mice (Group-5, 6 & 7) using a 30G syringe. The group-3 mice received
injections of normal saline only while EPO treatment for five consecutive days was given to
the mice of group-4 and group-7. Four weeks following transplantations functional analysis
of the heart was done using Millar apparatus and hearts of the euthanized mice from different
groups examined for MSCs homing and tissue fibrosis.
3.4.4 RNA Extraction and cDNA Synthesis
Freshly isolated hearts of the euthanized mice were dissected to separate left
ventricles of different treatment groups. RNA extraction was then carried out from 50mg of
LV heart tissues using Trizole reagent and quantified using ND-1000 spectrophotometer. 1
µg RNA from respective samples was used to synthesize cDNA using M-MLV reverse
transcriptase.
3.4.5 Gene Expression Study
RT-PCR was carried out for IGF-1 using GeneAmp PCR system 9700 (Applied
Biosystem) with β-actin as internal control. The gene specific primers (Table 1) were used
under PCR conditions of initial denaturation at 95°C for 5 min, 35 cycles of denaturation at
95°C for 45 sec, annealing at 60°C (IGF-1) and 58°C (β-actin) for 45 sec, extension at 72°C
for 45 sec, and final extension for 10 min at 72°C.
Quantitative RT-PCR was done for mRNA expressions of Bax and p16INK4a
using
7500 thermal cycler (Applied Biosystem). The 20uL reaction mixture (triplicate) was made
using maxima sybr green (Fermentas) and cDNA amplified using gene specific primers
(Table.1). Amplification conditions were same as described for RT-PCR with annealing
conditions at 58°C and 60°C for Bax and p16INK4a
respectively. β-actin was kept as internal
control and normalized gene expression analysis carried out using 7500 System SDS
software (version 1.3.1).
3.4.6 Tissue Procurement for Histological Studies
For paraffin sections the hearts of the euthanized mice were first perfused while for
cryo-sections the hearts were freshly isolated and rapidly frozen in liquid nitrogen. The
isolated hearts were cut into three sections representing its apex, middle and base. The
middle sections were then undertaken for the respective processing procedures.
Briefly, for paraffin sections, the middle sections were fixed in 4% paraformaldehyde
(PFA) and then dehydrated in increasing ethanol grades (70%, 80%, 95% and 100%). This
was followed by clearing step in xylene. The sections were then placed in liquid paraffin at
70°C for 30 minutes twice and then embedded. 5µM thick sections were made using
microtom machine (HM-340E, Microm Inc.USA). For cryo-sections, sections were first
embedded in Tissue-Teck OCT (Sakura Torrance, CA, USA) then rapidly frozen in liquid
nitrogen. The tissue sections were kept frozen at -20°C until sectioning was done using
cryostat (Microm) at -20°C on tissue treated slides. 5µM thick sections were then processed
for tunel assay and immunostaining.
3.4.7 Tunel Assay
To assess LV myocardial cell apoptosis frozen serial sections 5µm thick from group-
1, 2&3 of EPO treatment experiments were subjected to tunel staining. Briefly sections were
first washed in PBS for thirty minutes and fixed for 10 minutes by 4% PFA. The sections
were labeled with TUNEL as per protocol provided by the manufacturer (Millipore). After
incubation with Avidin-FITC for 30 minutes in dark, the sections were counterstained with
DAPI (Tuo et al., 2008). Apoptosis was quantified by counting tunel positive cells in the left
ventricle at six random sites per slide in sets of three slides per treatment group and average
taken.
3.4.8 Immunostaining for eNOS
The frozen ventricular tissue sections of the above mentioned treatment groups of the
EPO experiment were air dried and washed with PBS for 5 minutes followed by fixation in
ice cold methanol for 15 minutes. The sections were then treated with normal serum specific
to secondary antibody at room temperature for 30 minutes. Sections were incubated
overnight at 4°C with a rabbit polyclonal anti eNOS antibody (1: 100 dilution, Abcam plc.
Cambridge, UK) in blocking serum. Sections were then incubated with a rhodamine
conjugated anti-rabbit IgG for 1 h. This was followed by counterstaining with DAPI and
mounting using Vectashield (Vector Labs). Images of LV sections of the respective treatment
groups at six random fields in triplicate per treatment groups were taken using an inverted
microscope IX-51 (Olympus).
3.4.9 Detection of Stem cells in LV Tissue
The frozen heart sections of the different transplanted groups (Group-5,6&7) were
analyzed for homing of transplanted stem cells. The frozen sections were stained with DAPI
and visualized for homing of GFP⁺ stem cells in the left ventricular tissue using inverted
microscope IX-51 (Olympus). Six random fields in set of three per treatment groups were
selected and an average count of GFP⁺ stem cells made.
3.4.9.1 Sirius Red Staining
Paraffin embedded serial sections of the two control non-transplanted (Group-1 & 2)
and the three transplanted (Group-5, 6&7) groups in the transplantation experiments were
analyzed for fibrosis by Sirius red staining. Before rehydration step the slides were baked at
60°C for 1 h followed by the xylene clearing step. The slides were then passed through
graded ethanol (100%, 95%, 85%, 75%, 60%, and 50%) into distilled water. A saturated
picric acid solution with 0.1% Sirius Red (Aldrich Chemicals) was used to stain the slides for
overnight. Slides were then washed for two minutes in 0.01 N HCl and quickly dehydrated
in graded ethanol. After passing through xylene slides were coverslipped in mounting
medium (Grimm et al., 2003). The slides were visualized for collagen accumulation and
images taken using inverted microscope IX-51 (Olympus) equipped with a digital camera
DP-71 (Olympus). Images from six random fields in set of three per treatment groups were
then analyzed for percentage of fibrosis in left ventricular tissue by image J software.
3.4.9.2 Millar Analysis
Hemodynamic parameters of the mice in the different treatment groups (Group 1―6)
of transplantation experiment were taken using a Millar microtip pressure transducer. Briefly,
mice were intubated after anesthetizing with Pentobarbital sodium (55 mg g−1) and
ventilated with room air by using MiniVent (type 845, Harvard Apparatus). The breathing
rate of mice was maintained at 95 breaths per minute and body temperature kept at 37°C
during the procedure. The catheter was advanced into the left ventricle through the right
carotid artery. Pressure volume loops were observed on the chart recorder and the data
recorded in the closed chest preparation (Limana et al., 2002; Leri et al., 2003; Anversa et
al., 2002; Pacher et al., 2008). The parameters assessed included maximum pressure, end
systolic pressure, stroke volume and ejection fraction.
3.5 Statistical Analysis
Analysis of data for different experiments such as cell proliferation, densitometry,
SOD activity, apoptosis, chemotactic ability, real time PCR, homing of GFP positive MSCs
and tissue fibrosis, was performed using Student’s unpaired t-test (p value of <0.05 was
considered statistically significant) and all the data are expressed as mean ± standard error of
the mean except for homing studies where expressed as +SD.
CHAPTER 4
RESULTS
4.1 In vitro Studies 4.1.1 Characterization of MSCs
The study included mice at diabetic day 60 with blood glucose levels above
300mg/dL (Fig. 4.1).
Figure 4.1. Mouse model of diabetes. Streptozotocin induced changes in blood glucose levels
of C57BL/6 wild-type mice till 60 days. (STZ: streptozotocin).
MSCs from mice at diabetic day 60 were isolated, cultured and analyzed for stem cell
markers by flow cytometry. The analysis revealed that MSCs were positive for CD44
(97.7%), CD90 (95.4%), and CD105 (92.3%) and negative for CD34 (1.4%) and CD45
(0.8%) (Fig. 4.2 ―E).
FLOW CYTOMETRY
Figure 4.2. Flow cytometry of diabetic MSCs: (A–C) diabetic MSCs positive for CD44,
CD90, and CD105 and (D-E) negative for CD45 and CD34 (hematopoietic
markers).
4.1.2 Stimulation of Cell Proliferation in Preconditioned Diabetic MSCs
IGF-1 & FGF-2 were used alone and in combination in different concentrations to
precondition diabetic MSCs. The best cytokine regimen was selected on the basis of cell
proliferation measured after 48 h of preconditioning. The preconditioning of diabetic MSCs
with IGF-1/FGF-2 in combination at 50ng/mL each showed the highest cell proliferation
(1.61±0.11) as against of untreated cells (0.92±0.08). Cell proliferation figures of 1.10±0.11,
1.35±0.12, 1.37±0.05, 1.44±0.07 and 1.38±0.09 were observed for preconditioning with 50
ng/mL IGF-1, 50 ng/mL FGF-2, 100 ng/mL IGF-1, 100 ng/mL FGF-2, and combination of 1
ng/mL FGF-2, and 50 ng/mL IGF-1 respectively (Fig. 4.3A). The growth factors regimen
showing highest cell proliferation was thus represented by 50ng/mL each of IGF-1 & FGF-2
in combination and used as the preconditioning strategy for subsequent experiments.
Figure 4.3A. Cell proliferation after preconditioning of diabetic MSCs. All values were
expressed as mean±standard error of the mean; *P<0.05 versus untreated
diabetic cells.
Cell proliferation of diabetic MSCs based on PCNA expression was also determined
after preconditioning with VEGF (50ng/mL) and compared with IGF-1/FGF-2 (50ng/mL
each) preconditioning. The PCNA expression in the two preconditioned groups as quantified
by qRT-PCR showed a significantly higher PCNA expression in the IGF-1/FGF-2 (50ng/mL
each) group compared to that of VEGF (50ng/mL) (Fig. 4.3B).
Figure 4.3B. Analysis of cell proliferation for (PCNA) expression comparing VEGF and
IGF-1/FGF-2 preconditioning of diabetic MSCs.
