pipeline news november 2011

PIPELINE NEWSSaskatchewan’s Petroleum Monthly Canada Post Publication No. 40069240

November 2011 FREE Volume 4 Issue 6

Co-opCo-opRe nery FireRe nery Fire

Page A2Page A2

Chasing the Chasing the hook: Skylifthook: Skylift

Page C1Page C1

CareerCareerOpportunities

Page C20Page C20

Sales • Lease • Service • Parts • RepairRegistered B620 Certifi ed Shop

All Types of Tankers, Vac Trailers, Gravel, Grain, Livestock, Goosenecks, Open and Enclosed

Recreational Trailers

Hwy. 16 West, Lloydminster, AB ∙ 1-866-875-7665 ∙ 1-780-875-7667 ∙ www.tnttankandtrailer.com

Heil DOT407 38 & 46 Cube, 1 & 2 CompartmentHeil & Hutchinson TC406 Crude 38 CubeNew 2011 27 Cube Acro ALum Dumping Vac Trailer

2011 used Hutchinson 18 Cube TC406 Crude Stiff Pole PupTremcar DOT407, 38 & 42 Cube, 1 & 2 Compartment Heil DOT407 Quad Wagon, 32 Cube

Hutchinson TC406 11 & 16 Cube

1985 Krohnert Tri Axle, Stainless, Insulated, Portable Water

North Country Triaxle End Dump

2055 Kenworth T800, 4” T&E Hyd Pump

1997 Polar 34 Cube, 306 Crude

Advance & Hutch, 34 Cube, Water Trailers (7 avail)

Crane business is pickingup

Mammoet, with the red crane, and Myshak Crane and Rigging, with the white crane, respond to a bridge collapse in Lloydminster caused by an over height load on Oct. 11. See story page A3. Photo by Geoff Lee

A2 PIPELINE NEWS November 2011

NewsNotes

Briefs courtesy Nickle’s Daily Oil Bulletin

We Also Have:We Also Have:40 Wheel Combo Trailer40 Wheel Combo Trailer30 Ton Tow Trucks 30 Ton Tow Trucks 40 Ton Sliding Boom Recovery Unit 40 Ton Sliding Boom Recovery Unit Air Cushion RecoveryAir Cushion Recovery30 Ton Winch Tractors30 Ton Winch Tractors

Our 60 Ton Tandem Our 60 Ton Tandem Tri-Drive Tow Truck Tri-Drive Tow Truck

Safely Tows All Your Safely Tows All Your Service Rigs,Service Rigs,

Coil Tubing,Coil Tubing,Flushbys, Picker TrucksFlushbys, Picker Trucks

780.875.HOOK780.875.HOOK4 6 6 5

Highway 16 West 10 Miles West of Lloydminster

Tri Drive 30 TonTri Drive 30 Ton

30 Ton Winch Tractor30 Ton Winch Tractor

By Brian ZinchukPipeline News

Regina – An explosion and subsequent fi re hit

the Consumers’ Co-operative Refi neries Ltd. com-

plex in Regina on Oct. 6 at approximately 2 p.m.

Th e fi re was quickly extinguished by the refi n-

ery’s response team. While city fi refi ghters were

staged in response, they were not required to put out

the fi re.

Th irteen people were transported to hospital, 10

by emergency medical services, and another three by

a contractor working on the site, according to Vic

Huard, Co-op vice-president of corporate aff airs.

Of the 13 taken to hospital, 10 were treated and

promptly released. One was treated and released

shortly thereafter. Of the two remaining in hospital,

one was released on Oct. 14 for further outpatient

treatment in Edmonton, while the fi nal person re-

mained in critical condition in Regina General Hos-

pital as of Oct. 14. Th e critically injured person was

reported as improving daily, according to a represen-

tative of the contractor that person was working for.

Both of the fi nal two victims were scaff olders

with Skyway Canada Ltd.

A further 23 people reported injuries to Oc-

cupational Health and Safety, but none of these re-

quired medical treatment at a hospital, according to

Huard.

Initial reports from Huard and other Co-op of-

fi cials in a press conference a little over an hour after

the explosion indicated a diesel and hydrogen fi re.

On Oct. 18 Huard told Pipeline News they did

not yet know the source, but what had burned was

diesel and hydrogen, which had apparently found

an ignition source. Th e refi nery is co-operating with

the independent investigation being conducted by

Regina Fire and Protective Services, Saskatchewan

Occupational Health and Safety, the Offi ce of the

Fire Commissioner, and the provincial boilers and

vessels branch.

Th e incident happened in an older area of the

plant that was being “revamped.” Th e refi nery com-

plex is currently undergoing a multi-year $1.9 billion

expansion and revamp. Th e expansion is intended to

increase production by 30,000 bpd next year. Th e fi re

is not expected to aff ect that expansion plan.

Th ere were approximately 2,500 people working

on the site at the time, the vast majority of whom

were contractors working on the revamp and the ex-

pansion. Huard reported they had accounted for all

the workers within the revamp area within 75 min-

utes.

Th e Co-op refi nery supplies a substantial por-

tion of the Prairie provinces’ diesel and gasoline

needs. As of Oct. 18, Huard said there would be a 20

per cent reduction of diesel production capacity until

May 2012. While gasoline production was initially

down 50 per cent for one week, they were able to get

it back up to 90 per cent of normal production.

Th e company is working on cross-purchase

agreements with other refi ners to fi ll in the gap.

To increase diesel production, the refi nery is

now using more light synthetic crude, but is process-

ing less heavy crude.

The Consumers’ Co-operative Re neries Ltd. complex in Regina suffered an explosion and re on Oct. 6. A total 36 people reported in-

juries, 13 of whom were treated at hospital, and of those, two remained in hospital for a signi cant time. This le photo was taken in August, 2010.

Explosion and re rock Regina Co-op re nery

Sask. rig count strong, down

slightlySaskatchewan’s drilling rig count remains

strong, but has slipped slightly in the early fall

compared to its sky-high summer numbers.

According to Nickle’s Rig Locator (www.ri-

glocator.ca) on Oct. 19, there were 96 drilling rigs

working in Saskatchewan, down from the 110

level seen for much of the previous three months.

It was still about a half dozen rigs more than what

was seen in 2010, and 30 more than the same time

in 2009.

Th e slight downward trend was in part due to

some substantial rain in southeast Saskatchewan.

One rig operator told Pipeline News the ground

has been so saturated from earlier in the year, it

didn’t take much to make it too wet to work, and

as a result they had some rigs down.

All told, Saskatchewan’s rig count has been

higher than 2010 numberd and substantially

higher than 2009 numbers for all the year except

for the period from mid-April to mid-June.

Diaz updates Lloydminster

wellsDiaz Resources Ltd. announced Sept. 28 that

its three recently drilled horizontal heavy oil wells

at Lloydminster, Alberta, had been on production

for 30 days and are averaging a combined rate of

200 bpd.

Th e new wells bring production from the Di-

az-operated pool to approximately 350 bpd.

Diaz has a 50 per cent working interest in the

Lloydminster pool and anticipates that addition-

al development drilling will begin in the fourth

quarter.

PIPELINE NEWS November 2011 A3

NewsNotes

Briefs courtesy Nickle’s Daily Oil Bulletin

Specialists in Internal & External Coating ApplicationsEpoxy Linings • Metalizing • Fiberglass • 100% Solids Epoxy

Pipe, Bends, Tanks & Vessels

“Industry Leading Quality and Service Since 1987”6150 - 76 Avenue, Edmonton, AB T6B 0A66150 - 76 Avenue, Edmonton, AB T6B 0A66150 - 76 Avenue, Edmonton, AB T6B 0A66150 - 76 Avenue, Edmonton, AB T6B 0A66150 - 76 Avenue, Edmonton, AB T6B 0A6

Phone: 780-440-2855 Fax: 780-440-1050Email: [email protected] www.brotherscoating.comEmail: [email protected] www.brotherscoating.comEmail: [email protected] www.brotherscoating.comEmail: [email protected] www.brotherscoating.comEmail: [email protected] www.brotherscoating.com

By Geoff Lee Pipeline News

Lloydminster – Myshak Crane and Rigging

(MCR) proved to be Johnny-on-the-spot at the

scene of a collapsed Canadian Pacifi c rail overpass

on Highway 16 at the east end of Lloydminster on

Oct. 11.

Th e severed spur rail line serves the Lloydmin-

ster Husky Upgrader whose operations were not af-

fected as trains were re-routed to CP tracks east of

the accident location.

MCR, based in Edmonton, just happened to

have a 500-ton crane in town working at the ADM

canola processing plant where managers quickly

gave them the okay to respond to the transportation

emergency.

“I think it was a benefi cial thing that we were

in town,” said MCR crane supervisor Jason Tymo-

fi chuk.

“I heard on the radio that the mayor was happy.

A lot of people were shocked how quickly we got

that thing cleaned up.”

MCR teamed up with Mammoet who sent a

similar 500-ton crane to the scene from Edmonton

the next morning to help lift and load the girder

onto a fl atbed – all within 24 hours.

Th e steel overpass was struck by an overheight

excavator loaded on the back of an eastbound semi

the afternoon of Oct. 11, forcing a detour of all high-

way traffi c through the area.

“It’s worth noting this was an overheight load

being carried on the fl at deck truck,” said CP spokes-

person Mike Lovecchio from Vancouver.

“It was very simply a case of situational aware-

ness and a failure of situational awareness on the part

of the truck operator that led to this incident.”

Th e highway re-opened the evening of Oct. 12

with thanks from Lloydminster Mayor Jeff Mulli-

gan to MCR, ADM and emergency responders in a

message broadcasted that night.

“Fortunately, no one was seriously hurt in this

accident. And thanks to the dedicated work of many

talented and dedicated professionals, together with

help from ADM, who provided access to a crane

service that was working on-site on their project, we

were able to re-open the highway late tonight,” said

Mulligan.

Th e next morning, MCR crane supervisor Ja-

son Tymofi chuk told the Pipeline News he and crane

operator Tyson Seehagel got involved after hearing

about the accident on the radio while doing crane

work at the ADM plant in town. Page A6

MCR, Mammoet, adynamic duo in 911 job

A semi carrying an overheight backhoe struck the CP rail overpass on Highway 16 on Oct. 11 col-lapsing it onto the highway. Myshak Crane and Rigging (MCR) and Mammoet worked together to lift and remove the girder within 24 hours with the highway re-opening shortly thereafter. Cranes will be used again to reinstall the repaired girder in the coming weeks.

Tuscany Energy Ltd. announced Oct. 7 it had

placed a recently drilled Dina horizontal heavy oil

development well on production at Evesham, Sas-

katchewan, with an average fl ush production rate

of 110 (66 net) bpd.

Tuscany has a 60 per cent interest in this well

and is the operator.

Th e well was the fi rst to be drilled on the west

side of the pool, from a new production pad. Tus-

cany plans to drill two more wells from this pro-

duction pad in the fourth quarter.

At Macklin, Saskatchewan, Tuscany has

drilled a horizontal well into another Dina heavy

oil pool. Th e well was placed on production Sept.

18 at a fl ush production rate of 110 (60.5 net) bpd.

Tuscany has a 55 per cent working interest in the

well and is the operator. It plans to shoot addition-

al 3D seismic over the Macklin project to assist in

fi nalizing a development plan for 2012.

Th e company’s partner in the Macklin project,

Diaz Resources Ltd., holds the remaining 45 per

cent working interest.

Tuscany updates Evesha, Macklin drilling

Southern Paci cadds well pairs

At its STP-Senlac thermal project, Southern

Pacifi c Resources Corp. committed to its develop-

ment plan, which includes maintaining produc-

tion levels on an annual basis between 4,000 bpd

and 5,000 bpd. Over the past quarter, the property

achieved an average production rate of 4,829 bbls per

day, primarily a result of the recent addition of Phase

H, which consists of two SAGD well pairs placed on

production in April 2011.

As part of its development strategy, Southern

Pacifi c was now drilling in early October and pre-

paring Phase J for production. It consists of three

SAGD well pairs, which may not all be needed until

later in the fi scal year and will be layered into the

facility as capacity permits.

Southern Pacifi c recently completed a scheduled

bi-annual maintenance turnaround at STP-Senlac.

Th e turnaround took only nine days to complete

compared to the 14 days for which it had budgeted.

All the wells are now back on production.

Mission Statement:Pipeline News’ mission is to illuminate importance of Saskatchewan oil as an integral part of the province’s sense of community and to show the general public the strength and character of the industry’s people.

Pipeline NewsPublisher: Brant Kersey - Estevan

Ph: 1.306.634.2654

Fax: 1.306.634.3934

Editorial Contributions: SOUTHEAST

Brian Zinchuk - Estevan 1.306.461.5599

SOUTHWEST

Swift Current 1.306.461.5599

NORTHWEST

Geoff Lee - Lloydminster 1.780.875.6685

Associate Advertising Consultants:SOUTHEAST

• Estevan 1.306.634.2654

Cindy Beaulieu

Glenys Dorwart

Kristen O’Handley

Deanna Tarnes

Teresa Hrywkiw

SOUTHWEST

• Swift Current 1.306.773.8260

Doug Evjen

Stacey Powell

NORTHWEST

• Lloydminster Daniela Tobler 1.780.875.6685

MANITOBA

• Virden - Dianne Hanson 1.204.748.3931

• Estevan - Cindy Beaulieu 1.306.634.2654

CONTRIBUTORS

• Estevan - Nadine Elson

To submit a stories or ideas:

Pipelines News is always looking for stories or ideas

for stories from our readers. To contribute please

contact your local contributing reporter.

Subscribing to Pipeline News:

Pipeline News is a free distribution newspaper, but

is now available online at www.pipelinenews.ca

Advertising in Pipeline News:

Advertising in Pipeline News is a newer model cre-

ated to make it as easy as possible for any business

or individual. Pipeline News has a group of expe-

rienced staff working throughout Saskatchewan

and parts of Manitoba, so please contact the sales

representative for your area to assist you with your

advertising needs.

Special thanks to JuneWarren-Nickle’s Energy Groupfor their contributions and assistance with Pipeline News.

Published monthly by the Prairie Newspaper Group,

a division of Glacier Ventures International Corporation,

Central Offi ce, Estevan, Saskatchewan.

Advertising rates are available upon request and are sub-

ject to change without notice.

Conditions of editorial and advertising content: Pipe-

line News attempts to be accurate, however, no guarantee

is given or implied. Pipeline News reserves the right to re-

vise or reject any or all editorial and advertising content as

the newspapers’ principles see fi t. Pipeline News will not

be responsible for more than one incorrect insertion of an

advertisement, and is not responsible for errors in adver-

tisements except for the space occupied by such errors.

Pipeline News will not be responsible for manuscripts,

photographs, negatives and other material that may be sub-

mitted for possible publication.

All of Pipeline News content is protected by Canadian

Copyright laws. Reviews and similar mention of material

in this newspaper is granted on the provision that Pipeline

News receives credit. Otherwise, any reproduction with-

out permission of the publisher is prohibited. Advertisers

purchase space and circulation only. Rights to the adver-

tisement produced by Pipeline News, including artwork,

typography, and photos, etc., remain property of this news-

paper. Advertisements or parts thereof may be not repro-

duced or assigned without the consent of the publisher.

Th e Glacier group of companies collects personal infor-

mation from our customers in the normal course of busi-

ness transactions. We use that information to provide you

with our products and services you request. On occasion

we may contact you for purposes of research, surveys and

other such matters. To provide you with better service we

may share your information with our sister companies and

also outside, selected third parties who perform work for

us as suppliers, agents, service providers and information

gatherers.

A4 PIPELINE NEWS November 2011 EDITORIAL

Editorial

One way or another, it is highly likely Saskatch-

ewan will have a sovereign wealth fund by this time four

years from now.

Last month Pipeline News spoke to each of the

three mainstream party leaders – the NDP’s Dwain

Lingenfelter, Liberals’ Ryan Bater, and Saskatchewan

Party’s Brad Wall. In some manner or another, all sup-

port the creation of a sovereign wealth fund.

Lingenfelter spoke at length about his plan, one of

the key planks in the NDP’s policy platform. He thinks

a small amount of non-renewable resources revenue,

$100 million a year, should start going into a sovereign

wealth fund like Norway’s, the most successful fund of

its kind in the world. Debt repayment is key, but repay-

ment and savings could happen at the same time.

Bater pointed out that his fi rst speech as party

leader in 2008 declared support for such a fund. He’s

toying with the idea of half of those non-renewable

resource revenues going to the fund. But we must pay

down the debt fi rst, he said.

Wall’s support is more begrudging, likely because

it would be unwise for him politically to give too much

credence to the major policy point of his opponent. In-

deed, his response to the question of does Saskatchewan

need such a fund was quite brief, stating, “Th e idea is

one I’ve talked about some time ago. We even talked

about it in opposition. It’s a good idea for an economy

that has a lot of resource wealth. But we have to pay off

the debt fi rst.”

Here’s where the if ’s come in. If Bater or Lingen-

felter were to be elected, a sovereign wealth fund is

a sure thing. Th ere is no hope of Bater forming gov-

ernment, indeed, the Liberals will have a tough time

getting one or two seats. Lingenfelter is so far behind

Sovereign wealth fund is coming

in the polls, he’ll have a heck of a time maintaining the

seats he has, never mind causing an upset.

So will Wall do it? His attention seems to be almost

single-minded on paying down the debt, which is prob-

ably the smartest course of action. If we can survive

what is looking like a double-dip recession relatively

unscathed, and if we can pay off the $3 or so billion

remaining of provincial, non-Crown corporation debt

over the next four years, then we just may see such a

fund in place.

Wall argues that we essentially have a fund already

in place, the so-called rainy day fund, which was drawn

upon to deal with non-budgeted items like the fl oods of

2011, when it was indeed raining. However, the struc-

ture of the fund diff ers quite a bit from what Lingen-

felter subscribes to.

Th e Norwegian fund is interesting in that its invest-

ments are entirely outside of Norway, due to the infl a-

tionary nature of adding billions of dollars to the Nor-

wegian economy. Should Saskatchewan structure such

a fund to keep it from becoming a political football, i.e.

keeping the fund from investing in Saskatchewan proj-

ects that are questionable or political in nature? (Alberta

is the prime example here.) Lingenfelter seems to think

so, saying it should be apolitical. While he wouldn’t en-

tirely rule out Saskatchewan investment, he thinks that

should be left up to fund managers, not politicians.

Any way you look at it, a sovereign wealth fund for

Saskatchewan is an idea whose time has come. It’s really

hard to argue against saving for the future.

So yes, let’s pay down the debt. But after that’s done,

Saskatchewan should form its own sovereign wealth

fund, modelled on Norway’s success. It’s too good an

idea to ignore.

OpinionPIPELINE NEWS November 2011 A5

PIPELINE NEWS INVITES OPPOSING VIEW POINTS. EDITORIALS AND LETTERS TO THE EDITOR ARE WELCOME.

Email to: [email protected]

Brian Zinchuk

From the top of

the pile

Geoff Lee

Lee Side of Lloyd

It’s potpourri time again, so please enjoy the

mixed bag of subjects for commentary beginning

with the 18th Technical Heavy Oil Symposium held

in Lloydminster in September.

Symposium steeped in innovation talkMany of this year’s presentations served to make

the point that the heavy oil industry is driven by in-

novation and technology developed in Lloydminster

and other heavy oil centres in Western Canada.

A case in point is a new product by Noralta

Technologies Inc. called the nGauge that will allow

operators to accurately monitor and measure all of

the fl uid interfaces in a production tank or process

vessel with bottom line savings in fl uid hauling be-

ing just one benefi t.

Th e product is not on the market yet, but there

was no better place to introduce its near readiness

than to potential clients at the symposium.

Another innovative topic by Weatherford fo-

cused on the skyrocketing demand for steam injec-

tion control devices that distribute steam evenly in a

steam assisted gravity drainage (SAGD) reservoir.

Th e new devices allow for improved steam-oil

ratios and smaller carbon footprints from thermal

projects.

Other presentations by Champion Technologies

and Trican Well Service focused on new chemical

solutions to stimulating oil production from dam-

aged or underperforming wells.

All of the topics and speakers fi t into the innova-

tive and technical mould the symposium is intended

to address, so from that perspective the event was a

success.

Fracking on the front burnerTh e Canadian Association of Petroleum Pro-

ducers’ (CAPP) new guidelines for the hydraulic

fracturing of shale gas by are well timed given the

growing public debate and concern for fracking fl u-

ids on water quality and the environment.

When it comes to fresh supplies of drinking wa-

ter, there can be no compromises for human health

or the environment.

Quebec halted its fl edgling shale-gas industry

earlier this year following recommendations in an

environmental-assessment report that advised the

province to conduct more studies on the ecological

risks.

In August, Southwestern Resources Canada put

all seismic testing in New Brunswick on hold due to

ongoing protests over shale gas development where

fracking is used.

Fracking involves injecting a mixture of chemi-

cals, water and sand into the ground to help release

gas and oil.

CAPP’s new guidelines announced Sept. 10 in-

clude improved water and fl uids reporting practices

that apply to all CAPP natural gas producing mem-

bers operating in Canada.

CAPP president Dave Collyer said that protect-

ing Canada’s water resources is fundamental to the

industry’s social licence to operate and to grow.

He also said with the increase in natural gas pro-

duction from unconventional sources such as shale,

Canadians have told the industry they want more

information as to how industry uses and protects

water.

Th e CAPP principles address those concerns.

Th ey also articulate industry’s water management

objectives and water protection practices. CAPP

members will focus eff orts to improve water perfor-

mance by industry over time.

Th e new guidelines commit CAPP members to

support the disclosure of fracturing fl uid additives.

CAPP will also continue to advance, collaborate

on and communicate technologies and best practices

that reduce the potential environmental risks of hy-

draulic fracturing.

Th e guidelines include a commitment to safe-

guard the quality and quantity of regional surface

and groundwater resources, through sound wellbore

construction practices, sourcing fresh water alterna-

tives where appropriate, and recycling water for re-

use as much as practical.

Another guideline calls for CAPP to measure

and disclose water use with the goal of continuing to

reduce our eff ect on the environment.

CAPP also pledges to support the development

of fracturing fl uid additives with the least environ-

mental risks.

Th e guidelines show that the upstream industry

listens and respond to its critics along with a convic-

tion to promote its strong track record as a safe and

reliable producer of natural gas.

Two for one from Lee Side columnist

Th is month Pipeline News is focusing on cranes

and pickers. In preparing my list of possible stories,

one quickly rose to the top of the list.

By far, the most cranes in the province can be

found at the Regina Consumers Co-op Refi nery

Complex. I had been there a year ago, and lost count

of how many cranes there were on site. It was an

awful lot, working on an approximately $1.9 billion

revamp and expansion to the facility.

So on Oct. 3 I left a message for the facility

manager, and followed up with an e-mail. Not hear-

ing back, the next day I called. While he liked the

last piece I did, they were terribly busy, and simply

wouldn’t have time to have me come down right now.

Maybe a few months down the road, he off ered.

My initial plan had been to go to Regina on

Th ursday, Oct. 6. My wife was taking our son in for a

dental appointment, so it would have been a perfect

opportunity to kill two birds with one stone. My re-

quest was to do a brief interview with the manager,

followed by a tour of the cranes at work, and possibly

a short interview with the crane foreman. If it all had

gone according to plan, I would have done the initial

interview at 1 p.m., and been on the site, taking pic-

tures, around 2 p.m.

At about 2 p.m., a fi reball arose from one of the

older parts of the refi nery, followed by a fi re. Th ir-

teen people were treated medically. A subsequent 23

people reported injuries, but did not require medical

attention. Burns were the primary consideration.

If my best laid plans had gone forward, I would

have been within about a few hundred metres of the

explosion, maybe closer.

In my previous stories about the refi nery, one

thing that was impressed upon me was their strong

focus on safety. Indeed, we had talked about doing

a follow-on story about their safety program in the

spring of 2011, but I never followed up on it.

Now some may say, “Brian, they just had an ex-

plosion and fi re, and 36 people were injured. How

can you call that safe?”

Consider this: Including permanent staff and

contractors, there were just under 2,500 people on

site. A little over an hour after the explosion, I lis-

tened to the live news conference on CJME. By that

point, the fi re was under control, and all permanent

and contractor staff in the aff ected area were ac-

counted for. In just 75 minutes.

It’s hard enough to count heads with school kids

on a fi eld day, never mind account for thousands of

people on a site that covers the better part of a sec-

tion of land.

News video of the workers showed them gath-

ered in groups, mustered as expected. Every person I

saw on the TV had fl ame retardant coveralls.

It is precisely for this reason – a fl ash fi re – that

workers are required to wear such coveralls. You

can’t fi ght a fi re with them, but they can give you a

fi ghting chance in a situation like what happened. I

expect they would have made a diff erence for those

who were injured.

Th e company’s emergency responders were able

to put out the fi re without the assistance of Regina

Fire and Protective Services. City fi refi ghters were

staged, but not required in the end.

Th e area where the explosion took place was

part of the “revamp” project, and was an older area

of the plant. Th e initial indications were that a pipe

had leaked a mixture of diesel and hydrogen, and it

found an ignition source. Was that pipe part of the

planned revamp? Quite possibly. We don’t know. But

it might have been scheduled for maintenance, repair

or replacement in the coming months, as the project

reached its fi nal phases. It may simply have been a

situation of they were getting to it, but apparently

not quick enough.

For those who were injured, this incident will

be life altering, painful, and hard. But in the grand

scheme of things, it could have been much, much

worse. Th ere are dozens of massive storage tanks in

the vicinity. Th ousands of workers were on site. Th e

whole refi nery could have gone up.

Absolutely, something went terribly wrong. But

in the response, it appears, at least to this outsider, a

lot went right.

Brian Zinchuk is editor of Pipeline News. He can be reached at [email protected]

The close call that wasn’t


• 101 guests rooms • Meeting room facilities • Ample parking • Rusty’s Canadian Grille & Lounge • FREE high speed internet

For reservations call 1-888-700-2264 or visit www.bestcdn.com

Page A3“I’ve been in the industry for 15 years now. I kind

of fi gured we should go look at it,” he said. “So we

got there and knew they were going to need a crane

in order to do what they needed to do.

“We just happened to have a 500-ton crane.”

Th at crane is an all-terrain Liebherr LTM 1400

with a 197 foot main boom that has done previous

work in Lloydminster at the Husky upgrader, but

dealing with a collapsed rail girder is not routine.

“Th ese situations are always diff erent,” said Ty-

mofi chuk. “You never know what you are getting.

“Originally, I was told the bridge only weighed

60 tons, but after we hoisted on our loads, yesterday,

we lifted to 144,000 pounds which was already more

than what they said.

“Later, they told me it could weigh up to 100

tons, so I said ‘that’s quite a substantial diff erence

from the 60 tons.’

“When they couldn’t actually give me an actual

weight, I thought ‘I am not going to take the chance

of using one crane and having it too heavy.’

Page A7

Two 500-ton cranes lift bridge off semi

Above: MCR crane operator Tyson Seehagel, uti-lizing a 500-ton crane tested, the hoist weight of this collapsed CP rail girder at 144,000 pounds. After learning the girder could weigh up to 100 tons, the company called in Mammoet in Edmon-ton who sent their 500-ton crane to the scene the next morning. The two cranes worked together to lift and lower the wreckage within 24 hours. Both cranes needed 220,000 pounds of counter-weight.

MCR crane supervisor Jason Tymo chuk, left, gets briefed by a CP representative at the scene of a collapsed CP rail overpass in Lloydminster. MCR happened to have a 500-ton crane working at the ADM canola processing plant in town and got permission to respond the transportation emer-gency on Oct. 11.


www.exhaustmasters.ca

Complete Performance Exhaust for Gas, DPF and Diesel Vehicles Maximize Performance and Fuel Economy!

Specializing in Oilfield & Industrial ExhaustComponents and Systems

Specializing in Transport of Heavy and Oversized Equipment, Engineered Transport and Rigging Studies, SPMTs, Full Rail Services, Jacking Towers, Lift-N-Lock and Strand Jack Systems, State of the Art Rigging Equipment, Full Truckload and LTL Service - throughout North America. Hydraulic Cranes from 8 to 500 Ton Capacity, Crawler and Conventional Cranes

to 4000 Ton Capacity, Hydra-Slide Jacking and Skidding Systems, and Turnkey Transportation and Lifting Projects.

Mammoet strives to be the best full service provider, in the global market, for engineered lifting, and multi-modal transport

Worldwide specialists in heavy lifting and transport

www.mammoet.com

Over 80 Locations in over 40 Countries

WESTERN CANADA LOCATIONS

Bonnyville(780) 826-2253

Calgary(403) 252-0551

Edmonton(780) 449-0552

Fort McMurray(780) 791-5049

Pincher Creek(403) 627-4554

Vancouver, BC(778) 828-6516

Regina, SK(306) 523-4511

ALBERTA LOCATIONS

Page A6

“Your crane weighting is based on minimum

boom, right tight to you. Th e bigger radius you get

the less capacity you’re good for.”

Mammoet dispatched their own 500 ton LTM

1400 crane to the scene with MCR hoisting on end

of the fallen girder and Mammoet on the other to

get the job done safely.

“It’s not diffi cult to co-ordinate two cranes

working together,” said Tymofi chuk. “We picked it

up and swung it out of the way, clear of the hole.”

When the crushed semi with the excavator was

towed away, the two cranes got back to work and

swung the girder off to the far side of the road, set it

down then loaded it onto a truck.

Tymofi chuk said the job was a challenge, “be-

cause of the fact you don’t know what your factors

are – your weight and stuff ” including the tipping

angle.

“We were both running with 220,000 pounds of

counterweight.”

Lovecchio reports the bridge span was trans-

ported off site to the Edmonton area where will be

repaired and returned, but that date is yet to be de-

termined.

“Th e highway will have to be closed again so the

span can be reinstalled,” he said, noting CP owns the

bridge and the concrete piers.

“Th e full structure will be inspected prior to be-

ing brought back into service,” he added.

Tymofi chuk says the job was good PR for his

company and he hopes to come back and do the re-

installation crane work.

“Th at’s depending on how well they liked the

job we did. Th at’s all we can hope for. One or two

cranes will be used to put it back,” he said.

“Th ey say in two to three weeks it should be

ready to put back up. We should be able to do it our-

selves without Mammoet.

“We do have other cranes that can do what they

were doing too, and we get can a lot closer to the

bridge now that the hoe and everything is out of

there.”

Tymofi chuk says the MCR crane is equipped

with audible alarms when the lifting capacity is

reached, but he calls them more of an aid than a fail-

safe device.

“Th e number one thing that you deal with all

the time is your load charts. Th ey are printed off on

paper,” he said.

“Th e closer you get, the more lifting power you

have. Th e more boom that you sweep out, your charts

decrease as well because there is that much more

length.

“Th ere are certain attachments you can put on

this crane. We have a device called a super lift which

is a boom stiff ener, which increases your charts as

well.”

Th e LTM 1400 is one of the largest cranes in the

MCR fl eet that includes carry deck cranes, crawler

cranes, rough terrain hydraulic cranes and a variety

of picker trucks.

MCR also operates full crane services in Fort

McMurray, Red Deer and their newest location in

Bonnyville.

More power the closer you get


Monday to Friday

7:00 AM - 5:00 PM

4403 - 37th Ave.

Lloydminster, SK

(306) 825-2875

www.gforcediesel.com

M d F id h A

20 Service Bays

ALSO G FORCE DIESEL ESTEVAN!Best Performing

Pumps , Hoses & Accessories! T&E Pump Sales & Repair

306-636-5050221 - 4th Street

N!N!

!

O

m

ALSOALSO

PuPP m

LARGEST CANADIAN PDI CANADIAN PDI

DISTRIBUTORDISTRIBUTOR

LLLAAARRRGGG SSSLARGGESSTLLLAAARRRGGGEEESSSTT

Cat, Cummins & Detroit

DPF, EGR or VGTDPF, EGR or VGTSPECIALISTSSPECIALISTS

G Force Diesel Service Ltd.G Force Diesel Service Ltd.

Off road DPF, EGR

or VGT delete kits

available for your semi

By Geoff LeeEdmonton – Mammoet is no stranger to Lloydminster where the heavy lift-

ing and transport company regularly deploys a fl eet of carry decks, crawlers and

mobile cranes for Husky contract turnarounds and construction projects.

Th e international company gained public recognition and praise from of-

fi cials for its emergency work when they lifted and cleared a collapsed Canadian

Pacifi c overpass girder on Highway 16 in Lloydminster.

Th e company responded to the scene with a huge 500-ton LTM 1400 mo-

bile hydraulic crane.

Mammoet co-ordinated the 911 job with a similar LTM 1400 crane from

Myshak Crane & Rigging in Edmonton to help re-open the highway 24 hours

after a semi truck with an over height excavator struck and collapsed the bridge

on Oct. 11.

Th e crane work prompted a tour of Mammoet’s Western Canadian base in

Edmonton where Rick Patterson, director of hydraulic cranes, explained why

Rick Patterson, director of hydraulic cranes guided a tour of Mammoet’s base of operations in Edmonton where this massive 500-ton LTM mobile hydraulic crane was sent to Lloydminster to assist with an emergency lift of a collapsed CP overpass girder weighing up to 100 tons. Based on its lifting capacity, the LTM was the right crane for the job.

Mammoet responds to overpass collapse

the LTM 1400 was the right crane for that job.

“It’s got a great lifting capacity at a short radius,” he said, referring to the

LTM that was parked at the Mammoet complex with other cranes.

“Th at was part of the reason why it was chosen for that job.”

Th e LTM 1400 has a main boom of 197 feet and can be jibbed out to a reach

of 276 feet.

As for the challenge of co-ordinating the lift of the fallen CP steel girder

that weighed up to 100 tons, Patterson said good communication makes jobs

like that go off without a hitch.

“We were very successful working with the Myshak crane,” said Patterson,

who noted the lift was a big job for Mammoet.

“We do some emergency work with various rail companies when they have

train derailments. It’s a common type of work that we would do.”

Mammoet’s global lift and transport activities focus on the petrochemical

industry, civil engineering projects, power generation projects and off shore and

marine projects and include emergency situations.

Patterson says cranes are dispatched to job sites and emergencies from

whichever branch has equipment available including their growing crane and

transport operations in Regina and Saskatoon.

Mammoet’s transport fl eet in Saskatchewan includes everything from con-

ventional trailers right up to monster hydraulic platform trailers capable of car-

rying loads up to 100 feet long, 24 feet wide, and 20 feet high, weighing up to

200 tons.

“We transport just about anything oil and gas related – mining equipment,

oil and gas vessels, modules and any facility and plant pieces – pretty much any-

thing that will fi t on the trailer,” said Doug McCaskill, director of operations,

transport division.

