plasmid-related anaerobic autotrophy of the novel archaebacterium sulfolobus ambivalens

3

© Nature Publishing Group 1985

Upload: scarlett

Post on 29-Jul-2016

213 views

Category:

Documents

1 download

Report

Download

Embed Size (px):

TRANSCRIPT

Page 1: Plasmid-related anaerobic autotrophy of the novel archaebacterium Sulfolobus ambivalens

© Nature Publishing Group1985

Page 2: Plasmid-related anaerobic autotrophy of the novel archaebacterium Sulfolobus ambivalens

© Nature Publishing Group1985

Page 3: Plasmid-related anaerobic autotrophy of the novel archaebacterium Sulfolobus ambivalens

© Nature Publishing Group1985

Subunit Cell Wall of Sulfolobus acidocaldarius · SUBUNITCELLWALLOFS. ACIDOCALDARIUS guanidine hydrochloride (pH7, 37 C), a hydro- gen bond-breaking reagent, caused a partial or complete

Lesion-induced Mutation in the Hyperthemophilic Archaeon ...€¦ · 3 ABSTRACT Hyperthermophilic archaea offer certain advantages as models of genome replication, and Sulfolobus

Splash Contents Chapter Introduction Autotrophy and Photosynthesis 4.1What Are Autotrophs? 4.2Overview of Photosynthesis 4.3The Light Reactions 4.4The

Animal nutrition Everyone’s gotta eat The big picture Autotrophy vs. heterotrophy Why do we need food? –Use as fuel for cellular work –Form important

Archaeal Extrachromosomal Genetic Elements · virus 1 [ASV1]) and Bicaudaviridae (Acidianus two-tailed virus 1 [ATV]). Unclassiﬁed spindle-shaped viruses (e.g., Sulfolobus tengchongenesis

The RNA Component of RNase P from the Archaebacterium

Evolution and Radiation of Photosynthetic Organismsdspace.mit.edu/bitstream/handle/1721.1/53742/12... · Sulfolobus Thermoproteus Thermofilum pSL 50 pSL 4 pSL 22 pSL 12 Marine group

University of Bath · Insights into substrate specificity of archaeal Entner-Doudoroff aldolases: the structures of Picrophilus torridus 2-keto-3-deoxygluconate aldolase, and Sulfolobus

Research Article Molecular Characterization of Copper and ...downloads.hindawi.com/journals/archaea/2013/289236.pdf · Determinants in the Biomining Thermoacidophilic Archaeon Sulfolobus

Phototrophy –Conversion of radiant energy from the sun into ATP and NADPH Autotrophy involves carbon fixation –Conversion of inorganic carbon into organic

1.0 BIODIVERSITY · 1/11/2019 · (Sulfolobus sp.). •State the importance of bacteria. PROKARYOTE DOMAIN BACTERIA e.g: E. coli DOMAIN ARCHAE: Sulfolobus sp. ... •Most fungi are

Chapter 17 Archaea. I. Phylogeny and General Metabolism 17.1 Phylogenetic Overview of Archaea 17.2 Energy Conservation and Autotrophy in Archaea

Unraveling the function of the two Entner–Doudoroff ...ruoff/febs12106-sup-0001-EquationsS1-S6_FigS1-S3… · Entner–Doudoroff branches in the thermoacidophilic Crenarchaeon Sulfolobus

Crenarchaea Sulfur reduction Sulfur respiration Sulfur oxidation Thermoproteus Sulfolobus COLD Crenarchaea

Evolution and Radiation of Photosynthetic Organisms...Evolution and Radiation of Photosynthetic Organisms ... Sulfolobus Thermoproteus Thermofilum pSL 50 pSL 4 pSL 22 pSL 12 Marine

Effects Hyperbaric Pressure a Deep-Sea Archaebacterium in

Sulfolobus acidocaldarius Transports Pentoses via a ... · RESULTS Identiﬁcation of xylose-inducible transcripts in S. acidocaldarius using RNA-seq analysis. GrowthexperimentswithS

University of Groningen Electron microscopy of ... · Chapter 5 83 UV-inducible cellular aggregation of the hyperthermophilic archaeon Sulfolobus solfataricus is mediated by pili

Succession in a water column An adapting ecosystem maneuvering between autotrophy and heterotrophy Jorn Bruggeman Theoretical biology Vrije Universiteit

Shifts between autotrophy and heterotrophy in the reef ......(predação sobre zooplâncton). Alguns estudos comprovam que corais com maior capacidade de alimentação heterotrófica

Sulfolobus acidocaldarius

The Genome Sequence of the Crenarchaeon Acidilobus ... · Both modiﬁed EM and ED pathways are en- ... Stok,Sulfolobus tokodaii; Msed,Metallosphaera sedula; Cmaq,Caldivirga maquilingensis;

Lesion-Induced Mutation in the Hyperthermophilic Archaeon ... · Lesion-Induced Mutation in the Hyperthermophilic Archaeon Sulfolobus acidocaldarius and Its Avoidance by the Y-Family

Chapter 20 Metabolic Diversity: Phototrophy, Autotrophy, Chemolithotrophy, and Nitrogen Fixation

This paper is available on line at ......aKMT Catalyzes Extensive Protein Lysine Methylation in the Hyperthermophilic Archaeon Sulfolobus islandicus but is Dispensable for the Growth

0&0jb.asm.org/content/early/2015/08/11/JB.00496-15.full.pdf3 49 VXJJHVWWKDW Sulfolobus *,16PD\VWDELOL]HWKHLQWH UDFWLRQRI0&0ZLWKWKHPRYLQJ 50 UHSOLFDWLRQIRUN IDFLOLWDWL QJSURFHVVLYH'1$XQZLQGLQJ

Shifting roles of heterotrophy and autotrophy in coral ... of Experimental Marine Biology and Ecology 252 (2000) ... SPM l , respectively) and a ... daily respiration exceeded daily

Transcriptome-wide discovery of circular RNAs in Archaea€¦ · Sulfolobus solfataricus P2 and S. acidocaldarius cells were grown organotrophically in 300-l enameld bioreactor (Bioengineering

The Lonely Guy (LOG) Homologue SiRe 0427 from the ... · The Lonely Guy (LOG) Homologue SiRe_0427 from the Thermophilic Archaeon Sulfolobus islandicus REY15A Is a Phosphoribohydrolase

Cellulose Degradation by Sulfolobus solfataricus Requires ... · canases,(ii)exoglucanases,and(iii)-glucosidases.Endo--1-4-glucanases (EC 3.2.1.4) comprise cellulases and act directly

Two membrane-bound transcription factors regulate ... · Two membrane-bound transcription factors regulate expression of various type-IV-pili surface structures in Sulfolobus acidocaldarius

Characterization of the Archaeal Thermophile Sulfolobus

Advanced Bioinformatics (MB480/580) >Sulfolobus virus 1 complete genome 15465 bp. TTCGCCCGCTTACCGACGTACTTCGGTGAGGAACCGGTAACGGAGTTAG TACGCCCATAAGTTGAAACATTATCTCGTTTCGAAAGGAGGAAGAGGAA

The Sulfolobicin Genes of Sulfolobus acidocaldarius Encode … · Zernike Institute for Advanced Materials, University of Groningen, Nijenborgh 4, 9747 AG Groningen, The Netherlands2;

12345 A protist is any organism that is not a plant, an animal, a fungus, or a(an) 1.eukaryote. 2.prokaryote. 3.eubacterium. 4.archaebacterium