4.1.3 Gene Expression Profiling of MSCs
The two sets of diabetic MSCs, one preconditioned with VEGF and the other with
IGF-1/FGF-2 were compared with the normal and diabetic untreated MSCs for the gene
expression profiling. The analysis revealed a down regulation of prosurvival markers (IGF-1,
FGF-2, and Akt) and an upregulation of senescent (p16ᴵᴺᴷ⁴ᵃ, p66ˢʱᶜ, and p53), and apoptotic
markers (Bax and Bak) in the diabetic untreated MSCs compared with MSCs from normal
animals (Fig. 4.4A&B). Improvement in gene expression profiling of diabetic MSCs was
observed after preconditioning with both VEGF (50ng/mL) and IGF-1/FGF-2 (50ng/mL
each). Low levels of prosurvival (IGF-1, FGF-2, and Akt) and differentiation markers
(GATA-4 and Nkx 2.5) observed in the diabetic untreated MSCs significantly increased after
preconditioning. Whereas high levels of apoptotic markers (Bax and Bak) in the diabetic
untreated MSCs significantly reduced after preconditioning. A similar reduction in the
expression levels of senescent markers (p16ᴵᴺᴷ⁴ᵃ, p66ˢʱᶜ and p53) was also observed in the
preconditioned diabetic MSCs compared with the diabetic untreated MSCs. Gene expression
results after VEGF and IGF-1/FGF-2 based preconditioning of diabetic MSCs differed
significantly and IGF-1/FGF-2 preconditioning appeared better than VEGF. (Fig. 4.4C&D).
Densitometry of the gel was performed for quantification of bands and analysis made
accordingly (Fig. 4.4E).
Figure 4.4A-D. Gene expression profiling of MSCs. (A) Normal MSCs; (B) diabetic
untreated MSCs; (C) diabetic MSCs preconditioned with VEGF; (D)
diabetic MSCs preconditioned with IGF-1/FGF-2.
Figure 4.4E. Quantification of gene expression profiling of MSCs. The difference between
gene expression in IGF-1/FGF-2-preconditioned versus VEGF-preconditioned
MSCs was significant; *P<0.05. Quantification of gels was done as per
recommended guidelines in the user manual using Quantity One-1-D Analysis
Software, version 4.4 (Bio-Rad Laboratories, Inc.). Ladder band was used as a
standard. The results of PCNA expression and gene expression profiling data clearly indicated
IGF-1/FGF-2 combination to be better than VEGF treatment. So this treatment regimen was
selected for preconditioning of diabetic MSCs in all subsequent experiments. The
preconditioning of MSCs, therefore, would refer to treatment of MSCs with 50 ng/mL each
in combination.
4.1.4 Increased SOD Activity in Preconditioned MSCs
SOD activity increased significantly in the preconditioned MSCs (52.3% ±2.0%,
P<0.05) after 24 h of hypoxia treatment compared with the untreated diabetic MSCs
(36.9%±3.1%). Although SOD activity showed a decline after 48 h of hypoxia treatment in
both sets of MSCs, nevertheless the SOD activity was significantly higher in the
preconditioned MSCs (32.2% ±2.5%) compared with the untreated diabetic MSCs (23.1%
±2.2%). SOD activity measured under normoxic conditions in the MSCs from normal and
diabetic animals was used as a standard (Fig. 4.5).
Figure 4.5. Comparison of SOD activity among normal, diabetic untreated and diabetic
preconditioned MSCs under normoxia and hypoxia. Under normoxia, a high
SOD activity was observed in MSCs from normal animals compared with
MSCs from diabetic. Under hypoxia, a significant increase in SOD activity was
seen in the preconditioned diabetic MSCs compared with the untreated diabetic
MSCs at 24 h followed by a decline in both sets of MSCs at 48 h. * and **
represents comparison between diabetic preconditioned and diabetic untreated
MSCs at 24 and 48 h, (P<0.05 considered significant). 4.1.5 Effect of IGF-1 and FGF-2 Preconditioning on Apoptosis
A significant reduction in number of apoptotic cells was observed in the
preconditioned diabetic MSCs (51.8% ± 2.3%) compared with the untreated diabetic MSCs
(76.2% ± 1.8%) after hypoxia treatment as determined by flow cytometry for annexin-V (Fig.
4.6). The figure under normoxic conditions in both sets of diabetic MSCs was 17.2% ± 3.3%
and 31.5% ± 2.4% respectively.
Figure 4.6. Flow cytometry for annexin-V-positive cells. Preconditioned MSCs showed a
reduction in annexin-V positive cells compared with untreated cells. All values
were expressed as mean±SEM and (*P<0.05).
4.1.6 Chemotactic Ability of Preconditioned Diabetic MSCs
The mobilization of diabetic MSCs (both untreated and preconditioned) towards
chemotactic signals from SDF-1α under hypoxic stress was analyzed. The analysis revealed
that preconditioned diabetic MSCs showed a significantly high mobilization number
(73.9±5.3, P<0.05) towards SDF-1α compared with the untreated diabetic MSCs (31.9±5.9)
(Fig. 4.7). Wells with serum free medium alone without SDF1-α supplementation and
containing both sets of MSCs were considered as control.
Figure 4.7. Mobilization of untreated and preconditioned MSCs to SDF-1α.
A significantly high mobilization of preconditioned MSCs to SDF-1α seen as
compared to untreated MSCs. All values were expressed as mean±SEM. *P<0.05.
4.1.7 In vitro Tube-forming Ability in Diabetic MSCs
In vitro tube forming ability of both sets of diabetic MSCs (untreated and
preconditioned) was studied under both normoxia and hypoxia. It was evident from the
results that the preconditioned diabetic MSCs exhibited better tube forming ability under
both hypoxia and normoxia compared with the untreated diabetic MSCs (Fig. 4.8). In
addition, the ability of preconditioned diabetic MSCs to form tubular structure was much
better under hypoxia compared to normoxia (Fig. 4.8A&C).
Figure 4.8A-D. Preconditioned MSCs (A&C) demonstrate better tube-forming ability than
untreated cells (B&D) under conditions of both normoxia and hypoxia
(100×; Scale bar: ˜20 µm).
The quantification of tube formation in both sets of MSCs further confirmed the
enhanced angiogenic ability of the preconditioned diabetic MSCs compared with the
untreated diabetic MSCs (Fig. 4.8E).
Figure 4.8E. Quantification of tube forming cells under hypoxic and normoxic conditions.
MSC, mesenchymal stem cell. 4.1.8 Real-time RT-PCR Gene Expression after Glucose Stress
A real-time RT-PCR analysis of two angiogenic markers (Ang-1 and VEGF) and a
senescent marker (p16ᴵᴺᴷ⁴ᵃ) in two sets of diabetic MSCs (untreated and preconditioned) was
performed under conditions of high glucose (HG) stress. The preconditioned diabetic MSCs
showed an increase in gene expression of Ang-1 and VEGF and a decline in the expression of
p16ᴵᴺᴷ⁴ᵃ gene compared with the untreated diabetic MSCs (Fig. 4.9).
Figure 4.9. Real-time RT-PCR gene expression analysis under conditions of HG stress.
4.2 In vivo Studies
4.2.1 Effect of EPO Treatment on Gene Expression of Diabetic Heart
In EPO treatment experiments without transplantation of MSCs, the quantitative RT-
PCR results showed a significant decrease in the left ventricular mRNA expressions of Bax
and p16ᴵᴺᴷ⁴ᵃ in the diabetic EPO treated group (Group-3) as compared to the diabetic
untreated group (Group-2). Bax and p16ᴵᴺᴷ⁴ᵃ mRNA expressions of the control normal group
(Group-1) were less than both the previous groups (Fig.4.10A).
RT-PCR based Left ventricular mRNA expression of IGF-1 was better in the EPO
treated group as compared to the untreated diabetic group. The control normal group showed
high expression than both of these groups (Fig. 4.10B).
Figure 4.10. Left ventricular mRNA expression of Bax, p16ᴵᴺᴷ⁴ᵃ and IGF-1 in different
treatment groups of C57BL/6 male mice. A. Real time RT-PCR and B. RT-
PCR. (*p<0.05 vs. diabetic untreated).
4.2.2 Decreased Myocardial cell Apoptosis
Concomitant to the real time RT-PCR results for expression of bax, tunel assay for
apoptosis performed on LV cryosections revealed a significant decrease in myocardial cell
apoptosis in the EPO treated group (4±0.3) compared with the untreated group (8±0.5).
Apoptosis was significantly less in the normal heart sections (1±0.3) compared with both the
untreated and EPO treated groups (Fig.4.11).
Figure 4.11. A.TUNEL assay for apoptosis in left ventricular heart sections (40 X) of
different treatment groups of C57BL/6 male mice. B. Number of apoptotic cells
per random field in respective heart sections. (*p<0.05).
4.2.3 Enhancement of eNOS Expression
Expression of eNOS, a constitutive form of nitric oxide synthase expressed in the
endothelial cells, was found to be decreased in the diabetic group compared with the control
normal group. The expression of eNOS in the diabetic myocardium was found to be
increased after EPO treatment (Fig. 4.12).
Figure 4.12. Expression of eNOS in the left ventricular heart sections (20 X) of different
treatment groups of C57BL/6 male mice.
The treatment of diabetic mice with EPO alone indicated an improvement in the
microenvironment of the diabetic heart. This was shown by a decrease in myocardial cell
apoptosis and an increase in expression of prosurvival marker (IGF-1) and eNOS. In the light
of the beneficial effects of preconditioning on diabetic MSCs mentioned earlier,
transplantation studies were performed which employed a combined strategy of transplanting
preconditioned diabetic MSCs in to the left ventricle of diabetic heart followed by EPO
treatment in vivo.
4.3 Transplantation Studies
4.3.1 Homing of MSCs
GFP positive (GFP⁺) MSCs (Both untreated and preconditioned) transplanted in left
ventricle of various transplantation groups of diabetic mice were studied for homing. A
significant number of GFP⁺ cells were observed in the mice transplanted with preconditioned
MSCs (Group-6) compared with that of diabetic untreated MSCs (Group-5) (Fig. 4.13 A, B).
Additional improvement in homing was observed in the diabetic mice transplanted with the
preconditioned MSCs and given EPO treatment (Group-7) compared with the previous two
groups (Fig. 4.13C). The diabetic myocardium transplanted with untreated diabetic MSCs
contained 12±1.5 GFP positive cells, followed by 25±2.0 in the preconditioned MSCs and
45±3.5 in the diabetic preconditioned MSCs and EPO-treatment group (Fig. 4.13 D).
Figure 4.13. A-C. Homing of GFP-positive MSCs in Left ventricular heart sections (40 X) of
different treatment groups of C57BL/6 male mice. D. Number of GFP positive
cells, all values were expressed as mean standard deviation of the mean;
*P<0.05 versus untreated diabetic group.
4.3.2 Reduction in Tissue Fibrosis
Paraffin embedded sections (LV) of various transplanted groups stained with Sirius
red staining showed reduction in fibrosis percentage (Fig.4.14 A-E). Maximum fibrosis
(14.75%±1.75%) was noted in the diabetic heart without transplantation. This was followed
by the group transplanted with untreated MSCs (13.16±0.5%), diabetic group transplanted
with the preconditioned MSCs (10.59%±1.25%) and the diabetic group transplanted with
preconditioned MSCs and given EPO treatment (6.67%±0.25%).