“Length and dimensionally, we can pretty much move anything. Our trans-

port division covers everything from a small silo up to a big module.”

One of those monster 24 line hydraulic platform trailers is based at the

Edmonton yard where it is ready for duty hauling massive loads on public road-

ways.

“Its capacity depends on the area and the road confi guration,” said McCa-

skill.

“It’s typically used for hauling modular pieces for production plants and gas

plants and any large vessel that’s properly fi t on it.” Page A9


PICKER & OILFIELD HAULING SERVICE

• Boom & Knuckle Pickers• Boom & Knuckle Pickers•15-50 Ton/165’ Reach•15-50 Ton/165’ Reach

• Winch Tractor c/w Lo-Boys• Winch Tractor c/w Lo-Boys• Tandem & Tri-axle Trailers• Tandem & Tri-axle Trailers

• Tank Cradles c/w Hydraulic Arm• Tank Cradles c/w Hydraulic Arm• Pilot Trucks• Pilot Trucks

• Double Man Basket• Double Man Basket• ISN & Comply Works Member• ISN & Comply Works Member

• COR/IRP Certified• COR/IRP Certified

Lloydminster, SK/AB • Ph: 780-875-9250 • Fax: 780-875-4148

Proudly serving Lloydminster Area for over 20 Years

Mammoet has an array of mobile hydraulic cranes from 55 to 500 tons mobilized from its base of operations in Edmonton. In the background are the booms of 40, 60 and 80-ton rough terrain cranes.

Page A8Mammoet also manages a lot of heavy lifts and transport work from its

other Alberta bases in Calgary and Fort McMurray. McCaskill said the business

is picking up on all fronts.

“It’s very busy right now. Mammoet is progressively busy,” said McCaskill.

“We are roving billboards with all of the equipment we have. Obviously, we

are proud of our name because it’s all over everything in big white letters.”

McCaskill said when it comes to transporting huge loads on public high-

ways the job is neither easier nor harder in Saskatchewan than it is in Alberta.

“Every province has unique infrastructure challenges. Th e population den-

sity is one thing, but in this line of work you are careful no matter where you

are,” he said.

“Th ere are always restrictions and cautions to be taken. Saskatchewan has

challenges just like Alberta.”

Mammoet is also trying to keep pace with the demands for its lifting and

transport services in Saskatchewan with its strong mining, oil and gas, and pow-

er economy.

“We are fi nding that the workload is increasing year after year,” said Pat-

terson. “We are fi nding our branches in Regina and Saskatoon are getting an

increased market share every year.

“Oil and gas and mining are the drivers and some wind energy in southern

Saskatchewan. We are constantly going in and out of Saskatchewan and sup-

porting our group there.”

Th e largest cranes like the 500-ton LTM 1400 used to lift the collapsed

CP bridge in Lloydminster are mobilized from Edmonton, Calgary and Fort

McMurray.

At its Saskatchewan crane and transport operations, Mammoet uses smaller

cranes up to 200 tons for the local commercial, potash and oil and gas markets.

“Th ey would hoist compressor fl are stacks, components, coolers and boilers

that type of equipment. We also participate in turnarounds,” said Patterson.

“We work with Husky on a regular basis. We use similar cranes to the LTM

1400 and also cranes ranging from 9 ton carry decks up to 400-ton crawlers.”

Heavy lifter knows how to move mountains of metal

Mammoet is busy throughout Alberta too, with a wealth of construction

and oil and gas projects demanding their lifting and transport expertise and

services.

“We have been very fortunate,” said Patterson. “We’ve been relatively busy

throughout the downturn here. We see good things coming in the future. We are

involved in various projects all over Alberta. It defi nitely keeps us busy.

“We’ve got a strong presence in Fort McMurray with the various owners

up there with maintenance and new construction. We do a lot of heavy lifts and

transport in the Fort McMurray region.”


Millennium Oilflow Systems & Technology (MOST) is a manufacturing company making products for the oil field, specifically for production

of heavy oil by the artificial lift system (PCP application).

Products manufactured and sold are made to ISO 9001-2000, API and CSA standards.

Main Offi ce:4636 Eleniak RoadEdmonton, Alberta

Canada T6B 2S1TEL: 780.468.1058Fax: 780.468.9165

Lloydminster Offi ce:5103 62 Street

Lloydminster West, AlbertaCanada T9V 2B3

CELL: 780.808.0950CELL: 780.808.9852

We Are Environmentally FriendlyMOST products are some of the most environmentally friendly

solutions in the oil field services industry.

OUR POLICYTo manufacture precision, quality products that meets or exceeds industry standards and customer requirements while continually

striving for improvement.

Broker

Cell: (306) 460-7628Bus: (306) 463-1766 Fax: (306) 463-6631

[email protected]/kindersley

1 West Road, Kindersley, SK S0L 1S1

independently owned & operated

By Geoff LeeLloydminster – By practicing the golden rule in

business, Bry-Tan Trucking Ltd. has become a pick-

er and oilfi eld hauler of choice for many customers

in the Lloydminster area.

“We’ve got a lot of customers throughout the

years, and hopefully we treat them pretty good,” said

Bryan McGonigle, president.

“We treat them good, and hopefully they treat

us good too and keep on calling us back. I would

says about 95 per cent of our business is repeat busi-

ness.”

Bry-Tan’s work is performed with a core fl eet

of four stiff boom cranes, six knuckle pickers, three

winch trucks, and a highway tractor.

Th ey also have an assortment of low-boys, hi-

boys, tank cradles, pilot trucks, man baskets and re-

lated equipment ready to roll out of their four-acre

yard.

Bry-Tan counts contractors, equipment rental

Golden rule keeps Bry-Tan on a rollcompanies and utility operators among its loyal base

of customers requesting a variety of picker and haul-

ing services.

“We actually have one truck that works for

ATCO Electric,” said McGonigle. “It works for

them just about every day. Th ey are hauling poles

and transformers.

“Th e other ones are doing anything that’s related

to the oilfi eld. We haul everything from tubing and

rods to tanks.

“We’ve got fi ve tank cradles, so we do hauling of

tanks. We do a lot of spotting of tanks with the big-

ger pickers,” he said.

Bry-Tan also hauls and installs equipment such

as fi re tubes for Husky Energy and Canadian Natural

Resources during their spring battery turnarounds.

Th ey also handle day-to-day hauling of com-

pressors and buildings for new oilfi eld plants and

facilities in the area for a variety of clients.

“We’ve got diff erent types of trailers. We’ve got

hi-boys, low-boys, drop decks, and scissor necks,”

said McGonigle.

“We also haul equipment such as trackhoes and

loaders, and we haul a lot of rental equipment for

various companies.

Page A11

Bryan McGonigle, president of Bry-Tan Truck-ing, hangs onto the door railing of this 20-ton Manitex truck mounted stiff boom crane. The company has four Manitex stiff booms ranging from 20 to 50 tons.


Volvo Construction Equipment

dependable used parts from Strongco. Let’s Work.

1640 Enterprise RoadMississauga, ON L4W 4L4(905) 670-5100www.strongco.com

ALBERTACalgary (800) 342-6523

Edmonton (800) 252-9398

Grande Prairie (888) 513-9919

Red Deer (866) 950-3473

ATLANTICDartmouth (800) 565-1916

Moncton (800) 332-3338

Newfoundland (709) 747-4026

ONTARIOGrimsby (800) 668-9575

Kitchener (800) 265-2488

London (Lambeth) (800) 265-4762

Mississauga (800) 268-7004

Orillia (800) 268-7004

Ottawa (Stittsville) (800) 822-3308

Sudbury (Lively) (800) 267-9833

Thunder Bay (800) 465-5080

QUEBECBaie-Comeau (866) 996-3091

Boucherville (877) 674-8380

Chicoutimi (800) 323-1724

Laval (800) 363-6789

Ste-Foy (800) 463-2662

Val-d’Or (800) 561-4192

Strongco offers Used Parts and Rebuilt Components. Dependable solutions to help our Volvo and Champion Motor Grader customers continue to make the grade every day.

Tremendous Value Trusted Reliability• The same great quality and service that you • Carefully selected and thoroughly inspected have come to expect – but at a lower price. by Strongco service technicians.• Saves you money on repair costs. • 30-day used parts warranty.

Extended Machine Life What You Need, Now• Renewed strength, functionality and efficiency. • Fast access to a wide variety of used parts. • One of Canada’s largest used parts inventories for Champion Motor Graders.

We’re continuing to do our part to help you. Visit your nearest Strongco branch parts counter to speak to one of our specialists. Search our inventory online at www.tractor-part.com and at www.machinerytrader.com

Page A10“We do quite a bit on the residential side. We

do quite a few roof rafters and air conditioning

units and stuff like that. We have quite a bit of vari-

ance in the jobs that we do.”

Bry-Tan’s six knuckle-boom pickers have a lift-

ing capacity ranging from 18 to 42 tons. Th ey are

equipped with Palfi nger cranes that are operated by

remote control.

“We can get into a lot of buildings with them,”

said McGonigle.

“Th ey are basically good for a lot of diff erent

things. We haul a lot of pipe with them and build-

ings and stuff like that.

“Th e nice thing about the knuckle pickers is

that they are pretty easy to operate.”

All knuckle pickers are made overseas, but

Palfi nger has a distribution centre in Niagara Falls,

Ontario, when Bry-Tan can order parts over night.

“Th e biggest thing is parts availability. We don’t

put things together to sit on the front lawn to col-

lect dust,” said McGonigle.

“We want them out there working. You have to

be able to supply parts in order to get them opera-

tional. Everything breaks down.”

Bry-Tan’s four stiff boom pickers have lifting

capacities ranging from 20 to 50 tons with Mani-

tex cranes that can reach longer and higher than a

knuckle-boom.

“In various situations, the boom pickers are as

eff ective as the knuckle pickers are,” said McGoni-

gle.

“For a lot of people, it’s just a preference of

what they want to do.”

Th e 20 ton Manitex has about 68 feet of reach,

while the 30 ton has 156 feet of reach with a jib.

Th e 42 ton and the 50 ton can extend to 97 feet

and jibbed to 154 feet.

“Th ey are ideal for tank moving. Th at’s basically

what the two bigger ones are used for – hauling

tanks and setting tanks,” said McGonigle.

While 2011 has been one of Bry-Tan’s busiest

years, McGonigle says they were just as busy, if not

busier, that fi rst time oil hit $70 a barrel.

“When oil was at $140 we weren’t as busy as

when oil was at $70,” he said in reference to there

being a shortage of service workers in the oilfi eld.

“It was very hard to fi nd people to work. I don’t

know where everyone went to, but people kind of

vanished and it was hard to fi nd good employees.

“You can have all the equipment in the world,

Boom or knuckle-picker?

but if you don’t have good people to operate it, you

don’t have very much.”

Generating repeat business has been the driv-

ing philosophy behind the success of Bry-Tan since

McGonigle started the company in 1989 with a

truck and two employees.

“I started with Roy’s Trucking as a lease opera-

tor, and then I went on my own and we just kind of

grew from there,” he said.

“We have had a lot of people over the years that

we have worked for that I have been involved with

at some point in time,” said McGonigle.

“It’s not only the people that I’ve been involved

with, but the people that some of my guys have

been involved with. Page A12

There is never a dull moment for Bry-Tan Trucking, a company that gets the call each year to move this oatplane from the Lloydminster hangar to Sandy Beach, north of the city. The plane is lifted onto this lo-boy with the aid of a truck mount knuckle-boom Pal nger crane.

Photo submitted


would like to Welcome their new Dental TherapistLloydminster Paint& Supplies Ltd.

Daryl (780) 875-4454 or(780) 871-41095628 - 44 Street, Lloydminster, AB

ATV / SLED DECKS

Adjustable width decks also available

Re-usable and High Resale Value

• Our customers testify that we

have the best looking deck on the

market - and it is built to last

• If a customer decides to

purchase a different pickup the

deck can accommodate either

Short & Long Box trucks

• Easy to load & unload

• Reversible ramp for your

snowmobile & quad

• High quality brushed aluminum

requires no maintenance

• Rounded headache rack

• 4 side LED lamps

• Super Clamps Included

• Strongest (and longest) ramp

system on the market

v

NEW Shop Location 6303 63rd Ave (north of Kenworth)

Kevin - 780-871-8931Kevin - 780-871-8931Tyler - 780-872-3885Tyler - 780-872-3885

24 Hour Service 780-872-322524 Hour Service 780-872-3225

All RepairsAll Repairs• 1 ton to Class 1 to Service Rigs

• Safety Certified CVIP• Safety Certified CVIP• Preventative maintenance• Preventative maintenance

• Air Conditioning• Air Conditioning

3 Mobile Units3 Mobile UnitsAuthorized Repair Facility

••

Page A11“Some of my guys have worked with me for quite some time, so they bring

a lot of business into the realm of Bry-Tan Trucking.”

McGonigle’s right hand man is manager Mike Savoy who handles the dis-

patch and co-ordinates crews and equipment.

“Mike has been with me for approximately 12 years. He has run a lot of the

equipment. He ran a 17-ton and then he went to a 30-ton and a 42-ton,” said

McGonigle.

“Th ere is probably nobody who is more dedicated to what we do than Mike

is. He is very responsible and a good person to work with.”

Bry-Tan has grown to more than 30 employees today with McGonigle’s

wife Patrice managing the administration and the couple’s three sons Tanner,

Brayden and Riley working in operations.

Asked to recall a memorable business moment, McGonigle chose the day

they were called upon to pick a spray plane that crash-landed into a slough.

“We had to take that spray plane out of the slough and actually turn it in mid

air,” he said. “Th e plane wasn’t damaged hardly at all.

“It was pretty challenging to do that kind of thing with two pickers because

the plane was upside down. When we lifted it out of the water, we had to turn it

upright to put it back on its wheel.

“Th ere have been a few jobs throughout the years that have been pretty chal-

lenging.”

For McGonigle, every job Bry-Tan does is another opportunity to gain an-

other repeat customer.

“If you do a good job and people appreciate you, you usually go back again.

My theory is good news takes a long time to get around and bad new gets around

pretty fast.

“You don’t want the bad news to get around at all, but it’s the stuff that trav-

els the fastest,” McGonigle said.

Long-term workers bring in business

Bry-Tan Trucking, a picker and oil eld hauling service company, is owned and operated by Bryan McGonigle and his wife Patrice who have built their business based on satis ed repeat customers. Their three sons also work for the company in operations.

Bry-Tan Trucking has six truck mounted knuckle-boom cranes built by Pal nger including one 18-ton, two 22-ton, two 30-ton and one 42-ton crane for a variety of oil eld and related lifting and hauling work.


Meadow Lake – Th e

Meadow Lake Trib-

al Council (MLTC),

through its Resource

Developments Inc. busi-

ness entity, will develop

a 36 megawatt renew-

able power generation

facility at its 100 per

cent owned NorSask

sawmill.

Resource Develop-

ments will redirect the

mill’s fi bre waste prod-

ucts from a beehive

burner to a state-of-the-

art power generation

plant adjacent to the

mill to produce electri-

cal power for sale to the

province.

SaskPower and

MLTC signed a let-

ter of intent on Oct. 3

and are now working

on mutually agreeable

terms for the 25-year

power purchase agree-

ment, which is expected

to be completed by the

end of 2011.

Th e construction of

the biomass Meadow

Lake Bioenergy Cen-

tre next to the NorSask

mill will also generate

about 300 jobs includ-

ing 25 permanent jobs

at the facility.

Biomass is an in-

dustry term for using

renewable organic ma-

terial to generate en-

ergy.

Th e project is the

fi rst power development

project initiated by the

newly formed First Na-

tions Power Authority

in partnership with the

government of Sas-

katchewan and Sask-

Power.

“Th is is the fi rst

project to come about

through the support of

FNPA, which refl ects

the vision of the govern-

ment of Saskatchewan

to actively engage First

Nations in the prov-

ince’s growing econo-

my,” said Rob Norris,

minister responsible for

SaskPower.

“Th e project will

have a direct and posi-

tive impact on the local

community and sur-

rounding area, while

adding greener and

cleaner energy to Sas-

katchewan’s power

grid.”

Th e renewable pow-

er project is scheduled

to be in service in early

2014.

“Th e Meadow Lake

Bioenergy Centre is a

very signifi cant mile-

stone for the business

development vision of

Meadow Lake Tribal

Council,” said Chief

Eric Sylvestre.

Th ere are nine bands

in the MLTC including

fi ve Cree and four Dene

First Nations.

“We are excited

about the economic op-

portunities this project

will provide for our part-

nerships and our com-

munities, and it builds

upon more than 20

years of successful busi-

ness management. We

are proud to be leading

a major project in part-

nership with FNPA and

SaskPower.”

FNPA is a non-

profi t, membership-

based corporation

formed last spring to

set out a partnership

framework for a more

streamlined process to

help First Nations move

their generation projects

forward.

Each of the 74 Sas-

katchewan First Na-

tions is eligible to hold

membership.

“Congratulations to

MLTC on their hard

work and dedication to

make this project a real-

ity,” said FNPA execu-

tive director Jason Pol-

lock.

“Th eir vision and

leadership has not only

resulted in a much

needed renewable power

project for the province

of Saskatchewan, but

also the creation of this

organization (FNPA)

which will serve to as-

sist many other First

Nations in becoming

involved in the power

generation industry.

“SaskPower is to be

equally commended for

their commitment to

working with First Na-

tions, as demonstrated

by MLBC and their on-

going commitment to

the establishment of the

FNPA,” Pollock said.

First Nations togenerate green power

Call Brent or Darlene for all of your CCCCCCCCCaaaaaaaallllllllllllllll BBBBBBBBrrrrrrreeeeeeeennnnnnntttttttt oooooooorrrrrrr DDDDDDDDaaaaaaaarrrrrrrlllllllleeeeeeeennnnnnneeeeeeee ffffffffoooooooorrrrrrr aaaaaaaallllllllllllllll ooooooooffffffff yyyyyyyyoooooooouuuuuuuurrrrrrr equipment certi cation needs!eeeeeeeeqqqqqqqqquuuuuuuuiiiiiiiiipppppppppmmmmmmmmeeeeeeeennnnnnnnttttttttt cccccccceeeeeeeerrrrrrrrtttttttttiiiiiiiii ccccccccaaaaaaaatttttttttiiiiiiiiioooooooonnnnnnnn nnnnnnnneeeeeeeeeeeeeeeedddddddddssssssss!!!!!!!!!

BAR EngineeringBAR Engineeringis a is a multi-disciplinemulti-discipline engineering rm that engineering rm that

provides a wide array of solutions to the mostprovides a wide array of solutions to the mostdemanding industries across Western Canada.demanding industries across Western Canada.

Clients rely on BAR Engineering to deliverClients rely on BAR Engineering to deliverhigh-quality, cost effective, timelyhigh-quality, cost effective, timely and and

expert servicesexpert services to meet their project needs. to meet their project needs.

LLOYDMINSTER, ABLLOYDMINSTER, AB • • T: (780) 875-1683 T: (780) 875-1683 •• F: (780) 875-2728 F: (780) 875-2728WEYBURN, SK WEYBURN, SK •• T: (306) 842-4300 T: (306) 842-4300 •• F: (306) 842-4404 F: (306) 842-4404

W: BARENG.CA W: BARENG.CA •• E: [email protected] E: [email protected]

MUNICIPAL COMMERCIAL INDUSTRIALOIL & GAS UTILITY


One Call Will Get It AllOne Call Will Get It All

6401 63rd Avenue, Lloydminster (Northwest of Kenworth) Phone: (780) 875-6604 ∙ Fax: (780) 875-6634

- Power Swivels- Power Tongs- Drill Collars- Rod & Tubing Handling Equipment- Drill Bits- B.O.P's- Annulars- Flow Back Tanks- Accumulators- Cat Walks & Pipe Racks- Elevators- Flanges- Scapers - Downhole- Tanks - Rental- Tongs - Casing & Tubing

We are happy to coordinate pick up pick up and and deliveriesdeliveries for all your equipment needs.

FULL FLUSHBY & PRESSURE SERVICES

BODY VACS,STEAMER/PRESSURE WASHER SERVICES

SALTWATER DISPOSAL PUMPING SERVICES

Ken McConnellOwner/Operator

24 HR Dispatch: 780-205-9001Mike #: 403*11*29001

Fax: 306-397-2697Box 238 Edam, SK

[email protected]

24 HOUR SERVICE24 HOUR SERVICE

Racken Enterprises.indd 1 8/21/08 1:00:06 PM

New energy minister for Alberta's Redford cabinet

Edmonton – Out with the old and

in with the new.

Th at’s the prerogative of new Al-

berta Premier Alison Redford in nam-

ing a new cabinet team that includes

the appointment of Ted Morton as

energy minister, replacing Ron Liepert

who takes over as fi nance minster.

“Th is cabinet refl ects what change

looks like. It’s a team that’s committed

to listening to Albertans, and getting

to work right away on bringing the

change Albertans want and expect,”

said Redford about her cabinet shuffl e

that took eff ect on Oct. 12.

“As promised, there is a lot of new

talent around the table that will change

the way government works. Th ere are

also some familiar faces, including

Doug Horner, who, as previously an-

nounced, will stay on as deputy pre-

mier.”

Th e new cabinet will take the helm

of a renewed government structure, in-

cluding the creation of a Ministry of

Human Services that will bring to-

gether programming for children and

families in need.

Aboriginal relations and immigra-

tion will move to Intergovernmental,

International and Aboriginal Rela-

tions to better co-ordinate federal and

Aboriginal portfolios.

Th e function of economic devel-

opment for the province will move to

Treasury Board and Enterprise. Th e

Ministry of Environment and Wa-

ter will emphasize the importance of

protecting one of Alberta’s greatest re-

sources.

Redford also announced the ap-

pointment of nine parliamentary assis-

tants and membership in the govern-

ment’s renewed committee structure.

A new Operations Committee

will play a key role in the day-to-day

co-ordination of the government’s

agenda, including issues management,

legislation and house planning, and

communications.

Ted Morton was elected to his

second term as a Member of the

Legislative Assembly of Alberta

for the constituency of Foothills-

Rocky View on March 3, 2008.

Previously, Dr. Morton served as

Minister of Finance and Enter-

prise and Minister of Sustainable

Resource Development.

Other previous appoint-

ments include vice chair of the

Treasury Board and vice chair of

the Cabinet Policy Committee

on the Economy and member of

the Cabinet Policy Committee

on Agenda and Priorities. He was

fi rst elected in November 2004.

Dr. Morton obtained his

bachelor of arts in political science

from Colorado College (1971) and

his MA (1975) and PhD (1981)

in political economy from the

University of Toronto. From 1981

to 2004 he was a professor with

the University of Calgary and a

visiting professor at institutions in

Quebec, France, the United States

and Australia.

In 1998 Dr. Morton was

elected as a Senator-in-waiting

in Alberta´s second-ever Senate

election.

He served as director of policy

and research, offi ce of the Leader

of the Offi cial Opposition, Parlia-

ment of Canada in 2001.

Dr. Morton has received sev-

eral career awards and distinc-

tions, including Phi Beta Kappa

(1971); Best Nonfi ction Book

of 1992, Alberta Writers Guild;

Bora Laskin National Fellowship

in Human Rights (1995); and the

runner-up, Donner book prize

for best book on Canadian pub-

lic policy (2000). In 2001 he was

recognized in Macleans Guide to

Canadian Universities as one of

the 20 most popular professors at

the University of Calgary.

Dr. Morton has published

numerous scholarly articles and

six books.

He and his wife, Patricia, have

three children. In his spare time

Dr. Morton enjoys hunting, fi sh-

ing, gardening, cooking, and ski-

ing.

Courtesy Government of Al-berta website

Of cial biography of Ted Morton


Over a quarter-million small businesses in Canada rely on TELUS for wireless solutions and coverage.

Saskatchewan’s biggest* 4G Network is here.Make the switch to unrivalled support and coverage. Visit telus.com/builtforbusiness.

Business-friendly support, including device protection, dedicated 24/7 business

support and an account team trained to meet business needs

Business-focused solutions delivering data security and management of mobile

business, people and fleet

*Comparing the shared HSPA+ network available from TELUS to the public disclosure of HSPA+ network coverage of other provincial service providers for July 2011.

Make the switch to unrivalled support and coverage. Visit telus.com/builtforbusiness.


Lloydminster – MRC Midfi eld and a group

of their preferred vendors held a mini oil show at

the MRC shop in Lloydminster on Sept. 22 with

no danger of it challenging the heavy oil show that

comes to town next fall.

“It’s a customer appreciation mini oil show

event,” said Dean Sutherland, MRC’s sales and ser-

vice spokesman.

“Most of our clients already know what we mar-

ket, but it allows them to come in and ask questions

on certain products.

“I hope our customers come out and see these

products, ask questions and come away with some-

thing they haven’t been exposed to yet as far as new

technology and new equipment goes that could be

cost eff ective in their operations.”

MRC held a similar mini oil show two years ago

to celebrate the grand opening of their current loca-

tion.

“We just thought it was a good idea,” said

Sutherland. “It gets all of our customers together in

one place.

“It’s a good chance to see everybody and talk

with everybody, and give them a little appreciation

and some socializing on a more personal level.”

A pulled pork supper with DJ music and chari-

table donations to the Big Brothers Big Sisters of

Lloydminster and the local MS Society of Canada

added to the business social mix of the customer ap-

preciation event.

“We have a very good relationship with all of our

customers,” said Sutherland.

“Th is kind of serves two purposes – it’s a very

good informational forum for them, and also on the

social end of things, we get to visit with them away

from work. It helps build a relationship.”

MRC bills itself as the world’s largest distributor

of pipe, valves and fi ttings and related products for

the oil and gas industry with more than 60 locations

in Canada.

Th e Lloydminster shop carries a full line of pipe,

valves and fi ttings with a catalogue of over 100,000

available products, from completion and surface

completion products, to products pertaining to pro-

duction and production maintenance, and facilities.

“We also distribute wellhead drives, downhole

PC pumps and surface equipment,” said Sutherland,

who noted the demand is strong for just about every

product MRC carries.

“Business is good for us,” he said. “It’s been a

busy year, and I hope it continues that way.”

Sutherland is excited about the sales prospects

for some new vendor products brought to the event

including a new line of EuroMax PC pumps made

by Europump Systems Inc., located across the street

from MRC.

“Th at’s kind of a new product for us that we

are marketing for Europump,” said Sutherland. “It’s

going to change a lot of ways things are done. It’s

new on the market and it’s going to do some good

things.”

Th e new EuroMax PC pumps are designed with

a consistent elastomer thickness which minimizes

internal stator distortion, one of its many benefi ts.

“Th e elastomer thickness is constant from top

to bottom. It’s about eight millimeters thick, so you

get a better pressure rating,” explained Ted Harland,

Europump’s technical support expert.

Page A17

MRC hosts its own mini oil showGeoff Strong, an inside sales representative from Pro Tech Valve Sales Inc. in Edmonton, was ready to answer all questions about his company’s line of valves during the MRC Mid- eld mini oil show for customers and preferred

vendors Sept. 22.


Kenilworth Combustion Southeast SK to Northeast BCContact Heine Westergaard 1-780-744-3974

Nomad Electric in Northern AlbertaContact Clint Ferriss 1-780-624-2447

Pronghorn Controls in Southern and Central AlbertaContact Stan Neu 1-403-501-4895

CCR Combustion in East Central AlbertaContact Kevin Moan 1-780-872-0706

www.kenilworth.ca MAIN OFFICE 1-780-744-3974 FAX 1-780-744-2242

Eliminate odour from eld tanks and DEHY’s while using vapour as process fuel.

The rules are changing for red equipment in the oil and gas industry.

Are you ready for 2015?Are you ready for 2015?

Kenilworth has the solution!

Contact us TODAY to nd out

A non-destructive testing company in Estevan Saskatchewan & Virden, ManitobaX-ray, Gamma Ray, (pipeline crawlers), Ultrasonic (shear wave and corrosion surveys) Magnetic Particle, Liquid Penetrant,

Hardness Testing, API 510 and CWB Inspection.

All areas | 1.800.442.8721Virden | Phone or Fax: 204.855.3129 | Cell: 306.741.7265 Estevan | Phone: 306.421.3810

Brooks , AB | 403.362.5757North Battleford | 306.446.0242Shaunavon, SK |306.294.7077

Pumps, tubing drains, valves showcased Page A16

“Th ere is less torque and it’s easier

to pull the rotor out of the stator. Th ere

are a lot of advantages to it.”

“Th ere is better temperature dissi-

pation if you starve the pump and there

is a better pressure rating because the

pump is shorter than a conventional

pump,” he noted.

Th e product brochure lists the

full set of features and benefi ts of the

pumps that are designed primarily for

heavy oil with light oil applications up

to about 30 API oil as well.

“MRC distributes it for us. Th ey

do a good job,” said Harland.

Titus Tools Inc., a Lloydminster

company the designs and sells oil and

gas well production products, show-

cased the Titus safety torque tubing

hanger and the Titus safety toque tub-

ing drain that MRC distributes.

“Th ose are a couple of featured

products now that make it much easier

for the rig crews to handle putting in

a tubing drain in the tubing hanger

which is part of the production string

in an oil well,” said Titus president and

founder Tracy Klotz, at his company’s

booth.

“Midfi eld does a tremendous job

promoting other products in the area.

I am glad to be here.”

Stream Flo Industries Ltd. and

its subsidiary Master Flo from Ed-

monton, populated their display with

wellhead equipment, check valves and

chokes distributed at MRC locations

across Western Canada.

Page A19

Shane Tucker from Canadian Natural Resources Ltd., foreground, left, talks products with Tracy Klotz, president of Titus Tools in Lloydminster during a special customer appreciation oil show hosted by MRC Mid eld featuring displays from preferred vendors.


• Winch Tractor Available Step Deck Scissor Deck• B-Pressure• Steel Sales• Portable Rigs• Structural Steel• Shale Tanks• Flock Tanks• Silos• 400 BBL Tanks• Mud Tanks• 12’ Brake & Shear

• 200 Ton Iron Worker• Custom Sandblasting & Painting• Internal Tank Coating

Phone: 780.614.2113Phone: 780.614.2113Fax: 780.614.2115Fax: 780.614.2115

Luc Cell: 780.210.0635Luc Cell: 780.210.0635email: [email protected]: [email protected]

Box 1789, St. Paul, Alberta T0A 3A0

www.northernlightswelding.comwww.northernlightswelding.com


"We have been using these mats for roads and completions. We have not found a mat as heavy duty as these! We use them right up to the wellhead and the big 40 ton pickers have not broken one board. There is virtually no flex! If we do end up breaking one they let us pay for just the repairs, we don't have to buy a whole new mat! We rent them from March - November and will do it again next year. "

– Al Liknes Carduim Production integrated Team Penn West

Exploration - Drayton Valley

[email protected]@energyauctions.ca

403.815.2016

Our Mats are built for swamp use. These mats consist of over 1000’ Board Feet. They are 12(Twelve) 8” x 8” x 16’ held together by 1 ¼” Steel Rods. They are extremely easy to handle with little to no movement once in place! There is virtually no fl ex thus saving broken boards. When renting our mats once you have returned them as long as they are re-usable we will only charge you for repairs we will not charge you for the replacement of the entire mat.

Page A17“We were invited

by MRC Midfi eld as a

preferred vendor to rep-

resent our products and

display them and in-

troduce our products to

customers,” said Gordon

Lee, a technical sales

agent for Stream Flo

chokes.

“It’s a good time for

visibility and to meet

new customers and

some existing customers

as well.”

Stream Flo is a lead-

ing manufacturer of

wellheads, check valves

and safety systems for a

global oil and gas mar-

ket.

Master Flo, with

locations throughout

the world, is a leading

manufacturer of surface

chokes, control valves,

actuators and subsea

chokes.

“Business is great.

We are doing real well

throughout Western

Canada – business is re-

ally good in the industry

right now,” said Lee.

Pro Tech Valve

Sales Inc. in Edmonton

jumped at the chance

to display some of their

products distributed by

MRC to customers as

one of about 12 preferred

vendors on site.

“Th e event for our

company is more to

show off our products

like our ball valve name

and our gate and globe

valve name, and show

what Midfi eld supplies

to their end users and

answer any questions,”

said Geoff Strong, an in-

side sales representative

for Pro Tech.

“Pro Tech is all

about gate valves, globe

valves, check valves and

ball valves and high

pressure stainless carbon

steel, low temp – lots of

materials for diff erent

applications.”

“Th ese products

would be used more on

the production side of

things – not to get the oil

of the ground but once

it’s out of the ground –

to move it from pipe to

pipe and stuff like that.”

Strong said Pro Tech

does a lot business with

Suncor in Fort McMur-

ray as the company buys

a lot of their gate valves,

globe valves and check

valves.

Pro Tech designs,

manufactures and sells

valves and fi ttings for

power plants and pet-

rochemical and refi nery

companies worldwide.

A chance to show off

Right: Dean Sutherland, a sales agent with MRC Mid eld, was happy to wel-come visitors and customers to his company’s mini oil show held on Sept. 22 with participation from about a dozen preferred vendors.

Left: Gordon Lee, a tech-nical sales rep for Stream Flo Industries Inc. and its subsidiary, Master Flo, grips one of Master Flo’s chokes for oil and gas applications during the MRC Mid eld oil show on Sept. 22 at MRC’s shop in Lloydminster.

We offer 30 & 35 Ton Picker Services and We offer 30 & 35 Ton Picker Services and 3 Ton Picker Delivery Service3 Ton Picker Delivery Service

Professional and Experienced Operators Professional and Experienced Operators focusing on Safety & Customer Satisfactionfocusing on Safety & Customer Satisfaction

Dispatch 780-214-4345Of ce 780-874-9960

Email info@dekkeroil eld.comFax 780-874-9970

Box 12838 Lloydminster, AB T9V 1E9 B

Ask about our Financing and Leasing options

Regina 1507 Ross Ave. (306) 789-7383 1-800-667-7716 Saskatoon 303– 50th St. East (306) 242-3411 1-800-667-3098

WWW.FRONTIERPETERBILT.COM

24 Hour Emergency Parts & Service

BUY – SELL – TRADE

Estevan #1 Frontier Street (306) 636-6320 1-888-345-8070 Lloydminster 5201 - 40th Ave. (306)825-3553 1-800-667-6323

Monthly Specials Check out our

Online


• TUBING BAILERS • TUBING ROTATORS• JUNK BASKETS • GAS SEPARATORS• PUMP TO SURFACE EQUIPMENT • TUBING DRAINS• SWAB MANDRELS • ROD COUPLINGS• PERF WASH TOOLS • TUBING ANCHORS• CASING SCRAPERS • ROD SHEARS• TORQUE ANCHORS • PUMP OUT PLUGS• NO TURN TOOLS • SLOTTED SAFETY SUBS

QUALITY TOOLS & QUALITY SERVICE

Lloydminster 780.875.2151 • Provost 780.753.3132Brooks 403.794.0045 • Swift Current 306.773.5512

•••••• • ••• Quality Tools & Quality Service

CHECK OUT OUR WEBSITE: www.dashtoolsinc.com

Full Zip or Snap OffStarting at

$$79799999EACH

By Geoff Lee

Lloydminster – Rod Carroll can’t wait to take

delivery of a 2011 Kenworth T800 truck equipped

with a Manitex 35-ton crane. Th e unit is expected to

arrive this month.