Figure 4.14. A-E. Fibrosis as seen in left ventricle heart sections(40 X) of different treatment
groups of C57BL/6 male mice by sirius red staining. F. Percentage of collagen
accumulation in LV sections (A-E) of different treatment groups (* p<0.05).
4.3.3 Hemodynamic Parameters
Hemodynamic parameters of diabetic mice of various treatment groups in the
transplantation experiments were analyzed by Millar analysis. Millar analysis of normal
(group-1) and diabetic mice (group-2) without transplantation of MSCs were performed and
considered as standard. The analysis between the two groups (group-1 & group-2) for
parameters such as maximum pressure, end systolic pressure, stroke volume, and ejection
fraction showed an obvious impairments in the diabetic group compared with the normal
mice group. The heart functions of diabetic mice however increased significantly after EPO
treatment alone (Group-4) (Table 2).
The Millar analysis of the transplanted groups for the aforesaid cardiac parameters
revealed that the group-7 (Diabetic mice transplanted with the preconditioned MSCs and
given EPO treatment) showed the highest improvement in the heart functioning of diabetic
mice followed by group-6 (diabetic mice transplanted with the preconditioned MSCs)
compared with the group of diabetic mice transplanted with untreated MSCs (Group-5)
(Table 2).
Table 2. Cardiac parameters as determined by Millar analysis in different treatment groups of
C57BL/6 male mice. All values were expressed as mean±standard error of the mean;
NS; Normal saline group. UT; Untreated. Pre; Preconditioned.
CHAPTER 5
DISCUSSIONS
Among various types of stem cells used to repair injured myocardium, MSCs derived
from BM represent the most common type used for this purpose (Ohnishi et al., 2007; Song
et al., 2009). The potential of MSCs to repair damaged heart has been highlighted in some
recent studies and constitute an important area of research for the treatment of diabetic HF
(Zhang et al., 2008; Abdel Aziz et al., 2008; Dong et al., 2008; Paul et al., 2009; Li et al.,
2010; Jin et al., 2011). However, hyperglycemia can affect their reparability by forcing stem
cells into early aging (Rota et al., 2006) and could severely undermine the outcome of stem
cell based therapies for HF. So the present study intended to delineate the effects of diabetes
on MSCs derived from bone marrow and augment the function of diabetes-impaired MSCs
using a preconditioning strategy.
The RT-PCR results indicated a downregulation of survival markers (IGF-1, FGF-2,
Akt) and a high expression of senescent (p16ᴵᴺᴷ⁴ᵃ, p66ˢʱᶜ, p53) and apoptotic (Bax, Bak)
genes in the diabetic MSCs compared with the MSCs form normal animals. These findings
highlight diabetes-induced impairment of MSCs and are in agreement with the previous
reports which also describe that hyperglycemia can cause stem cell dysfunction (Awad et al.,
2005; Ohnishi et al., 2007). Rota et al. (2006) for instance, reported that diabetes increases
the expression of p16ᴵᴺᴷ⁴ᵃ, p66ˢʱᶜ, and p53 and can promote apoptosis in stem cells. A
negative correlation between senescent and prosurvival markers as documented previously
(Pons et al., 2008) also helps explain our present findings in the diabetes affected MSCs.
A preconditioning strategy employing growth factors was adopted to enhance the
functioning of diabetic MSCs. The IGF-1/FGF-2 growth factors in combination (50ng/mL
each) represented the best preconditioning regimen as determined by the cell proliferation
assay (Fig. 4.3A). This was also reflected in the results of gene expression profiling where
preconditioning of diabetic MSCs with IGF-1/FGF-2 significantly upregulated the
prosurvival markers (IGF-1, FGF-2, Akt), and downregulated the senescent (p16ᴵᴺᴷ⁴ᵃ, p66ˢʱᶜ,
p53) and apoptotic markers (Bax, Bak). The preconditioning also resulted in a significant
increase in the expression of early cardiac differentiation markers (GATA-4, Nkx2.5) in the
preconditioned diabetic MSCs compared with the untreated diabetic MSCs (Fig. 4.4). The
selection of IGF-1/FGF-2 growth factors to precondition diabetic MSCs was a key factor for
this remarkable cellular response. Owing to the known role of IGF-1 in survival pathways
(Anversa, 2005) IGF-1 has been in extensive use to enhance stem cell function (Li et al.,
2007; Lu et al., 2009). The previous data on FGF-2 indicate its role in promoting expression
of early cardiac differentiation markers (Degeorge et al., 2008), cell proliferation (Choi et al.,
2008) and suppressing cellular senescence (Ito et al., 2007). Therefore, the use of this novel
combination of IGF-1/FGF-2 resulted in an increase in cell proliferation, the expression of
survival genes and more importantly caused a decline in expression of the senescent genes.
Owing to the multifunctional attributes ascribed to VEGF (Tong et al., 2006), a
parallel treatment option of preconditioning diabetic MSCs with VEGF (50ng/mL) was also
used. The rationale behind this strategy was to compare the two treatment options (IFG-
1/FGF-2 vs. VEGF preconditioning) and select the better one. The diabetic MSCs did show
improvement in cell senescent state, cell survival signaling and proliferation after VEGF
preconditioning but these effects were less than the overall effects of IFG-1/FGF-2 based
preconditioning (Fig. 4.4). IGF-1/FGF-2 preconditioning was hence identified as a better
treatment option to enhance the functionality of MSCs under hyperglycemia and used for
further analysis in subsequent sets of experiments.
Hypoxic and high glucose insults given to the preconditioned MSCs formed the basis
of these subsets of experiments in a way to imitate microenvironment of the diabetic heart.
Preconditioned diabetic MSCs showed a significant improvement in SOD activity under
conditions of hypoxic stress compared with the untreated diabetic MSCs exhibiting low SOD
activity (Fig. 4.5). In a recent study Stolzing et al. (2008) reported that SOD activity depends
on ROS levels and is affected by the donor age. ROS levels tend to become high in diabetes
(Ohshima et al., 2009) and this may have caused the low SOD activity observed in the
diabetic MSCs. ROS generation in hyperglycemia is also well documented to cause stem
cells susceptibility to apoptosis, and necrosis (Fiers et al., 1999) and impairs the angiogenic
ability of cells (Ebrahimian et al., 2006). In concordant with these findings diabetic MSCs
showed a high number of apoptotic cells and reduced tube-forming ability. After
preconditioning of diabetic MSCs a significant decline in number of apoptotic cells (Fig. 4.6)
concomitant with enhanced in vitro tube-forming ability was observed (Fig. 4.8).
The mobilization of diabetic MSCs to chemotactic signals in response to SDF-1α also
significantly improved after preconditioning (Fig. 4.7). De Falco et al. (2009) described
hyperglycemia-induced impairment of the SDF-1α–CXCR-4 pathway to affect recruitment of
EPC in patients with coronary artery disease. The importance of SDF-1α–CXCR-4 axis for
mobilization and recruitment of stem cells has been previously reported by Wang et al.
(2006) and it has been shown that release of SDF-1α in conditions such as ischemia causes
upregulation of CXCR-4 receptor in different types of stem cells to ensue mobilization (Zhou
et al., 2002; Kucia et al., 2004). So a low chemotactic response by the untreated diabetic
MSCs reported here is in agreement with the previous findings which improved significantly
after preconditioning with IGF-1/FGF-2 in combination.
The tolerance of diabetic MSCs to high glucose stress was evaluated by emulating a
clinical hyperglycemic condition in vitro. For this purpose diabetic MSCs (both untreated
and preconditioned) were exposed to high glucose (30 mmol/L) treatment to roughly mimic
blood glucose levels in patients with inadequately controlled diabetes or as observed under
conditions of stress like inflammation, infection or hospitalization (Chen et al., 2007). The
real time-PCR results showed a downregulation in the expression of p16ᴵᴺᴷ⁴ᵃ coupled with
an upregulation of Ang-I and VEGF in preconditioned diabetic MSCs compared with the
untreated diabetic MSCs (Fig. 4.9). This exciting finding indicates that preconditioning of
diabetic MSCs not only improves cell survival and its angiogenic ability but also helps
withstand cellular senescence under conditions of high glucose stress.
Thus IGF-1/FGF-2 combination of growth factors has the potential to improve the
functionality of diabetes-impaired MSCs by enhancing cell proliferation, downregulating
senescent and apoptotic genes and upregulating prosurvival genes. This novel combination
also offers protection from hypoxic and high glucose insults and will be of great use in the
study of diabetes affected MSCs in future.
In view of the documented role of EPO in enhancing cellular response in different
disease modalities such as diabetes, neurodegeneration, cardiovascular system and renal
systems (Maiese et al., 2008), a subset of experiments were also carriedout in this respect.
The study intended to evaluate the effects of EPO administration on improvement of diabetic
myocardium and its functional status after transplantation of MSCs.
The gene expression studies showed a down regulation of p16ᴵᴺᴷ⁴ᵃ and Bax genes
and an upregulation of IGF-1 in the left ventricular tissue of the diabetic heart following EPO
administration compared with the untreated group (Fig. 4.10). The indication of an increase
in apoptosis in the diabetic heart tissue was further evident in the results of tunel staining
(Fig. 4.11A). The EPO treated group on the other hand showed less number of apoptotic cells
(Fig. 4.11B). These findings are in agreement with the previous studies which support that
EPO administration reduces complications in diabetes (Silverberg et al., 2006) and decreases
cardiomyocyte apoptosis in ischemic cardiac diseases (Tramontano et al., 2003; Gao et al.,
2007; Ueda et al., 2010). This relevance is further supported by the findings that one of the
most common reason of cardiovascular complications is diabetes and the incidence of and
risk of mortality from cardiovascular disease is two to eight fold higher in the diabetic
patients (Gaede, et al., 2003; Francia et al., 2009).
Although apoptosis prevention by EPO is considered to be a key mechanism in acute
cardioprotection (Paschos et al., 2008) the role of nitric oxide (NO) is also important
(Vanhoutte, 1988; De Caterina et al., 1995; Tharaux et al., 1999). The endothelial isoform of
NO is the prevailing form in the cardiovascular system and depends on eNOS expression.
eNOS has been documented to protect from hypertension and myocardial infarction in
transgenic mice model overexpressing recombinant human EPO through up regulation of
eNOS expression (Paschos et al., 2008). EPO has also been reported to enhance production
of coronary NO and provide protection from reperfusion-induced myocardial injury (Mihov
et al., 2009). Better eNOS expression was observed in the left ventricular tissue of the
diabetic mice following EPO administration compared with the untreated group (Fig. 4.12).
The site of eNOS upregulation in the left ventricular tissue most likely seems to be the
coronary endothelium, since no difference in eNOS expression of cardiomyocytes was
reported in a recent study employing EPO administration in rat model of ischemia /
reperfusion injury (Mihov et al., 2009). EPO together with its benefit of cardioprotection
may be an indicator of enhanced angiogenesis, since studies have shown that EPO
independently leads to angiogenesis (Reinders et al., 2006; Li et al., 2007) and promotes
mobilization of EPC that is associated with neovascularization of ischemic tissue (Heeschen
et al., 2003).
In continuation of these findings, transplantation of MSCs in the left ventricular
tissue of diabetic mice was done followed by EPO administration to evaluate improvement of
diabetic myocardium. The study involved assessment for homing of MSCs and reduction in
fibrosis in various transplantation groups which was followed by Millar analysis of cardiac
parameters.
The results indicated a significant increase in homing of the preconditioned MSCs
and reduction in left ventricular tissue fibrosis after EPO treatment compared with the
preconditioned MSCs group (Fig. 4.13 & 4.14) without subsequent EPO treatment. The
preconditioned MSCs group without EPO treatment in turn showed a significant homing and
reduction in fibrosis compared with the untreated group (Fig. 4.13 & 4.14). Evidence of
increase in cardiac fibrosis due to diabetic cardiomyopathy has previously been documented
(Tschope et al., 2004; Westermann, et al., 2007; Zhang, et al., 2008). The reduction in
fibrosis reported in the present study is in concordant with the previous findings which also
implicate EPO in reducing interstitial fibrosis and cardiac remodeling in cases of ischemic
heart diseases and MI (Gao et al., 2007; Ueda et al., 2010).
The functionality of the diabetic heart based on maximum pressure, end systolic
pressure, stroke volume, and ejection fraction was assessed in different transplanted and non
transplanted groups (Table 2). Heart functionality of diabetic mice (Group-2&3) was
considerably impaired as compared to that of control normal mice (Group-1). However, the
heart functionality of the diabetic mice improved significantly following administration of
EPO alone (Group-4). A more significant increase in cardiac functions was observed in the
diabetic mice transplanted with the preconditioned MSCs (Group-6) compared with the
diabetic mice transplanted with untreated MSCs (Group-5) and the group-4 given EPO
treatment alone. The diabetic mice transplanted with preconditioned MSCs and given EPO
treatment (Group-7) showed maximum improvement in the cardiac parameters assessed
compared with all other diabetic groups. In particular, values of the end-systolic pressure
(ESP) (77.1+6.4mmHg) and ejection fraction (EF) (26.9+0.62%) observed in the
preconditioned EPO-treated group were closest to the normal standard base line values of
ESP (90-110 mmHg) and EF (44-62%) as reported by Pacher et al. ( 2008) compared with all
other diabetic groups. To date no known study has been carried out that characterizes the
effects of EPO on heart of type-1 diabetic mice and its outcome after transplantation of
MSCs preconditioned with IGF-1/FGF-2. Although a limited study done on a human atrial
model of hypoxia/reoxygenation in diabetic patients do indicates reduction in myocardial
apoptosis and improvement in contractility of the cardiac tissues (Mudalagiri et al., 2008).
Other studies, which document improvement of heart function after EPO administration,
mostly involved model of ischemia-reperfusion injury or MI in different animals and human
subjects (Calvillo et al., 2003; Parsa et al., 2003; Moon et al., 2003; Van der Meer et al.,
2005; Hirata et al., 2006; Westenbrink et al., 2007; Lipsic et al., 2008). So the findings about
the functionality of the diabetic heart shown in the present study should be viewed as a
pioneer study of its kind and indicates potential for the future studies.
In the present study EPO (1000 I.U/kg) was administered for five consecutive days
after MSCs transplantation. Future studies should be designed to evaluate the functionality of
diabetic heart by employing different doses and increasing duration of EPO administration.
Moreover, different local and systemic factors such as VEGF, endothelin 1 and transformimg
growth factors known to be modulated by EPO should also be investigated to determine the
role of EPO in the acute and late cardioprotection (Arcasoy, 2008; Piuhola et al., 2008). The
study should also address some important safety issues such as rise in levels of serum EPO
(den Elzen et al., 2010), hemoglobin, blood pressure and risk of thrombosis (Besarab et al.,
1998).
Although the present EPO based transplantation study indicates improvement of
diabetic heart at several fronts such as a decrease in myocardial apoptosis, senescence, left
ventricular tissue fibrosis, and an increase in homing of preconditioned MSCs, expression of
eNOS and heart functionality, the inclusion of above mentioned considerations for future
studies would further illuminate the potential of this novel combination to treat diabetic HF.
CHAPTER 6
REFERENCES
Abdel Aziz, M.T., El-Asmar, M.F., Haidara, M., Atta, H.M., Roshdy, N.K., Rashed, L.A.,
Sabry, D., Youssef, M.A., Abdel Aziz, A.T., Moustafa, M. (2008). Effect of bone
marrow-derived mesenchymal stem cells on cardiovascular complications in diabetic
rats. Med Sci Monit 14:249–255.
Alison, M.R., Poulsom, R., Forbes, S. et al. (2002). An introduction to stem cells. J Pathol
197:419–23.
Amos, A.F., McCarty, D.J., Zimmet, P. (1997). The rising global burden of diabetes and its
complications: estimates and projections to the year 2010. Diabet Med 14 Suppl
5:S1–S85.
An, D., Rodrigues, B. (2006). Role of changes in cardiac metabolism in development of
diabetic cardiomyopathy. Am J Physiol Heart Circ Physiol 291(4):H1489–506.
An, D., Rodrigues, B. (2006). Role of changes in cardiac metabolism in development of
diabetic cardiomyopathy. Am J Physiol Heart Circ Physiol 291(4):H1489–506.
Anderson, D.J., Gage, F.H., Weissman, I.L. (2001). Can stem cells cross lineage boundaries?
Nat Med 7:393–95.
Anversa, P. (2005). Aging and longevity: the IGF-1 enigma. Circ Res 97:411–414.
Anversa, P., Leri, A., Rota, M., Hosoda, T., Bearzi, C., Urbanek, K., Urbanek, J., Bolli, R.
(2007).Concise review: stem cells, myocardial regeneration, and methodological
artifacts. Stem Cells 25:589–601.
Anversa, P., Olivetti, G. (2002). Cellular basis of physiological and pathological myocardial
growth. In: Page E, Fozzard, H.A., Solaro, R.J., eds. Handbook of Physiology. Section
2. The Cardiovascular System. Volume I. The Heart 1:75–144.
Arcasoy, M.O. (2008).The non-haematopoietic biological effects of erythropoietin. Br J
Haematol 141:14–31.
Asahar, T., Kawamoto, A. (2004). Endothelial progenitor cells for postnatal vasculogenesis.
Am J Physiol cell Physiol 1287:C572–C579.
Asaumi, Y., Kagaya, Y., Takeda, M., et al. (2007). Protective Role of Endogenous
Erythropoietin System in Nonhematopoietic Cells Against Pressure Overload–
Induced Left Ventricular Dysfunction in Mice. Circulation 115:2022–2032.
Awad, O., Jiao, C., Ma, N., Dunnwald, M., Schatterman, G.C. (2005). Obese diabetic mouse
environment differentially affects primitive and monocytic endothelial cell
progenitors. Stem cells 23:575–583.
Aydemir-Koksoy, A., Bilginoglu, A., Sariahmetoglu, M., Schulz, R., Turan, B. (2010).
Antioxidant treatment protects diabetic rats from cardiac dysfunction by preserving
contractile protein targets of oxidative stress. J Nutr Biochem 21(9):827–33.
Bearzi, C., Rota, M., Hosoda, T., Tillmanns, J., Nascimbene, A., De Angelis, A., Yasuzawa-
Amano, S., Trofimova, I., Siggins, R.W., Lecapitaine, N., Cascapera, S., Beltrami,
A.P., D'Alessandro, D.A., Zias, E., Quaini, F., Urbanek, K., Michler, R.E., Bolli, R.,
Kajstura, J., Leri, A., Anversa, P. (2007). Human cardiac stem cells. Proc Natl Acad
Sci USA 104:14068–14073.
Besarab, A., Bolton, W.K., Browne, J.K., et al. (1998). The effects of normal as compared
with low hematocrit values in patients with cardiac disease who are receiving
hemodialysis and epoetin. N Engl J Med 339:584–90.
Boudina, S., Abel, E.D. (2010). Diabetic cardiomyopathy, causes and effects. Rev Endocr
Metab Disord 11(1):31–9.
Bullard, A.J., Govewalla, P., Yellon, D.M. (2005). Erythropoietin protects the myocardium
against reperfusion injury in vitro and in vivo. Basic Res Cardiol 100: 397–403.
Burch, P., Heintz, N. (2005). Redox regulation of cell cycle re-entry: cyclin D1 as a primary
target for the mitogenic effects of reactive oxygen and nitrogen species. Antioxid
Redox Signal 7:741–751.
Cai, Z., Manalo, D.J., Wei, G., Rodriguez, E.R., Fox-Talbot, K., Lu, H., et al. (2003). Hearts
from rodents exposed to intermittent hypoxia or erythropoietin are protected against
ischemia–reperfusion injury. Circulation 108:79–85.
Calvillo, L., Latini, R., Kajstura, J., Leri, A., Anversa, P., Ghezzi, P., Salio, M., Cerami, A.,
Brines, M. (2003). Recombinant human erythropoietin protects the myocardium from
ischemia-reperfusion injury and promotes beneficial remodeling. Proc Natl Acad Sci
USA. 100:4802– 4806.
Candido, R., Srivastava, P., Cooper, M.E., Burrell, L.M. (2003). Diabetes mellitus: a
cardiovascular disease. Curr Opin Investig Drugs 4(9):1088–1094.
Carnot P. DeFlandre C. (1906). Sur l’activite hemopoietique de serum au cours de la
regeneration du sang. C R Acad Sci (Paris) 143:384–6.