Th at will be the third crane Carroll and his wife

Amie have purchased for their Dekker Oilfi eld Ser-

vices Ltd. business and will raise the bar on their lift-

ing capacity.

Dekker currently has a Kenworth C-500 tan-

dem tridem with a 30-ton National 1100 crane with

a 69-foot reach and a 40,000 pound deck mounted

winch.

Th ey also operate a 2011 GMC one-ton dually

that tows a 34-foot gooseneck trailer with a truck

mounted Fassi 3-ton knuckle-boom crane.

Th e new truck-mounted Manitex will feature a

77-foot boom to go with a 40,000 lb. deck winch.

“It will allow us to do pretty much the same as

the 30-ton; it’s just that we won’t have to run it as

much,” said Carroll who started his picker service in

February 2010.

“With the 30-ton you are running rig mats and

skids and some of the equipment seems to be getting

bigger. Th e 35-ton will give us the ability to handle it

without maxing out our weight charts and stuff .

“It’s not that the 30 is too small, it’s just that the

35 would be better.”

Th e new 35-ton picker truck will work out of

Dekker’s new location at the former Tanroc site in

Lloydminster where they have rented one and half

bays and space for a new offi ce.

“Once we get the fl ooring and walls up and

everything built the way we want it to be built, it

should be a lot nicer,” said Dekker with renovations

in full swing.

Ryder, a muscular 140 pound shop dog, is taking

everything is stride with his bowl full of food.

“He’s momma’s boy, that one,” said Dekker, who

doesn’t get much grunt work out of the pooch who

earns his keep as a watchdog.

Th e brunt of Dekker’s lifting is accomplished by

his 30-ton stiff boom crane used to haul everything

from skids, Class 3 shacks, pumps, tanks and tubing

to drill collars, power tools and drilling equipment.

“Whoever calls, we haul it,” said Carroll who fo-

cuses his picker services on deliveries to service rigs.

“We have steered toward the service side with

the odd drilling job. Our business is just picking stuff

and moving stuff , and hauling it out to rigs, and get

it out on time,” he said.

Carroll said the key to their success so far is be-

ing honest with customers and not taking on jobs

they can’t fulfi l.

“We try to do everything as professionally as we

can and as reliably as we can,” he said.

Page A21

Rod Carroll, with Ryder at his side, posed for a photo in front of this National 1100, a 30-ton truck mounted crane with a 69-foot boom at the Dekker Oil eld Services Ltd. yard. Dekker is anxious to take delivery of a new 35-ton Manitex picker with a 77-foot boom this month. Both truck mounted cranes come with a 40,000 pound deck winch.

Dekker relocates, new picker on order


FinancingFinancingOAC - Including USAOAC - Including USA

Limited Powertrain WarrantyLimited Powertrain WarrantyExport ServicesExport Services

Over 80 Trucks in StockOver 80 Trucks in StockAll Makes and ModelsAll Makes and Models

WWW. CUSTOMTRUCK.CAServing the prairies for over 45 years

2010 Kenworth T800

Cummins ISX, RTLO18918B,

14,600 lbs, 500 hp

Serial # J943811/12

2005 Peterbilt 379L

CAT C15, 18918B,

12,000 lbs, 475 HP

Serial #N881141

ReginaRegina 520 Park Street , S4N 0T6520 Park Street , S4N 0T61•800•463•93331•800•463•9333 306•569•9021 306•569•9021Bob WirtzBob Wirtz535-3869535-3869

Lenny JanzLenny Janz535-3572535-3572

Erin FoundErin Found520-2227520-2227

Chris BeatonChris Beaton541-8336541-8336

SaskatoonSaskatoon 2410 Northridge Drive, S7L 7L62410 Northridge Drive, S7L 7L61•800•268•42221•800•268•4222 306•-931•1911 306•-931•1911

Guy TatlowGuy Tatlow221-7254221-7254

Ian CopnerhurstIan Copnerhurst221-0274221-0274

Chad KempChad Kemp229-4423229-4423

Gord WoodGord Wood221-9597221-9597

Bert Downton - Saskatchewan Used Truck Sales Manager Bert Downton - Saskatchewan Used Truck Sales Manager 539-1128539-1128

The World’s BestThe World’s Best

2008 Kenworth T800

2009 Kenworth T660

2007 Kenworth T800

2008 Kenworth T800

CUM ISX, RTLO18918B, 12,000 lbs, 485/1850 HP,

D40-170P Serial #J934359

18 Manual, 13,200 lbs, 62” ACAD Sleeper, 485 HP,

46,000/lbs Serial #J941635

ISX, FRO16210C, 12,000 lbs, 72” ACFT Sleeper, 450ST HP Serial #J997998

C9 CAT, RTLO11908LL, 12,000 LB, 335 HP

Serial #J935170

2 Available

Staying with what you know Page A20

“If somebody phones and asks for a truck – if

we can’t supply it, we just don’t take the job. We

can’t ‘screw’ people around because they won’t phone

again.”

Dekker has four operational employees with

plans to hire three or four additional workers when

the new truck arrives as business orders continue to

pick up.

Currently, Carroll and Matt Lamberty run the

30-ton crane while Jamie Hayes and her co-worker

Kaitlyn Fraser operate the one-ton dually with the

Fassi knuckle-boom.

Like any new business start-up, Carroll and his

right hand man, Lamberty, initially relied on people

they knew for picker jobs even if it led them far from

Lloydminster where they do most of their work

now.

“Matt’s got 12 years of experience and I’ve got 12

to 13,” said Carroll. “We have worked in Fort Mc-

Murray, Grande Prairie, Manitoba, Estevan – we’ve

been all over.

“We spent a lot of years up in the Cold Lake

Weapons Range. We are still running into people we

have worked with in the past, and all of a sudden you

get another person phoning.

“We are striving to be Lloydminster based, but if

someone calls from anywhere, the truck’s got wheels

and we’ll go there.”

Carroll says starting a picker service company

was a no-brainer because that’s all he’s ever done

since he landed his fi rst job at age 18 at Classic Oil-

fi eld in Lloydminster where he and Lamberty earned

their journeyman picker tickets.

Carroll and a co-worker eventually left Classic

to start Spectra Oilfi eld Service Ltd., another lo-

cal picker company, before selling out to his partner

three years ago.

After bailing out of a brief wireline job that he

didn’t enjoy, Carroll landed a crane operator’s job in

Fort McMurray with SMS Equipment Inc.

“Th ey would assemble the huge 930 and 960

Komatsu haul trucks used by Suncor, so you were

lifting anything from 68 to 72 tons, depending on

the day,” said Carroll.

“I did that for a bit, and then I heard it started to

get busy at home again, so I came home and started

Dekker.

“I think I have a handle on the business. I

haven’t done anything else. I just came back to what

I know.”

Dekker Oil eld Services Ltd. is renovating their new shop and of ce in Lloydminster, but the ongoing construction work doesn’t stop owner Rod Carroll from working the phones to secure new picker customers. Carroll and his wife Amie launched the business in February 2010.

ree

Wo


401 Hwy #4, PO Box 879, Biggar SK, S0K 0M0Tel: (306) 948-5262Fax: (306) 948-5263

Over 17 Years Building Storage Tanks

Over 60 000 sq/ft of Production Space

• We build ULC, UL, Flameshield, API-650, 620, 12F, ASME• 7-3000 bbl• 2,273-200,000 L Horizontal Contained• Pressure Vessels

• 2,273-110,000 L Jacketed Underground• 2,273-120,000 L Vacuum Monitored• 1,250-5,000 L Rectangle• 5,000-200,000 L Single Wall Vertical

AGI’s innovative design, custom manufacturing process and comprehensive service combine to make AST’sone of the most cost eff ective, effi cient means of storage available today.

CALL US TO DISCUSS YOUR NEEDS:

1-800-746-6646

Website: www.envirotank.comEmail: info @envirotank.com

Tank Welding Unmatched in the IndustryUltra-sonically tested and X-Ray Quality

Flowsur ValveSaving Pumpsat Lower Prices

with Less Hassle

Automatic PumpAutomatic PumpShut DownShut Down

[email protected]

Ready For A Buyout??We advise Owner - Operators of Private Oil eld

Service Businesses on Liquidity Options

For more information please contact:

G. Trevor ConwayManaging Partner & Director

Tel: (403) 456-6473Email: [email protected]

Lloydminster –

More boom for your

buck. Th at’s the motto

of Dynamite Oilfi eld &

Picker Service Inc. that

celebrated its 10th year

of business in Lloyd-

minster in September.

Kris Bexson, who,

along with his wife and

bookkeeper, Hannah,

own and operates the

company that employs

four people. He attri-

butes the company’s

success to date to put-

ting that motto into

practice on a daily basis.

“We do supply very

well maintained equip-

ment,” said Bexson. “We

have an excellent record

for showing up on time

and doing exactly what

we say we are going to

do.

“Also my guys – I

have excellent man-

power. Th ey know the

business and they do it

safely. In 10 years, we

haven’t had one time-

lost accident and very

few reportable inci-

dents.”

Dynamite’s core

business activity is its

picker service with a

fl eet of three truck-

mounted Fassi knuckle-

boom cranes with a re-

spective lifting capacity

of 3.5, 5 and 7.5 tons.

Th e pickers can be

equipped with a reverse

knuckle-boom attach-

ment arm for lifting ob-

jects such as engines and

compressors through

small man doors.

Th ey also have three

fi fth-wheel trailers for

hauling equipment in-

cluding Pason oilfi eld

instrumentation and

data acquisition systems

to drilling rigs.

“All of our trucks are

medium duty trucks,”

said Bexson. “We stick

with medium duty and

we can do bigger jobs,

too, for less cost using

the same equipment.”

Market demand

has led the company

to diversify into hot

shot services, welding

and fabrication, oilfi eld

maintenance and man

lift work.

“We do any sort of

oilfi eld work that we can

handle,” said Bexson.

“We haul equipment

around – downhole tub-

ing, tools to service rigs.

We do quite a lot of man

basket work.

Dynamite recently

“tricked out” their man

baskets with a custom

fi breglass exterior fi nish

bearing the company

name and logo.

“Th e baskets attach

to our cranes so that’s

what we use for our man

lifts,” said Bexson.

Page A23

More boom for the buck at Dynamite

Dynamte completed this tandem lift of a pontoon boat at Boundary RV & Marine in Lloydminster with two cranes. The truck on the left (since sold) is a 1991 International equipped with a 4.5 ton Legend crane. On the right is a 2003 Freightliner with a 4.5 ton Fassi crane. Photo submitted


4 Flushby TrucksSteamer TrucksSlant Capable

Truck Cell: (306) 823-3512Cell: (306) 823-7111Res: (306) 823-4309Fax: (306) 823-4663

P.O. Box 331 Neilburg, SK S0M 2C04 Flushby TrucksSteamer TrucksSlant CapableVac Trucks

Page A22 “Th e baskets are for any kind of high work in plants and

facilities for piping that’s up in the air. It’s a little more economical than using

scaff olding. It’s a lot quicker.

“Mostly, we use them for steaming off tanks. We will meet a steam tech or

a fi eld consultant out on a site. Maybe they had some oil come up to the top of

their tank and run down the side of the tank; we will lift the steam guy up to

wash off the tank.”

Dynamite also provides a general picker service in town to move garden

sheds and boats and to lift roof rafters for new residential home construction,

but oilfi eld work is their bread and butter.

“At least 90 per cent of our business is oilfi eld,” said Bexson. “We pick up

small buildings and shacks and engines and motors. Most of our work is fi eld

work. We don’t do a lot of plant maintenance.”

Dynamite can also set up temporary cement containment rings to contain

leftover casing cement from newly drilled wells, and they also do wellsite setups

including some pipefi tting.

Variety is the spice of life for Bexson, who started a welding shop to main-

tain his own equipment and has branched out to making pipe racks, equipment

docks, ladders and stairs and custom oilfi eld work.

Bexson admits he thrives on diversity and challenges as a small business

owner.

“You are always on the move. You can have your day planned out, but you get

a few phone calls and guys need this or that done, and you have to be on the ball

and switch up your day and keep things moving and customers happy,” he said.

“I fi nd that very exciting. You are not doing the same thing every day.”

“You are really on your toes all the time, and of course, you are dealing with

equipment and you have to keep things maintained and make sure everything is

safe and organized properly.”

Bexson recently sold his very fi rst truck, a 1991 International with a 4.5 ton

Legend crane on it. Th e Fassi knuckle-boom is his crane of choice today.

“Th ey are easy to maintain. Th ey are an economical crane. Th ey have safety

features that I like,” he said.

“When it starts to drop down, that tells you the load is too heavy, so then

you boom back in, set it down, and get your equipment closer to the drop point.

Th at’s a safety feature. Th at’s the bypass valves that are built into all these hy-

draulic folding cranes.

“I really like that feature. If you are lifting and moving and doing everything

Most work in the eld

right, and you grease your picker all the time, and change the oil once a year, they

will last forever.”

Bexson said some of the keys to Dynamite’s survival in the past 10 years

were keeping their equipment in good shape with a regular maintenance plan,

and establishing a good relationship with their employees. Page A24

Kris Bexson, owner of Dynamite Oil eld & Picker Service Inc. expects all of his employees will graduate this month from an online Boom Truck Operator B (cranes up to 15.5 tons) course offered by Western Trade In-stitute in Saskatoon and endorsed by the Saskatchewan Apprenticeship and Trade Certi cation Commission.

dedicated to providing a light picker & hauling

service to the general public

as well as the oil and gas industry

in a safe and economic manner.

phone:phone:780.872.0033780.872.0033

Supplying 3.5 ton to 7.5 Supplying 3.5 ton to 7.5 ton truck mounted folding ton truck mounted folding

cranes for service incranes for service in AB and SK. AB and SK.

Over 10 Years of Service Over 10 Years of Service to the Lloydminster Area!to the Lloydminster Area!


BONDED TRUCKBED PROTECTION

· Spray-in Truck Bed Protection· Textured Non-Slip Surface

· Available in a Full Assortment of colors that will not fade

· Protection for Decks, Signs, Parts and Much More

Protec t Your Trailer!Protec t Your Trailer!S eaml ess, Easy To C l ean Fl oorS ea ml ess, Easy To C lean Floor

windshield & replacement· Prevent Chips & Cracks from Spreading

· Restores Safety & Structural integrity· Improves Clarity & Cosmetics 65 - 90 %

· Saves You Money Over Replacing

Rock Chips & LongRock Chips & LongCrack RepairsCrack Repairs

All Work GuaranteedAll Work GuaranteedFix that rock chip or crack before the snow fl ies!Fix that rock chip or crack before the snow fl ies!

· Interior Steam Cleaning

· All your Truck & SUV accessories

· Meguiar ’s Car Care Product Distribution· Over 20,000 Different Truck Accessories

BOND

Complete Auto Detailing Centre

3,5905 - 44 St. LloydminsterPh: (780) 808-2911

i d hi ld & lCRACKMASTERSCRACKMASTERS

Stable Foam Clean-outs | Hydro Vacs | Coiled Tubing Units | Power Tong Repair | Pressure Trucks | Vac Trucks

Page A23“You can have 10

vehicles, but if you don’t

have good employees,

you are not worth any-

thing,” he said.

Craig Salzl is the

lead picker operator and

assistant manager and

the senior hand at Dy-

namite with more than

six years on the payroll,

followed by Ethan Cart-

er who also operates a

picker.

Eugene Dufresne,

the maintenance crew

foreman, and Donald

Waskewitch, a labourer,

are the newer opera-

tional employees, but

everyone is trained to

troubleshoot mechanical

problems.

“We all kind of

pitch in,” said Bexson.

“We brought in a main-

tenance program about

fi ve years ago. We go

through these trucks ev-

ery 30 days with about

a fi ve page checklist we

developed ourselves.

“Since we imple-

mented that, I haven’t

ever had a breakdown in

the fi eld. I can’t remem-

ber the last time I had a

tow truck for one of my

trucks.

“If you are on your

way to a job, and you

have a breakdown, you

have an angry customer.

Th ere is a lot of money

waiting on lease and if

you are an hour late, the

people aren’t going to be

very happy.

“I’ve always tried to

learn as much as I can

about the equipment

that I am running. If you

can teach that to your

employees, that cuts

down you breakdowns

signifi cantly too.”

Bexson says the

company has been busy

the last two years and fu-

ture plans include build-

ing a bigger building be-

fore expanding with new

equipment.

“I am quite happy

with where we’re at right

now,” he said. “I think

I would like to build a

shop before buying any-

more equipment. We

have been here for eight

years and we are out-

growing the space.”

Good employees, maintenance key

Picker operators, Craig Salzl, left, and Ethan Carter ank Kris Bexson who is inside his company’s latest custom man basket with the company name on it.


Introducing The Next Generation Of Belt Drive

Ask Us About Our Other Products

• Adaptable to your torque requirements

• Compact. Just 2’ tall from bottom of stuf ng box to top of guard

• Easy to use

• Safe

• Affordable

• Wickedly Simple

• Stuf ng box design, repair & tracking

• Drivehead design, repair & tracking

• Field service & consultation by highly trained technicians

• Failure analysis & recommendationsfor improvements

Comes complete with our superior

FS style Stuf ng Box and a variety

of hydraulic motor and belt options.

Contact us to nd out more:Tel: 780.875.11096702-56th Street

Lloydminster, AB

Or nd us on the internet at:www.brightlingequipment.com

Lloydminster – No job is too big

for Action Towing & Recovery, except

when it doesn’t involve towing recovery

services, such as the collapse of the Ca-

nadian Pacifi c overpass on Highway 16

in Lloydminster on Oct. 11 that sent

cranes to the rescue.

“Th at stuff was out of our league. I

wasn’t about to start off ering my services

to stuff like a bridge,” said John Buhnai

at his Action Towing base located on

Highway 16 about 16 kilometres west

of the city.

“Most of our work is towing and

recovery work of trucks and heavy

equipment.”

Two 500-ton cranes were called in

to lift and clear the collapsed CP steel

girder that weighed up to 100 tons.

Action Towing however, is no

slouch when it comes to lifting heavy

wrecks or oilfi eld equipment in places

where most cranes and pickers fear to

tread.

Th eir NRC 40-ton sliding boom

recovery unit has a 35 foot boom height

and a 35 foot reach with enough muscle

at any angle to pick up wrecked service

rigs and heavy construction equipment

for towing or hauling. Page A27

Action Towing & Recovery owner, John Buhnai with his wife Ginette, has the bragging rights to the largest wrecker in the west with this 47 foot long Tow Mater with a 60-ton towing capacity. This photo was taken on a cold winter’s day in 2010 for a Pipeline News feature on working in cold weather – with the company gearing up for cold months of lifting and recovery work ahead.

Action towing can out lift most pickersAction towing can out lift most pickers


Lloydminster Citizens On Patrol

Check Us Out At www.lloydcops.com

Be A Part Of The Solution

For all our info and an Application

to download Requirements are

-Security check, training, and 5 hrs on

patrol a month.

Help with crime prevention

This ingenious design incorporates a set of centralizing drag blocks to the Multi Set Torque Anchor that helps reduce the vibrations and dampen the harmonics produced by higher RPM PC Pumps

If you have a specifi c problem on an application, we’ll help you design & develop novel production optimization equipment.

FEATURING, PREMIUM CENTRALIZED MULTI SET TORQUE ANCHOR

We offer 5 different models each with unique characteristics that will suit any specifi c PCP application.

At Premium We Know Torque Anchors!

Torque Anchors | Gas Separators | Horizontal Intake Sub | Tubing SwivelsTubing Centralizer | Fike Drain | Tubing Shear Joint | C-1 Tubing Anchors

Packers, Downhole Tools, Flow Control, Coating, Others#8, 10672 – 46th Street S.E.Calgary, Alberta, CanadaPhone: (403) 723-3008

Lloydminster, Alberta, Canada Phone: (780) 875-3050 Fax: (780) 875-3002

[email protected]: (780) 522-8296

The anchor is centralized in the casing providing a standard larger bypass area than most existing centralized anchors. It is available for all casing sizes with a variety of connection sizes and types.

Single Set Anchor - one anchor block coilable • Multi Set Anchor - Our Best Seller Cam Set Anchor - higher the torque, the better it will engage • Simple Set Anchor - our most economical option

Check out our website for our other 4 models of Torque Anchors

www.PremiumALS.com

Page A25 Unlike

picker trucks that lose

lifting capacity the fur-

ther their boom reaches,

the NRC maintains its

ability to lift its rated ca-

pacity.

“It will lift 40 tons

stretched right out,”

said Buhnai. “It’s diff er-

ent from a picker truck.

Picker trucks lose capac-

ity the further out you

reach.”

Asked why pickers

aren’t made the same

way as the NRC, Buh-

nai says it is just the way

they are engineered and

designed.

“Pickers would have

to be built too heavy.

Th ey wouldn’t be able

to haul anything down

the road with them,” he

said.

“We don’t haul

things on the back of it.

We just use it for recov-

ery work, and we might

tow the odd truck with

it. We are not trying to

haul a trailer and a pay-

load with it.”

Th e NRC also gets

the nod to lift heavy oil-

fi eld equipment in places

where picker trucks are

challenged by terrain, ac-

cessibility or soggy soil.

“We’ve done a num-

ber of lifts at diff erent

places – sometimes lift-

ing a heavy load that is

hard to get at with a big

unit. Our unit is small,

but it’s got heavy lifting

capacities,” said Buhnai.

“It’s kind of handy

to get into a tight area.

“Th ere are times

when we have to get

dragged in by farm trac-

tors because the roads

are so muddy we can’t

drive on them, so we just

get pulled.”

On the towing side

of the business, Ac-

tion Towing has six tow

trucks all equipped with

winches for recovery

work and pulling vehi-

cles out of ditches. Some

of the trucks have two

winches.

Th e fl eet ranges from

40 tons of towing capac-

ity up to the mother of

all wreckers, the 60 ton

Tow Mater – a 47 foot

yellow monstrosity.

“It’s the biggest and

the baddest,” said Buh-

nai. “It’s got fi ve axles

and four of them drive.

It can tow service rigs,

and big cranes. I haven’t

seen anything bigger out

there with more towing

capacity.

“We tow everything

from one-ton trucks to

road building equip-

ment, graders and front

end loaders to cranes

and service rigs as well

as big cranes that weigh

up 90,000 to 100,000

pounds.”

Action Towing’s

hauling fl eet includes

three lowboy trailers in-

cluding a tandem winch

tractor, a tri-axle scissor

neck and a 40-wheel

combo trailer with a re-

movable neck.

Th e combo unit has

a 60-ton capacity for

hauling service rigs and

heavy equipment to work

sites during road bans.

Th e company also

has an air cushion recov-

ery system for recovering

tipped trailers, tankers

and fi fth wheel trailers.

Buhnai has a staff

of seven employees sup-

ported by his wife Gi-

nette who works the

phones and books along

with doing some dis-

patching.

Action Towing has

a shop at their highway

yard where they main-

tain their own equip-

ment and sell new and

used trucks parts.

Asked to recall some

of the tougher towing

and recovery jobs at Ac-

tion Towing, Buhnai says

they have been doing

this long enough now

that no job is too tough.

“Some of them are

a little more challenging

than others, but it’s just a

matter of going out there

and looking it over and

doing our job,” he said.

Th ey base their de-

cision on what unit to

dispatch based by ask-

ing the customers a few

questions when they call

for help, with most of the

calls relating to highway

accidents and rollovers

that occur year round.

“Th ere’s rollovers on

nice days just as well as

there are on wet days or

stormy days,” said Buh-

nai.

“A lot of it is high-

ways where people are

driving on the blacktop

and get distracted for

whatever reason and roll

over on the straight and

narrow highways.

“We do a lot of oil-

fi eld work, but there’s a

lot of oilfi eld trucks out

there, so it stands to rea-

son there are going to be

some wrecks in the oil-

fi eld.”

Th e day the CP

overpass collapsed after

being struck by an over

height excavator on the

back of a semi, Action

responded to multiple

oilfi eld-related accidents

near the city.

Distractions cause numerous roll oversDistractions cause numerous roll overs

Action Towing’s 1994 Peterbilt NRC 40 ton sliding boom recovery unit was ideal for lifting and hauling this inoperable LeTourneau-Westinghouse earth mover on a lowboy from a site near Dewberry.

Photo submitted

COMPANYA

EQUIPMENT (2010) LTD.

NANANANANANANANAANANNANANNNNNNNNNNNNNNNNN TITTTTTTTTTT ONONONONONOOONNONONOONONONONNNNNNNONNNNNALALALAALALALALAAALAAAAAALALAALAAL NNNNNBBTBBTBTBBTBTBBTBTBBBBTTBBTBBBBBTTBTTT45444444445454454445444455 (((( 5454 TTTTTTTTTTONONONONONONONNONONONONONONONONOOONNONOONNNOONOONON))))))))))))))))))))))))))))))))))NANANANANANAANAANANANANANANANANANAAANANNAAANNANAAAAANAAAAAATITITITITITITTITTITIT ONONONONONONONONONONONOONONONONNONONONONONNNONONNNNNONONNNNNNONNNNNNNNONONNNNNOOOOOONNALALAAAALALALALALAALALAAAAALAALLAAAAAAAALAAAAAAAAAAAAAAA N N N N N N NNNNNNNBTBTBTBTBTBTBTBTBTBTBTBTBBTBTBTBTBTBTBTBTBTTTBTBTBTBTBTBTBBBTBTBTBTBTBTBTBTBTBTTBBTB 45454444454545454545454545454445454454544545454445544 ( ( ( ( ( ((( ( ((((((((((((((((((((( 454545454545454545454545454545454545454545454554545454545545454545454454445454544544444545 T T T T T T TT T TTT TT TT TT T T TTTT T TTTT TT T TTTT TTT TTTTTTTTONONOONONONONONONONONONONONONONNONONONONONONONONONONONONONONOOONONONONONONOOONONONOOOOONOOO ))))))))))))))))))))))))))))))))))))NANANANAANANANANANANNANANANANANAAAATITITITITTTT ONONONONONONONONONONNOONONNONONNNNNNNNNNNNNNNNALALAALAALAALAAALALAAAAAAAAAAA N N N N N NNNBTBTBTBTBTBTBTBTBTBTBTBTBTTBTBTBTBTBTBTBTBBTTBTBTTBTBTBTBBB 454544444454545454544545454544444 (( (((((((((454545454554545454454545454545454555544444545445 TTTTTTTTTTTTTTTTTONONONONONOONONONONONONONONNOONONONONONOONNNONNONNOO ))))))))))))))))))))))))NANANANANANANANANANANNNAANANNANANAANNNAANATITITITITITIIITT ONONONONONONONONONOOOOOO ALALALALALALAAA NNNN ((((NAAAAAAAATITTTTT OOOOOO ))))))))))))))))NATIONAL NBT45 [45 TON]

419 - 47TH STREET E.SASKATOON, SK S7K 5H4

(306) 955-4266

WE CREATE CUSTOMIZED TRUCK EQUIPMENT SOLUTIONS TO SUIT ANY NEED!

SALES - PARTS - SERVICE - CERTIFICATION

EXCALIBUREQUIPMENT.CA

Lloydminster –

Guest Control Systems

held a grand opening

of their new offi ce and

shop complex in Lloyd-

minster on Sept. 29 with

news the company hopes

to further expand to

Bonnyville or the Peace

Region of northern Al-

berta.

“Right now, we do

work all the way up to

Fort McMurray and we

have a small offi ce shop

in Kerrobert,” said Chad

Guest, company presi-

dent.

“We run about fi ve

guys steady down in that

area. Th ey work all the

way down to Kindersley

and do a lot of work in

the Hoosier and Denzil

area.”

Expansion in Lloyd-

minster and elsewhere is

driven by a demand for

Guest Control’s forced

air and natural draft

burner systems that they

manufacture and sell

from their new 20,000

sq.-ft. building.

Th e business volume

for burner sales, instal-

lations and service tops

that of their other elec-

trical, instrumentation,

pressure safety valve re-

pair and rental divisions

in that order.

“Th e biggest de-

mand right now is for

the heater systems that

we carry,” said Guest at

the grand opening.

“Th ere has been a

big push with that for

the last few years to get

systems certifi ed. It has

been driven by the CSA

B149.3 code for tank

heating systems. It’s a

burner system code that

applies to gas fi red heat-

ing systems.

“Th e government

doesn’t grandfather the

old systems that are out

there any longer, so they

have to be brought up to

code.

“As a result, there

has been a huge boom

in the burner heating

industry. We were for-

tunate enough to be in

a position to meet the

needs of customers.”

Guest has been on

a growth path during its

25 year history by adapt-

ing to the current needs

of the oil and gas indus-

try with new products

and services.

“When we started,

we did a lot of service

work and maintenance

work for instrumenta-

tion primarily in the

plants around the area,”

said Guest.

“We still do that,

but we have expanded

through the burner

heating systems – which

is more of our business

now than instrumenta-

tion is, but it’s just the

changing demands in

the oilfi eld.

“We still do instru-

mentation and electrical

work, but primarily, our

work right now is heat-

ing systems.”

Guest Control’s new

building includes 10,000

sq.-ft. of shop space that

allows the company to

design, engineer and

manufacture their own

line of forced air burners

and natural draft burn-

ers that meet the CSA

code.


One Call Will Supply It All

RIG PARTS SPECIALISTSwww.lamarreequipment.com

9419 - 27th Avenue, Edmonton, AB, CanadaPhone: (780) 438-3493 Fax: (780) 438-6655

Email: [email protected]

LAMARRE EQUIPMENT INC.

WPT Air Clutches Gummi Air Clutches

Burner sales drive Guest Control growth

Jordan Moss, a valve tech, left, works with burner tech John Leeson to hoist the housing for a Guest Control Firestorm burner onto a pickup with the aid of a ve-ton overhead crane.

Page A29


MOBILE UNITS MOBILE UNITS FORFOR

HireHireoror

PurchasePurchaseNO BOILER TICKETNO BOILER TICKET

REQUIRED TO OPERATEREQUIRED TO OPERATE

Grant Stegen 403 548-1231Syl Tateson 403 793-4616

NEW WATER HEATERNEW WATER HEATER

•• Completely Mobile fresh water heater Completely Mobile fresh water heater•• Capable of heating a 400 bbl. tank Capable of heating a 400 bbl. tank 0 - 40 degrees C in 40 min. 0 - 40 degrees C in 40 min.•• Variable heat output up to 15 million B.T.Us. Variable heat output up to 15 million B.T.Us.•• Diesel fired CSA approved burner Diesel fired CSA approved burner•• Extremely efficient fuel saving design Extremely efficient fuel saving design•• Patent pending Patent pending

THERMAL TEC LTD.

Overhead crane helpful in shop

Page A28Th ey also have room

to complete certifi ed re-

pairs to safety valves and

control instrumentation

and storage space for

sales of pressure safety

valves (PSV), back-up

generators and burner

systems.

“We do a lot of

manufacturing right

here in the shop,” said

Guest. “Th at’s one of

the reasons we built the

shop, to be able to do the

manufacturing in one

facility.

“It’s easier for qual-

ity control; it’s easier for

scheduling work, and

getting all the parts put

together for the next

jobs.”

One of the unique

features in the shop is a

fi ve-ton overhead crane

that can carry much

heavier loads if the need

arises.

“One of the rea-

sons we put our crane

is to make sure we have

enough capability for

any future growth,” said

Guest.

“A lot of the stuff

that we manoeuvre isn’t

really heavy, but it’s

over the weight to carry

around easily. Th e crane

makes it easier for that

type of stuff to be done.

“We went fi ve-ton

simply because the dif-

ference between a fi ve or

a two is future capabili-

ties. It’s there.

“We have a PSV

shop for rebuilding safe-

ty valves (pressure relief

valves) so we have some

of the valves coming off

the pipeline, and they’re

eight by 10 inches and

weigh about 500-600

pounds.

“For repairs of in-

strumentation valves,

the crane is fairly handy

as well.

“Most of the stuff

we deal with is probably

1,000 pounds or less.

Th ere is a separator out-

side right now that we

are rebuilding, and that

gives us the ability to

bring it inside and com-

pletely dismantle it. Th e

vessel itself will be sev-

eral thousand pounds.”

A crane demon-

stration was part of the

grand opening that in-

cluded generous serv-

ings of pulled pork with

all the fi xings for guests

and customers.

“We’ve got some

prize giveaways and we

are here talking to cus-

tomers if they come in

and enjoy some lunch

on us today,” said Guest

who said the new build-

ing will lead to improved

effi ciencies and better

service for customers.

“It’s a good base for

running our operations

out of. We are running

up to 100 guys now.

It was very diffi cult in

our old shop. It was too

small. Th is off ers us a lot

of opportunity that way

and for business growth

potential in the future.

“Traditionally we

were running around

17 to 25 people about

six years ago and we

have expanded steadily.

We’ve gone from the 25

to 40 range, and then we

went from 40 to 60, and

I think this summer we

peaked at 105.”

Guest Controls

opened its new shop to

employees on May 1

with staff making the

move into the two storey

offi ce wing on June 1.

Th e new building,

located at the north end

of the Hill Industrial

Park, sits on a two-acre

yard with enough park-

ing for more than 45

service vehicles.

“We keep busy,” said

Guest. “On safety meet-

ing days, it’s a very full

area. We do a lot of fi eld

installations with our

equipment, primarily in

burner systems.

“We also have elec-

tricians out there as well

as the instrument techs.

Th ey all require vehi-

cles.”

As for future growth,

Guest said, “it’s just a

matter of trying to get

the people in place to

make sure we can service

the customers well” be-

fore they take that step.

“We are looking at

possibly moving up to the

Peace or to Bonnyville.

“Th at’s where we

have actually been doing

quite a few systems – up

in Wabesca and Grande

Prairie and the Dawson

Creek area,” Guest said.

Brian Guest, who founded Guest Controls in 1978, poses with his son Chad, the company president, during the grand opening of the company’s new building in the Hill Industrial Park in Lloydminster.