Chambers, I., Smith, A. (2004). Self-renewal of teratocarcinoma and embryonic stem cells.
Oncogene 23:7150–60.
Chen, Y.H., Lin, S.J., Lin, F.Y., Wu, T.C., Tsao, C.R., Huang, P.H., Liu, P.L., Chen, Y.L.,
Chen, J.W. (2007). High glucose impairs early and late endothelial progenitor cells by
modifying nitric oxide-related but not oxidative stress-mediated mechanisms.
Diabetes 56:1559–1568.
Choi, S.C., Kim, S.J., Choi, J.H., Park, C.Y., Shim, W.J., Lim, D.S. (2008). Fibroblast
growth factor-2 and -4 promote the proliferation of bone marrow mesenchymal stem
cells by the activation of the P13K-Akt and ERK1/2 signaling pathways. Stem Cells
Dev 17:725–736.
Chong, Z.Z., Shang, Y.C., Maiese, K. (2007). Vascular injury during elevated glucose can be
mitigated by erythropoietin and Wnt signaling. Curr Neurovasc Res 4:194–204.
De Caterina, R., Libby, P., Peng, H.B., et al. (1995). Nitric oxide decreases cytokine-
induced endothelial activation. Nitric oxide selectively reduces endothelial expression
of adhesion molecules and proinflammatory cytokines. J Clin Invest 96:60–8.
De Falco, E., D Avitabile, D., P Totta, P., S Straino, S., F Spallotta, F., C Cencioni, C., AR
Torella, A.R., Rizzi, R., Porcelli, D., Zacheo, A., Di Vito, L., Pompilio, G.,
Napolitano, M., Melillo, G., Capogrossi, M.C., Pesce, M. (2009). Altered SDF-1
mediated differentiation of bone marrow-derived endothelial progenitor cells in
diabetes mellitus. J Cell Mol Med 13: 3405–3414.
Deeping, R., Kawakami, K., Ocker, H., Wagner, J.M., Heringlade, M., Noetzold, A., et al.
(2005). Expression of the erythropoietin receptor in human heart. J Thorac
Cardiovasc Surg 130:877.
den Elzen, W.P., Willems, J.M., Westendorp, R.G., de Craen, A.J., Blauw, G.J., Ferrucci, L.,
Assendelft, W.J., Gussekloo, J. (2010). Effect of erythropoietin levels on mortality in
old age: the Leiden 85-plus Study. CMAJ 182(18):1953–8.
Degeorge, B.R.Jr., Rosenberg, M., Eckstein, V., Gao, E., Herzog, N., Katus, H.A., Koch,
W.J., Frey, N., Most, P. (2008). BMP-2 and FGF-2 synergistically facilitate adoption
of a cardiac phenotype in somatic bone marrow c-kit+/Sca-1+ stem cells. Clin Transl
Sci 1(2):116-25.
Devereux, R.B., Roman, M.J., Paranicas, M. (2000). Impact of diabetes on cardiac structure
and function: The Strong Heart Study. Circulation 101: 2271–2276.
Di Filippo, C., Marfella, R., Cuzzocrea, S., Piegari, E., Petronella, P., Giugliano, D., Rossi,
F. D’ mico M. (2005). Hyperglycemia in streptozotocin induced diabetic rat
increases infarct size associated with low levels of myocardial HO-1 during
ischemia/reperfusion. Diabetes 54:803–810.
Di Paola, M., Lorusso, M. (2006). Interaction of free fatty acids with mitochondria:
Coupling, uncoupling and permeability transition. Biochim Biophys Acta 1757(9-
10):1330–1337.
Dobrin, J.S., Lebeche, D. (2010). Diabetic cardiomyopathy: signaling defects and therapeutic
approaches. Expert Rev Cardiovasc Ther 8(3):373–91.
Dong, Q.Y., Chen, L., Gao, G.Q., Wang, L., Song, J., Chen, B.,Xu, Y.X., Sun,L. (2008).
Allogeneic diabetic mesenchymal stem cells transplantation in streptozotocin-induced
diabetic rat. Clin Invest Med 31:328–337.
Dyntar, D., Eppenberger-Eberhardt, M., Maedler, K., Pruschy, M., Eppenberger, H.M.,
Spinas, G.A., Donath, M.Y. (2001). Glucose and palmitic acid induce degeneration of
myofibrils and modulate apoptosis in rat adult cardiomyocytes. Diabetes 50(9):2105–
2113.
Ebrahimian, T.G., C Heymes, C., D You, D., O Blanc-Brude, O., B Mees, B., L Waeckel, L.,
M Duriez, M., Vilar, J., Brandes, R.P., Levy, B.I., Shah, A,M., Silvestre, J.S. (2006).
NADPH oxidase-derived overproduction of reactive oxygen species impairs
postischemic neovascularization in mice with type I diabetes. Am J Pathol 169:719–
728.
Esneault, E., Pacary, E., Eddi, D., Freret, T., Tixier, E., Toutain, J., Touzani, O., Schumann-
Bard, P., Petit, E., Roussel, S., Bernaudin, M. (2008). Combined therapeutic strategy
using erythropoietin and mesenchymal stem cells potentiates neurogenesis after
transient focal cerebral ischemia in rats. J Cereb Blood Flow Metab 28(9):1552–63.
Falcão-Pires, I., Gonçalves, N., Gavina, C. et. al. (2010). Correlation between plasma levels
of apelin and myocardial hypertrophy in rats and humans: possible target for
treatment? Expert Opin Ther Targets 14:231–241.
Fazel, S., Cimini, M., Chen, L., Li, S., Angoulvant, D., Fedak, P., Verma, S., Weisel, R.D.,
Keating, A., Li, R.K. (2006). Cardioprotective c-kit+ cells are from the bone marrow
and regulate the myocardial balance of angiogenic cytokines. J Clin Invest 116:1865–
1877.
Fiers, W., Beyaert, R., Declercq, W., Vandenabeele, P. (1999). More than one way to die;
apoptosis, necrosis and reactive oxygen damage. Oncogene 18:7719–7730.
Fisher, B.M., Gillen, G., Lindop, G.B., Dargie, H.J., Frier, B.M. (1986). Cardiac function and
coronary arteriography in asymptomatic type-1 (insulin-dependent) diabetic patients:
evidence for a specific diabetic heart disease. Diabetologia 29(10):706–712.
Fliser, D., Haller, H. (2007). Erythropoietin and treatment of non-anemic conditions –
cardiovascular protection. Semin Hematol 44:212–7.
Francia, P., Cosentino, F., Schiavoni, M., Huang, Y., Perna, E., Camici, G.G., Lüscher, T.F.,
Volpe, M. (2009). p66ˢʱᶜ protein, oxidative stress, and cardiovascular complications of
diabetes: the missing link. J Mol Med 87:885–891.
Frantz, S., Calvillo, L., Tillmanns, J., Elbing, I., Dienesch, C., Bischoff, H., Ertl, G.,
Bauersachs, J. (2005). Repetitive postprandial hyperglycemia increases cardiac
ischemia / reperfusion injury: prevention by the alpha-glucosidase inhibitor acarbose.
FASEB J 19:591–593.
Fuchs, E., Segre, J.A. (2000). Stem cells: a new lease on life. Cell 100:143–55.
Fuchs, E., Tumbar, T., Guasch, G. (2004). Socializing with the neighbors: stem cells and
their niche. Cell 116:769–78.
Gaede, P., Vedel, P., Larsen, N., Jensen, G.V., Parving, H.H., Pedersen, O. (2003).
Multifactorial intervention and cardiovascular disease in patients with type 2 diabetes.
N Engl J Med 348:383–393.
Gallagher, K.A., Liu, Z.J., Xiao, M., Chen, H., Goldstein, L.J., Buerk, D.G., Nedeau, A., SR
Thom, S.R., Velazquez, O.C. (2007). Diabetic impairments in NO-mediated
endothelial progenitor cell mobilization and homing are reversed by hyperoxia and
SDF-1a. J Clin Invest 117:1249–1259.
Gao, E., Boucher, M., Chuprun, J.K., Zhou, R.H., Eckhart, A.D., Koch, W.J. (2007).
Darbepoetin alfa, a long-acting erythropoietin analog, offers novel and delayed
cardioprotection for the ischemic heart. Am J Physiol Heart Circ Physiol 293:H60–8.
Gomperts, B.N., Strieter, R.M. (2007). Stem Cells and Chronic Lung Disease. Annu Rev Med
58:285-298.
Grimm, P.C., Nickerson, P., Gough, J., Mckenna, R., Stern, E., Jeffery, J., Rush, D.N.
(2003). Computerized Image Analysis of Sirius Red–Stained Renal Allograft
Biopsies as a Surrogate Marker to Predict Long- Term Allograft Function. J Am Soc
Nephrol 14:1662–1668.
Guang-wei, L., Ying-hua, H., Wen-ying, Y., et al. (2002). Effects of insulin resistance and
insulin secretion on the efficacy of interventions to retard development of type 2
diabetes complications: the Da Qing IGT and diabetes study. Diabetes Res Clin
Pract. 58:193–200.
Guo, J., Lin, G., Bao, C., Hu, Z., Chu, H., Hu, M. (2008). Insulinlike growth factor 1
improves the efficacy of mesenchymal stem cells transplantation in a rat model of
myocardial infarction. J Biomed Sci 15:89–97.
Haffner, S.M. (1997). The Scandinavian Simvastatin Survival Study (4S) subgroup analysis
of diabetic subjects: implications for the prevention of coronary heart disease.
Diabetes Care 20:469–471.
Hahn J,Y., Cho, H.J., Kang, H.J., Kim, T.S., Kim, M.H., Chung, j.H., Bae, J.W., Oh, B.H.,
YB Park, Y.B., Kim, H.S. (2008). Pre-treatment of mesenchymal stem cells with a
combination of growth factors enhances gap junction formation, cytoprotective effect
on cardiomyocytes, and therapeutic efficacy for myocardial infarction. J Am Coll
Cardiol 51:933–943.
Haider, H., Asjraf, M. (2005). Bone marrow cell transplantation in clinical perspective. J Mol
Cell Cardiol 38:225–235.
Haider, H.Kh., Ashraf, M. (2008). Strategies to promote donor cell survival: combining
preconditioning approach with stem cell transplantation. J Mol Cell Cardiol 45: 554–
566.
Hanefeld, M., Fischer, S., Julius, U., et al. (1996). Risk factors for myocardial infarction and
death in newly detected NIDDM: the Diabetes Intervention Study, 11-year follow-up.
Diabetologia 39:1577–1583.
Hayat, S.A., et al. (2004). Diabetic cardiomyopathy: mechanisms, diagnosis and treatment.
Clin Sci (Lond) 107(6):539–57.
Heeschen, C., Aicher, A., Lehmann, R., et al. (2003). Erythropoietin is a potent physiologic
stimulus for endothelial progenitor cell mobilization. Blood 102:1340–6
Herzog, E.L., Chai, L., Krause, D.S. (2003). Plasticity of marrow-derived stem cells. Blood
102:3483–93.
Hirata, A., Minamino, T., Asanuma, H., Fujita, M., Wakeno, M., Myoishi, M., Tsukamoto,
O., Okada, K., Koyama, H., Komamura, K., Takashima, S., Shinozaki, Y., Mori, H.,
Shiraga, M., Kitakaze, M., Hori, M. (2006). Erythropoietin enhances
neovascularization of ischemic myocardium and improves left ventricular dysfunction
after myocardial infarction in dogs. J Am Coll Cardiol 48:176–184.
Holman, R., Turner, R., Stratton, I., et. al. (1998). UK Prospective Diabetes Study Group.
Efficacy of atenolol and captopril in reducing risk of macrovascular and
microvascular complications in type 2 diabetes: UKPDS 39. BMJ 317:713–720.
Hu, G., Tuomilehto, J., Silventoinen, K., Barengo, N., Jousilahti, P. (2004). Joint effects of
physical activity, body mass index, waist circumference, and waist-to-hip ratio with
the risk of cardiovascular disease among middleaged Finnish men and women. Eur
Heart J 25:2212–2219.
Ito, T., Sawada, R., Fujiwara, Y., Seyama, Y., Tsuchiya, T. (2007). FGF-2 suppresses
cellular senescence of human mesenchymal stem cells by down-regulation of TGF-
β2. Biochem Biophy Res Commun 359:108–114.
Jiang, Y., Jahagirdar, B.N., Reinhardt, R.L., et al. (2002). Pluripotency of mesenchymal stem
cells derived from adult marrow. Nature 418:41–49.
Jin, J., Zhao, Y., Tan, X., Guo, C., Yang, Z., Miao, D. (2011). An Improved Transplantation
Strategy for Mouse Mesenchymal Stem Cells in an Acute Myocardial Infarction
Model. PLoS One 6(6): e21005.
Kannel, W.B., Hjortland, M., Castelli, W.P. (1974). Role of diabetes in congestive heart
failure: the Framingham Study. Am J Cardiol 34(1):29–34.
Kannel, W.B., McGee, D.L. (1979). Diabetes and cardiovascular disease: the Framingham
Study. JAMA 241:2035–2038.
Khan, M., Manzoor, S., Mohsin, S., Khan, S.N., Ahmad, F.J. (2009). IGF-1 and G-CSF
complement each other in BMSCs migration towards infarcted myocardium in a
novel in vitro model. Cell Biol Int 33:650–657.
Kinnaird, T., Stabile ,E., Burnett, M.S., Shou, M., Lee, C.W., Barr, S., Fuchs, S., and
Epstein, S.E. (2004). Local delivery of marrow-derived stromal cells augments
collateral perfusion through paracrine mechanisms. Circulation 109:1543–1549.
Kinnaird, T., Stabile, E., Burnett, M.S., and Epstein, S.E. (2004). Bonemarrow- derived cells
for enhancing collateral development: mechanisms, animal data, and initial clinical
experiences. Circ Res 95:354–363.
Kinnaird, T., Stabile, E., Burnett, M.S., Lee, C.W., Barr, S., Fuchs, S., and Epstein, S.E.
(2004). Marrow-derived stromal cells express genes encoding a broad spectrum of
arteriogenic cytokines and promote in vitro and in vivo arteriogenesis through
paracrine mechanisms. Circ Res 94:678–685.
Krause, D.S. (2002). Plasticity of marrow-derived stem cells. Gene Ther 9:754–758.
Krause, D.S., Theise, N.D., Collector, M.I., et al. (2001). Multi-organ, multi-lineage
engraftment by a single bone marrow-derived stem cell. Cell 105:369–77.
Kucia, M., Dawn, B., Hunt, G., Wysoczynski, M., Majka, M., Ratajczak, J., Rezzoug, F.,
Ildstad, S.T.,Bolli, R., and MZ Ratajczak, M. Z. (2004). Cells expressing early
cardiac markers reside in the bone marrow and are mobilized into the peripheral
blood after myocardial infarction. Circ Res 95:1191–1199.
Kucia, M., Jankowski, K., Reca, R., Wysoczynski, M., Bandura, L., Allendorf, D.J., Zhang,
J., Ratajczak, J., Ratajczak, M.Z. (2004). CXCR4-SDF-1 signalling, locomotion,
chemotaxis and adhesion. J Mol Histol 35:233–245.
Kudo, M., Wang, Y., Wani, M.A., Xu, M., Ayub, A., M Ashraf, M. (2003). Implantation of
bone marrow stem cells reduces the infarction and fibrosis in ischemic mouse heart. J
Mol Cell Cardiol 35:1113–1119.
Laflamme, M.A. Murry, C.E. (2011). Heart regeneration. Nature 473(7347):326–35.
Leiter, E.L. 1999. In McNeill JH ed. Experimental models of diabetes. CRC Press. Boca
Raton, Fla. 418pp.
Leri, A., Franco, S., Zacheo, A., Barlucchi, L., Chimenti, S., Limana, F., Nadal-Ginard, B.,
Kajstura, J., Anversa, P., Blasco, M.A. (2003). Ablation of telomerase and telomere
loss leads to cardiac dilation and heart failure associated with p53 upregulation.
EMBO J 22:131–139.
Li, C.J., Zhang, Q.M., Li, M.Z., Zhang, J.Y., Yu, P., Yu, D.M. (2009). Attenuation of
myocardial apoptosis by alpha-lipoic acid through suppression of mitochondrial
oxidative stress to reduce diabetic cardiomyopathy. Chin Med J (Engl).122:2580–
2586.
Li, J., Leschka, S., Rutschow, S., Schwimmbeck, P.L., Husmann, L., Noutsias, M.,
Westermann, D., Poller, W., Zeichhardt, H., Klingel, K., et al. (2007).
Immunomodulation by interleukin-4 suppresses matrix metalloproteinases and
improves cardiac function in murine myocarditis. European journal of pharmacology
554(1):60–68.
Li, Q., Turdi, S., Thomas, D., Zhou, T., Ren, J. (2010). Intra-myocardial Delivery of
Mesenchymal Stem Cells Ameliorates Left Ventricular and Cardiomyocyte
Contractile Dysfunction Following Myocardial Infarction. Toxicol Lett 195(2-3):
119–126.
Li, Y., Takemura, G., Okada, H., Miyata, S., Maruyama, R., Li, L., Higuchi,
M.,Minatoguchi, S., Fujiwara, T., Fujiwara, H. (2006). Reduction of inflammatory
cytokine expression and oxidative damage by erythropoietin in chronic heart failure.
Cardiovasc Res 71:684–694.
Li, Y., Yu, X., Lin, S., Li, X., Zhang, S., Song, Y.H. (2007). Insulin- like growth factor 1
enhances the migratory capacity of mesenchymal stem cells. Biochem Biophys Res
Commun 356:780–784.
Limana, F., Urbanek, K., Chimenti, S., Quaini, F., Leri, A., Kajstura, J., Nadal-Ginard, B.,
Izumo, S., Anversa, P. (2002). Bcl-2 overexpression promotes myocyte proliferation.
Proc Natl Acad Sci USA 99:6257–6262.
Linheng, Li., Ting, Xie. (2005). Stem Cell Niche: Structure and Function. Annu Rev Cell Dev
Biol 21:605–631.
Lipsic, E., Schoemaker, R.G., Van Der Meer, P., Voors, A.A., Van Veldhuisen, D.J., Van
Gilst, W.H. (2006). Protective effects of erythropoietin in cardiac ischemia: from
bench to bedside. J Am Coll Cardiol 48:2161–7.
Liu, X., Wei, J., Peng, D.H., Layne, M.D., Yet, S.F. (2005). Absence of heme oxygenase-1
exacerbates myocardial ischemia/reperfusion injury in diabetic mice. Diabetes
54:778–784.
Lloyd-Jones, D. et al. (2010). Executive summary: heart disease and stroke statistics--2010
update: a report from the American Heart Association. Circulation 121(7):948–54.
Lu, G., Haider, H.K., Jiang, S., Ashraf, M. (2009). Sca-1þ stem cell survival and engraftment
in the infarcted heart: dual role for preconditioning induced Connexin-43. Circulation
119:2587–2596.
Maiese, K., Chong, Z.Z., Shang, Y.C. (2008). Raves and risks for erythropoietin. Cytokine &
Growth Factor Reviews 19:145–155.
Marfella, R., Di Filippo, C., Esposito, K., Nappo, F., Piegari, E., Cuzzocrea, S., Berrino, L.,
Rossi F. Giugliano D. D’ mico M. (2004). Absence of inducible nitric oxide
synthase reduces myocardial damage during ischemia reperfusion in streptozotocin-
induced hyperglycemic mice. Diabetes 53:454–462.
Martindale, J.L., Holbrook, N.J. (2002). Cellular response to oxidative stress: signaling for
suicide and survival. J Cell Physiol 192:1–15.
Mastromarino, V., Volpe, M., Musumeci, M.B., Autore, C., Conti, E. (2011). Erythropoietin
and the heart: facts and perspectives. Clin Sci 120(2):51–63.
Mathur, A., Martin, J.F. (2004). Stem cells and repair of the heart. Lancet 364:183-92.
Mazzone, T, Chait, A., Plutzky, J. (2008). Cardiovascular disease risk in type 2 diabetes
mellitus: insights from mechanistic studies. Lancet 371(9626):1800–1809.
McCulloch, E.A., Till, J.E. (2005). Perspectives on the properties of stem cells. Nat Med
11:1026–28
Meier, M., Hummel, M. (2009). Cardiovascular disease and intensive glucose control in type
2 diabetes mellitus: moving practice toward evidencebased strategies. Vasc Health
Risk Manag 5:859–871.