ISO 9001:2008REGISTERED FIRM

NEW!

[email protected] www.marmit plastics.com

888.868.2658

Highway 43 West, Grande Prairie

PO Box 366 Station Main, AB T8V 3A5

“The Team You Can Trust”TT“T“T““

MPIMARMIT PLASTICS IN

C.

MARMIT PLASTICS INC

.

100 G allon Double Wall

Tank

Lloydminster – A lot

of heavy lifting goes on

under the shop roof of

Full Tilt Field Services

in Lloydminster, a com-

pany that specializes in

the manufacture of cus-

tom truck deck packages

and the installation of

articulating cranes.

Full Tilt is a dealer

for Fassi articulating

cranes and National

Cranes. Th eir prod-

ucts help to transform

all brands of customer

trucks into full service

picker trucks, mainte-

nance units, winch trucks

and small deck trucks.

“We take a cab and

chassis from a customer’s

truck – whatever brand

they bring in,” said shop

manager Lee Steinbring.

“We work with them

to make a full package of

what they require – cus-

tom built from front to

back – tool boxes and

decking and all that kind

of stuff .”

Full Tilt is also a

dealer of IMT truck

bodies that are fully as-

sembled in the shop.

Manual grunt work

is kept to a minimum

thanks to a set of power-

ful overhead cranes and

a 30,000 lb. truck lift, all

housed within a mas-

sive 54,000 sq.-ft. shop

shared with its parent

company, CE Franklin

Ltd.

“We have three over-

head cranes in here to

help assemble these new

trucks,” said Steinbring.

“We have two sev-

en-ton cranes and one

fi ve-ton. Th is way we can

grab any size of picker

or crane and put them

on the unit. We built the

space with a really high

roof so we can handle a

fairly high unit.”

Th e cranes are also

used to lift heavy manu-

factured deck parts that

are welded in the fabri-

cation shop where the

bulk of manufacturing

begins.

“We bring in the cab

and chassis and look at

the placement and how

we can build around the

fuel tanks that come with

the unit and design the

unit with the customer

to make it work for their

application,” said Stein-

bring.

“Th ere’s a lot of weld-

ing and a lot of steel. We

build the steel frame on

top of the chassis all the

way up. We custom make

all of our tool boxes. We

can build any size they

are looking for. We can

build our own aluminum

doors here.

“Th e sky is the limit

when you are coming up

with any new ideas to

build stuff .

“We do it all from

brand new trucks to

customers bringing in

older cabs and chassis

and making the modifi -

cations that they desire

– whether it’s modifying

their tool boxes or add-

ing new ones on.”

Custom features can

range from storage de-

vices such as pinch bar

holders and pipe rack ac-

cessories to side racks.

Page A31

Shop manager, Lee Steinbring, opens a garage door at the Full Tilt shop revealing a set of Fassi articulating cranes or knuckle booms as they are sometimes called. Full Tilt is a dealer for Fassi and National Crane equip-ment that is used on pickers for the oil and gas and construction indus-tries.

Full Tilt cranes make light of lifting


Knuckle booms more compact on truck Page A30

Picker trucks outfi tted with a Fassi

articulating boom, also known as a

knuckle boom, have a lifting capacity

from one ton to 50 tons.

“Th ey are fairly common on a lot of

maintenance units and fl ushbys,” said

Steinbring. “Th e Fassi is a little easier

to mount on some trucks, and it’s more

manoeuverable.

On a fl ushby, you don’t have the

room to mount a stiff boom. Th e articu-

lating crane folds up a little smaller and

it’s a little easier to work around.

“It is very popular. A lot of guys will

put them on the smaller trucks. Once

you get past an eight-ton in Saskatch-

ewan, you need a picker ticket to oper-

ate it.

“A lot of people stay with the

smaller ones for building maintenance

and miscellaneous stuff out there.”

National Crane equipment is pop-

ular for pipe handling due to its quick

speed and heavy lifting capability.

Steinbring says a picker truck could

be used for a wide variety of things

from lifting miscellaneous equipment

lying around a yard and pipe handling

to putting roofs on houses.

“Some of them will have man lifts

that go on the end so you can get up

to look at certain things,” added Stein-

bring.

“Th ere is such a wide variety. It’s

just about moving things that you can’t

move by hand,” he said.

Picker trucks are also used in build-

ing supply, construction, tire service,

public works, mining, railroad, and

rental markets.

“We do service the oilpatch, but we

also do a lot of stuff for construction,

roofi ng trucks and little deck trucks for

delivery – a little bit of everything,” said

Steinbring.

“Once the trucks are done, I’ve got

an engineer who goes through the crane

mount and ensures everything is secure

and sound and gives it a certifi cation for

the year.”

Full Tilt is the only crane dealer in

Lloydminster which means there is a

steady stream of vehicles in all makes

and models for custom deck work and

servicing of truck mounted equipment

that arrive at their shop.

“It’s been fairly consistent. It’s been

a steady incline here for the last six

months,” said Steinbring.

“It looks like the sky is the limit

again. It just keeps increasing as we

go.”

Full Tilt is also a go-to shop for

light and heavy duty mechanical repairs

and safety checks on all kinds of oilfi eld,

industrial and commercial vehicles for

service in Alberta and Saskatchewan

including service rigs and drilling rigs.

Full Tilt is well known as a manu-

facturer of hydraulic skid packages used

in the oilfi eld and is also a dealer of

VMAC compressors, and Crane Smart

Systems under the CE Franklin um-

brella.

CE Franklin distributes pipe, valves,

fl anges, fi ttings, production equipment,

tubular products and other general oil-

fi eld supplies to oil and gas producers

in Canada as well as to the oilsands, re-

fi ning, heavy oil, petrochemical, forestry

and mining industries.

Mechanic Ian Bialowas greases a ball joint on a Ford F-550 in Full Tilt’s automotive service and repair shop.


Lloydminster – Archer Daniels Midland Company (ADM) has donated

$25,680 to Lakeland College to help fund the curriculum of a new blended

program in second class power engineering.

Th e funding for second class power engineering studies is in keeping with

Lakeland’s plans to expand its training opportunities for careers in the oil and

gas industry under a new energy, entrepreneurship and Saskatchewan program

located at the Lloydminster campus.

“A new second class power engineering program will be part of program-

ming available from Lakeland College, a long-time training provider serving the

Alberta/Saskatchewan region, that would train an additional 80 students over

four intakes of students per year,” said Kara Johnston, energy program director.

“It will be an excellent addition to our current program off erings aimed to

serve several vital industries within our geographic area.”

Th e program funding cheque was presented to Johnston by Mike Deck,

ADM donates seed money to Lakeland

Lakeland heavy oil and operation technology students joined ADM’s Mike Deck (far left) and Lakeland’s Kara Johnston (far right) during a cheque presentation on Oct. 6 at the Lloydminster campus. ADM donated $25,680 to the college to go towards the creation and curriculum development of a blended program in second-class power engineering. Photo submitted

plant manager of ADM Agri-Industries, a wholly owned subsidiary of ADM

that operates a canola processing plant in Lloydminster.

“ADM strives to make a positive diff erence in the communities where we

live and work,” said Deck during the Oct. 6 presentation.

“We are proud to present this gift to Lakeland College and look forward

to helping develop a program to give power engineers an opportunity to up-

grade their skills, increase their personal safety and improve their operational

effi ciency.”

Currently, Lakeland off ers a one year certifi cate program in fourth class

power engineering with plans to off er a two year diploma in third class power

engineering in 2012.

Th e upgraded programming will be housed in a new $30 million heavy oil

operation technician (HOOT) lab with the fi rst phase construction expected to

begin in the spring of 2012.

Th e Alberta government kicked off the project fundraising in July with a

commitment of $4.9 million toward the fi rst $15 million phase of construction.

Th e new lab will include a new water testing room, an operations control

room, an operations lab and simulation and gas process labs.

Classrooms, lecture theatres, a student lounge, a computer lab and faculty

offi ces will be added in the second phase of the project.

A new power engineering lab and facility would enable the college to in-

crease seat numbers in its over-subscribed HOOT program and transition the

current one-year certifi cate HOOT program to a two-year program.

Th e facility will also enable Lakeland to off er more customized oil and gas

programming including petroleum management training and short-term, just-

in-time courses to address specifi c industry needs.

Th e existing HOOT program provides students with lab and classroom in-

struction in the operation and maintenance of boilers, turbines and combustion

engines leading to an industry practicum and a fourth class power engineering

exam in Alberta.

Th e donation is a part of the corporate ADM Cares program, a social in-

vestment program that directs funds to initiatives and organizations that drive

meaningful social, economic and environmental progress worldwide.

Th e program comprises three distinct focus areas: supporting the responsible

development of agriculture, improving the quality of life in ADM communities

and fostering employee giving and volunteer activities.


2009 FREIGHTLINER FLC11264SD stk #s picker unit,c/w Manitex 30102 picker,490 DD60, Allison Automatic

$325,000

1998 GMC TOPKICK C7500 ,Stk# J504146, 6

speed trans, single axle,

18 ft. deck, Hiab model

105 knuckle picker

$29,900

2005 FORD F550stk# A40565,C/w 1997 Cus-co vac unit,Refurbished in 2008, 500 fruitland blower, TC-350 crude spec

$95,000

2001 WESTERN STAR 4964SXstk# K970766, C/w 3x5, gardiner denver triplex pump, Hutchinson aluminum 11m3 single compartment

$185,000

Access Matting For Sale or Rent

Don’t Let The Weather Dictate Your Drilling Operations

Our Mats:* 8’ X 14’ Solid Oak (Hardwood) 3-Ply Laminated Mats

* Optional Interlocking Fingers Available Upon Request * A Beefy ‘187’ Carriage Bolt Pattern (Zinc Coated) * Green Painted Ends For Added Longevity To Cut Boards

Eric Ducharme 204.724.0592 or Chris Allison 204.851.1709

Call Today for Competitive PricesFor More Information visit us online @

4024

9211

•06/

25/1

0

By Brian ZinchukShaunavon – A little

south of Shaunavon, just

off the highway and nes-

tled in a bit of a valley, is

where you will fi nd one

answer to the accommo-

dations shortage in the

Shaunavon area.

Paladin Accomo-

dations Ltd. set up its

camp 22 kilometres

south of Shaunavon and

two kilometres east of

the highway. Th ey are

using land that is owned

by Audrey Matyka, of

Matyka Oilfi eld Service.

It’s far enough from

town to be quiet, and

peaceful. “Th e stars are

brighter,” noted Jona-

than Lupul, general

manager.

Clayton Greenlay is

the camp manager. Th e

operation is owned by

the Lupal family.

“We started offi -

cially January 4. We had

about a year and a half ’s

prep work before that,”

said Lupul.

“Th e trailers were

on the ground in August

2010,” Greenlay said.

Th ey had to run in gas,

power, their own septic

system and well in order

to get up and running.

Unlike camps running

off noisy and expensive

diesel generators, the

camp is tied into grid

power.

It wasn’t easy to

get that, however. Like

others in the oilpatch

have told Pipeline News, they’ve had to wait quite

a while for SaskPower to

get them them hooked

up. It took getting a gov-

ernment minister to in-

tercede to see action.

“We were told it

was going to take up to

16 weeks to get power,”

Lupul said. Th e interces-

sion got it done in two

weeks.

“We didn’t have a

customer base when we

started. We couldn’t wait

16 weeks. We had to

bulldoze through that,”

Lupul said.

Th e facility has two

primary components for

a total of 74 beds. A few

are used for staff .

“We have a 49-bed

Atco dorm,” Lupul said.

Th ey have individual

rooms, and common

washrooms.

He added, “We have

a fi ve unit Aramark com-

plex with 25 beds.

“We leased a two-

unit rec room. Th e

kitchen is in the Ara-

mark unit.

Greenlay has worked

on the service rigs and

grew up on a ranch 20

kilometres southeast of

Shaunavon, while Lupul

has been in the service

industry for years.

Greenlay noted one

of the interesting aspects

of running a camp is

pleasing varying tastes

for food. Page A34

Shaunavon camp in placePaladin Accommodations camp manager Clayton Greenlay, left, and general manager Jonathan Lupul, right, pose in front of their Shau-navon area camp.

Photos submitted


www.caltechsurveys.com

CALGARY403 |263 |8055

REGINA306 |775 |1814

UNITY306 |228 |4366

PROFESSIONAL LAND SURVEYORS Wel l S i tes P ipel ines Mapping As-Bui l ts Construct ion SurveysSubdiv is ion/Property Surveys

40242872•0

3/0

6/0

940

2428

72•0

6/25

/10

[email protected]

See our online inventory atwww.brutusbodies.com

4024

7758

•10/

23/0

9

5201

6700

•06/

25/1

0

Page A33 “We really try to step it up on the

food,” he said.

Th ey off er hearty, southwest Saskatchewan home

cooking, Lupul said. “What your grandma makes.”

Th ey aren’t aiming for fi ve star dining, but hearty

food.

“We use a local butcher for meats, local Hutter-

ite colonies for eggs and vegetables,” he said.Greenlay spends up to fi ve hours a day sourcing

food. He said, “We shop daily for fresh food. Some-

times we go to Swift Current, but mostly we get it

in Shaunavon.”

Th ey point out there’s a diff erence from daily

shopping and getting a food truck once a week.

Th e location is on a bus route, so it’s one of the

fi rst to get plowed when the snow falls, they pointed

out.

Th eir clientele has been a mix. “We’ve had drill-

ing crews, heavy haul truckers, helicopter pilots. We

do a lot for frac crews from Baker Hughes and Tri-

can.”

Sometimes the camp will fi ll to the max, then

it will be dead for weeks, then they’ll have 40 beds

fi lled. Cenovus’ activity over the summer kept them

busy.

“We’re putting in a bid for TransCanada’s Key-

stone XL,” Lupul said.

Th e company is also talking about a joint venture

with another housing provider to meet the needs of

that project.

As for early October, they didn’t yet have con-

tracts in place for the winter. But with many drilling

crews staying in campers, and Shaunavon, Eastend

and Gull Lake all full, they anticipate business will

be coming their way.

“Every hotel has been full for much of the past

two, three years,” Lupul said.

Greenlay added, “Calls are coming in all the

time. Th ere’s a lot of activity, we just have to market

more. We have a dogged pursuit of clients.”

74 bed camp in a tight market for places to stay

Clayton Greenlay is on the roof of the Paladin Accommodations camp. It has 74 beds.


www.metaltekmachining.com

ABSA RegisteredConforming to ISO and API Standards • 24hr Service

780 - 875 - 6535

TUBING DRAINS

FAVAFLOW SURE

VALVEC-VICES ROD BREAKER

WELLHEAD FLANGES

BAILER BITS

Drill Collar & Drill Pipe Recuts

Thread & Rethreadof Casing

REAMER SUBS

BOP TOPPLATES

Design - Engineering - ManufacturingDesign - Engineering - Manufacturing

· Wellhead Equipment Design,Manufacturing and Repair· Thread and Re-thread Casing, Tubing and Line Pipe· Drill Pipe and Collar Storage and Inspection· General and Custom Welding and Manufacturing· C.A.D Library of Parts· Complete Assemblies

· Product Development

· Rotary Connection Manufacture and Repair· Down Hole Production and Fishing Equipment Construction· Phosphate Coating Available For Finished Parts· MIG, TIG and B Pressure and Aluminum· Service and Drilling Rig Stocked Parts· Custom and Production Machining· Rapid Prototyping

PIPELINE NEWSSaskatchewan’s Petroleum Monthly

B-SectionNovember 2011

By Geoff LeeWainwright, Alta. – Davco Welding Ltd., based

in Wainwright and Lloydminster, has bulked up

its crane fl eet with the addition of a new 250-ton

Link-Belt crane for heavy duty facility construction

throughout east central Alberta and western Sas-

katchewan.

Th e company has also acquired a small, but nim-

ble, Spyder crane for inside facility work with the

ability to walk through a one-man door, turn into a

four-foot wide hallway and lift 6,380 pounds.

Davco specializes in oilfi eld construction, main-

tenance, and heavy lifting with a growing demand

for a variety of cranes and lifting capacity to move

facility equipment such as tanks, compressors, pipes,

valves and header inlet buildings.

“Th ings are getting heavier in the oilfi eld,” said

Faas, who co-owns the company with his wife Con-

nie.

“As they can haul bigger and heavier loads, big-

ger and heavier trailers are getting made, and loads

are getting heavier to lift and set in place when they

get to a facility.

“We started out with a 6-ton Broderson crane

that we worked around the yard and at some sites.

Th en we got a 12-ton we took out on smaller jobs.

“Now, we’ve got bigger jobs, and we are working

on bigger pipe and using bigger cranes.

“We go from a 14-ton to a 250-ton all terrain.

Th e 250-ton crane is used for a lot of long reach

heavier stuff such as heavy compressors.

“Right now, it’s on a river job that is reaching out

over 200 feet. We have rented cranes in the past to

fi ll the gap that we didn’t have. Finally, we decided

we should have one of our own.”

Th e Link-Belt ATC 3250 has a reach of 358 feet

which enabled Davco to put the crane to work in

September and early October hoisting pieces for a

coff er dam for a fresh water intake system on the

North Saskatchewan River east of Lloydminster.

Th e heavy crane work was part of a steam assist-

ed gravity drainage (SAGD) construction project.

Davco is the only company between Edmonton

and Saskatoon with a 250-ton crane that was imme-

diately put into action lifting a 67,000 pound valve

assembly near Strome, Alberta after it arrived at the

Wainwright yard in August.

It has also been used to hoist 40,000 pound sec-

tions of 30-inch pipe at the Strome job site east of

Camrose.

Th e versatile Spyder UNIC 295 crane is also

earning its keep inside plants and facilities with re-

stricted lifting requirements.

“Th e Spyder crane is to be able to get inside

buildings and able to work inside without having to

get a really large crane to tear the roof of a building

off and do a bunch of extra work,” said Faas.

Th e Spyder has a lifting height of 29 feet and a

boom length of 28 feet.

Page B2

Davco’s new 250-ton Link-Belt crane has a 358 foot reach that was ideal for hoisting pieces for a coffer dam for a fresh water intake system as part of a SAGD project on the North Saskatchewan River, east of Lloydminster. The project took place in September. Photo submitted

Cranes from a 'spyder' to 250 tons: Davco

B2 PIPELINE NEWS November 2011

Page B1

“It’s excellent for inside a facility or a tank farm.

It saves a lot of time and money,” said Faas.

“We can travel out to the site. It’s a lot quicker to

get it in there. We do not have to get extra crews just

to be able to get a bigger crane onto site.”

Davco has a total of nine cranes for lifting oil-

fi eld skid units, compressors, tanks, vessels and pip-

ing of any confi guration along with heavy military

equipment for CFB Wainwright.

“Th ey get loads out there – sometimes dead

equipment and stuff that needs to lifted,” said Faas.

“When they do an exercise, they haul a bunch

of equipment in and if they can’t unload it, they call

us to do it.

“We lift tanks, guns, helicopters, planes – all

kinds of cool stuff they have.”

Davco also assists emergency response person-

nel at accident scenes by utilizing long reach cranes

that have even been use to put derailed trains back

on track.

“Th ey are usually interesting jobs,” said Faas.

“Luckily, we have never been to an accident where

anyone has actually been killed.

Page B3

Tanks, guns, helicopters - all in a days work

Lifting this 67,000 pound valve assembly at an oil eld facility near Strome, Alberta was easy work for Davco’s new 250-ton Link-Belt crane.

Photo submitted

This new Spyder crane quickly earned its keep lifting a 2,000 pound valve inside a Pikes Peak SAGD facility in the Lloydminster area. The Spyder can work well in tight spaces.

Photo submitted

Dave Faas, president of Davco Welding based in Wainwright and Lloydminster, climbs the stairs of this fabricated steel platform made for a client to go over a pipeline rack at a facility.

Photo by Geoff Lee

www.davco.ccwww.davco.cc

Oil eld Facility Oil eld Facility Construction Construction

Services in Alberta Services in Alberta & Saskatchewan& Saskatchewan

• Welding

• Pipe tting

• Facility Construction

• Cranes & Heavy Lifting

• Skid Packages

• Painting & Sandblasting

• Torquing

• B Pressure Welder Testing

• Air Trailer

Wainwright - LloydminsterWainwright - LloydminsterPhone: (780) 842-5559 • Email: [email protected]: (780) 842-5559 • Email: [email protected]

PIPELINE NEWS November 2011 B3

89 Escana Street, Estevan Sk. • Phone: 637.2121 Toll Free: 1.866.332.2121

• Estevan • Saskatoon • Regina • Winnipeg

• SALES • SERVICE • PARTS • LEASING

Estevan Sk • Phone: 637 22112221111

Trucking Estevan Ltd.Trucking Estevan Ltd.

88 Devonian Street, Estevan, SK.88 Devonian Street, Estevan, SK.Ph: 634-4041 (24 hr) • Fax: 634-4040Ph: 634-4041 (24 hr) • Fax: 634-4040

www.samstrucking.ca

• Full Service Trucking Company• Top Quality Rig Moving Experience

A 90 ton crane was deployed by Davco Welding to lift this 2,000 barrel tank into place. Photo submitted

Jake Courtemanche guides a load of hollow structural steel at Davco’s fab-rication shop in Wainwright. The lift-ing was done using a 90-ton crane.

Photo by Geoff Lee

Page B3“Safety has really

changed things a lot in

how we, and everybody

else, operate. Safety is a

big thing.

“Your safety record

is really important when

you are awarded jobs.

Jobs are awarded be-

cause of your safety pro-

gram. We like to think

our safety record is one

of the best.”

Davco got its start

30 years ago as a small

mom and pop weld-

ing and quality control

company that eventually

purchased its nine acre

site as business grew.

Today, the com-

pany provides a range

of oilfi eld services from

cranes and heavy lifting

and facility construction

to welding, skid packag-

es, torquing, and paint-

ing and sandblasting in a

variety of buildings and

fabrication tents.

“Th ings just kind

of grew and grew,” said

Faas, who has a staff of

more than 100 employ-

ees including his twin

sons Kevin and Jamie

who perform a variety of

supervisory functions.

“We are kind of a

one-stop shop,” said Faas.

“We like to think we can

do just about everything.

We do it right from the

drawings to the painting

and installation.

“We are getting

more and more work for

everything – our fi eld

crews, our manufactur-

ing – everything to the

cranes. It’s getting busier

and busier.

“We are looking at

expanding some more.

We are looking at hir-

ing some more. I would

like to hire more guys. I

think we can handle up

to 125 pretty easily.”

Davco has been

awarded some of the

structural steel work to

support the proposed

Keystone XL pipeline by

TransCanada Corpora-

tion.

“Th at was defi nitely

a bonus,” said Faas. “Th at

gives us work to look for-

ward to. Th e work will be

structural for the pipe-

line for the compressor

stations as they go down

the line.”

Davco previously

landed a contract tying

in lines at Hardisty for

the main Keystone pipe-

line in 2009.

Crews also weld ev-

erything from two-inch

to 48-inch pipe at facili-

ties and compressor sta-

tions for pipelines from

Hardisty to Manitoba

with the assistance of

picker trucks.

“It’s mostly small

stuff that they lift or haul

out to site like small pip-

ing valves and assemble

them on site,” said Faas.

“Th ey use the pick-

ers to lift them – mostly

in the yard – it’s load-

ing them up and taking

them to site.”

Davco’s fl eet of

equipment includes

rollers, bevellers, line-

up clamps, hydraulic

torques and other es-

sential tools to com-

plete large scale facility

construction and facility

upgrades, routine turn-

arounds and shutdowns,

and spool replacements.

Davco signed on for Keystone XLstructural work


IInnssttrruummeennttaattiioonn SSaalleess && RReennttaallss

(Since 1985)

AAccuutteecc SSyysstteemmss LLttdd.. ((330066)) 448877 22553366 wwwwww..tthheeqquueessttggrroouupp..ccoo

(Since 1985)

LLEVEL-PRO Tank Gauging System

(Since 1985)

TM

LLEVEL-PRO Tank Gauging System

LEVEL-PRO “ PLUS“c/w Low Cost Simplex Satellite

Designed for Permanent & Portable tank applications.

TAANNKK LLEEVVEELL IINNVVEENNTTOORRYY &&SSPPIILLLL PPRREEVVEENNTTIIOONN OOn-site Displays

MMESSENGER1100 4X

((Since 1985)

RRemote siteCommunications

TMTAANNKK LLEEVVEELL IINNVVEENNTTOORRYY &&

SSPPIILLLL PPRREEVVEENNTTIIOONN(Since 1985)

ELECTRICAL • Gensets - 40 KW - 200 KW• Light Towers • Transformers

Mudvac's, Transfer Pumps c/w Manifolds & Hoses, Trash Pumps, Matting All Sizes,Bowen Power Swivels, 125 h.p. Boiler

GENERALOILFIELD HAULING

TANKS (All sizes)

• Mud • Shale • Premix • Processing • Polymer • Cone • Flare • Floc • 400 BBL

BORDER TANK RENTALS LTD.• LEADERS IN OILWELL DRILLING PRODUCTION RENTAL EQUIPMENT •

FAX: (306) 634-9963PHONE: (306) 634-7700P.O. Box 1238

ESTEVAN, SASKATCHEWAN S4A 2H8

Wainwright, Alta. – Steady as she goes. Th ose are

comforting words from ship captains and offi cers of

economic development such as Carley Herbert with

the Town of Wainwright.

Herbert sees smooth sailing ahead for the local

and regional economy including the oil and gas sec-

tor.

“We just talked to a few oil and gas companies

in the area, and they are all saying the same kind of

thing – it’s been a very steady year,” she said.

“Th ey are expecting it to get even busier by the

end of the year and into next year which is really

positive.”

Th e September newsletter of the Wainwright

Economic Development Board lists 16 new business

start-ups in town in 2011 including a Penn West

outlet.

Th ere is also a positive buzz about the acquisi-

tion of Carson Energy Services Ltd. by Flint Energy

Services Ltd. that aff ects approximately 100 Carson

employees in Wainwright.

“We are anticipating that will help us because

Flint is even larger than Carson,” said Herbert not-

ing the takeover went into eff ect on Oct. 1.

“I did talk to them after this announcement and

they all felt really positive about the acquisition. Th e

management is staying on.”

Wainwright is also benefi ting from a strong ag-

ricultural economy this year, and some new construc-

tion projects at CFB Wainwright despite Canada’s

pullback from Afghanistan.

Defence Construction Canada closed tenders on

Oct. 4 for the construction of a $30 million expan-

sion of its vehicle maintenance facility.

Th e military developer also plans to tender the

construction of a proposed $5.1 million community

centre at the base in the spring of 2012.

“With the military and agriculture having a

great year this year, and a steady oil sector, the busier

it is for us,” said Herbert.

“Th ere’s more money been spent here and more

businesses starting.”

Several commercial franchises including Hump-

ty’s Family Restaurants, Quiznos and Ricky’s All

Day Grill Restaurants and RONA hardware have

posted franchise investment opportunities on the

town’s website.

“We have a lot of people interested in Wain-

wright because we are kind of a growing commu-

nity,” said Herbert.

“We are kind of a regional hub and we have al-

ways had a very stable economy. It’s a good place to

start a business.

“A lot of franchises are looking here, so hopefully

if we can match them up, we can get them here.”

Proof the town is growing will come with the

results of the federal government’s 2011 census.

Page B5

Wainwright ring on all cylinders

Wainwright economic development of cer, Carley Herbert sees positive growth in this year’s re-gional oil and gas economy continuing into 2012. Wainwright is also bene ting from a strong agri-cultural economy in 2011 and new construction projects in the works for CFB Wainwright.


#1 Hwy 18, Oxbow, Saskatchewan306-483-5132 • www.ensignenergy.com

Big Sky Drilling, operating out of Oxbow, Saskatchewan, has the largest rig eet in Saskatchewan.

Big Sky Drilling specializes in oil and natural gas drilling in Southeast Saskatchewan and Southwest Manitoba.

FLOAT EQUIPMENT-REAMERS

Estevan, SKwww.gillisspowertongs.com

Tel: (306) 634-6768Fax: (306) 634-6738

Serving the Serving the southeast corner of southeast corner of Saskatchewan since Saskatchewan since

19931993

Sales & Safety:Sales & Safety:Ryan WallingtonRyan Wallington

421-7011421-7011

Manager:Manager:Dylan GillissDylan Gilliss421-8158421-8158

Sales:Sales:Logan GillissLogan Gilliss421-8481421-8481

Fax: 634-8298Email: [email protected]

EstevanSaskatchewan

Page B4Th at should put the

population near or over

the 6,000 mark, not in-

cluding the 600 or so

military personnel at

CFB Wainwright – with

many factors driving lo-

cal growth.

“We have a popu-

lation of 40,000 in our

trading area,” said Her-

bert.

More seniors are

also choosing to live in

Wainwright with the de-

velopment of retirement

homes by Points West

Living, an Alberta pro-

vider of supported living

options for retirees.

“We have retirees

coming here for better

health care and service,

and people for diff erent

industries – the oilfi eld

and the military obvi-

ously,” Herbert said.

A newer hospital to

replace the aging Wain-

wright Health Care

Complex tops the town’s

economic wish list with

land available in a con-

cept development.

“We are hoping we

have a spot for them if

the government comes

through with the fund-

ing,” said Herbert.

“We are hoping with

the military here, that

might help. Obviously,

if that were to happen,

then we would become a

bigger hub for people to

move to and retire to.

“It would be excel-

lent. Obviously, health

care is huge in any com-

munity. We have a lot

of doctors. We have 10

doctors here which really

helps us as well.

“People come here

from Viking and Lloy-

dminster for doctors.

When they are here, they

do other shopping too.”

While commercial

property along Highway

14 through Wainwright

is in short supply, the

town is forging ahead to

develop and service new

residential and industrial

lots to keep the economy

ball rolling.

“We plan to continue

to grow and try to work

with diff erent companies

to come here,” said Her-

bert. “We are developing

our own residential sub-

divisions to keep that go-

ing.”

Th e town plans to

develop up to 135 new

residential lots by next

fall in the fi rst phase of

its newest Enstrom sub-

division at the east end of

town.

An 190 additional

lots will come in Phase 2

where that new hospital

would be located.

Only 14 residential

lots are available in the

fi nal phases of the exist-

ing Baier residential sub-

division that the town

also serviced in keeping

with its plans to attract

newcomers.

Th e Baier subdivision

features a mix of single

houses and townhouses,

but rental housing re-

mains in short supply.

“We have had one

apartment go to a condo

so it limits the rentals.

Obviously, we have a

need for aff ordable hous-

ing,” said Herbert.

“Th at being said, we

do have Habitat for Hu-

manity planning a build

here for next year. Th ey

are going to build a du-

plex for a couple of fami-

lies.”

Only one indus-

trial lot remains in Tory

Heights Industrial Park,

but the town will prepare

plans to service fi ve new

lots over the winter.

“We are looking for

options for that for the

longer term as well,” said

Herbert.

Several franchises seeWainwright as an opportunity

The last available residential lots in the nal phases of the Baier subdivi-sion at the east end of Wainwright are lling up quickly as the town con-tinues to grow.

Lloydminster – Ques-

tions are a scientist’s best

friend when it comes to

research and discovery.

Th at is the case for

Jose Alvarez, a research

scientist with Alberta

Innovates Technology

Futures whose research

into the eff ectiveness of

waterfl ooding in heavy

oil applications began

with questions.

Th ose questions

were key to the clarity

of his presentation on

waterfl ooding at the 18th

annual Technical Heavy

Oil Symposium held in

Lloydminster Sept. 14-

15, and are worth re-

peating.

Why is heavy oil

waterfl ooding consid-

ered to be an unfavour-

able recovery method?

Can knowledge

gained from conven-

tional oil waterfl oods be

extended to heavy oil?

Why is published

data on fi eld studies lim-

ited, controversial and

contradictory?

Alvarez said these

questions have led him to

advocate more research

on the mechanisms of

how to get oil out of

pores in the reservoirs

utilizing waterfl ooding

with the goal of increas-

ing recovery rates.

Th e theory of wa-

terfl ooding is to restore

pressure to a reservoir by

“sweeping” the reservoir

with water via injector

wells placed through-

out the reservoir to dis-

place the remaining oil

towards the producing

well.

Alvarez noted exist-

ing research shows that

sweep effi ciency drops

off in heavy oil due to

the higher mobility of

viscous oil.

Higher mobility is

bad he said because in-

stead of pushing the oil

like a piston with water,

it pushes it like a fi nger.

“Th ese fi ngers are

not very effi cient in or-

der to push the oil from

the reservoir,” said Alva-

rez.

“Th e problem is we

don’t understand what

is happening in some re-

gimes with waterfl ood-

ing.

“We know that, for

example, with heavy oil

we are not getting as

high a recovery factor as

light oil; however, we are

getting recovery factors

that are not explained by

classical theory.”

“We need to un-

derstand what are the

mechanisms in order to

improve the recovery

factor in heavy oil,” he

said.

Alvarez believes re-

search needs to focus on

the recovery mechanisms

after what’s called break-

through – when the fi rst

drop of water from a

waterfl ood arrives at the

production well.

“I believe there are

two kinds of regimes.

One is before break-

through. Th at is pretty

well explained by clas-

sical theory. We know

about that,” he said.

“However after

breakthrough, what we

have found is that up

to 50-60 per cent of the

oil is produced at very

high water cuts, so what

the theory is explaining

there is not very clear

now.”

Alvarez says fi eld

scale experiments are

needed to evaluate the

real time importance of

the mechanisms.

He also said future

research needs to incor-

porate the mechanisms

into advanced simula-

tions.

“If we can under-

stand the mechanisms

better, we can increase

the recovery factor of

our heavy oil, and we

can push waterfl oods

into even higher oil res-

ervoirs which have a lot

of here in Canada.

“Some people will

tell you can’t use water-

fl oods for higher than

100 centipoise (viscous

heavy oil).

“However, here in

Canada, we are proving

those people are wrong.

We have been pushing

the envelope up to 1,000

cP, and we have recov-

ered up to 40 per cent

of the oil. We are try-

ing to push the envelope

higher.

“In Lloyd, there is a

huge tradition. Since the

’60s they have been us-

ing waterfl ooding. Th e

recovery factor can be

improved. We can write

new books about how

to extrapolate what we

know in Lloydminster

to the world.”

Alvarez expects ad-

vances in waterfl ooding

by the heavy oil indus-

try in the Lloydminster

area will be universally

accepted, the same way

that the local develop-

ment of heavy oil pro-

duction with sand or

CHOPS has gained

worldwide usage.

“What we know

here in Lloyd will be

used in other countries,

but what we need to do

is to better understand

the mechanisms, then

we can get more oil from

the ground,” he said.