Mihov, D., Bogdanov, N., Grenacher, B., Gassmann, M., Zund, G., Bogdanova, A.,
Tavakoli, R. (2009). Erythropoietin protects from reperfusion-induced myocardial
injury by enhancing coronary endothelial nitric oxide production. European Journal
of Cardio-thoracic Surgery 35:839–846.
Mishra, P.K. (2008). Bone marrow-derived mesenchymal stem cells for treatment of heart
failure: is it all paracrine actions and immunomodulation? J Cardiovasc Med
(Hagerstown) 9:122–128.
Moon, C., Krawczyk, M., Ahn, D., Ahmet, I., Paik, D., Lakatta, E.G., et al. (2003).
Erythropoietin reduces myocardial infarction and left ventricular functional decline
after coronary artery ligation in rats. Proc Natl Acad Sci USA 100: 11612–11617.
Ohnishi, S., Yanagawa, B., Tanaka, K., Miyahara, Y., Obata, H., Kataoka, M., Kodama, M.,
Ishibashi-Ueda, H., Kangawa, K., Kitamura, S., Nagaya, N. (2007). Transplantation
of mesenchymal stem cells attenuates myocardial injury and dysfunction in a rat
model of acute myocarditis. J Mol Cell Cardiol 42:88–97.
Ohshima, M., Li, T.S., Kubo, M., Qin, S.H., Hamano, K. (2009). Antioxidant therapy
attenuates diabetes-related impairment of bone marrow stem cells. Circ J 73:162–
166.
Orkin, S.H., Zon, L.I. (2002). Hematopoiesis and stem cells: plasticity versus developmental
heterogeneity. Nat Immunol 3:323–28.
Orlic, D., Kajstura, J., Chimenti, S., Jakoniuk, I., Anderson, S.M., Li, B., Pickel, J., McKay,
R., Nadal-Ginard, B., Bodine, D.M., A Leri, A., Anversa, P. (2001). Bone marrow
cells regenerate infracted myocardium. Nature 410:701–705.
Orzechowski, A. (2003). Justification for antioxidant preconditioning (or how to protect
insulin-mediated actions under oxidative stress). J Biosci 28:39–49.
other cells by spontaneous cell fusion. Nature 416:542–45.
Pacher, P., Nagayama, T., Mukhopadhyay, P., Batkai, S., Kass, D.A. (2008). Measurement of
cardiac function using pressure–volume conductance catheter technique in mice and
rats. Nat Protoc 3(9):1422–1434.
Parsa, C.J., Matsumoto, A., Kim, J., Riel, R.U., Pascal, L.S., Walton, G.B., Thompson, R.B.,
Petrofski, J.A., Annex, B.H., Stamler, J.S., Koch, W.J. (2003). A novel protective
effect of erythropoietin in the infarcted heart. J Clin Invest 112:999 –1007.
Paschos, N., Lykissas, M.G., Beris, A.E. (2008). The Role of Erythropoietin as an Inhibitor
of Tissue Ischemia. Int J Biol Sci 4(3):161–168.
Paul, D., Samuel, S.M., Maulik, N. (2009). Mesenchymal Stem Cell: Present Challenges and
Prospective Cellular Cardiomyoplasty Approaches for Myocardial Regeneration.
Antioxid Redox Signal 11(8): 1841–1855.
Piuhola, J., Kerkela, R., Keenan, J.I., Hampton, M.B., Richards, A.M., Pemberton, C.J.
(2008). Direct cardiac actions of erythropoietin (EPO): effects on cardiac
contractility. BNP secretion and ischaemia/reperfusion injury. Clin Sci 114:293–304.
Pons, J., Huang, Y., Arakawa-Hoyt, J., Washko, D., Takagawa, J., Ye, J., Grossman, W., Su,
H. (2008). VEGF improves survival of mesenchymal stem cells in infarcted hearts.
Biochem Biophys Res Commun 376(2):419-22.
Prunier, F., Pfister, O., Hadri, L., Liang, L., Del, M.F., Liao, R., Hajjar, R.J. (2007). Delayed
erythropoietin therapy reduces post-MI cardiac remodeling only at a dose that
mobilizes endothelial progenitor cells. Am J Physiol Heart Circ Physiol 292:H522–
H529.
Robins, S.J., Collins, D., Wittes, J.T., et al. (2001). Relation of gemfibrozil treatment and
lipid levels with major coronary events: VA-HIT: a randomized controlled trial.
JAMA 285:1585–1591.
Rodrigues, B., Cam, M.C., McNeill, J.H. (1998). Metabolic disturbances in diabetic
cardiomyopathy. Mol Cell Biochem 180:53–57.
Rosova, I., Dao, M., Capoccia, B., D Link, D., Nolta, J.A. (2008). Hypoxic preconditioning
results in increased motility and improved therapeutic potential of human
mesenchymal stem cells. Stem cells 26:2173–2182.
Rossant, J. (2004). Embryonic stem cells in prospective. In Handbook of Stem Cells, ed. R
Lanza. Gearhart, J., Hogan, B.L., Melton, D., Pedersen, R. et al. London: Elsevier
Acad.
Rota, M., LeCapitaine, N., Hosoda, T., Boni, A., De Angelis, A., Padin-Iruegas, M.E.,
Esposito, G., Vitale, S., Urbanek, K., Casarsa, C., Giorgio, M., Lu¨ scher, T.F.,
Pelicci, P.G., Anversa, P., Leri, A., Kajstura, J. (2006). Diabetes promotes cardiac
stem cell aging and heart failure, which are prevented by the deletion of the p66ˢʱᶜ
gene. Circ Res 99:42–52.
Rubart, M., Field, L.J. (2006). Cardiac regeneration: repopulating the heart. Annu Rev
Physiol 68:29–49.
Rubler, S., et al. (1972). New type of cardiomyopathy associated with diabetic
glomerulosclerosis. Am J Cardiol 30(6):595–602.
Ruifrok, W.P., de Boer, R.A., Westenbrink, B.D., van Veldhuisen, D.J., van Gilst, W.H.
(2008). Erythropoietin in cardiac disease: new features of an old drug. Eur J
Pharmacol 585(2-3):270–7.
Ruschitzka, R.T., Wenger, R.H., Stallmach, T., Quaschning, T., de Wit C., Wagner, C.K.,
Labugger, R., Kelm, M., Noll, G., Rülicke, T., Shaw, S., Lindberg, R.L.P.,
Rodenwaldt, B., Lutz, H., Bauer, C., Lüscher, T.F., , and Gassmann, M. (2000).
Nitric oxide prevents cardiovascular disease and determines survival in polyglobulic
mice overexpressing erythropoietin. Proc Natl Acad Sci USA 97(21):11609–13.
Sadamoto, Y., Igase, K., Sakanaka, M., Sato, K., Otsuka, H., Sakaki, S., et al. (1998).
Erythropoietin prevents place navigation disability and cortical infarction in rats with
permanent occlusion of the middle cerebral artery. Biochem Biophys Res Commun
253: 26–32.
Sakanaka, M., Wen, T.C., Matsuda, S., Masuda, S., Morishita, E., Nagao, M., et al. (1998).
In vivo evidence that erythropoietin protects neurons from ischemic damage. Proc
Natl Acad Sci USA 95:4635–4640.
Saladin, K.S. (2005). Human Anatomy. 1st Edition. Mc Graw Hill Higher Eduaction.
Sambuceti, G., Morbelli, S., Vanella, L., Kusmic, C., Marini, C., Massollo, M., Augeri, C.,
Corselli M. Ghersi C. Chiavarina B. Rodella .F. ’ bbate . Drummond, G.,
NG Abraham, N.G., Frassoni, F. (2009). Diabetes impairs the vascular recruitment of
normal stem cells by oxidant damage; reversed by increases in pAMPK, Heme
Oxygenase-1 and Adiponectin. Stem Cells 27:399–407.
Sanchez, A., Garcia-Sancho, J. (2007). Cardiac repair by stem cells. Cell Death Differ
14:1258–1261.
Sarwar, N. et. al. (2010). Diabetes mellitus, fasting blood glucose concentration, and risk of
vascular disease: a collaborative meta-analysis of 102 prospective studies. Lancet
375(9733):2215–22.
Shake, J.G., Gruber, P.J., Baumgartner, W.A., Senechal, G., Meyers, J., Redmond, J.M.,
Pittenger, M, F., and Martin, B.J. (2002). Mesenchymal stem cell implantation in a
swine myocardial infarct model: engraftment and functional effects. Ann Thorac Surg
73:1919–1925.
Sharif, S., Nakagawa, T., Ohno, T., Matsumoto, M., Kita, T., Riazuddin, S., Ito, J.,
Nakagawa, T. (2007). The potential use of bone marrow stromal cells for cochlear
cell therapy. Neuroreport 18:351–354.
Shushakova, N., Park, J.K., Menne, J., Fliser, D. (2009). Chronic erythropoietin treatment
affects different molecular pathways of diabetic cardiomyopathy in mouse. Eur J Clin
Invest 39(9):755–60.
Silverberg, D.S., Wexler, D., Iaina, A., Schwartz, D. (2006). The interaction between heart
failure and other heart diseases, renal failure, and anemia. Semin Nephrol 26:296–
306.
Singh, R., Barden, A., Mori, T., Beilin, L. (2001). Advanced glycation end products: a
review. Diabetologia 44:129–146.
Song, S.W., Chang, W., Song, B.W., Song, H., Lim, S., Kim, H.J., Cha, M.J., Choi, E., Im,
S.H., Chang, B.C., Chung, N., Jang, Y., Hwang, K.C. (2009). Integrin-linked kinase
is required in hypoxic mesenchymal stem cell for strengthening cell adhesion to
ischemic myocardium. Stem Cells 27:1358–1365.
Sowers, J.R., Epstein, M., Frohlich, E.D. (2001). Diabetes, hypertension, and cardiovascular
disease: an update. Hypertension 37(4):1053–1059.
Sparagna, G.C., Jones, C.E., Hickson-Bick, D.L. (2004). Attenuation of fatty acid-induced
apoptosis by low-dose alcohol in neonatal rat cardiomyocytes. Am J Physiol Heart
Circ Physiol 287(5):H2209–H2215.
Standrings, S., Borley, N.R., Collins, P., Crossman, A.R., Gatzoulis, M.A., Healy, J.,
Johnson D. Mahadevan V. Newell R. .M. Wigley C.B. (2008). Gray’s natomy:
The Anatomical Basis of Clinical Practice.4th
Edition. CHURCHILL LIVINGSTONE
ELSEVIER.