FOR LEASE OR RENT20 ac. subdivided yardsite located in the center of the Waskada, Manitoba oil eld.

It includes 3 bedroom home with central air & electric heat suitable for living or of ce.

- 3,600 sq. ft. of cold storage sheds- property is fenced and has 2 large accesses on to main road

- treated water pipeline with multiple hook ups- MTS high speed phone service

- lots of room for parking of large equipment or heated shop- great location for oil eld based business

Looking for a long term tenant. For information contact Greg anytime

at 204-522-5044.

SVEIN BRYEIDE SVEIN BRYEIDE CONSTRUCTION Ltd.CONSTRUCTION Ltd.

HWY. 47 N. AT BENSON Fax: 634-9798 Cell: 421-0203

• Trackhoe and Backhoe• Lowbeds and More

Serving Sask for over 30 years.

• Earth moving and Oilfield Construction

• Lease Preparations and Restorations

• Pipeline Construction and Maintenance

• Road Building, Dugouts• Dozer Ripper and Winch Cats

• Motor Scrapers, Graders, Gravel Truck

634-6081

Water ood mechanisms need study

Jose Alvarez, a research scientist from Alberta Innovates Technology Futures, kicked off the 18th annual Technical Heavy Oil Symposium in Lloydminster in September with a talk on the state and direction of heavy oil water ooding.


Innovation Assured, Value DeliveredPrairie Petro-Chem, a Clariant Oil Services business, is a leader in the development and application of oil and gastreating compounds and industrial chemicals. Our expanded geographic position and talented and knowledgeableteam of experts are ready to help you improve your operations. Contact us today to learn more about our chemicaltechnologies and services.

Prairie Petro-Chem, A Clariant Oil Services Business: 738-6th Street, Estevan, SK S4A 1A4. Phone Orders: 306-634-5808. Fax Orders: 306-634-6150. Email Orders: [email protected]. General Inquiries: 306-634-7362. General Fax: 306-634-6694.Web: www.oil.clariant.com. Twitter: @ClariantOilSvcs What do you need?

By Brian Zinchuk

Weyburn – By add-

ing more services and

expanding existing ones,

Gibson Welding Ltd.

has been able to grow

substantially in recent

years. For instance, a

drive around the Stough-

ton area will often result

in fi nding a picker with

“Gibson Welding” on its

boom.

Th ere are a lot of

turns required to get into

Gibson Welding’s main

yard, about 12 miles

southwest of Weyburn.

Many roads and ap-

proaches in the area are

still cut due to the fl ood-

ing this past spring. “We

still can’t used our main

road. We’ve been trapped

here since last spring.

Th ere were three feet of

water on the road,” said

John Gibson.

Gibson sat down

with Pipeline News in a

brand new offi ce shack

that arrived just a few

days prior. Th e larger of-

fi ce is in keeping with

the company’s growth

trend.

Gibson started his

business as a small weld-

ing operation. “It started

out with me welding.

I had a little shop here,

and built things. I had

a truck and went out to

the drilling rigs,” he re-

called.

“It sort of mutated

into oilfi eld trucking

and rentals. Th at’s was

we primarily do now.

“I started build-

ing catwalks for service

rigs. We’ve got 22 sets.

Th ey’re just starting No.

23. We rent them out.”

“We keep three

welders, and that’s what

they do, build things and

fi x things,” he said.

When they’re not

making catwalks or other

items, they make tanks.

“We build our own

400-barrel tanks,” Gib-

son said, noting that

since they had so much

trouble in getting tanks

from other suppliers, the

company began building

its own fi ve years ago.

Prior to that, tanks were

coming from a northern

Alberta manufacturer.

“We don’t sell them.

We build them to rent.

We’ve got 80-some

tanks now.

Business really start-

ed to pick up around

2006 for Gibson Weld-

ing. He said, “It all start-

ed around fi ve years ago.

We were getting enough

to eat, but certainly noth-

ing like it is now.”

Th e Bakken play

made all the diff erence,

he explained.

Depending on the

season, the company’s

staff runs around 20 to

25. “We’re staffi ng up for

winter now. We get busy

in the winter. We’ve got

four steamer trucks we

fi re up.”

Pickers addedTh e pickers were

added to move rental

units. “Six years ago, we

were having trouble get-

ting trucks to move our

rental units. So why don’t

we buy a truck?” he said.

Page B8

This Gibson Welding picker was found near Stoughton on Sept. 27. Photo by Brian Zinchuk. The company estab-lished a shop at Stoughton just a few miles away.

Gibson Welding grows with Bakken play

FAX: 306-453-4476BOX 40, CARLYLE, SASK. S0C 0R0

www.evergreenenviro.ca

306-453-4475

* Environmental Protection Plans * Impact Assessments * Pre-Site Assessments * Environmental Audits & Assessments

* Well Site & Battery Abandonments * Drilling Waste Management * Pre/Post Water Well Testing * EM Surveying * GPS Mapping

* Formerly “Three Star Environmental”


NOW IN OUR

NEW LOCATION!413 Mississippian Drive

Estevan

Phone: 634-7892 • www.ipc-sk.ca

Proud to be an active part of the communityLocally Owned and Operated

Offering you Competitive PricesQuality Products

Great Service

WATER ENERGY RECOVERY

Location: Midale, SK 16-09-07-11 W2

A full oilfield waste management, custom treating and water disposal facility

306-458-2988306-458-2988

www.palko.com

New locations in Construction - Opening SoonOungre: Waste Water Processing Facility

Location: 01-16-002-14w2

Stoughton: Waste Water Processing FacilityLocation: 16-21-007-08w2

Page B7Initially, the fi rst one was a bit of

a letdown. He bought an old truck

whose clutch promptly dropped on

it. “We put a clutch in, and away we

went,” Gibson said.

It was a 17.5-ton unit. Th ey still

have it. It stays in the yard.

“I ran it myself seven days a week.

We couldn’t keep up,” he said.

A year or so later another picker

was purchased, then another. Each

was progressively bigger – 17.5, 23,

28, 30, 35 tons. Th e company now has

fi ve pickers in total, with a sixth being

built. It’s a 45-ton tri-drive, tandem

steer Kenworth equipped with a fi fth

wheel to pull its own trailer. Th e crane

is a Weldco unit with a swing cab.

With the mix of sizes, Gibson said,

“We hit each market,” adding that get-

ting bigger units meant getting “a little

braver each time.”

“Th ere’s incredible demand. It’s

very related to the type of work the

Bakken requires. Th ose fracs are very

picker intensive.”

Th ey also have three “Texas Bed”

trucks, one of which is a tri-drive. A

further winch tractor is being built in

Edmonton.

Rig matting has been in especially

high demand this past year, with Gib-

son saying, “We’re buying it buy the

truckload. It’s usually moved by pick-

er.”

Gibson Welding has grown to

become a very vertically-integrated

company, which is how Gibson likes

it. “I’m very much a believer in that. It

makes economic sense.”

If they need a new product or ser-

vice, they add it. For instance, a skid-

steer loader was recently added to deal

with the rig matting, in particular the

swamp matting. “It’s been running ev-

ery day since spring,” Gibson said.

Th e rental fl eet has grown to in-

clude approximately 80 tanks, 22 cat-

walks, 60 test separators, 30 fl are stacks,

and 300 pieces of rig matting.

Another addition has been renting

out work strings, pipe for service rig

work. For companies on a short term

job, it works out well.

“A lot has fallen on our lap because

it fi ts so well with what we’re already

doing,” Gibson said. As an example, he

noted a company will rent their mat-

ting, and then a catwalk. Th at leads

to a work string and tanks, plus light

towers and, if it’s winter, a steamer.

Th en you need the trucking to move

all of it.

Asked if he’s aiming at one-stop

shopping, Gibson replied, “To a cer-

tain point, it is. If we don’t have it, I

can help them get it.”

Gibson noted two local fi rms were

instrumental in getting the company

off the ground. He pointed to Norm

“Pierre” Mondor at Aldon Oils and

Ken Lee with Midale Petroleums.

“Th ey took a chance on me, helped

me get going,” he said. “I wouldn’t be

where I’m at without those two.”

Other supporting companies such

as Crescent Point have helped. Indeed,

when it came time to add a satellite lo-

cation, it landed right in the middle of

the Bakken fairway, at Stoughton.

“It made sense to have a presence

there. We like to keep our rental equip-

ment central. If we’re going to have a

yard, let’s have a shop.”

Th e result is a minimization of

commuting with the heavy trucks. In-

stead, workers can go to the Stoughton

shop in a pickup, and then take the big

truck out to the site. Page B9

Vertical integration keeps adding services

A tri-drive bed truck is a recent addition to the Gibson Weld-ing eet.

Specializing in • pumpjacks

• vessels • manbasket work

Travis Hutt - owner/operatorCell: (306) 487-8120 Bus: (306) 487-2608 • Fax: (306) 487-2296

Lampman, SK. Email: [email protected]

HUTT’STRUCKING LTD.

• 45 Ton Picker • Texas Bed/Winch Truck • Highway Tractor • Highboys • 45 Ton Picker • Texas Bed/Winch Truck • Highway Tractor • Highboys • Stepdecks • Double Drop Trailers • Pilot Trucks• Stepdecks • Double Drop Trailers • Pilot Trucks

“ ” Page B8

“We can reach quite a ways from

Stoughton,” Gibson said.

Construction of the shop started

a year ago in the spring. “Our timing

was terrible,” he said, noting the mud-

dy conditions.

In the last year, the company has

begun to pick up work with Cenovus,

whose primary fi eld is nearby. “Th ey’ve

been kind in giving us a chance,” Gib-

son said. “Th at’s been a pleasant sur-

prise.”

He noted the Bakken play is mov-

ing towards Oungre. One day south of

Torquay he counted 10 rigs, including

both sides of the Canada-U.S. border.

Family operation Gibson Welding is a family opera-

tion. “My wife Marg has been with me

since Day 1,” he said. “She’s the offi ce

trouble-shooter now, a person to go to

when you stumble. She’s been at my

side through it all.

Th eir son, Jason, 28, acts as fi eld

supervisor. “He’s been there ever since

he got out of school,” John said.

Th eir daughter, Michelle, 32, “went

out and saw the world, and decided

Saskatchewan is the place she ought to

be,” John said.

She has a bachelor’s degree of

management in accounting from the

University of Lethbridge, and is now

the offi ce manager.

Jackie, 22, is taking a petroleum

engineering degree in Butte, Montana.

She works with the fi rm as a summer

student. Smiling, John said, “We give

her every terrible job we could fi nd –

22 years of revenge!”

Daughter Morgan, 19, is taking

business admininistration at the Uni-

versity of Regina, and assists in the of-

fi ce.

Daughter-in-law Rena Good-

win, 28, is the safety co-ordinator. She

worked very hard over the past year,

and the company passed its Certifi cate

of Recognition audit with fl ying col-

ors, according to Gibson.

“We believe in safety, but we also

believe in safety with common sense.

We’re fortunate, we’re small enough

we can still have a lot of hands-on.

Pretty well every day, everyone who

works with us interacts with someone

who owns the company.”

Asked about the recent spat of ac-

quisitions in the southeast Saskatch-

ewan oilpatch, Gibson replied, “We’re

not for sale, ever. It’s not part of the

plan.”

“It will take over your life. A fam-

ily business is a great thing, but at the

supper table, it’s still there. We bought

a house in Phoenix just to get away

from the thing.”

“It’s the best of times, but also a

diffi cult time to fi nd labour. You’ve

got to have good people. It’s 30 below,

at 5:30 a.m., you’re putting a guy in a

half-million dollar truck. You’ve got to

have a pretty good guy.

“Saskatchewan’s about ready to

have its turn. We’re just about there.

We’ve got the natural resources, good

’ole farmboys that want to live here. I

think we can become quite a province

in the next few years.

“You have to maintain a favour-

able business environment. You need

to keep it to attract the capital. Th at’s

what we’re lacking. We need the rest

of the work to put money in here,” he

said.

As for their own company’s fu-

ture plans, Gibson said, “I think we’ll

do more of the same, and do it a little

better.”


LINELOCATING

GPSMapping

Box 235

Oxbow, SK S0C 2B0 Canada

Dispatch: 306-483-7897 Offi ce: 306-483-2194

Fax: 306-483-2292


Serving Southeast Saskatchewan

and Southwest Manitoba.

www.absolutelocating.com

Whole family involved with rmMarg and John Gibson own and operate Gibson Welding of Weyburn.Saskatchewan’s about ready to have

its turn. We’re just about there.- John Gibson, Gibson Welding Ltd.


2010 Weybex Award Winner2010 Weybex Award Winner

The environmentally friendly The environmentally friendly alternative.alternative.

Red Deer, ABRed Deer, AB

Calgary, ABCalgary, AB

Frobisher, SKFrobisher, SK

www.dpsmicrobial.com

By Brian ZinchukCarnduff – It all

started out 25 years ago,

with two brothers-in-

law, one truck and one

trailer. Now C & N Oil-

fi eld Maintenance Ltd.

employs about 30 peo-

ple, operates a fl eet of 32

units, and launched its

own oilfi eld supply store

a year ago.

On Oct. 14, the

company celebrated its

25th anniversary with a

customer appreciation

day at its new shop in

Carnduff , the one they

moved into a year ago.

Company founders

Wayne Carley and Doug

Needham sat down with

Pipeline News in that

new shop on the com-

pany anniversary to dis-

cuss their origins. Doug

is married to Wayne’s

sister, Bev.

Carley bought out

Needham three years

ago, allowing him to

retire from the busi-

ness. And while Wayne

is still president of the

operation, his son Kris

runs much of the day-

to-day operations as op-

erations manager. Kris’s

wife Gayla is operations

manager. Doug’s son,

Ryder Needham, worked

with C&N as a summer

student, but has gone on

to a good job with a ma-

jor fi rm in Winnipeg.

Th eir fi rst employee,

Allan Hubbard, rounds

out the management

staff .

“I started with Bed-

ford Petroleums 28 or

29 years ago as an op-

erator,” Wayne said.

“When they sold, I ran

portable separators.”

He was working

under contract for a

successor company of

Bedford.

“I hired Doug to re-

lieve me on weekends.

Page B11

C&N Oil eld Maintenance Ltd. celebrated its 25th anniver-sary on Oct. 14. From left are Allan Hubbard, employee No. 1 and supervisor for circulating and pressure trucks; Doug Needham, co-founder, now retired; Wayne Carley, co-founder and president; Gayla Carley, of ce manager; and Kris Carley, operations manager.

Photo by Brian Zinchuk

25 years for C&N


• Vacuum Trucks• Vacuum Trucks• Steamers• Steamers• Water Trucks• Water Trucks• Tridem & Quad Pup • Tridem & Quad Pup Trailers Trailers

• Tractors/Vacuum Wagons• Tractors/Vacuum Wagons• Fire & Vapor Suppression • Fire & Vapor Suppression Unit Unit• Air Trailers/Safety • Air Trailers/Safety Supervisors Supervisors

CLASSICCLASSICVACUUM TRUCK LTD.VACUUM TRUCK LTD.

24 Hour 24 Hour ServiceService

ALIDA, SKALIDA, SK (306) 483-8697(306) 483-8697

Renting Soon - Call 634-6030 or 421-0252

This is the C&N eet and shop in the early days. Photo submitted

Page B10“As it started to peter

out, I said to Doug, ‘We

should buy out Charlie

Foster.’ He had one ser-

vice truck and trailer, and

did light maintenance.”

Th e pair bought

the truck and trailer for

$27,000 with the help

of a loan from Wayne’s

parents. It was paid off

in three years.

Asked who would

drive, Doug commented

on their diff ering driving

styles, with Wayne being

much more aggressive on

the pedal. “If it was a bid

job, Wayne would drive.

It if was by the hour, I

would drive.”

Th e work was initial-

ly general oilfi eld main-

tenance, doing pipefi t-

ting and changing belts.

Wayne had the benefi t

of four years as an oil-

fi eld operator before they

started, including having

worked for Valleyview

Oilfi eld Services in Ox-

bow. Doug had also put

in six months after high

school at Pembina Me-

ter in Edmonton. Both

farmed.

Doug and Bev

bought the family-

owned jewelry story

from Bev and Wayne’s

parents. Th ey sold it 12

years ago due to an in-

creased focus on the oil-

fi eld. However, during

the early years before the

days of cellphones, Bev

used to do dispatch from

the jewellery store. Cli-

ents would call the store,

and she would reach

them by way of two-way

radio. Bev also worked

on the administration

side of the business.

“When we bought

the store, gold was $35

an ounce. Oil was around

$20 a barrel,” Doug said.

“An ordinary ladies’ gold

band sold for $10 when

we bought it."

At the time of the

interview, oil was trad-

ing around $87 a barrel,

and gold was $1,680 an

ounce.

“In the summer I

farmed, and came back

to the store,” Doug said.

A lot of C&N’s work

was part-time, at fi rst.

Th ey could often wrap

up a job early in the day,

and then go farming.

“You’d wait for the

phone to ring,” Doug

said, noting it was a lot

slower pace than today.

A lot of those jobs only

took three hours.

“When we were

knocking on doors, we

were meeting people for

the fi rst time,” Wayne

said of their eff orts to

drum up business.

Th e previous owners

of that truck and trailer

had worked primarily

for Imperial Oil. “Th at’s

where we started,”

Wayne said.

Both strongly cred-

ited that initial work for

Imperial Oil for defi ning

how they did business.

“Th e changes in safety

haven’t been that big for

us, because Imperial Oil

was on the cutting edge,”

Wayne said. “I think

we’re a better company

today because Imperial

Oil was one of our fi rst

customers.”

Indeed, he said

they’ve seen other com-

panies over the years

that were nowhere near

where Imperial Oil was

back then.

Doug said, “Th eir

standards were high. If

you worked for them, you

could work for anyone.”

“Safety has come a

long way over the years,

but we hit the ground

running with Imperial

Oil,” Wayne said.

Imperial Oil also

helped launch a very im-

portant part of C&N’s

business, chemical deliv-

ery.

Doug said, “One day,

Imperial Oil asked us to

circulate some wells, 25

wells west of Carnduff .

Th ey would give us an-

other chunk, and another,

then boom!”

Wayne added, “A

lot of that was driven by

Bob Gibson with Esso

Chemicals, and Shane

Boyes with Nalco. Th ey,

through their chemical

sales, needed someone

to apply the product for

them. Th ose two chemi-

cal salesmen really ex-

panded our sales.”

Now C&N works

for over 50 companies,

according to Wayne, who

said, “We probably go

into at least 5,000 wells a

month now.”

Initially Doug would

handle the circulating,

then Allan Hubbard

started circulating as well.

He’s now the supervisor

in charge of all circulators

and pressure trucks.

“If you ever wanted

to clone someone, It

would be Al,” Wayne

said, speaking highly of

his work ethic. That,

combined with Doug

and Kris’s sales skill,

and Wayne’s manage-

ment, hasvebeen part

of the formula for their

success over the years.

Their initial growth

was on the maintenance

side. In five years, they

had grown to six units,

including a steamer,

a chemical delivery

truck, two crew trucks

and a pickup.

In the past, they

used to do hazardous

material work with

PCBs, but no longer.

The company has

seen substantial growth

in the last four or five

years. A portion of that

growth can be attribut-

ed to former C&N em-

ployees who have gone

onto bigger things, and

now hire their old em-

ployers to handle their

chemical needs.

“There are prob-

ably 20 guys in the

field who worked for

us who we now work

for,” Wayne said. Be-

fore he returned to the

fold, one of those was

his son Kris.

Page B12

Clients are best salespeople


FOR ALL YOUR VACUUM TRUCK NEEDSFOR ALL YOUR VACUUM TRUCK NEEDSTANDEM•TRI-AXLE•SEMI-VAC UNITS•COMBO UNITS•TANK TRUCKS

306•482•7897 OR 306•485•7833

100 Tonne Crane100 Tonne Crane100 Tonne CraneNEWNEWNEW

matting rentalsmatting rentals

bed trucksbed trucks

winch truckswinch trucks

pickerspickers

SERVING SASKATCHEWAN OIL & ENERGY INDUSTRY SINCE 1954SERVING SASKATCHEWAN OIL & ENERGY INDUSTRY SINCE 1954

Slick Drill Collar & Slick Drill Collar & Heavy Weight Pipe RentalHeavy Weight Pipe Rental

Weekly & monthly packages availableWeekly & monthly packages availableCall: 306-421-0235 or 306-421-6374Call: 306-421-0235 or 306-421-6374

46 – 13th Street NE • Weyburn, SK • S4H 1K8Phone: 306-842-5490 • Fax: 306-848-0275

Toll-free: 888-346-8260

www.hseintegrated.com

If You’re Serious About Safety

Occupational Health & SafetyAudiometric & Respiratory Equipment Fit Testing

••

Standby & Emergency Medical ServicesIndustrial Hygiene

•

•

Wireless Air Quality MonitoringPlume Dispersion Modeling

••

Gas Detection EquipmentGas Leak Detection and Analysis

••

Safety Project Management & ConsultingBreathing Air Equipment & ServicesOf ce/Air TrailersShower ServicesH2S Safety

•

•

•••

Emergency Fire ghtingCon ned Space & High Angle RescueWell Control and Blowout RecoveryHot Tap & FreezeSafety Training

••

•

••

Page B11 Over the years, numerous producing companies have

come and gone. “We’ve changed the same location sign seven times on some

wells,” Wayne said.

During slowdowns, wells still need servicing. “If the maintenance slows down,

circulating keeps going,” Doug said.

“When everyone saw a slowdown, we increased our business,” Wayne added.

“As far as I’m concerned, (former Alberta premier) Ed Stelmach was one of

the best things to happen to the Saskatchewan oilfi eld. Th at’s been a big thing for

this corner.”

Th ey bought their fi rst pressure truck four years ago. “Th at opened a lot of

doors for us,” Wayne said. “We’ve got three now.

“As they’re fi nding the Bakken to be corrosive, they needed a new system to

look after it. Th at’s where our pressure trucks come in.”

Of the 32 units that make up C&N’s fl eet, seven were added in the last year

alone, much of that on the chemical side.

“Th e majority of our business is chemical-related,” Wayne said.

Circulating keeps going even during slowdowns“Chemical is repetitive. It’s month in, month out, even with low oil prices.

Th at’s where we put most of our eff orts.

“Our best salespeople are the chemical companies in southeast Saskatchewan.

Th ey fi nd the work and customers, and then they call us.”

Having a comfort level with those companies is key, Wayne and Doug said,

with Wayne noting those chemical companies have confi dence the job will get

done. “We’re going to put it on our program and do it.”

Th eir employees are trained, and have proper documentation, Wayne said.

“Th e reason we’re here today is because of our staff . If you don’t have good

people working for you, then you’re in trouble. If you don’t treat them right, and

they go somewhere else and you have to work for them, they’re not going to give

you work.

“We have well over 10 million litres of chemical we’ve hauled over the 25

years. Boy, it’s been a lot,” he said.

In October, 2010, C&N Supply was launched, providing an independent local

oilfi eld supply store for Carnduff . “Th e amount of business we did in the fi rst year

was beyond my expectations,” Wayne said.

Regarding his retirement, Doug said, “I really do miss they guys in the dog-

houses and the fi eld.”

He does not, however miss the winter work, noting that now he spends time

down south in the winter.


24 Hour DispatchOxbow: 306-483-2848

Pipestone: 204-854-2231Waskada: 204-673-2284

Serving Southeast Saskatchewan, Southwest Manitoba & North Dakota since 1956.

• 16, 21 & 35 million BTU Super Heaters

• Propane Fired

• Horizontal 80 m3 frac tanks

• Triaxle Combo Units

16 21 & 35 illi BTU

• Tandem, tridem, quad sour sealed units

• Triaxle Combo Units

Stoughton – Secondary containment systems are

often modular – bolt together walls, and a poly liner

for the bottom. Th erein lies the problem, at least ac-

cording to Jayson King, who has come up with his

own solution for secondary containment – a one

piece, welded steel solution.

“It’s all in one piece. Th ey pick it off , put it on the

ground, put the tanks in it, and tied it in,” said King.

“Conventional containments are a steel wall

pinned together with a liner. Th ey take quite a bit

of manpower to set up – a three man crew and four

hours. Mine doesn’t have a liner. It’s all one piece,

welded steel.

“With labour shortages, mine can be set up with

two guys and a picker.”

Th e walls are formed with a rigid lip around the

top. Th e bottom corner is designed for rigidity. Th e

fi nal product looks like a very large tub.

Th e containment units are made in Weyburn by

Stewart Steel.

Now a consultant for lease building and recla-

mation, King said, “I used to do construction and

maintenance. I’ve set up conventional containments.

Th ey were quite labour-intensive. Th ere has to be

a better way to do this,” he said. “Driving around,

thinking, I came up with this design.”

Th ere are two sizes. Th e fi rst is 20 feet wide and

40 feet long, with a three-and-a-half foot wall. It

will hold two 400-barrel tanks. Th e second is 20 feet

wide and 52 feet long, with a four-and-a-have foot

wall. It can handle two 750-bbl. tanks, or three 400-

bbl. tanks.

Th e whole unit is made of 3/16-inch plate steel.

It has enough fl ex to form to the ground, but is rigid

enough to hold the weight, according to King. Th ere

are patents pending on the design.

Th e two sizes are 13,000 and 15,000 pounds re-

spectively, and are well within the capacity of most

pickers. Th ey sit fl at on the trailer, but are considered

an oversized load.

“It’s right to the limit. It needs pilot vehicles and

permits to move it,” King said. “Moving them hasn’t

been an issue.”

He added even with pilot trucks, it’s still cheaper

to move and install one of these one-piece contain-

ments than utilizing the conventional method.

Having a steel fl oor is tougher than a poly mem-

brane, which can be easily punctured. “It takes quite

a bit to puncture this,” he said.

While a poly liner can be slippery when wet, the

steel fl oor of these units has a slip-resistant surface.

Th e inside has a chemical-resistant coating.

Additionally, gravel is often placed inside poly

lined containments. Th ere is no need for that in these

units. Th e tanks are set on six 3 x 12 inch bridge

planks. Page B14

The blue secondary containment unit seen here west of Stoughton is essentially a very large tub of welded steel. That allows it to move in one piece, set up easily, and be a lot tougher than a poly liner. Photo by Brian Zinchuk

One-piece containment solution

The secondary containment unit is one piece


• Oilfield Graveling• Gravel Crushing & Screening• Sealed Trailers for Hauling

Contaminated Waste• Lease Preparation

& Reclamation• Grading

• Excavating• Heavy Equipment Hauling

• Car/Truck Wash• COR Certified

TOLL FREE 1-888-532-5526Creelman, Sask.

Dispatch Rod/Larry: (306) 421-9295Larry Cell: (306) 457-7712

Shop: 433-2059; Of ce phone/Fax: 433-2069

NEW - DRILLNEW - DRILLGENERATORSGENERATORS

24 hours a day • 8 kw - 350 kw

• Pumpjacks• Well Site Shacks• Service Rigs• Construction Sites• Drilling Rigs

Phone Toby: 577-1907Phone Toby: 577-1907

Jayson King designed a one-piece solution, seen over his shoulder, to simplify secondary containment.


Page B13Not having gravel

also makes reclamation

easier. If gravel becomes

contaminated from a

spill, it has to be sent to a

proper disposal site. Th e

one-piece units can be

cleaned with a steamer

and vac combination

unit.

“When reclaiming

it, it’s easier to move

around than a conven-

tional one,” King said,

noting poly liners often

have to be scrapped.

Flanges are included

on the side and end for

tie-in purposes. “Some

people have tied a load

line into it. Lots go over

the wall,” King said.

Each unit comes

with stairs. King has

recently switched to an

aluminum three-step

crossover with a plat-

form on top.

Units are rented out

on a monthly basis. Th e

most common usage is

for single well batter-

ies, however, there is a

potential to use them

for cleanups. Since they

are essentially large tubs,

contaminated snow can

be placed it them to melt

down. Th en a fl uid haul-

er can suck off the water

and oil, and treat it at the

producer’s own facilities,

like produced emulsion.

“My containments

are based out of Wey-

burn and Stoughton,”

said King, who hails

from Corning, north of

Stoughton.

King started plan-

ning this venture in the

summer of 2008, and

started producing them

in September 2009. Th at

year he produced be-

tween 10 and 15 units.

Th e following year took

off .

“Th ey really started

kicking in,” King said.

“Th ere were some weeks,

I moved 10 in a week.”

Th e fl ooding of 2011

slowed everything down,

but this winter looks

promising. “It’s starting

to pick up now,” he said.

“I see nowhere else but

up.”

To that end, King

has recently hired a con-

tainment co-ordinator.

Containment units can be used for snow cleanup


BERT BAXTER TRANSPORT LTD.

301 Kensington Ave.301 Kensington Ave.Estevan, SK.Estevan, SK.

Phone: (306) 634-3616(306) 634-3616

3902 - 75th Ave.3902 - 75th Ave.Leduc, AB.Leduc, AB.

Phone: (888) 835-0541(888) 835-0541

www.bbaxtertransport.ca

When your well site, lease or tankage requires containment,

call JK Containments for informationcall JK Containments for informationon how we will save you

time and money!

This product is patent pending

One piece portable containment designed

with quick set up, environmental security

and government regulations in mind.

Jayson King 306.736.9169Stoughton, SK

Jayson King 306 736 9169Jayson King 306 736 9169

www.jkcontainments.com

Genset / Light TowersGas Powered Pumps

Telescoping Fork & Scissor LiftsBackhoe / Trenchers / Trailers

Temporary Power Cable

Oil eld, Industrial, Commercial

Ph:(306) 634-9888 Ph:(306) 634-9888 ELECTRIC MOTOR DIV.

New/Used SalesComplete Rewinding & Repair

REPAIR SHOPTrash Pumps, Lights, Heaters,

Generators, Compressors, Converters

ESTEVANESTEVAN

Regina – Oil and gas

companies in Saskatch-

ewan may be too busy

drilling to acquire ad-

ditional petroleum and

natural gas rights while

the going is good.

Th at belief is shared

by Energy and Resourc-

es Minister Bill Boyd in

his reaction to the small

October sale of oil and

gas rights that brought

in just $13 million for

the province.

By contrast, the

combined lease and li-

cence sale of new rights

in Alberta topped $99

million in a two week

period ending Oct. 5.

“I consider this sale

to be a solid but smaller

sale,” said Boyd. “But I

believe what we’re see-

ing in this sale and the

one before it is compa-

nies focusing on assets in

hand and developing the

rich inventory of lands

they have accumulated

over the past two years.

“We see evidence of

that in demand for drill-

ing rigs and service rigs,

where the utilization

rates here are actually

higher than the rates in

Alberta and British Co-

lumbia.”

Th e August sale

generated $21.7 million

in sales revenue for the

province.

“Th ese last two sales

have seen smaller com-

panies establishing land

positions in our oil-

patch,” said Boyd.

“As well, this year is

tracking to be either the

third or fourth best on

record for land sale rev-

enues, with the top two

years occurring in the

last four years.

“Industry contin-

ues to send a message of

confi dence in our rich

oil resource and in our

strong business climate.”

Total land sale rev-

enues for the 2011 cal-

endar year now stand at

$228 million.

Th e October sale in-

cluded 142 lease parcels

that attracted $12.6 mil-

lion in bonus bids and six

petroleum and natural

gas exploration licences

that sold for $446,000.

Th e Swift Current

area led the pack with

most bids and the high-

est sales total of $4.3

million followed by the

Weyburn-Estevan area

at $3.3 million

Th e Lloydminster

area recorded sales of

$2.9 million with the

Kindersley-Kerrobert

area trailing the province

at $2.6 million.

Th e highest price for

a single parcel was $1

million. Federated Co-

operatives Limited ac-

quired this 259-hectare

lease parcel southwest of

Gull Lake.

Th e highest price

on a per-hectare ba-

sis was $9,468. Ranger

Land Services Ltd. bid

$153,285 for a 16-hect-

are lease parcel west of

Lashburn.

An oil shale spe-

cial exploratory permit

block on off er northeast

of Tisdale received a

work commitment bid

of $2.1 million from

Prairie Land & In-

vestment Services Ltd.

Th e next sale of

Crown petroleum and

natural gas and oil shale

dispositions will be held

on Dec. 5.

Swift Current area (numbers round off )

Th e total bonus re-

ceived in the area was

$4.2 million, an average

of $486 per hectare. Th is

compares to $2.8 mil-

lion, an average of $671

per hectare at the last

sale. Page B18

Drilling is hot but land sales are not

Contact your local Pipeline News Sales rep. to get you 28,000

Circulation on your career ad!

Speci c Targeting

B16 PIPELINE NEWS November 2011 PIPELINE NEWS November 2011 B17

Swayze Concrete Ltd.Swayze Concrete Ltd.Dennis • 861-1186Dennis • 861-11861531 Railway Ave., Weyburn, SK1531 Railway Ave., Weyburn, SKFax: 306-842-0414Fax: 306-842-0414Ph: 306-842-6558Ph: 306-842-6558

Swayze Concrete Ltd.Swayze Concrete Ltd.Randy • 482-7647Randy • 482-7647

Hwy 318 North, Carnduff , SKHwy 318 North, Carnduff , SKFax: 306-482-3350Fax: 306-482-3350Ph: 306-482-3617Ph: 306-482-3617

PRODUCTS WE CAN SLING:• Pipeline Sand• Road Gravel• Fill Gravel• 1/2 - 1 1/2 Rock• Mulch• Top Soil

SLINGING IS IDEAL FOR:• Bedding For Flow Lines• Tank Farm Bedding• Weeping Tile• Foundation Backfi ll• Excavation Backfi ll• Grade Fills• Landscaping

KENWORTH T800 MULTICAT STONE SLINGERKENWORTH T800 MULTICAT STONE SLINGEROur operators can sling prod-

ucts into the tightest spots,

saving you time and money.

With a radio remote control

and a 220º working pivot ra-

dius the conveyor can accu-

rately place material up to 80

feet from the end of the truck,

eliminating material handling,

reducing construction time

and improving bottom line.

The Stone Slinger has a 16 - 18

yard capacity depending on

the materials being hauled.

Contact us for Contact us for precise, labour free precise, labour free

placement of placement of materials on your materials on your

job site.job site.

Day Day Construction Ltd.Construction Ltd.