Stolzing, A., Jones, E., McGonagle, D., Scutt, A. (2008). Age related changes in human bone
marrow-derived mesenchymal stem cells: consequences for cell therapies. Mech
Ageing Dev 129:163–173.
Sulaiman, M., Matta, M.J., Sundaresan, N.R. et al. (2010). Resveratrol, an activator of SIRT1
up-regulates sarcoplasmic calcium ATPase and improves cardiac function in diabetic
cardiomyopathy. Am J Physiol Heart Circ Physiol 298:H833–843.
Tarnok, A., Ulrich, H., Bocsi, J. (2009). Phenotypes of Stem Cells from Diverse Origin.
Cytometry 77A:6–10.
Terada, N., Hamazaki, T., Oka, M., Hoki, M., Mastalerz, D.M., Nakano, Y., Meyer, E.M.,
Morel, L., Petersen, B.E., Scott ,E.W. (2002). Bone marrow cells adopt the phenotype
of other cells by spontaneous cell fusion. Nature 416(6880):542-5.
Tharaux, P.L., Chatziantoniou, C., Casellas, D., et al. (1999). Vascular endothelin-1 gene
expression and synthesis and effect on renal type I collagen synthesis and
nephroangiosclerosis during nitric oxide synthase inhibition in rats. Circulation
99:2185–91.
Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., et al.
(1998). Embryonic stem cell lines derived from human blastocysts. Science
282:1145–47
Thum, T., Fraccarolla, D., Schultheiss, M., Froese, S., Galuppo, P., Widder, J.D., Tsikas,
D., G Ertl, G., Bauersachs, J. (2007). Endothelial nitric oxide synthase uncoupling
impairs endothelial progenitor cell mobilization and function in diabetes. Diabetes
56:666–674.
Toma, C., Letts, D.P., Tanabe, M., Gorcsan III, J., Counihan, P.J. (2007). Positive effect of
darbepoetin on peri-infarction remodeling in a porcine model of myocardial
ischemia–reperfusion. J Mol Cell Cardiol 43:130–136.
Toma, C., Pittenger, M.F., Cahill, K.S., Byrne, B.J., and Kessler, P.D. (2002). Human
mesenchymal stem cells differentiate to a cardiomyocyte phenotype in the adult
murine heart. Circulation 105:93–98.
Tong, Q., Zheng, L., Lin, L., Li, B., Wang, D., Huang, C., Li, D. (2006). VEGF is
upregulated by hypoxia-induced mitogenic factor via the PI-3K/Akt-NF-kappaB
signaling pathway. Respir Res 7(1):37.
Tramontano, A.F., Muniyappa, R., Black, A.D., Blendea, M.C., Cohen, I., Deng, L., Sowers,
J.R., Cutaia, M.V., El-Sherif, N. (2003) Erythropoietin protects cardiac myocytes
from hypoxia-induced apoptosis through an Akt-dependent pathway. Biochem
Biophys Res Commun 308:990–4.
Tschope, C., Walther, T., Escher, F., Spillmann, F., Du, J., Altmann, C., Schimke, I., Bader,
M., Sanchez-Ferrer, C.F., Schultheiss, H.P., et al. (2005). Transgenic activation of the
kallikrein-kinin system inhibits intramyocardial inflammation, endothelial
dysfunction and oxidative stress in experimental diabetic cardiomyopathy. Faseb J
19(14):2057–2059.
Tschope, C., Walther, T., Koniger, J., Spillmann, F., Westermann, D., Escher, F.,
Pauschinger, M., Pesquero, J.B., Bader, M., Schultheiss, H.P., Noutsias, M. (2004).
Prevention of cardiac fibrosis and left ventricular dysfunction in diabetic
cardiomyopathy in rats by transgenic expression of the human tissue kallikrein gene.
Faseb J 18(7):828–835.
Tuo, Q., Zeng, H., Stinnett, A., Yu, H., Aschner, J.L., Liao, D. (2008). Critical role of
angiopoietins/Tie-2 in hyperglycemic exacerbation of myocardial infarction and
impaired angiogenesis. Am J Physiol Heart Circ Physiol 294:H2547–H2557.
Ueda, K., Takano, H., Niitsuma, Y., Hasegawa, H., Uchiyama, R., Oka, T., Miyazaki, M.,
Nakaya, H., Komuro, I. (2010). Sonic hedgehog is a critical mediator of
erythropoietin-induced cardiac protection in mice. J Clin Invest 120(6):216–229.
UK Prospective Diabetes Study Group. (1998). Tight blood pressure control and risk of
macrovascular complications in type 2 diabetes: UKPDS 38. BMJ 317:703–711.
UK Prospective Diabetes Study Group. (2000). Association of glycemia with macrovascular
and microvascular complications of type 2 diabetes (UKPDS 35): prospective
observational study. BMJ 321:405–412.
Urbich, C., DImmeler, S. (2004). Endothelial progenitor cells: characterization and role in
vascular biology. Circ Res 95:343–353.
Vanhoutte, P.M. (1988).The endothelium--modulator of vascular smooth-muscle tone. N
Engl J Med 319:512–3.
Verfaillie, C.M. (2002). Adult stem cells: assessing the case for pluripotency. Trends Cell
Biol 12:502–08.
Verma, S., Maitland, A., Weisel, R.D., Li, S.H., Fedak, P.W., Pomroy, N.C., Mickle, D.A.,
Li, R.K., Ko, L., Rao, V. (2002). Hyperglycemia exaggerates ischemia reperfusion-
induced cardiomyocyte injury: reversal with endothelin antagonism. J Thorac
Cardiovasc Surg 123:1120–1124.
Voulgari, C., Papadogiannis, D., Tentolouris, N. 2010. Diabetic cardiomyopathy: from the
pathophysiology of the cardiac myocytes to current diagnosis and management
strategies. Vasc Health Risk Manag 6:883–903.
Wagner, W., Horn, P., Castoldi, M., Diehlmann, A., Bork, S., et al. (2008). Replicative
Senescence of Mesenchymal Stem Cells: A Continuous and Organized Process. PLoS
ONE 3(5):e2213.
Wang, J., Song, Y., Wang, Q., Kralik, P.M., Epstein, P.N. (2006). Causes and Characteristics
of Diabetic Cardiomyopathy. Rev Diabetic Stud 3(3):108–117.
Wang, J.S., Shum-Tim, D., Galipeau, J., Chedrawy, E., Eliopoulos, N., and Chiu, R.C.
(2000). Marrow stromal cells for cellular cardiomyoplasty: feasibility and potential
clinical advantages. J Thorac Cardiovasc Surg 120:999–1005.
Wang, Y., Haider, H.Kh., Ahmad, N., Zhang, D., Ashraf, M. (2006). Evidence for ischemia
induced host-derived bone marrow cell mobilization into cardiac allografts. J Mol
Cell Cardiol 41:478–487.
Weissman, I.L. (2000). Translating stem and progenitor cell biology to the clinic: barriers
and opportunities. Science 287:1442–46.
Westermann, D., Rutschow, S., Jager, S., Linderer, A., Anker, S., Riad, A., Unger, T.,
Schultheiss, H.P., Pauschinger, M., Tschope, C. (2007). Contributions of
inflammation and cardiac matrix metalloproteinase activity to cardiac failure in
diabetic cardiomyopathy: the role of angiotensin type 1 receptor antagonism.
Diabetes 56(3):641–646.
Westermann, D., Van Linthout, S., Dhayat, S., Dhayat, N., Schmidt, A., Noutsias, M., Song,
X.Y., Spillmann, F., Riad, A., Schultheiss, H.P., et al. (2007). Tumor necrosis
factoralpha antagonism protects from myocardial inflammation and fibrosis in
experimental diabetic cardiomyopathy. Basic research in cardiology 102(6):500–507.
Wright ,G.L., Hanlon, P., Amin, K., Steenbergen, C., Murphy, E., Arcasoy, M.O. (2004).
Erythropoietin receptor expression in adult rat cardiomyocytes is associated with an
acute cardioprotective effect for recombinant erythropoietin during ischemia–
reperfusion injury. FASEB J 18:1031–1033.
Yagyu, H., Chen, G., Yokoyama, M., Hirata, K., Augustus, A., Kako, Y., Seo, T., Hu, Y.,
Lutz, E.P., Merkel, M., Bensadoun, A., Homma, S., Goldberg, I.J. (2003).
Lipoprotein lipase (LpL) on the surface of cardiomyocytes increases lipid uptake and
produces a cardiomyopathy. J Clin Invest 111(3):419–426.
Ying, Q.L., Nichols, J., Evans, E.P., et al. (2002). Changing potency by spontaneous fusion.
Nature 416:545–48.
Zhang, D., Zhang, F., Zhang, Y., Gao, X., Li, C., Yang, N., Cao, K. (2007). Combining
erythropoietin infusion with intramyocardial delivery of bone marrow cells is more
effective for cardiac repair. Transpl Int 20(2):174–83.
Zhang, D.G., Zhang, F.M., Zhang, Y.Q., Zhou, F., Gao, X., Li, C.F., Cao, K.J. (2006).
Erythropoietin enhances the therapy potency of autologous bone marrow stromal cells
in a rat heart infarction model via phosphatidylinositol-3-kinase/Akt pathway.
Zhonghua Xin Xue Guan Bing Za Zhi 34(10):912–6.
Zhang, L., Cannell, M.B., Phillips, A.R., Cooper, G.J., Ward, M.L. (2008). Altered calcium
homeostasis does not explain the contractile deficit of diabetic cardiomyopathy.
Diabetes 57(8):2158–2166.
Zhang, N., Li, J., Luo, R., Jiang, J., Wang, J.A. (2008). Bone marrow mesenchymal stem
cells induce angiogenesis and attenuate the remodeling of diabetic cardiomyopathy.
Exp Clin Endocrinol Diabetes 116:104–111.
Zhou, Y., Larsen, P.H., Hao, C., Yong, V.W. (2002). CXCR4 is a major chemokine receptor
on glioma cells and mediates their survival. J Biol Chem 277:49481–49487.
PUBLICATION
Growth Factor Preconditioning Increases the Functionof Diabetes-Impaired Mesenchymal Stem Cells Mohsin Khan,* Shoaib Akhtar,* Sadia Mohsin, Shaheen N. Khan, and Sheikh Riazuddin
STEM CELLS AND DEVELOPMENT Volume 20, Number 1, 2011
*Both authors equally contributed