Lease ConstructionLease ConstructionLease Restoration • MulchingLease Restoration • Mulching

Carnduff, SK.Carnduff, SK.Phone: (306) 482-3244Phone: (306) 482-3244

- 24 hour service- 24 hour service

• New & Remanufactured Wellhead Equipment & Valves

• Wellhead & Frac Tree Installations

• Frac Trees, 3”, 4” & 5”, 10,000#• Gate Valves, 2”, 3”, 4”, 5” & 7”, 2,000# - 10,000#• Miscellaneous wellhead equipment

“MORE THAN JUST GRAVEL”Crushed AggregatesCrushed Aggregates

Top Soil, Gravel, SandTop Soil, Gravel, Sand& Crushed Rock& Crushed Rock

Municipal & Oil LeaseMunicipal & Oil LeaseRoad Gravelling & ContaminatedRoad Gravelling & Contaminated

Soil HaulingSoil HaulingAggregate ScreeningAggregate Screening

ExcavatingExcavatingGraders, Lowbeds & CatsGraders, Lowbeds & Cats

Sealed End DumpsSealed End Dumps24 Hour Service24 Hour Service

Cell: 577-7553Cell: 577-7553Fax: 455-2433 • ARCOLA Of ce:Fax: 455-2433 • ARCOLA Of ce: 455-2429455-2429

- Oil eld Maintenance - Service Crews- Pressure Welding - Pipeline Construction

- Battery Construction - Rent or SellNew & Used Equipment

Randy: 634-5405 - Cellular 421-1293Darcy: 634-5257 - Cellular 421-1425 • Fax: 634-4575

LOCALLY OWNED & OPERATEDBOX 843, ESTEVAN, SK.

24 Hour Service - 634-8737

When one looks at the riglocator.ca maps showing the activity around Stoughton, you quickly nd it is one of the highest concentrations in western Canada. A quick drive within a few miles of Stoughton on Sept. 27 revealed just how much is going on. Photos by Brian Zinchuk

A busy day around StoughtonEasy Rider Trucking

Aaron Well Servicing

Noble Well Services

Gee Bee Construction Matted wellhead

A good lease for ducks

CanElson Rig 26

Bert Baxter Transport

Allan Construction


RUNNING STEADY, ALWAYS READY

Hydro Vac Trucks

Straight Vacs

Water Hauling

Steam Trucks

24-7 Service

306-781-2296MOOSOMIN & REGINA

· Full Line Of Excavating Grading and Compaction Equipment

· Tri Axle Sealed End Dumps Tandems, Low Beds

· Sand, Gravel, Rock and Topsoil

· 24-7 Service

A Division of Boyd Excavating Ltd.

Page B15 Th e top purchaser of acreage in this area was Federated

Co-operatives Limited, who spent $1.9 million to acquire two lease parcels.

Th e top price paid for a single lease in this area was $1 million by Federated

Co-operatives Limited for a 259 hectare parcel situated partially within the Gar-

denhead South Upper Shaunavon Oil Pool, 23 km southwest of the Town of Gull

Lake.

Th e top price paid for a single licence was $53,022, by Eastend Energy Corp.

for a 1,036 hectare block situated partially within the Whitemud Second White

Specks Gas Pool, 10 km southwest of Eastend.

Th e highest dollar per hectare in this area was received from Scott Land &

Lease Ltd., who paid $4,190 per hectare for a 130 hectare parcel located adjacent

to the Chambery Upper Shaunavon Oil Pool, 14 km south of the town of Shau-

navon.

Weyburn-Estevan areaTh e total bonus received in the area was $3.3 million, an average of $489

hectare. Th is compares to $11 million, an average of $1,068 per hectare at the last

sale.

Th e top purchaser of acreage in this area was Windfall Resources Ltd., who

spent $914,198 to acquire six lease parcels.

Th e top price paid for a single lease in this area was $372,669 paid by Wyatt

Oil + Gas Inc. for a 65 hectare parcel situated adjacent to the Willmar Frobisher-

Alida Beds Pool, 21 km south of Carlyle.

Th e top price paid for a single licence was $53,520, paid by Plunkett Resources

Ltd. for a 1,036 hectare block situated 49 km southwest of the Roncott Bakken

Pool, 5 km southeast of Rockglen.

Th e highest dollar per hectare in this area was received from Torquay Oil

Corp., who paid $8,891 per hectare for a 32 hectare parcel located within the

Queensdale East Frobisher-Alida Beds Pool, 14 km south of Manor.

Lloydminster areaTh e total bonus received in the area was $2.9 million, an average of $202 per

hectare

Th is compares to $5.7 million, an average of $698 per hectare at the last sale.

Th e top purchaser of acreage was Prairie Land & Investment Services Ltd.,

who spent $1 million to acquire 12 lease parcels.

Th e top price paid for a single lease was $578,510, by Prairie Land & Invest-

ment Services Ltd. for a 259 hectare parcel situated two km south of the Soda

Lake Cummings Oil Pool, 15 km southwest of Maidstone.

Th e highest dollar per hectare in this area was received from Ranger Land

Services Ltd., who paid $9,467 per hectare for a 16 hectare parcel located within

the Lone Rock Sparky Sand Oil Pool, 20 km southwest of Lashburn.

Kindersley-Kerrobert areaTh e total bonus received in the area was $2.6 million, an average of $215 per

hectare. Th is compares to $2.2 million, an average of $256 per hectare at the last

sale.

Th e top purchaser of acreage in this area was Plunkett Resources Ltd., who

spent $561,351 to acquire one lease parcel. Th is was the top price paid for a lease

and the highest dollar per hectare in this area at $2,167per hectare.

Th is 259 hectare parcel is situated two km east of the Whiteside Ribstone

Creek Sand Gas Pool, 12 km northwest of Kindersley.

Th e top price paid for a single licence in this area was $130,535 by Allstar

Energy Limited for a 3,885 hectare block situated within the Bayhurst Viking Gas

Pool, 13 km north of Leader.

Oil shale permit issued near Tisdale

OXBOW

483-2826

ALIDA

443-2466

CARLYLE

453-2262

REDVERS

452-3216

ESTEVAN134 4th Street

637-4370

• Bulk Petroleum & Propane

Girard Bulk Service Ltd.Girard Bulk Service Ltd.PROPANE

• Cardlock• Propane Accessories

• Lubricants


* Bed Trucks* Winch Tractors

* Pickers

RIG MOVING Phone: 482-3244

G.W. TrenchingG.W. Trenching& Hauling Ltd.& Hauling Ltd.

Serving the Oil eld in S.E. Sask. for 36 years!

Lampman, Saskatchewan

Contact: Gordon WaughBus.: (306) 487-3178Cell: (306) 421-0566Fax: (306) 487-3253

• Oil eld Fiberglass Pipeline• Sand and Gravel• Backhoe Service• Bobcat Service• Environmental Services• Electrical Trenching• Grader Work• Flow Line Construction• Cat Work (6-way Dozer)• Sewer and Water

Steve Cole’s home town is Gainsborough. After building a company in Red Deer, he’s now set up a satellite operation in southeast Sas-katchewan. Photo by Brian Zinchuk

What’s that truck doing? He’s Haulin’ Acid

Estevan – Th e skull and crossbones on his hat are fi tting for Steven Cole. See, he’s

Haulin’ Acid.

More specifi cally, he owns and operates Haulin’ Acid, a Red Deer based acid-haul-

ing outfi t that’s in the process of establishing a southeast Saskatchewan presence.

In late September, Cole was looking for a shop for an Estevan-area truck. “Th ere’s

not a lot out there for a one-truck operation,” he said of the real estate situation.

“Th ere are new shops going up, but they want you to rent the whole shop. Until

something pops up, we’ll have to park outside.”

At 36 years old, he’s rediscovered his old stompin’ grounds.

“I never in a million years thought I would be coming back to this area. Years ago,

there wasn’t a lot of opportunity.

Sometimes, however, opportunity comes a-knockin’.

“When a frac has to shut down to wait for an acid truck for 24 hours, that

shouldn’t happen. From 12 hours away, I got a truck there quicker than what

they could get locally. When you’ve got a whole frac crew, the clock is

ticking.”

Th at fi rst call came in late 2010. Th e company has been work-

ing in southeast Saskatchewan for the better part of a year, ex-

cept “when the ocean arrived this past spring.

“We started thinking about this as soon as we got the

phone calls. Th ere was no work in the spring. Now, things

are rockin’ and rollin’. We’re here to stay.

“I wouldn’t attempt to set up here if I wasn’t from

this area,” he said, noting the importance of local con-

nections. He was born in Oxbow. “My home town is

Gainsborough. My grandma’s still in Carnduff . My

grandfather, Casey Anderson, worked for Dome.”

Haulin’ Acid’s driver in southeast Saskatchewan

is from Manitoba. Like many other people, fi nding

accommodations has proven to be tough. At the end

of September, he was still staying in a holiday trailer

in Lampman. He was eventually able to fi nd winter

accommodations in Carnduff .

“He sees the potential in this area. He was ex-

cited about working with us,” Cole said.

Safety is of utmost importance when your spe-

cialty is hauling highly corrosive material. “We’re 11

years accident-free. Zero lost-time accidents. Th e

safety thing is huge. It proves we’ve been doing it

right.”

Page B20


BADGERDAYLIGHTING™

• Tandem Tandem • Tri Axle • Tandem • 4 x 4

Regina ........................................ (306) 531-9487Saskatoon ................................. (306) 934-2964Swift Current ........................... (306) 773-0724Lloydminster ........................... (306) 875-1640Kindersley ................................ (306) 463-6006Carlyle ....................................... (306) 577-3400Weyburn ................................... (306) 848-0906Carnduff/Oxbow .................... (306) 482-5270

Toll Free: 1-800-465-4273www.badgerinc.com

Shoring Sales & Rentals

Full Service Hydrovac Fleet

Available To Saskatchewan

GENERAL OILFIELD HAULINGGENERAL OILFIELD HAULING

• 8 to 40 Ton Picker Service• 8 to 40 Ton Picker Service• Winch Trucks, Bed Trucks• Winch Trucks, Bed Trucks• Air-Ride Equipment • Tank Rentals• Air-Ride Equipment • Tank Rentals

634-8888634-8888 Estevan, SKEstevan, SK

Manitoba, Saskatchewan, AlbertaManitoba, Saskatchewan, Alberta

Opening in August 2011

Enquire as to lodging.

Phone: 1-204-325-7496 Ext 234or email

gm.cn923@choicehotels .com

Take advantage of Early Booking and Pre-sales!

Now Open

306•634•8332

404 Kensington Avenue ~ Estevan, Saskatchewan

Like Purolator for acidHaulin’ Acid now operates a truck based in the Estevan area.

Photo courtesy Haulin’ Acid

Page B19In times of labour

shortages, sometimes

standards slip. Not for

Cole. When it comes to

staffi ng, Cole said, “I’d

rather turn down work

than send out an incom-

petent driver. Our record

speaks for itself.

Th e company is

working on getting it’s

United States Depart-

ment of Transporta-

tion papers in order.

Southeast Saskatchewan

could serve as a potential

springboard to working

south of the 49th paral-

lel. He noted, “Th ere are

no acid haulers in North

Dakota. I got asked to

haul loads down there.”

However, there are

lots of regulatory road-

blocks to overcome be-

fore that can happen.

“I started out as an

owner-operator with

one truck for the fi rst

fi ve years. I realized if I

didn’t expand, I’d be 60

years old, driving this

acid truck,” Cole said.

And expand, he did.

“We have seven acid

trucks and one shower

truck. It’s a separate unit.

All of our acid trucks

have showers on them as

well. I could see as safety

gets more strict, they be-

come more in demand.”

Th e company just

hired a full-time admin-

istrator, relieving Cole’s

wife Darla of the duties.

“Acid is a funny

business. It’s not used on

every well. It’s a special-

ty thing. We have days

we could have used fi ve

more trucks. Th e next

day, you need two,” he

said. “We’re like Purola-

tor for acid.”

Acid is used in

maintenance work, fi x-

ing leaking wells, and

in abandonments. It’s

needed even when drill-

ing is slow.

Th e Cardium play

has rejuvenated Alberta’s

oilpatch, but Saskatch-

ewan has its own shine.

He noted, “Th ey don’t

use as much acid as in

the Bakken. Th is area is

great compared to work-

ing in Alberta. It’s all

fl at, there’s less chain-

ing up. It’s not hard on

equipment.”

Speaking of south-

east Saskatchewan, he

said, “Th e selling feature

is the size of this patch

for a guy who has a fam-

ily and is tired of be-

ing on the road. It’s all

within a two-and-a-half

hour drive. You can be

home, if you can fi nd a

home.”

• Repairs done on all models including: Sonolog, Echometer, DX, etc.

• Major parts and supplies in stock at all times

• Fluid Levels• Dynamometers• Pressure Surveys• Foam Depressions• Equiment Sales, Rentals & Repairs

Scott .........861-1001Anita .........861-7305Keith .........861-2243Dave .........452-8401

Ryan .........458-7790Chantal .....861-9796Brett ..........891-6303Spare ........891-6966

Box 4 • Midale, SK S0C 1S0Phone: (306) 458-2367 Fax: (306) 458-2373

email: [email protected]


TRUCKINGTRUCKING• Pickers• Pickers• Bed Trucks• Bed Trucks• Winch Tractors• Winch Tractors• Texas Beds• Texas Beds

RENTALSRENTALS• 400 BBL Tanks, Lined, • 400 BBL Tanks, Lined, Sloped, Steam Coiled, Sloped, Steam Coiled, Sumped & Sour Serviced, Sumped & Sour Serviced, • Enviro-Vac Units• Enviro-Vac Units• Rig Mats • Rig Mats • Invert Systems• Invert Systems• Surface Sump Tanks• Surface Sump Tanks• Caterpillar Loaders• Caterpillar Loaders• Vapor Tight Equipment• Vapor Tight Equipment

• Portable Flaring Equipment• Portable Flaring Equipment• Flow Back Separators• Flow Back Separators• Pre-Mix Systems• Pre-Mix Systems• Surface Tanks• Surface Tanks• Acid Tanks• Acid Tanks• Mixing Bins• Mixing Bins• Shale Bins• Shale Bins• Flare Tanks• Flare Tanks

(A Division of Total Energy Services Ltd.)

MIDALE Ph: 306•458•2811Fax: 306•458•2813

midale@totaloil eld.ca

CARLYLEPh: 306•453•4401Fax: 306•453•4402

carlyle@totaloil eld.ca

ESTEVAN MCLEAN TISDALEPh: (306) 634-5111 • Fax: (306) 634-8441 • 407 Kensington Avenue, Estevan

Hours: Mon. - Fri. 7:30 a.m. - 5:30 p.m.; Sat. 8 a.m. - 5 p.m.

VISIT US ON OUR WEBSITE: VISIT US ON OUR WEBSITE: www.wood-country.comwww.wood-country.com

WOOD COUNTRYWOOD COUNTRY

"Thinking windows? Shop and compare!"

Insist on CWD windows and doors.PVC Windows - Metal clad windows

Patio and garden doors - Insulated steel doorsCall for comparative pricing!

Metal CladdingNow stocking various lengths of Galvalume & white/white metal.

Farm and industrial, galvanized, galvalume and coloured. 26, 28, 29 & 30 gauge metal ordered to suit your size and needs.

Phone for pricing with your individual requirements!

Many types & pro les available.

We have the solution...COMMERCIAL BUILDING

60x76-16’ Stud Frame Buildingc/w: 20x14 R16 Overhead Door 2 - 36” Commercial Outswing Doors

$32,760.92

FARM BUILDING

50x100-18’ Post Frame Buildingc/w: 24x18 H.D. Steel Sliding Door

$28,377.01

Call today Call today for a FREE for a FREE building building

quote!quote!

3D MaintenanceCell numbers: 483-8024, 483-7024, 483-8148

Home: 486-2143 • Fax: 486-4855

Box 12 Frobisher, SK. S0C 0Y0

[email protected]

FOR SALEFOR SALE

40 acres for sale 1 mile west of Estevan. Two story house with single attached heated garage. Wrap around deck on 2 sides on upper level. Two bedroom country style with main living on the upper level with a gas fi replace in the living room. Lower level has a family room, bath-room and back entry to the garage. Large barn/shop with 3 stalls and two box stalls, tack room, shop in the back of the barn. Two sheds. Dugout and a well with unlimited water supply. This is a great place for horse lovers. Serious inquiries only.

Call 306-421-5042 or 306-471-8711.

Flint completes Carson Energy acquisition

Flint Energy Ser-

vices Ltd. has complet-

ed the previously an-

nounced agreement to

acquire all of the issued

shares of Carson Energy

Services Ltd., a privately

held energy services

company based in Sas-

katchewan.

Th e transaction

was subject to regula-

tory approvals that were

obtained at the end of

September, and closed

eff ective Oct. 1.

Th e purchase price

is comprised of $112

million in cash and 2.12

million Flint common

shares, plus up to an

additional $30 million

earn-out spread over the

next three years, subject

to closing adjustments.

Payment of the earn-out

portion of the purchase

price is dependent on

the Carson operations

meeting the EBITDA

target of $40 million per

year.

Carson, established

in 1974 and based in

Lampman, Saskatch-

ewan, is one of the prov-

ince’s largest private

companies engaged in

energy services, with

over 900 employees and

operations in 17 loca-

tions covering major

energy plays in Sas-

katchewan, Manitoba

and eastern Alberta. Th e

company off ers pipeline

construction, fabrica-

tion, civil and facility

construction, oilfi eld

maintenance, pipeline

integrity, horizontal dir-

ectional drilling, truck-

ing and tubular man-

agement, environmental

and safety sales and ser-

vices. Th e acquisition

also provides Flint with

a fi rm platform to ex-

pand its energy services

reach into Saskatchewan

and Manitoba.

Ron Carson,

president of Carson

Energy Services, will

continue as president

of Carson’s operations

within Flint. In addition,

Carson will continue to

operate under the Carson

Energy Services brand

while Flint and Carson

adopt the best practices

of each organization,

ensuring uninterrupted

and seamless services

to their customers. Th e

Carson operating results

will be consolidated in

the company’s produc-

tion services segment,

and will be reported in

the fourth quarter and

year end statements.

Shining brightThis high dynamic range photo, a combination of 7 exposures taken within a few seconds combined via software into one picture, shows the dramatic sky behind Lasso Drilling Rig 1 just east of Midale on Oct. 13. HDR



STRONGER BUILDINGSSTRONGER POSTS

Find out more about the strongest post framebuilding on the market.

Commercial buildings, machine sheds, shops, barns, hay sheds, arenas & more.

1-866-974-7678 IntegrityPostStructures.com

BOOK NOWBOOK NOW

Serving the SoutheastSaskatchewan oilfi eld industry since 1994.Newalta has provided waste management services for the

Southeast Saskatchewan oilfi eld industry for more than 17 years.

We’re proud of our strong local presence, our exemplary safety

record, solid environmental performance and our long track

record of excellent service.

Contact:Halbrite Location at 306-458-2419Lease 16-29-06-12W2OrAlida Location at 306-443-2146Lease 16-13-05-33W1

24 Hour Tank Truck Services(306) 421-5995

• 10m• 10m33 Compartment Pressure Truck 5000 PSI (steel line) Compartment Pressure Truck 5000 PSI (steel line)• 6m• 6m33, 2 Compartment Pressure Truck, 2 Compartment Pressure Truck• 2 - 15m• 2 - 15m33 Acid Trucks & 30m Acid Trucks & 30m33 Acid Wagon Acid Wagon• Sour Sealed 407 Crude Trailers• Sour Sealed 407 Crude Trailers • Fresh Water Trucks • Vac Trucks • Fresh Water Trucks • Vac Trucks • All Equipment is Modern & • All Equipment is Modern & G.P.S. Equip. G.P.S. Equip. • Fresh Water • Fresh Water Available Available

“Where Experience and Dependability “Where Experience and Dependability Are Just a Phone Call Away”Are Just a Phone Call Away”

#3 Breeze Street, Estevan, SK#3 Breeze Street, Estevan, SKOf ce: 306-634-0070 • Fax: 306-634-0071Of ce: 306-634-0070 • Fax: 306-634-0071

Estevan and Weyburn locationsEstevan and Weyburn locations

Weyburn – Th ese are busy times for

Bob Maurer Construction and Main-

tenance, a Weyburn-based oilfi eld ser-

vice company.

Bob Mauer started the business in

2002. His previous career in the oil-

fi eld was on the drilling side. He was

a toolpush on drilling rigs.

“I quit school to go on the rigs at

17,” he said, having started with Sim-

mons Drilling 28 years ago.

“I got tired of the rigs. I saw an

opportunity in oilfi eld construction,”

Maurer said.

He initially started with an end

dump truck and a backhoe. “We were

doing a lot of reclamation on old fl are

pits,” he said. “Th at created a lot of

work for a few years.

“Th en we went to dozers, building

leases for drilling.”

Excavators were the next addition,

leading into pipelining fi breglass fl ow-

lines.

Th e company now does lease-

building, pipelining, jack setting, builds

batteries, hauls gravel, operates pickers

and bed trucks, or, as Maurer puts it,

“A little bit of everything.”

Th e heavy equipment fl eet is com-

posed to eight dozers, four excavators,

two backhoes, a grader, a scraper, eight

semis including one bed truck, and

one 40-ton picker. Th ere are also vari-

ous tractors, mowers, snowblowers and

boiler units. Page B23

Alex Akerstrom hooks up the chains to the top of the tank.

Lots of work to be had

Bob Maurer would like to add a second picker, if he could nd people to run it.


WEYBURN, SK 306-842-8901

ESTEVAN, SK 306-634-8912

Essential Coil & Stimulation Services currently has a fleet of 25 coil units. These units are tan-dem tandem and tandem tridems. We have coil capabilities of up to 2500 meters of 2.00”, 3400 meters of 1.75”, 4500 meters of 1.5”, and 6700 meters of 1.25”. 7 sets of Class II blowout pre-

venters, including two remote accumulators and Class III capabilities.

We are actively working in Southern Saskatchewan. We have a shop in Weyburn at

#3 20th Ave. SE. Please call us for a list of all the services we provide.

If you are looking for a dynamic new career and live in the

area, fax your resume with a driver’s abstract to 403-580-8906

5 – 22nd Avenue S.E., Weyburn, Sask.

Tel: (306) 842-6100

For 24 hour emergency service call:

(306)861-2841Parts: (306) 842-6100

Tremcar West Inc. offers our customers a certified

repair shop with qualified workers specializing in:

www.tremcar.com

• Tank Trailer Repair

• PIVK B620 Inspections

• Auto Greasing

• SGI Inspections

• Trouble Shooting ABS Systems

• Stock and Sell Parts

• Leasing Available

Suzanna NostadtVice President

Bruce PalmerService Manager

Bob Maurer Construction and Maintenance running hard

Page B22“We can pretty much do everything,” Maurer he said, adding, “I’ve got fi ve

crew maintenance trucks running around.”

Two years ago he added a picker. “Th ere was demand for it. It leads you into

more work. A guy is turning down work every day. It is now much busier than

before.”

He’d like to add another picker, but manpower is an issue.

“We set pumpjacks, move tanks, matting, pipe, tubing and rods for the ser-

vice rigs.”

Th e picker has also seen a lot of days working with another fi rm, assisting

Fast Trucking with rig moves when they are short of pickers. Bob Maurer bed

trucks help out as well.

Th ere are 35 people working for Bob Maurer Construction and Mainte-

nance. Pretty much all their staff is local.

“A lot of my crew trucks run out of Estevan,” he said.

Th e company’s work is widely spread. “Everything’s as busy as it can be,”

Maurer said.

Th is winter is “pretty much booked up. We’re doing as much as we can do.”

Next summer looks promising as well, he said.

Now 45, Maurer was born and raised in the Weyburn area, and has lived

there all his life. He still lives on the family farm a few miles south of the city.

However, he’s rented out all his land. “Th ere’s not enough of me to go around,”

he said.

Th e current shop was built three years ago, one of the early entrants to the

Evanston Park on the south side of Weyburn, in the RM of Weyburn. “I’ve got

11 acres,” Maurer said, noting there is room to expand.

Bob Maurer Construc-tion and Maintenance's picker, operated by Rob Carlson (insert) moves a tank for Leg-acy Oil and Gas. Photo by Brian Zinchuk


* Gastric banding results in an average of 58% excess weight loss within the first three years and patients continue to maintain their weight loss even up to seven years later. (Niville E et al. A mid-term Experience with the Cousin Bioring - Adjustable Gastric Band. Obes Surg 2011; May 5. [EPub])

Serge D. - Fort McMurray, AB

Actual Slimband® Patient

I did, and thanks to Slimband® that’s now a reality for me.

If you’re like me, you don’t want to go on a diet where you

have to count calories, measure your portions or give up

the foods you love. It’s too easy to cheat and too much

effort to keep up!

For the last 10 years, Slimband® has helped over 6,000 men and women

discover a permanent solution to their weight problems, opening the door

to a healthier, happier life.

Aren’t you just about ready to consider something that works?

Call us at 1.800.700.7373 or visit us online at www.Slimband.com

to schedule a free consultation to help you decide whether Slimband®

is the right weight loss solution for you.

Obesity in the workplace

costs companies an alarm-

ing amount of money.

That’s a fact. One estimate

puts the costs associated

with employing obese peo-

ple at $285,000 per year

for a company with 1,000

employees. As a nation,

obesity is costing Canada

roughly $4.3 billion dollars

in healthcare expenses ac-

cording to the most recent

2001 survey. South of the

border obesity is costing

American companies $45

billion each year in medi-

cal coverage and employee

absenteeism. Obesity as

a health and productiv-

ity issue costs companies

more than tobacco use

or alcoholism.

Given this context, men

and women who suffer

from being overweight or

obese often face the ad-

ditional struggle of so-

cial stigma and bias in the

workplace. Obese adults

are often confronted with

negative prejudices and

stereotypes when applying

for a new position. Or, they

experience the “glass ceil-

ing” effect when trying to

advance within a company.

A leading employment

concern for any worker is

discrimination and unfortu-

Weight Bias in the WorkplaceImagine having your skills overlooked because you are overweight. Weight bias in employment situations happens more often than you think.

Do you wish you could get back into shape?

nately, obese or overweight

employees face over-

whelming discrimination

from their colleagues and

superiors in the workplace.

According to one study,

93% of human resource

professionals would prefer

to hire a “normal weight”

person over an obese per-

son who was equally quali-

fied for the job. If the posi-

tion involved face-to-face

interaction with clients,

12% of those who made

staffing decisions said they

felt an obese person would

not be fit for the job.

When it came to job ad-

vancement, 15% of human

resource personnel said

they would be less likely to

promote an obese employee

even if they had the skills

and knowledge that would

make them successful in

the position. Shockingly,

11% of those surveyed felt

it was appropriate

to terminate an em-

ployee strictly because of

their excess body weight.

Despite these negative

results, the researchers

found that no action was

being taken to correct the

unfair treatment of over-

weight employees. Con-

trary to the popular belief

that social pressure will

motivate overweight people

to “shape up”, research has

shown that 79% of over-

weight people react by re-

fusing to diet in an attempt

to affirm that the bias is un-

deserved. Rather than in-

spiring weight loss, weight

bias in the workplace has

detrimental effect on the

overweight employee.

Ideally, employers would

show genuine concern for

the health of their over-

weight employees by cre-

ating healthier work en-

vironments that support a

healthy lifestyle. Instead of

adding the stress and disap-

pointment of being treated

unfairly at work, co-work-

ers and management staff

should be sensitive and sup-

portive of colleagues who

have a weight issue.

Many companies have

found that covering the cost

of permanent solutions like

weight loss surgery is more

cost-effective than pay-

ing for disability insurance

or on-going prescription

weight loss medications

that may result in more sick

days due to side effects.

Addressing obesity in the

workplace with effective

long-term solutions like

gastric banding surgery can

also lower the cost of work-

er’s compensations for inju-

ries or accidents that occur

at the office.

For more information or to book a free consultation call Slimband at

1-800-700-7373

Slimband® Gets Results! The Slimband® is a fully reversible 20-minute procedure that’s clinically

proven* as an effective way to lose weight and keep it off for good.

A D V E R T I S I N G F E AT U R E

Start weight 321 lbs

Now weighs 214 lbs*Results may vary.


Call our Saskatchewan & other locations Toll Free:

Canalta - RamadaWeyburn........1.877.726.2320

Canalta - HotelsHumboldt .....1.888.831.1331Melfort ............1.855.680.4242 Moosomin .....1.877.342.7422Tisdale ...........1.877-771-6235Weyburn........1.877.809.1888

You can consolidate your corporate accommodation needs with Canalta Hotels.

Take a break

Bunkfrom your

Proud sponsors of:

canaltahotels.comPlease visit our web site

for the amenities in each hotel.

Working and traveling is stressful, whether it’s on the rigs or for business. Recharge yourself in your own space with warm hospitality, comfortable rooms, Comfortable Canalta Dream Bed, free continental breakfast, high speed internet, hot tubs, pool, gym and exercise facilities and other wonderful amenities.

Let our friendly staff at a Canalta Hotels take care of your accommodations.

R E DV E R SGENERATORS LTD.

#3 Railway Avenue

24hr 306-452-8200

RENTALS & MAINTENANCEDIESEL ENGINES - PUMPS - COMPRESSORS

Phone: 443-2424 Fax: 443-2433

Box 160, Alida, Sask. S0C 0B0

24 Hour Service • Canada and United States Oilfield Tank Trucks •

• Hot Oil Trucks & Super Heaters • • Pressure Trucks • Bobcat & Gravel Trucks • Backhoe •

• Frac Water Heater & Frac Tanks •

Certificate of Recognition & IRP 16

Ken Boettcher 483-7462 Tim Boettcher 483-8121 Wayne Odgers Salesman 485-9221 Edgar Bendtsen Dispatcher 483-8185 Mike Crawford Dispatcher 485-7970 Grant Anderson Manager 483-7405 Marvin Ferriss Manager 483-8937 Terry Torgunrud Safety & Compliance 483-8952 Carl Boettcher Supervisor 485-8372

(Nickle’s Daily Oil Bulletin) Emerge Oil & Gas Inc. reports that based on

production results to date in 2011, capital plans for the remainder of 2011 and

recent Viking well production performance, it anticipates production to aver-

age 5,600-5,700 boepd for 2011, representing a 14 to 16 per cent increase from

2010.

Th e reduction from previous guidance is the result of various factors in-

cluding: weather-related production downtime; slightly higher than budgeted

decline rates in certain heavy oil fi elds; and most notably, the mid-year realloca-

tion of capital toward evaluating the Viking potential on its owned and farm-in

lands, resulting in the drilling of fewer heavy oil wells than originally budgeted.

Emerge now expects to drill 40 to 43 heavy oil wells during 2011 as com-

pared to a planned 65 to 70 wells per original production guidance and prior to

the reallocation of capital toward Viking prospects.

While disappointed with the lack of production growth over the last two

quarters, the company has grown its average production during each quarter in

2009 and 2010 and year over year in 2009, 2010 and 2011.

Th e company is anticipating a return to production growth in 2012 through

its inventory of heavy and light oil drilling opportunities, particularly in the

greater Lloydminster, Primate and Coronation core areas, with upside potential

as it continues to evaluate its lands at Kirkpatrick Lake.

Emerge will be developing its 2012 capital budget later in the fourth quar-

ter.

It estimates third quarter production to average between 5,400 and 5,500

boepd and current fi eld production is approximately 5,700 boepd. Th e company

continues to guide toward total capital expenditures of $70-75 million for 2011

and expects to exit the year producing between 5,800 and 6,000 boepd.

In an update on operations, Emerge announced a successful heavy oil de-

velopment drilling program at Primate, Saskatchewan, where six (6.0 net) wells,

including one (1.0 net) service well, have been drilled as part of the fall program,

which began in mid-September.

Oil production now exceeds 800 bpd (based on fi eld estimates) from the

Primate fi eld from a total of six wells, with two additional wells awaiting com-

pletion.

Individual wells at Primate are producing at rates of 100 to 160 bpd, which

is two to four times the typical 40 to 50 barrels per day, vertical heavy oil pro-

ducer in the Lloydminster area.

Th e wells produce from the McLaren sandstone, which averages fi ve to six

metres of oil pay.

Emerge shot a 72-kilometre 2D seismic program in the third quarter and

has identifi ed 15 to 20 additional locations on 8.25 sections of 100 per cent

owned land.

Th e company plans to drill an additional six to eight heavy oil wells during

the remainder of 2011 in the Primate and Freemont areas. Emerge continues to

shoot additional seismic and evaluate land in the area of the Primate develop-

ment.

Meanwhile, in the company’s Viking light oil drilling program, pursuant to

a farm-in agreement entered into in January 2011, Emerge initiated its drilling

program in late June 2011 for the fi ve (3.5 net) horizontal commitment wells

targeting the formation in the Kirkpatrick Lake area, along the Halkirk/Coro-

nation Viking trend.

Under the terms of the farm-in agreement, Emerge incurs 100 per cent of

the capital costs (through to equipping) during the earning phase and will earn

a 70 per cent working interest in the wells.

All fi ve wells were drilled by mid-August, with average horizontal lengths

of 1,050 metres each with the completions beginning thereafter. All of the hori-

zontal sections encountered up to two per cent free oil returns in the mud tanks

during drilling.

Four of the fi ve wells have been fracture stimulated and currently three of

the wells have been tied-in and placed on initial production. Th e fourth well was

expected to be tied-in and on production by the end of October and the fi fth

well was awaiting completion.

Emerge focuses on Viking prospect


DISTRIBUTION INC.315A Kensington Ave., Estevan, SK

(306) 634-2835Fax (306) 634-2797

40B 18th Street, N. E., WeyburnPh: (306) 842-5081 Fax: (306) 842-5309

www.apexdistribution.com

Complete Oilfi eld & Industrial Service & Distribution

24 HOURS A DAY!

Sucker Rods & AccessoriesPipe, Valves & FittingsDrilling & Service Rig SuppliesAuthorized Kimray DistributorSecondary Containment SystemsGuiberson Well Service ProductsOil Country Tubular GoodsViking PumpsMeter & Instrumentation RepairProgressive Cavity Pumps

Toll Free: 1-888-638-6433 or 1-306-634-6400Plant: 1-306-388-2344 Fax: 1-306-634-7828

email: [email protected] website: www.estevanplastics.ca

Also Manufacturers of:• Fibreglass Belt Guards • Internal Fibreglass of Steel Tanks • Tank Skimmers • Insulated Wellhead Shelters

ESTEVAN PLASTIC PRODUCTS LTD.ESTEVAN PLASTIC PRODUCTS LTD.Your One Stop Shop For Fibreglass TanksYour One Stop Shop For Fibreglass Tanks

780 barrel tank pressures from 4 oz. PSI to 1616 oz. PSI.oz. PSI.

100 Barrel FRPPoptank 10’ diameter x 7.6’ high

400 Barrel

12’ diameter x 20’ high

500 Barrel1 piece fibreglass Tank


or 12’ diameter x x25’ high





Land For Sale4 - 5 acre

industrial lots for sale - Shand District

Pongo Holdings Ltd.421-9576 or 421-2244

3 1/2 miles South of Estevan on Hwy 47( 35 of 1 of 8, West of 2nd )

Only 3 left

Regina – Saskatchewan has gained the equivalent population of 10 new cit-

ies in the past three and a half years to reach a record population of 1,057,888 in

the latest head count.

Statistics Canada reports the provincial population has grown by over 50,000

people from Jan. 1 2008 to July 1, 2011.

Th at’s 10 times the number of people required for any town of 5,000 people

in the province to seek city status and there is no letting up.

Between April 1, 2011 and July 1, 2011, Saskatchewan grew by 5,444 people,

the largest quarterly population jump since Statistics Canada starting keeping

quarterly population estimates.

Th e record quarterly growth consisted of a natural increase (births minus

deaths) of 1,524, net inter-provincial migration of 1,239 and net international

migration of 2,681.

Saskatchewan saw net in-migration from most other provinces including

Ontario (641 people), Alberta (423 people) and Manitoba (147 people).

Premier Brad Wall said the new population numbers show the continued

strength of the Saskatchewan’s economy.

“People move where the opportunities are and right now, there are a lot

more people moving into Saskatchewan than moving out,” Wall said.

“It wasn’t too long ago that the situation was completely reversed and more

people were moving away. Today, Saskatchewan is on the right track and our

government is working hard to make sure it stays that way.

“Th ere were those who said it would be impossible for Saskatchewan to

grow by 100,000 people in 10 years, which is really only growing at the national

average,” Wall said.

“Th e fact is – Saskatchewan has been growing by far more than the national

average for several years now. We’re up 50,000 people in just three and a half

years, so hitting 1.1 million people by 2015 is well within reach.”

Th e province’s population is also bucking the national trend by getting

younger with a median age of just 37.3 years – the second-lowest among the 10

provinces.

Saskatchewan is one of only two provinces to see its median age get younger

in the past year. In fact, since 2007, Saskatchewan’s median age has dropped

from 38.0 to 37.3.

Wall said this refl ects the fact that more young people and young families are

choosing to stay in Saskatchewan or are moving back to Saskatchewan.

“Th at means good things for our province’s future,” Wall said.

“A growing population and economy provides a growing tax base which

allows government to lower taxes and fund important government services like

health care, highways and education.”

Saskatchewan grows by 10 citiesSaskatchewan grows by 10 cities

This red service rig was working along Highway 13 between Grif- n and Stoughton on Oct. 13.


Working hard


IT’S ABOUT TIMEIT’S ABOUT TIMEJACK!JACK!

www.annugas.comToll Free 1.866.ANNUGAS

ANNUGAS PRODUCTION ENHANCERANNUGAS PRODUCTION ENHANCER

PAYS FOR ITSELF– 4 WEEKSThe increase in oil/gas

production isimmediately

measureable not only in time, but

real dollars.

INSTALLATION – 1 DAY

It only takes a few hours to have your compressor

up and running, practically eliminating production downtime.

YOUR TIME – ZERO

Our safety qualified installers willperform maintenance checks when required,onsite, saving you the

trip in.

®

Jack knows time is moneyJack knows time is moneyJack knows time is money

COMPRESSION CONSULTING LTD.

Please visit us at www.crescentpointenergy.com to learn more.

erggy.com yy

Thank you, Saskatchewan, for

10 great years.

We’re proud to be a part of your community.

PERCY H. DAVIS LTD.

CUSTOMS BROKERSForwarders & ConsultantsCustom Clearance Specialists

EDI Networking

Check out our International Small Package Service

DAILY DELIVERIES INTO DAILY DELIVERIES INTO ESTEVANESTEVANHEAD OFFICE

North Portal (306) 927-2165Estevan (306) 634-5454

Regina ................................(306) 352-2662Saskatoon...........................(306) 244-4847Regway...............................(306) 969-2126Moose Jaw .........................(306) 694-4322

Nationwide Serviceswww.percydavis.com

E-mail Address: [email protected]

(Nickle’s Daily Oil Bulletin) With a return to drier weather in Saskatch-

ewan, PetroBakken Energy Ltd. production has exceeded 43,000 boepd (87

per cent light oil and natural gas liquids), based on field estimates – up 22

per cent from the second quarter the company has reported.

Bakken business unit production is again over 20,000 boepd while

output from the Cardium business unit exceeds 14,000 boepd, with the

remainder of the production generated by the company’s southeast Sas-

katchewan conventional and Alberta/British Columbia business units.

PetroBakken, a 59 per cent-owned subsidiary of Petrobank Energy and

Resources Ltd., estimated that approximately 3,000 boepd of additional

productive capacity is currently down as of the first week of October due

to well maintenance, site access constraints (primarily related to flooding

originating in the second quarter) and facility maintenance.

Drilling activity in the third quarter resulted in 96 (69.9 net) wells,

a decrease of 19 (5.1 net) wells over the same period last year. Of the to-

tal, 32 (25.2 net) wells were drilled in the Bakken, 44 (31.3 net) wells in

the Cardium, 19 (12.4 net) wells drilled in PetroBakken’s Saskatchewan

conventional business unit and one (one net) well in its Alberta/British

Columbia business unit.

At the end of the quarter, there was an inventory of 47.7 net wells ei-

ther waiting to be completed or to be placed on production. Of these wells,

13.7 net wells were in the Bakken (6.8 net of which are on production but

not stimulated) and 24.5 net wells were in the Cardium.

PetroBakken said it continues to execute on its business plan and as

of early October had 18 drilling rigs operating: eight within the Cardium

fairway of Alberta, six within the Bakken fairway in southeast Saskatch-

ewan, two drilling conventional prospects in southeast Saskatchewan and

two drilling exploration wells in central Alberta.

The company anticipates that an additional 48 net wells will be drilled

and a total of 75 net wells will be brought on-

stream by the end of the year. This would leave an

anticipated inventory of 21 net wells which would

be expected to be brought onstream in the first

quarter of 2012.

PetroBakken running 18 rigs

What do you call a group of dozers? A herd? A gaggle? A ock? Maybe a eet? A crew? This crew of dozers was resting west of Stoughton on Oct.

13. Photo by Brian Zinchuk

What are they?


ENVIROTRAP SYSTEMS 1-306-483-7330Sales Contact: CHEYENNE OILFIELD SERVICES 1-306-483-7924

E-mail: [email protected] www.envirotrap.com

THE PROBLEM

All Your Wellhead Containment NeedsAll Your Wellhead Containment NeedsIncluding Hydraulic Pumping UnitsIncluding Hydraulic Pumping Units

MISSION STATEMENT“We Work In Harmony With Both The Oil Industry & Landowners To Protect

Our Environment”

ENVIROTRAPENVIROTRAPSYSTEMSSYSTEMS

THE SOLUTION

• Unit cost is less than clean-up cost from one packing failure

Responsible Product From a Responsible

Company

Chemical Barrel Containment

Stand

WellheadContainment Unit

Hydraulic PumpContainment Unit

Estevan Office: Estevan Office: Phone:Phone:

(306) 634-2681 (306) 634-2681Fax: Fax:

(306) 636-7227(306) 636-7227

Calgary – Oilsands

Quest Inc. may have

enough cash in its pock-

et at the end of October

to continue to advance

the development of its

oilsands pilot project at

Axe Lake, Saskatchewan

toward commercial pro-

duction of bitumen.

Th e Calgary-based

company is hoping to

convert a non-binding

letter of intent by a

third party to purchase

the company’s Wallace

Creek bitumen assets in

Alberta for $60 million

into a signed deal by the

end of the month.

Earlier in Septem-

ber, the company re-

ported it could run out

of fi nancing at the end

of October without ad-

ditional funding to con-

tinue its core steam as-

sisted gravity drainage

(SAGD) pilot project at

Axe Lake.

Th e pending trans-

action for Wallace

Creek, announced on

Sept. 27, includes $40

million in cash and a

$20 million contingent

payment subject to “cer-

tain events” according to

a news release.

“Th is prospec-

tive transaction is good

news for Oilsands Quest

shareholders,” said chief

executive offi cer Garth

Wong.

“It will provide us

much of the capital we

need to complete the Axe

Lake pilot and prove the

commercial recoverabili-

ty of our highest priority

core asset.

“While Wallace

Creek has shown con-

siderable potential, it

is not yet as well delin-

eated as Axe Lake and

is therefore considerably

further away from com-

mercial development,”

said Wong

Th e prospective pur-

chase off er follows the

cancellation of a $60

million rights off ering

on Sept. 12 with news

the company had re-

ceived a letter of intent

for the possible sale of

Wallace Creek.

“Our decision to

cancel the rights off er-

ing considered that the

negotiation of a material

transaction had reached

an advanced stage – a

transaction that would

signifi cantly change our

use of proceeds described

in the rights off ering

prospectus,” explained

Wong.

“As well, it had be-

come apparent that we

would not achieve a full

$60 million subscription

through the rights of-

fering, perhaps at least

partially due to the weak

markets of recent weeks.

“We are striving to

return the company to a

solid fi nancial footing so

that we can move ahead

on unlocking the value

of the barrels of bitumen

we have in the ground.

We appreciate the pa-

tience of our sharehold-

ers through this chal-

lenging period.”

Oilsands Quest is

also evaluating fi nancing

alternatives including

a private placement of

equity or a new, smaller

rights off ering that will

continue to explore stra-

tegic partnerships or

further asset sales.

Completion of the

Wallace Creek trans-

action is subject to a

number of terms and

conditions, including

negotiation of a defi ni-

tive agreement, board

approvals, due diligence,

fi nancing and approv-

al by Oilsands Quest

shareholders.

Oilsands Quest an-

ticipates that a defi ni-

tive sale agreement will

be concluded by the end

of October and that the

transaction will close by

the end of December

2011.

A further announce-

ment will be made upon

the execution of a defi ni-

tive sale agreement.

Th e company has

held Wallace Creek in

its portfolio since Janu-

ary 2008, when it pur-

chased the 45,545-acre

permit.

Th e area is prospec-

tive for SAGD oilsands

recovery, subject to fur-

ther seismic and drilling

investment to delineate

the bitumen reservoir

more fully.

Th e company says

the exploration program

conducted over the past

three years has added

substantially to the

geological understand-

ing and potential of the

Wallace Creek reservoir,

as refl ected in the trans-

action price.

Oilsands Quest re-

ceived approval from Al-

berta Energy in June to

extend its Wallace Creek

permits for an additional

67 days to March 31,

2013 to allow for two

full seasons of winter ex-

ploration programs.

Th e company also

relinquished its licences

in Saskatchewan and its

southernmost contigu-

ous permits at Raven

Ridge in Alberta this

year to focus all of its ac-

tivities in Saskatchewan

on Axe Lake.

In addition, Oilsands

Quest received approval

from the government of

Saskatchewan to convert

portions of its Axe Lake

permits to 15-year leases

– the fi rst oilsands leases

in the province.

Th e proceeds from

the sale of the Wallace

Creek asset, if concluded,

will reduce the amount

of capital the company

requires to advance the

Axe Lake pilot project.

Th e proposed pilot

will consist of one pair of

100 metre long horizon-

tal wells, with the upper

well placed fi ve metres

below the glacial till cap,

or overburden, and is de-

signed to make use of the

existing surface facilities.

Oilsands Quest expects Wallace Creek sale

Serving S.E. Saskatchewan & Serving S.E. Saskatchewan &

Western ManitobaWestern Manitoba (Secor, Comply Works, and WCB compliant)(Secor, Comply Works, and WCB compliant)

Running Bear Rentals Ltd.

Box 395, Wawota Sask S0G 5A0306-575-8209

Light Towers 8kw 20kw


Dave: 306-461-4322Pat: 306-861-9986

• BEST trained most experienced staff

• BEST and newest equipment

• BEST engineering support

• BEST quality and service

• BEST choice for oilwell optimization

Calgary, Alta. – TransCanada Corporation’s

proposed Keystone XL pipeline is expected to gen-

erate more than 5,100 person years of employment

for Americans in South Dakota.

A new independent U.S. economic study says

the construction of the pipeline through the state

will stimulate the creation of those jobs from a com-

bination of construction work and spin-off jobs.

Th e report from the Perryman Group could

help the U.S. Department of State to determine if

the proposed pipeline is in the U.S. national interest

during its ongoing 90-day consultation period with

regulatory approval at stake.

If construction of the pipeline begins early in

2012, Keystone XL is expected be operational in

2013.

“Th is $7 billion pipeline project is shovel ready

and will put South Dakotans and thousands more

Americans back to work once construction begins,”

said Russ Girling, TransCanada president and chief

executive offi cer in a Sept. 29 news release.

“We will invest a total of $13 billion into the

entire Keystone pipeline system – all private money

with no government stimulus – to deliver Canadian

and American crude oil to the U.S Gulf Coast to

address the energy needs of Americans.”

Th e Perryman Group estimates that during con-

struction the project would lead to $470 million in

new spending for the South Dakota economy; in-

crease personal income by $319 million and boost

state and local tax revenues by more than $10 mil-

lion.

Th e study further concluded that once the pipe-

line is operational, South Dakota could see nearly

$685 million in property taxes to county and other

local governments during the operating life of the

pipeline, money that could be used to build new

roads, schools and hospitals.

Construction in South Dakota would consist of

seven new pump stations and over 314 miles of new

pipeline that would cross nine counties and is ex-

pected to employ over 3,050 construction workers.

Th e study notes the benefi ts of Keystone are not

limited to the states where it would be located.

From pipe manufactured in Arkansas, pump

motors made in Ohio and transformers built in

Pennsylvania, workers in almost every state in the

U.S. would benefi t from the project and the ongoing

development of Canada’s oil sands.

TransCanada says that within days of receiving

regulatory approval for Keystone XL, the project

would begin to put 20,000 Americans directly to

work during the construction phase.

Th is includes welders, pipefi tters, heavy equip-

ment operators and engineers to construct the proj-

ect that is expected to create an additional 118,000

total spin-off jobs (in person-years).

Th e Perryman study conservatively estimates the

permanent increase in stable oil supplies from the

Keystone XL pipeline will add more than 250,000

permanent jobs for U.S. workers and add more than

$100 billion in annual total expenditures to the U.S.

economy.

TransCanada and its supporters believe the

Keystone XL would also have a signifi cant ongoing

benefi t to the U.S. economy by providing a more sta-

ble, consistent and reliable supply of crude oil from

Canada versus importing crude oil from volatile, un-

stable regimes overseas that do not share the inter-

ests and values of Americans.

Th e proposed 2,673 kilometre pipeline to trans-

port crude oil from Hardisty, Alberta to delivery

points in Oklahoma and Texas received an environ-

mental clearance on Aug. 26 with the release of the

Final Environmental Impact Statement by the U.S.

Department of State.

TransCanada has voluntarily agreed with the

federal pipeline regulator to an additional 57 special

conditions that provide an even greater confi dence

in the operation and monitoring of the pipeline,

including: a higher number of remotely controlled

shut-off valves, increased pipeline inspections and

pipe that is buried deeper in the ground.

Keystone XL to pump jobs into South Dakota

Calgary, Alta. – Th e Energy Resources Conser-

vation Board (ERCB) has made four amendments

to its well-spacing framework for conventional and

unconventional oil and gas reservoirs.

Th e changes allow for enhanced conservation of

Alberta’s oil and gas resources by enabling compa-

nies to optimize resource recovery, in a safe, effi cient,

and responsible manner that maximizes the benefi t

of the resources for all Albertans.

Eff ective immediately, subsurface well-density

controls for coalbed methane and shale gas have been

removed across Alberta, and in certain gas zones in

southeastern Alberta.

In addition, baseline well densities have been

increased from one well to two wells per pool per

standard drilling spacing unit province-wide for

conventional gas reservoirs.

Centralized target areas for drilling spacing

units will now be standard throughout Alberta, with

the exception of a specifi c area in southeast Alberta

where corner target areas will be standard for gas

reservoirs only.

Regulation amendments have also been imple-

mented which decrease the complexity of the cur-

rent spacing framework.

Well spacing relates primarily to the subsurface

aspects of reservoir development and does not im-

pact the rights of landowners with respect to surface

development.

ERCB requirements for development of all

surface facilities, such as wells and pipelines, which

include public notifi cation requirements and allows

landowners to participate in ERCB processes, re-

main unchanged.

Well spacing relates primarily to the subsur-

face aspects of reservoir development and does

not impact the rights of landowners with respect

to surface development.

ERCB requirements for development of

all surface facilities, such as wells and pipelines,

which include public notifi cation requirements

and allows landowners to participate in ERCB

processes, remain unchanged.

ERCB adjusts well spacing framework


Supplementing both the Drilling and Production sectors of the Oilfield Industry. Tanker Units, Pressure Batch Trucks, and a Fully Equipped Pressure Batch Trucks, and a Fully Equipped

Service Truck are available. Service Truck are available.

We specialize in transporting Salt Water, Crude Oil, We specialize in transporting Salt Water, Crude Oil, Completions, Completions, Contaminated Mud & Fresh Water!Contaminated Mud & Fresh Water!

Office 1-306-453-4470Office 1-306-453-4470Fax 1-306-453-4404Fax 1-306-453-4404

Manager 1-306-577-9960Manager 1-306-577-9960Dispatcher 1-306-577-9801Dispatcher 1-306-577-9801

“Serving The Oil and Gas Industry “Serving The Oil and Gas Industry with 24 Hour Drilling Fluid Service”

Specializing in Non DamagingSpecializing in Non DamagingBiodegradable Drilling FluidsBiodegradable Drilling Fluids

Designed for Horizontal DrillingDesigned for Horizontal DrillingPO Box 1089, Carlyle, Saskatchewan S0C 0R0PO Box 1089, Carlyle, Saskatchewan S0C 0R0Phone: Phone: (306) 453-4411 (306) 453-4411 Fax: Fax: (306) 453-4404 (306) 453-4404

Division PresidentDivision President306-577-9900 (Carlyle)306-577-9900 (Carlyle)

Field Supervisor Field Supervisor306-421-0344 (Estevan)306-421-0344 (Estevan)

Field SupervisorField Supervisor306-452-8182 (Redvers)306-452-8182 (Redvers)

Warehouse ManagerWarehouse Manager306-577-3347(Carlyle)306-577-3347(Carlyle)

gg

Designing & Implementing Designing & Implementing Production Chemicals Production Chemicals

for Western Canadafor Western Canada

Cell: 306-575-7521Cell: 306-575-7521Of ce: 306-453-4414Of ce: 306-453-4414Fax: 306-453-4415Fax: 306-453-4415

mm g gg gf th Oilfi ld I d t T k U itf th Oilfi ld I d t T k U it

menting both the Drilling and Production menting both the Drilling and Production


Calgary Lloydminster Provost Redcliff Drayton Valley Kindersley Medicine Hat

Calgary Sales 403.264.6688

PPRODUCTION EQUIP. TANKS PUMPJACKS

The Oilfield Equipment People!TM

1.888.745.46471.888.745.4647Toll Free

Separators Treaters Free Water Knockouts

Pumpjacks Tanks Lineheaters Flare KO’s Compressors

NGL Bullets Primemovers Pumpskids Flarestacks

Gas Sweeteners Flowmizers Meterskids Dehydrators

Separators Treaters Free Water Knockouts

Pumpjacks Tanks Lineheaters Flare KO’s Compressors

NGL Bullets Primemovers Pumpskids Flarestacks

Gas Sweeteners Flowmizers Meterskids Dehydrators

PLATINUMPLATINUMEnergy GroupEnergy Group

www.platinumenergycanada.com

PUMPING UNITS

PIPELINE NEWSSaskatchewan’s Petroleum Monthly

C-SectionNovember 2011

Crane operator gets a lift from oilpatch

By Brian ZinchukEstevan – A love of lifting things has kept Dwight Packer in fi re-retardant coveralls while at the

controls of his cranes for 29 years.

Packer is the owner of Skylift Services Inc. of Estevan, the largest lifting operation in southeast

Saskatchewan.

“I got my fi rst boom truck in 1982, and have been expanding ever since,” Packer told Pipeline News.

Th e fi rst shop was built in 1983, a tiny 32 x 45 foot Quonset. “I wondered what I would do

with all the extra space,” he recalled.

Ever since, space has been at a premium. Th e old yard had numerous shop expansions

over the years, and fi nally, a new facility was built in the Frontier Peterbilt Industrial Park

east of Estevan. It was built in the summer of 2008, but they weren’t able to get into it

until the summer of 2009.

“We outgrew this shop before we moved,” he said, noting they use both yards.

In the early years, he started with a small portion of the old yard, then rented a

bit more yard space with each expansion.

“When I fi rst got into the business, I ran under L&C Trucking’s authority.

Walter Christenson helped me get started.”

Packer has been operating on his own since 1989.

“I bought my fi rst crane, a 35-ton, in 1987,” he said. “I bought a couple of

rough terrain [cranes] in 1989, a 15-ton and a 35-ton. In 1994, I built my

second shop, and had about four staff .”

Packer personally started out running cranes. He said, “It is a specifi c

skill, no doubt about it. I have had people tell me they can run anything

but fi nd that a crane is diff erent. One guy said he could run anything.

He got in the crane for one minute, and got out frustrated.

“You’re not moving the hook, you’re sort of chasing it, but you

know where it’s going,” he said.

As example, he noted that when a load is swinging into

position, positioning the boom over it causes it to stop.

“We have to make sure we know where everyone is, and

is out of the way.”

It’s apparent in his voice Packer has a love of cranes.

“I don’t just run cranes because I have to. I enjoy run-

ning cranes more than being in the offi ce.”

Page C2

Call Mike or Sean for more Call Mike or Sean for more information on all of the new and information on all of the new and used trucks and trailers we have used trucks and trailers we have

available for sale atavailable for sale at1-800-667-19301-800-667-1930 OR OR

check out our inventory online atcheck out our inventory online atwww.warnerindustries.cawww.warnerindustries.ca

• SALES• SALES• LEASING• LEASING• PARTS• PARTS• SERVICE• SERVICE• TRANSPORTATION• TRANSPORTATION

Regina Regina 330 4th Ave. E.330 4th Ave. E.

Moose JawMoose JawJct. N. Service Rd. Jct. N. Service Rd. & Hwy. 2 N.& Hwy. 2 N.

We have a great We have a great selection of new Doepker trailers selection of new Doepker trailers

available and on order.available and on order.Check online or give us a call Check online or give us a call

for a complete list!for a complete list!

Skylift's 120-ton crane lifts a tank into secondary containment. Photo submitted

Page C1Indeed, he’s often found running equipment,

even though his company is at a size where man-

agers tend to stay in the offi ce. His offi ce has a

direct entry from the shop area for easier acces-

sibility.

“I still get a big thrill out of lifting things,”

Packer said.

Varied fl eetTh e company’s fl eet covers a broad spectrum.

Th e smallest is a “Spyder crane.” It’s a tiny track-

mounted unit with outrigger legs that spread out

to look very much like a spider. When folded up,

it’s narrow enough to fi t through doorways and

into buildings. Th at unit was acquired about three

years ago.

“It goes in streaks. Lately, it’s been very busy,

or we’ll go a month without using it.”

Moving up in size is a 15-ton carry deck crane

on which the cab does not rotate with the boom.

Four rough-terrain cranes – a 15-ton, 35-ton

50 and 55-ton are next. Th e 50-ton was seen at

the Boundary Dam Power Station on the day of

the interview.

On the picker side, also known as boom

trucks, Skylift has 27, 30, 42 and 45-ton units. All

are equipped with fi fth wheels. Indeed, Packer ex-

plained. “We were the fi rst in the area to use fi fth-

wheel mount QMC pickers. Now everybody’s got

’em.”

For mobile cranes there are units in the 35, 60,

75 (two units), 90 and 120-ton sizes. Mobile cranes

can be identifi ed by their separate driving cab.

“We will have a brand new 110-ton Grove in the

yard,” Packer said, anticipating its delivery before the

publication of this paper.

With such a broad spectrum of lifting capacity,

Packer noted “Th ey all see their streaks. Right now,

my 75-ton Terex is the busiest. We do a lot of coiled

tubing at well sites. Th ey have to remove the coil be-

fore moving down the road. [Th e truck] would be

too heavy. [Th e coil] will go on a transport to the

location.

“In many cases, we’ll do the hauling as well,

transporting from one location to the next.”

Th ey have fi ve semi tractors and “a pile of trail-

ers.”

Other than coiled tubing, Packer said the com-

pany does a wide variety of work.

“We do a lot of facil-

ity work,” he said, not-

ing they were setting a

treater and header build-

ing at an NAL site that

day. Th e aforementioned

rough terrain crane was

at the power station, and

another crane was work-

ing on a coal-mining

dragline the day before.

“We do a lot of

pumpjacks – setting

them, maintaining them,

setting new ones. We

move and reset old ones.

Sometime’s they’ll settle, so we pick them up and

reset them.”

In addition to conventional lifting, they also do

some dropping – pile drivers, that is. “We do

driven piles. We have two pile rigs,” Packer said.

Th e drop hammer rigs are used with a pick-

er.

“A boom truck goes in, sets up quickly, and

tears down quickly,” he described. “It’s cost eff ec-

tive for smaller jobs.”

Skylift got into pile driving a dozen years

ago.

“We can do up to 16-inch piles and up to

about 51-feet long,” he said.

Recent growth“Most of our expansion has taken place in

the last six years. Oil has been a huge factor. Sas-

katchewan is the centre of the economic universe

right now. Th ere are power projects and oil,”

Packer said. “Th e coal mines give us lots of work

as well.”

“It’s an exciting time to be in the crane busi-

ness.”

Asked whether he would be looking at sub-

stantially larger cranes, Packer said those typical-

ly end up on project work, much further afi eld.

Th at’s contrary to his preference to remain rela-

tively close to home, within 200 miles. “It’s im-

portant to me to have everyone home at night, as

much as possible,” Packer said. “You can’t run a

business like this without people, and you

need to keep them happy.”

Skylift employs 28 people, but could

stand to add a perhaps one more crane

operator and one more picker operator.

“We try to grow from the inside, and

promote from within,” he said. “Th ey

grow up with the company, and don’t de-

velop habits we don’t like.”

“I’m very fortunate to have very ex-

traordinary people. I have the best peo-

ple. I know I do,” he said, adding that

included fi eld and offi ce staff .

“If everyone walked out tomorrow, I’d

shut the doors. You can’t do this without

them and I wouldn’t want to start over.

“Oil has been the mainstay over the

years. Power projects come and go. Th ey

[oil] are our bread and butter and have always been

at least 50 per cent of what we’ve done,” he conclud-

ed. “However, we do feel fortunate to have such a

diversifi ed customer base,” Packer said.

C2 PIPELINE NEWS November 2011

T. K. Trailer SalesManor, Sask. Ph: 1-306-448-2260; Cell: 1-306-575-7116

www.pjtrailers.com

DumpsDumps96” x 14’96” x 14’

60” x 8/10’60” x 8/10’ 78” x 10/12/14’78” x 10/12/14’

TiltsTiltsMakes Loading Makes Loading

Easy!Easy!

UtilitiesUtilitiesA variety to A variety to choose fromchoose from

Car Car HaulersHaulers

• COMMERCIAL • COMMERCIAL • FARM • FARM • OILFIELD • OILFIELD • PERSONAL• PERSONAL

2 & 3 Axle 2 & 3 Axle (various weights)(various weights)

8” I-Beam Frame8” I-Beam Frame

GoosenecksGoosenecks DeckoversDeckovers

We Now Sell LWe Now Sell LIGHTNINGIGHTNING CARGO TRAILERS! CARGO TRAILERS!

All AluminumAll Aluminum

Dan O’ConnorOperations Manager

204-748-5088

Office - Kola, MB.Office - Kola, MB.204-556-2464204-556-2464

Daylighting, Oilfield Hauling, Steaming & Mobile Pressure Washing, Winch, Water & Vac-uum & Computerized Certified Pressure Truck Services

Exciting times for crane operatorsDwight Packer lifts coiled tubing with a crane while Ryan Floden (below) coun-ters the wind with his tag line

PIPELINE NEWS November 2011 C3

Scott (Scooter) Boyes: 306-482-8886 Scott (Scooter) Boyes: 306-482-8886 Jason (Jake) Boyes: 306-482-8883 • Shawn (Gump) Boyes: 306-482-8313Jason (Jake) Boyes: 306-482-8883 • Shawn (Gump) Boyes: 306-482-8313

C

General Oil eld Hauling General Oil eld Hauling Serving Alberta, Saskatchewan and ManitobaServing Alberta, Saskatchewan and Manitoba

· Winch Trucks· Winch Trucks· Texas Bed Tri Drive· Texas Bed Tri Drive· Air Ride Equipment· Air Ride Equipment· 50 Ton Hiboys · 50 Ton Hiboys

· 50 and 60 Ton Scissorneck · 50 and 60 Ton Scissorneck Lowboys Lowboys· Tandem Axle Jeeps· Tandem Axle Jeeps· 30 Foot Gooseneck Hotshot Trailers· 30 Foot Gooseneck Hotshot Trailers

CLIFF NANKIVELLTRUCKING LTD.

Kalvin NankivellPresident

Claudia MullisVice-President

Of ce: (306) 462-2130Fax: (306) 462-2188

Box 123Kisbey, SK S0C 1L0

[email protected]

Phone: 634-5519 or 634-734124 Hwy. 39 E. Estevan

• GENERAL OILFIELD HAULING • TANK & TREATER MOVING • 24 HOUR PERSONALIZED SERVICE • PIPE CUSTODIAN • PUMP JACK HAULING

L & C Trucking

Estevan – While some might consider constantly

lifting heavy loads might be hard on the stress level,

that’s not how Kerry Goudy sees it.

Th e long-time picker operator is now a dis-

patcher with L&C Trucking in Estevan, a position

he has held for nearly two years. But prior to that, he

spent many years in the fi eld, mostly moving pipe.

“When I came into this, I didn’t know anything

about the oilfi eld,” Goudy said. “I worked at the

brickyard for 16 years.”

Goudy found himself working at Estevan Brick-

yard right out of high school, but when that job dried

up, it was time to turn to the oilpatch.

Goudy had a truck driver’s licence when he

started at L&C, as well as a rigging certifi cate, but

not a picker ticket.

“I took a fi ve month course when the brickyard

closed,” he said. “I needed something to do because

the brickyard was closing down. I needed somewhere

to go.”

He didn’t fi nd the course, which is heavy on load

charts and math, diffi cult. “I’m into that stuff . I didn’t

fi nd it hard. I never had a problem with math.”

“Anyone you talk to who has trouble, it’s the

math. Th eir main problem is the load charts area.

“You learn quick as a picker operator. You’ve

got to grab anything and everything. To be effi cient,

you’ve got to pay attention.

Page C4

Kerry Goudy has moved into the dispatch role after several years running pickers like the one be-hind him. Photo by Brian Zinchuk

Running picker? Not stressful. Dispatching? That’s stress


$190,000$190,000Rent to own

option available!!

ONLY 2 LEFT!SRI MODULAR HOMES FOR SALE

Right in Macoun (15 min. west of Estevan).

1,265 SQFT, 3 bedroom, 2 bath home

located on 80’ x 120’ lots.

1,000 SQFT pressure treated sun deck.

Call 421-3749

2011 Rental Price & Size Chart for 400bbl Tanks: 4 Panels X 4 Panels = 31’ X 31’ Good for One (1) OR Two (2) 400bbl Tanks. 4 Panels X 6 Panels = 31’ X 46’4” Good for Three (3) OR Four (4) 400bbl Tanks. 5 Panels X 6 Panels = 38’8” X 46’4” Good for Five (5) OR Six (6) 400bbl Tanks.

Rent: 400bbl Tanks, Mats, Secondary Containment, Self Powered Wireless Tank Gauges & Remote Tank Communication

Canada & USA Patent Pending

Containment Design

Lee (306) 487-7411 John (306) 487-7756 Keith (403) 909-3885

SSoutheast Rentals Ltd. Secondary Containment System Rentals

$375 / month

$440 / month

$500 / month

Crossover Stairs $ 85 / month

Save Time & Money with Fully Assembled Modular Walls Transportable & Expandable - Drop, Place and Pin Corners

[email protected]

36”

When hiring Scott Land, YOU hire the Advantage...• Surface Acquisitions, Freehold Mineral Leasing, Administration Projects• No project is too small or too large• Most active Land Company in Saskatchewan & Manitoba, with a proven 25 year track record• Experienced Field Agents• Competitive Rates, Including an Emerging Company Plan (ECP) package to all Junior Start-up Companies

1460 - 2002 Victoria AvenueRegina, SK S4P 0R7

Toll Free: 1-888-939-0000Fax# 306-359-9015

www.scottland.ca

Shaun Kozak, Mineral Manager 306-790-4352Chad Morris, Surface Manager 306-790-4363Celeste Farrow, Surface Coordinator 306-790-4378Laurie Bielka, Assistant Branch Manager 306-790-4360Crown Sale Inquiries 403-261-6580Main Line: 306-359-9000

Scott Land & Lease Ltd.

Page C3“You’ve got to be on

the ball. If it’s going to

go sour, it’ll go fast.”

Preplanning your

lifts is key, according to

Goudy, who said, “To

be a good picker opera-

tor, you’ve got to see the

end, and work your way

to the start. Th ere are

so many steps involved.

You make it so much

easier if you see the job

before you start it.”

Th ere’s also less

chance of missing some-

thing when you think

ahead, he added.

Most of his lifts

have been pipe and rods,

he explained, as L&C is

a pipe custodian, a com-

pany that takes care of

and transports pipe for

oil companies. “We haul

a lot of pipe.”

“In the fi eld, a lot

of times they don’t have

loaders. Drilling rigs

have loaders, but service

rigs don’t.

“In the beginning,

a lot was put on the

ground, on timbers.

Most guys just picked it

off the ground.”

He has also set a lot

of pumpjacks over the

years. Jacks have a lot of

things to tie down and

it needs to be done in a

certain manner so as to

not be overweight.

Goudy has also

had a lot of swampers.

Asked what makes a

good swamper, he said,

“One that pays attention

and basically does what

needs to be done. One

that knows where he

should be at all time.”

Th ey also have to

be willing to learn, he

added. A few of his

swampers have gone

on to become operators

themselves.

“Th e biggest thing

for a good swamper is

to be one that shows

up!” he said. “It’s nice to

have the same swamper

all the time, but that’s

not always a luxury.”

“It can be long

hours, but now with

complying with hours

of service [regulations],

you’re not out as much

as you used to be.”

One of his more

unique lifts was to lift a

roof off the foundation

where it was assembled

and over to the side.

Another operator in-

stalled it on the house

later. “Th at was pretty

interesting,” he said.

As for how he

ended up being one of

L&C’s three dispatch-

ers, Goudy said, “Th ey

asked me. Th ey needed

somebody to fi ll the

spot; I’d still be in the

picker.”

“Th e thing about

being in the picker is

there was no stress.

Any job they’d give you,

you’ve done a hundred

times.

Goudy describes

himself as laid back, but

said he still likes to get

the job done, and get it

done effi ciently.

Blair Hunter, whose

management duties

include looking after

L&C’s pickers, inter-

jected. “He’s not for

hire,” he said with a

smile. “Pickers are a hot

commodity right now.”

Coming to the dis-

patch side of things

from a picker opera-

tor experience makes it

“way easier to be a dis-

patcher,” Goudy said.

“Dispatching is high

stress. You’re not just

dealing with your job,

but everyone else’s jobs,

and their personalities.

You have to be neutral,

take it in, be a mediator,

and move one.”

“I’m a perfectionist.

I always have been. It’s

a trait of a good picker

operator. You have to

take pride in what you

are doing,” Goudy con-

cluded.

An L&C Trucking picker rolls down the street, leaving their principle yard on the east side of Estevan.

You've got to see the end, and work your way to the start


Estevan, SK

Arti cial Lift Systems 306.637.6055

Completion Systems 306.634.9339

Drilling Services 306.634.2924

Fishing & Re-Entry Services 306.634.2924

Rental Services 306.634.2924

Wellhead Systems 306.634.7600

Thru-Tubing Services 306.634.2924

Wireline 306.634.4726

Weyburn, SK

Testing and Production Services 306.842.2699

Secure Drilling Services 306.842.2699

(Nickle’s Daily Oil Bulletin) - Gibson Energy

Inc. and Palko Environmental Ltd. have entered

into an agreement providing for the acquisition by

Gibson of all of the issued and outstanding com-

mon shares of Palko not already owned, directly or

indirectly, by Gibson.

Under the terms of the transaction, sharehold-

ers of Palko may elect to receive either: (i) 0.1717

of a common share of Gibson for each Palko share;

or (ii) $3.05 cash for each Palko share; or (iii) a

combination thereof.

Th e total cost to Gibson is approximately

$62.7 million, including the assumption of esti-

mated net debt of approximately $15.95 million.

When combined with the company’s invest-

ments in Palko to date, pursuant to which Gibson

has acquired approximately 39 per cent of the out-

standing Palko shares, Gibson is paying an eff ec-

tive price of approximately $2.26 per Palko share

in order to acquire 100 per cent of Palko.

Th e transaction will expand Gibson’s Cana-

dian custom terminal operations to include water

disposal services and oilfi eld waste management.

“Th e acquisition of the remaining interest of

Palko is a key step in forming this platform to

meet the ever-increasing water disposal services

and oilfi eld waste management needs of the oil

and gas industry in North America,” Stew Han-

lon, president and chief executive offi cer of Gib-

son, said in a prepared release. “Palko represents a

strategic acquisition for Gibson. Combined with

our recent investment in the Plato pipeline, treat-

ing and disposal facility and development plans

for our Rimbey custom terminal, it creates a ser-

vice off ering in Western Canada that will make

Gibson a signifi cant player in this space.”

Th e combined platform, including Palko (100

per cent interest), Plato and Rimbey, represents an

investment by Gibson of $82 million for a total

estimated earnings before interest, taxes, deprecia-

tion, and amortization (EBITDA) contribution of

$16 million per year when fully operational.

“Th is expansion of Gibson’s custom terminal

service off ering across Western Canada will create

additional benefi ts in our trucking and market-

ing businesses due to the integrated nature of our

business model,” Hanlon said.

Th e transaction is to be completed through an

arrangement pursuant to the Business Corpora-

tions Act (Alberta) and is expected to be complet-

ed by the middle of December.

Completion of the transaction is subject to ap-

proval by Palko shareholders, court approval and

regulatory approvals.

Th e board of directors of Palko has unani-

mously determined, with the nominees of Gibson

abstaining, to recommend that Palko shareholders

vote their Palko shares in favour of the transaction.

Certain shareholders of Palko, collectively hold-

ing or controlling approximately 42.9 per cent of

the Palko shares (81.8 per cent of the Palko shares

when combined with the Palko shares already

owned by Gibson), have entered into agreements

with Gibson whereby they have irrevocably agreed

to vote their Palko shares in favour of the transac-

tion.

Th e terms of the transaction prohibit Palko

from soliciting or initiating any discussion re-

garding any other business combination or sale of

material assets, includes provisions for Gibson to

match competing, unsolicited proposals and, sub-

ject to certain conditions, provides for a $3 million

break fee payable by Palko to Gibson.

FirstEnergy Capital Corp. is acting as fi nan-

cial adviser to Palko. Scotia Capital Inc. is acting

as fi nancial adviser to Gibson with respect to the

transaction.

Gibson Energy to acquire Palko Environmental


2012 MAXEY 30’X102” FLATDECK GOOSENECK

2x11, 200 lb. dual wheel axles, 16” wheels,

flip-up ramps, 5’ pop-up rear center,

led lights, front spring loaded

drop-leg jacks, D-rings, full width

diamond plate toolboxSUPER PRICE AT $ 10,995.00!SUPER PRICE AT $ 10,995.00!

Carlyle R.V. & Leisure 306-453-6773 www.carlylerv.com

4wd Tractor /4wd Tractor /Vacuum Wagon Uni tsVacuum Wagon Uni ts

•Daily or Hourly Rates •Daily or Hourly Rates

•SECOR Certi ed •SECOR Certi ed

Call 306.421.6374 Call 306.421.6374 or 306.486.2110or 306.486.2110

www.harleydavidsonofyorkton.comwebs i te spec ia l s –

2012 HARLEY-DAVIDSON’S®®Now AvailableNow Available

Ask About Service Shop SpecialsHARLEY-DAVIDSON® of Yorkton, SK

Since 1984306-783-1999

NEWNEW

Early deposits or lay-away

terms recommended

Stoughton, Oungre, gain disposal facilities

Mike Irvine of Endurance Oil eld Supervision and Construction sets elevations for the new Palko fa-cility at Stoughton. Photo by Brian Zinchuk

Oungre, Stoughton – Waste management

company Palko Envi-

ronmental Ltd. is in the

process of adding two

new facilities in south-

east Saskatchewan, one

near Oungre, and a sec-

ond near Stoughton.

“Business has been

steady with activity in

the area,” said Kyle Pe-

terson, Palko area man-

ager.

Th e company start-

ed with a disposal well

north of Midale. Con-

struction at that facility

started in 2007. A waste-

processing facility was

added in 2009 to pro-

cess other oilfi eld waste

streams. In the mean-

time, the company grew

to include four locations

in Alberta. Th e Oungre

and Stoughton facilities

are the fi rst expansions

in Saskatchewan, but

not likely the last.

“We plan to con-

tinue to grow,” Peterson

said.

Th e Oungre facil-

ity is located two miles

south of Oungre along

Highway 35 at 1-16-

2-14-W2. It is licensed

to accept water-based

oilfi eld waste streams.

Some examples include

service rig completion

fl uids, spill fl uids, pro-

duction fl uids and frac

fl uids.

Th e Stoughton facil-

ity is six miles south of

the town at 16-21-7-8-

W2. It will essentially be

a mirror image of Oun-

gre’s he noted.

Peterson said the

two new facilities will

accept tank trucks only

at this time. Vac trucks

will continue to be re-

ceived at Midale.

Both new facilities

will have six 1,000-bbl.

tanks for receiving fl uids

and pumping, plus ad-

ditional 400-bbl. utility

tanks.

Both Oungre and

Stoughton will have

drive-through unloading

risers, meaning no back-

ing up for truckers. Four

unloading spots will be

set up at each facility, with

the ability to add more

as required. Stoughton

has an entrance and exit,

while Oungre has one

entrance/exit and a turn-

around loop.

Each of the new fa-

cilities is located adjacent

to a highway, for easy ac-

cess. “It is a benefi t, to be

right off the highway,”

Peterson said.

Five people will be

employed at each of

the new facilities – one

manager and four op-

erators per facility. Lead

operators from Midale

were promoted to man-

agement positions at the

new plants. Jim Weber

will look after Stough-

ton, while Glenn Claybo

will take care of Oungre.

In addition to the

new disposal wells, Pe-

terson said the company

has had other projects

on the go. “We’re on

the move here. We built

a dedicated tank farm,

8-17-6-13, for Cenovus

that opened mid-Octo-

ber. It’s a facility to man-

age service rig work over

and completion fl uids.”

Dallas Birnie will be su-

pervising this operation.

Good product goes

back to Cenovus, and

the waste stream is sent

to the Palko Midale

plant.

Th e tank farm is near

the Cenovus Goodwater

plant.

Palko has also con-

solidated its Saskatch-

ewan administration

functions in a new offi ce

on Railway Avenue in

Weyburn. “We moved

our administration from

Midale to Weyburn,”

Peterson said.

“We’re excited to

better secure our current

customer base,” Peterson

said. “Th e two locations

were a good fi t for us.”


Foord Trucking Ltd.Foord Trucking Ltd.

Phone: 306.421.1049Phone: 306.421.1049

Sand & Sand & GravelGravel

1305 - 9th Street Estevan • 634-64561305 - 9th Street Estevan • 634-6456

Indulge your craving...Indulge your craving...

Granby’s on 9th

succulent lobster, succulent lobster, fresh shrimp & fresh shrimp &

crab legs. crab legs. Our chef is serving Our chef is serving up fine cuisine sure up fine cuisine sure

to satisfy any to satisfy any Seafood lover.Seafood lover.

I love work! In fact, I love it so much that I could

watch it all day!

Th is love began early in my life. Growing up in

the new area of Pleasantdale in Estevan, watching

work was an alternative to play. Houses were be-

ing built all around us, and my young friends and I

would watch from the sidelines the fascinating world

of work. From the pouring of cement foundations

to the framing and fi nishing, there was always some-

thing interesting to see.

We also watched the milk delivery men, news-

paper and letter carriers, and the garbage collectors

do their work on our street.

At home, my siblings and I watched my mother,

a nurse, work at healing our minor scrapes and cuts.

My father contributed to my love aff air with work.

He often took my brother, sister and me to his law

offi ce on weekends when he went back to do work or

to meet clients after hours. While he did his work, we

also “worked,” answering the phones as receptionists,

taking shorthand and typing memos as secretaries,

and sitting behind the big desks as lawyers, dispens-

ing wisdom and advice.

I know that I am not the only person fascinated

with the watching of work. Th ere is a whole genre of

reality TV devoted to the fascinating world of work

Ice Road Truckers, Dirty Jobs, and How It’s Made to

name just a few.

One of the benefi ts of my work now is watching

others do their work, up close and personal. From

watching the rig crew run sucker rods off the trailer

into the hole to re-assembling the pump jack after

servicing, there is always something interesting to

see.

“Wow! Did you see that?” I exclaimed to Lyle,

the new part-time guy I was training. We were at

Frontier Inspections outside of Estevan, loosening

the straps on the trailer holding down the sucker

rods that we were returning.

Th e loader operator, Alan, had approached in

his loader with the forks spread wide. But before he

got to the trailer, he slowed right down and paused.

In one of the smoothest moves I have ever seen, he

dipped the forks of the loader down to ground level

and with the left side he used the huge pincher grip

to pick up a small piece of wood about four-inches

square. Th is wood had a big nail protruding out of

the centre of it, a potential problem for anyone driv-

ing on the grounds. He then reversed the loader,

turned, and deposited the off ending small scrap of

wood in an open dumpster.

I was amazed. Alan had used the huge loader to

pick up the small piece of wood as easily as I could

have if I had simply bent over and used my fi ngers.

I was nearly speechless. I didn’t think anyone other

than Dwight at Guardian had that level of skill with

a big loader.

I had long been impressed with Dwight’s skill.

Watching him in his loader scoot back and forth

around Guardian’s yard with a load of pipe was like

watching a dancer, fl uid yet disciplined. His knowl-

edge of his loader’s abilities and his own skill from

years of practice made it seem almost eff ortless to

the casual observer. I knew diff erent though. I had

seen others badly operate loaders at shops and drill-

ing rigs often enough to recognize real skill. Alan

had that skill as well, it would seem.

A few days passed. Th en a call came. I was be-

ing dispatched to pick up wash pipe from Guardian

and take it to location, where a picker was waiting to

unload it. I would be backhauling used sucker rods

to Frontier. “Got that?” the boss asked.

“Got it,” I replied. “I should pick up popcorn.”

“What?” the boss asked.

I had spoken out loud by mistake. Smiling, I

said “Nothing.” I was missing an afternoon movie at

home but I would get to watch something far more

interesting that day. Men at work!

Nadine lives in Estevan with her husband and family, and works as a hot shot driver in the oilpatch regularly delivering goods in and around Estevan and Shaunavon, and Sinclair and Waskada. Her mission, beyond delivering the goods quickly, is to have every in-teraction be a positive one. She can be reached at [email protected]

One Woman’s Perspective on Life, Liberty and the Pursuit of

Land Locations By Nadine Elson

Shifting Shifting GearsGears

Watching men at work

• Pressure Vessels & Well Testers

• Sour Well & Sweet Well Production Testing

• Frac Flowback Tesing

• Coil Clean Out Rig Ins and Returns Monitoring

• Supply Blowback and 400 bbl tanks

• Complete Trucking Services

Call Dale 306-861-3635Serving Weyburn,

Estevan, Stougton & Redvers

EMERGENCY RESPONSE EXERCISE


customizable • durable • mobile

Call:Rick Edmundson • 1- 403-348-1671

or Toll Free • 1-877-842-3288

www.officestogo.ca

Offi ces to Go are built with superior

construction to withstand the harsh-

est climates.

They are not only extremely durable

but also have a high end interior.

The v-nose construction allows for

better fuel economy and ease of

towing.Standard Features! • microwave

• fridge

• air conditioners

• dual pane thermal windows

• leather sofa bed

• electric heaters

• mud room fl oor

• R38 Insulation

• 15,000 LB Hitches

• tow hooks

• one piece walk on rubber roof

with 12 year warranty

By Brian Zinchuk

Goodwater – A small

plane had the misfor-

tune of not only com-

ing in for hard landing,

but also smashing into

an above ground carbon

dioxide facility used in

enhanced oil recovery.

Th e gas fl owing through

it was sour. What do to?

Th at was the sce-

nario for a mock disaster

training exercise held by

Cenovus Energy near

their Goodwater plant in

the south Weyburn fi eld.

Th e event took place on

Oct. 17.

“Today was a full

scale emergency re-

sponse exercise,” said

Twila Walkeden, com-

munity relations adviser

for Cenovus.

Describing what she

stressed was an exercise,

not a real-life emergen-

cy, Walkeden said, “We

had a plane crash into

one of our production

facilities near our central

receiving terminal where

we receive CO2 from

North Dakota. It was

just northeast of the vil-

lage of Goodwater.”

Th e simulation

was of a small airplane.

“Th ere were three people

in the plane, one casualty

and two walking wound-

ed,” she said.

“It crashed right

into one of our produc-

tion fi eld facilities. Part

of the wing damaged

one of our CO2 lines.

“Our CO2 does con-

tain H2S. Th ere was a

danger of an H2S leak

both from the crash to

the facility and damage

to the CO2 pipe.

“We activated our

emergency response

plan. We did everything

we could to contain the

incident and ensure the

safety of our employ-

ees, contractors, general

public and the environ-

ment,” Walkeden said.

“We engaged the lo-

cal fi re department and

EMS (emergency medi-

cal services) to be part of

this simulation.

Th e exercise was

something of an open

secret, due to the fact a

panic could have been

caused without ample

warning. Local residents

within a two-mile radius

received hand-delivered

letters informing them

of the impending exer-

cise, lest someone think

there was a real emer-

gency.

“A big part was not

interrupting people’s

lives and not causing

unnecessary alarm,” she

said.

Cenovus staff also

knew something was

coming up, but not when,

or what it might be.

Th e call went out

at 8 a.m. on a Monday.

Within 10 or 15 min-

utes, responders were on

the site, Walkeden said.

To amplify the

simulated reality of the

training scenario, there

was a smoke machine

and roadblocks set up.

Upwards of 25 re-

sponders from Ceno-

vus took part in vari-

ous capacities. Some

responded to the fi eld,

while others were in the

command centre, co-

ordinating calls from a

boardroom at the Good-

water plant. Th ere they

had fl owcharts to follow

for emergency response.

Participants were

given inputs they had to

react to, like wind direc-

tion and H2S level. Th ey

initially assessed the area

was safe to go into sour

gas-wise, allowing them

to triage and assist the

injured parties. Other

responders pretended

to isolate the facility by

engaging various valves

and controls.

An evacuation plan

was developed, and, for

exercise purposes, put

into play.

Page C9

Cenovus runs emergency response exercise

Emergency medical technicians Jason Schmidt (standing left) and Marvin Fox (standing right) aid Cenovus rst responder Rick Anderson (kneeling) in the assessment of injuries to one of the casualty of the mock plane crash. The role of the injured was played by Jerrod Bartlett of Industrial Electric in Weyburn.

Photo by Randy Schiller/Cenovus

Weyburn Fire Department rescuers Owen Skjonsby (standing left) and Joe Cayan (kneeling right) assessed the simulated injuries of Industrial Elec-tric’s Doug Reddaway. Reddaway was a casualty in a mock plane crash. Kevin Cooke (standing with vest) Cenovus emergency respons plan co-ordinator observed.



2– 2008 CASE IH 535HD 2010 NEW HOLLAND T9060HD 2– 2008 CHALLENGER MT965B

2002 CAT 966G CAT GP30K

1976 INTERNATIONAL FLEETSTAR

2010 JINMA 504

1976 INTERNATIONAL FLEETSTAR

2004 FORD F3502007 PETERBILT 389-131

2010 DEGELMAN 7000 70 FT QTY OF CONTAINERS2009 UTILITY 53FT

AUCTION SITE: Hwy 12 & Cory Rd. Sale Starts 8 AM

Auction Company License #309645

CURRENT INVENTORY INCLUDES: 13 – Ag Tractors

55 – Combines

51 – Headers

8 – Swathers

15 – Trucks

29 – Trailers

4 – Wheel Loaders

7 – Sprayers

10 – Air Drills

5 – Harrows

2 – Lake Lots

� Motor Scraper

� Grain Carts

� Skid Steer Att.

� Grain Vacs

� Snowmobiles & Quads

� Containers

For complete and up-to-date equipment listings visit

» rbauction.com

UNRESERVED PUBLIC AUCTION

Saskatoon, SaskatchewanNovember 30, 2011

DON’T MISS OUT.We are still accepting consignments for this auction. Don’t miss out: call & take the hassle out of selling your equipment or trucks.

Flexible contract options – straight commission, cash guarantee or outright purchase

Full-service auctions at our auction sites – or on your own property

Worldwide marketing of your assets

Convenient on-site and online bidding options

CALL TO CONSIGN: 306.933.9333

This plane fuselage that was staged in the mock incident. A smoke ma-chine was used to make the scene realistic. The simulated injured passen-ger on the ground was played by Doug Reddaway of Industrial Electric in Weyburn and the victim inside the plane was a mannequin.


Effective communication methods learned

Page C8 Walkeden said, “We

mock evacuated some residents due to

a [simulated] building collapse and H2S

leak. Th at resulted in a plume of gas

travelling towards two residences. Th e

reception centre was McKenna Hall [in

Weyburn].”

By 11:30 a.m., everything had

calmed down and was back to normal.

“We strive to create an incident-

free environment. We practice emer-

gency response processes in tabletop,

communication and full scale exercises

like the one we’re doing today. Th is is

just one of the things we do to protect

the health and safety of the public, our

workers, contractors and the environ-

ment,” Walkeden said.

All told, she said, “It went over very

well. You always learn things about the

process.”

Some of the pointers picked up in-

clude the use of eff ective communica-

tion. Th ere are times when using two-

way radio, which broadcasts to all with

a radio, is appropriate, and other times

when a more private cellphone is advis-

able, she noted.

Th e last time a similar exercise was

done was a few years ago. Th is exercise

was probably three months in the mak-

ing, she said.


Got Pain?Do you have BACK, SHOULDER, KNEE pain

or discomfort anywhere...

Call us TODAY for a FREE CONSULTATION!Do

How it works:

When applying RF energy to the

body where pain occurs, any

resistance encountered by the energy

ow will cause heat to be produced

at the site of maximum resistance.

The heat then breaks down scarred

or inactive tissue, replacing it with

new cellular function. It also re-

stimulates the circulation, adding

more oxygen to the injured area.

New collagen is stimulated to

rebuild itself in the deeper dermis

and subcutaneous layers, causing

improvement to the underlying

tissues, muscles or inner scar tissue

areas

See how this and many of our

other treatments can help

you achieve your professional

approach to personal beauty!

Testimonials coming soon at www.bellmedicalaesthetics.com

This new non-invasive radio frequency treatment can be effective to

manage pain on a range of body areas. Using our latest non-invasive RF

machines it is now possible to apply radio frequency waves directly to pain

related areas without cutting or damaging the skin.

(A process that is not detrimental or harmful to the outer or inner layers of

the skin)

Gone are the days when taking pain killers was the only way to address

annoying and acute pain. Modern pain management techniques have been

developed to ght pain caused due to illnesses, injuries or post-operative

procedures.

•Safe •No Risk •Non-Invasive

iii i i

3-419 Kensington, 3-419 Kensington,

Estevan, SK S4A 2H8 Estevan, SK S4A 2H8

(Strip Mall by Wal-Mart)(Strip Mall by Wal-Mart)

Ph: 306.634.6789 Fax: 306.634.6793

Ph: 306.634.6789 Fax: 306.634.6793

[email protected]

[email protected]

PAIN FREE

HAIR FREE

Get rid of unwanted hair

anywhere on your body

www.courageoil eld.com306-483-2130, Oxbow, Sk

Downhole | Steaming | washing | digging | daylightingWe have a unique, always expanding list of services:

• Portable Catwalks• Winch Truck

• Belly Dump Gravel Trailer

HydrovacHydrovac•Enviromental End Dump Trailer• Portable Washrooms• Dry Steamer•Free Standing Rod Rigs

Combo VacCombo Vac

Canadian Owned & Operated

Your SolutionsOur Commitment

SMS Equipment holds a unique position in the industry as a one-stop supplier of the most complete range of equipment. We offer only world-renowned brand names that meet your standards of reliability and productivity. With over 40 locations to serve you across Canada, SMS Equipment is your local equipment and solutions provider.

Saskatoon Branch:

1.306.931.00442907 Millar Ave

Saskatoon, SK S7K 6P6

Regina Branch:

1.306.359.31212351 Albert St. N

Regina, SK S4P 3C6

www.smsequip.com

By Brian ZinchukWeyburn – Cenovus Energy and

Apache teamed up with the Petroleum

Technology Research Centre and City

of Weyburn to create a new visitor in-

formation centre explaining, the pur-

pose of which is to explain their op-

erations in the area.

Th e two companies are the lead

players in the Weyburn-Midale proj-

ect, which uses carbon dioxide pumped

from North Dakota in a miscible

fl ood for enhanced oil recovery. For

the last ten years, the project has been

monitored by the International En-

ergy Agency’s Greenhouse Gas CO2

measuring, monitoring and verifi ca-

tion initiative. Th at monitoring project

is wrapping up, but the everyday work

in the Weyburn and Midale units is

ongoing.

Th e new Weyburn Energy Inno-

vation Centre was launched on Sept.

28.

Weyburn Mayor Deb Button not-

ed, “For 60 years. Weyburn has been

synonymous with oil and gas. Th e in-

dustry is part of the fi bre of Weyburn.

Th e industry’s future is our future.”

It’s no small wonder then that the

host of the new centre is none other

than Weyburn City Hall itself. A por-

tion of the upstairs of City Hall has

been dedicated to the display, which

includes several multimedia kiosks,

newspaper clippings about the project

from around the world, and even core

samples of rock from the oilfi elds in

question.

Cenovous Energy operates the

larger Weyburn fi eld, while Apache

operates the Midale fi eld.

“Companies like Apache and

Cenovus have played a huge role in

developing the Midale and Weyburn

fi elds. We are thrilled to host the new

centre in Weyburn City Hall,” Button

said.

Jeff Richards of the Weyburn

Chamber of Commerce and master

of ceremonies noted, “Weyburn is the

hub of energy innovation. Our goal is

to educate and promote.”

He noted it’s not like the old days,

where workers could easily take their

children out in the fi eld and show

them what they do. Th is facility allows

young people to get a glimpse of what

goes on in the patch.

Th e total cost of the centre is ap-

proximately $50,000, paid for jointly

by Cenovus, Apache, the public out-

reach mandate of the IEA-GHG

project, and the City of Weyburn.

Norm Sacuta, communications

manager with the PTRC, said, “It’s

a visitor information centre primarily

about the Weyburn-Midale oilfi elds

and the greenhouse gas project. We

wanted to show how long this has been

a producing fi eld, since the 1950s.”

Th e displays also show the City of

Weyburn’s ties to the oilpatch, and the

importance of those ties in the growth

of the city.

Th ere’s been a number of re-

quests by the general public to learn

more about the fi eld, Sacuta explained.

While the Cenovus Goodwater site

has something rare in the oilpatch – a

sign that says “Visitors” on the outside,

those visitors are generally government

offi cials and researchers. Th e City Hall

location allows for an outreach to the

general public.

Page C11

Weyburn Energy Innovation Centre launched

Information panels explaining the surrounding oil eld are part of the dis-play.


Gibson Welding Ltd.Oilfield Trucking & Rentals

John 861-1280Fax 842-1707

[email protected]. BOX 926, WEYBURN, SK S4H 2L2

• 35, 30 & 23 Ton Pickers• Bed Truck• Pipe Custodian• Pipe Racks• Rig Matts• Flarestack Sales & Rentals• Tubing Trailers• 400 BBL Test Tank Sales & Rental• Wellhead Sales & Installation• Backhoe & Skid Steer• Steamer• Crew Truck• Test Separators• Work Strings• Light Towers• COR CertifiedSECOR Certi ed

SURFACE BIT RENTALQUALITY RERUN & RETIP

24 HR SERVICECELL: 306-421-3726RES: 306-634-7538

CHAD FROESE OFFICE: 306-388-2941

Weyburn City Hall hosts information centre

A core sample of the Vuggy formation can be seen on display.

Page C10

“It’s an expensive process, and City Hall was

kind enough to donate the space for free,” Sacuta

said. “Th e City was really interested to use this as a

beginning of an oil and gas centre for the city.”

“Cenovus thought it was important to partner

with the PTRC and Apache to showcase the tech-

nology in this project. We’re hoping these shows the

attention to innovation,” said Twila Walkeden, rep-

resenting Cenovus at the ribbon cutting ceremony.

“Th e oilfi eld’s future is dependent on innovation

to get more oil out of the ground. Th e ‘low-hanging

fruit’ has been picked. Th e ‘high fruit’ will be tougher

to get to, and more expensive.”

She noted the Weyburn unit has 1.4 billion bar-

rels of initial oil in place.

“We’ve recovered about 25 per cent with pri-

mary and secondary recovery. Using enhanced oil

recovery, we estimate we can recover another 18 to

20 per cent. Th at’s still not even half. Th e other half

of the volume will be recovered by other means.”

Regarding the new information centre, Walkeden

said, “It is important to note these four organization

found it is really important to educate people about

the project. We’re extending the life of this fi eld, and

storing CO2.”

Apache senior reservoir engineer Bob McKish-

nie said, “We’re doing CO2 to enhance recovery and

extend the life of the fi eld. Part of the project is to

ensure the CO2 stays in the ground for future gen-

erations. Th e display educates future stakeholders.”

Th e research component of the IEA-GHG

project came to a close on March 31, Sacuta said.

“Th ere’s still some analysis of well integrity and some

soil sampling which we have done four diff erent

times in the past.”

Th at sampling was disrupted by the wet con-

ditions last spring, so it was moved to the last two

weeks of October.

Th e British Geological Survey is doing the

work. It will test 600 points, plus the Cameron and

Jane Kerr family land which is outside the injection

zone.

Th e Kerrs made national headlines in early 2011

when they expressed concerns that injected CO2

might be leaking onto their land.

Th e British Geological Survey study is separate

from the independent study being done on the Kerr

land by the International Performance Assessment

Centre for Geologic Storage of CO2 (IPAC-CO

2).

IPAC-CO2 performed studies on the land in Sep-

tember.

Th e IEA-GHG research project players are now

putting together a best practices manual, due in the

spring of 2012. Knowledge from this project will

fl ow towards four Alberta CO2 projects, according

to Sacuta.

Four multimedia kiosks are the heart of the Wey-burn Energy Innovation Centre, located in Wey-burn City Hall.


BRENT GEDAK WELDINGBRENT GEDAK WELDING126 Lamoro St.126 Lamoro St.

just off Hwy 39 W. of Estevanjust off Hwy 39 W. of Estevan

Of ce: (306) 634-5150Of ce: (306) 634-5150Fax: (306) 634-5148Fax: (306) 634-5148

• Water Disposal/Injection Skid • Water Disposal/Injection Skid Packages • Truck Unloading Packages Packages • Truck Unloading Packages • MCC/Lact Units • Header Packages • MCC/Lact Units • Header Packages • Vessel Packages • Pressure Piping • Vessel Packages • Pressure Piping Systems • Industrial Insulators • Rig Systems • Industrial Insulators • Rig

Repairs • Rig Matting • Utilidor Repairs • Rig Matting • Utilidor Buildings • 3-D Drafting Services Buildings • 3-D Drafting Services

• Self Framing Buildings• Self Framing Buildings

www.brentgedakwelding.comwww.brentgedakwelding.com

COR Certi edCOR Certi ed

SaskatoonSaskatoon – It’s a busy time for – It’s a busy time for crane operators in Saskatchewan, crane operators in Saskatchewan, according to Cory Cowley.according to Cory Cowley.

Cowley is the business man-Cowley is the business man-ager for International Union of ager for International Union of Operating Engineers Local 870, Operating Engineers Local 870, the provincial local based in Sas-the provincial local based in Sas-katoon. It’s the trade union that katoon. It’s the trade union that represents the crane operator trade represents the crane operator trade in Saskatchewan.in Saskatchewan.

“We’re sending out apprentices “We’re sending out apprentices left and right,” said Cowley, noting left and right,” said Cowley, noting they had three crane dispatches on they had three crane dispatches on the day the day Pipeline NewsPipeline News called. Th at’s called. Th at’s a pretty regular occurrence. a pretty regular occurrence.

Apprentices are dispatched at Apprentices are dispatched at a ratio of one apprentice for every a ratio of one apprentice for every three cranes on a site, allowing the three cranes on a site, allowing the apprentice to work with several apprentice to work with several cranes and gain experience. Op-cranes and gain experience. Op-erators can obtain their Red Seal erators can obtain their Red Seal journeyperson papers through the journeyperson papers through the national apprenticeship board.national apprenticeship board.

Th e in-class portion of train-Th e in-class portion of train-ing can be done through schools ing can be done through schools like SIAST. Cowley noted, “You like SIAST. Cowley noted, “You still have to go in the fi eld and do still have to go in the fi eld and do the work.”the work.”

OE crane operators are cur-OE crane operators are cur-rently seeing a lot of work in Re-rently seeing a lot of work in Re-gina, Saskatoon, North Battleford, gina, Saskatoon, North Battleford, Colonsay, Nipawin and Estevan. Colonsay, Nipawin and Estevan. Alberta is also booming. Crane Alberta is also booming. Crane

operators are in high demand, ac-operators are in high demand, ac-cording to Cowley. cording to Cowley.

During slow times, being a During slow times, being a member of a union can lead to work member of a union can lead to work elsewhere in the country. One pro-elsewhere in the country. One pro-vincial local might phone another vincial local might phone another and ask for a number of operators and ask for a number of operators to come to work on a project, he to come to work on a project, he explained. “It’s a foot in the door explained. “It’s a foot in the door to run a crane around Canada,” he to run a crane around Canada,” he said.said.

Most Local 870 hands are cur-Most Local 870 hands are cur-rently working in the province, he rently working in the province, he said.said.

Cowley would like to see the Cowley would like to see the pace of activity somewhat lower, pace of activity somewhat lower, noting the government is doing noting the government is doing “Fifty years of work in three days.“Fifty years of work in three days.

“Th e pace is ridiculous. We “Th e pace is ridiculous. We don’t need to do all the province’s don’t need to do all the province’s work in a short time. You want to work in a short time. You want to ensure there’s something to do in ensure there’s something to do in the future.”the future.”

However, he added, “We’ll However, he added, “We’ll take it when it’s here.”take it when it’s here.”

Indeed, there are large number Indeed, there are large number of Alberta hands working in Sas-of Alberta hands working in Sas-katchewan under the union’s aus-katchewan under the union’s aus-pices. But it’s not just Albertans. pices. But it’s not just Albertans. “We’ve got people from all over “We’ve got people from all over Canada working right now.”Canada working right now.”

Keystone XLKeystone XLOperating Engineers is also Operating Engineers is also

one of the four unions that pro-one of the four unions that pro-vides unionized labour for big-vides unionized labour for big-inch pipelines like the planned inch pipelines like the planned TransCanada Keystone XL TransCanada Keystone XL which has been held up by envi-which has been held up by envi-ronmental concerns. ronmental concerns.

“It’s a normal pipeline to me. “It’s a normal pipeline to me. With the technology in place, it With the technology in place, it should never be a problem,” said should never be a problem,” said Cowley, who is a pipeliner him-Cowley, who is a pipeliner him-self. He noted there are concerns self. He noted there are concerns with a truck running down the with a truck running down the road, too.road, too.

If, and when, Keystone XL If, and when, Keystone XL does get the go-ahead, there are does get the go-ahead, there are two spreads, or crews, expected two spreads, or crews, expected to work on the Saskatchewan to work on the Saskatchewan portion. Th at would entail sever-portion. Th at would entail sever-al hundred operating engineers al hundred operating engineers members, from dozer hands, ex-members, from dozer hands, ex-cavator operators, sideboom op-cavator operators, sideboom op-erators to picker operators and erators to picker operators and boring hands.boring hands.

“We have no idea when that “We have no idea when that pipeline will go,” Cowley said. pipeline will go,” Cowley said.

The International Union of Operating Engineers has several crane operators working at the Boundary Dam Power Station clean coal pro-ject. Photo by Brian Zinchuk

Crane operators in high demand


ELECTRICAL CONSTRUCTION, MAINTENANCE & SERVICE

PLC’S, VFD’SBATTERY CONSTRUCTION

TRENCHINGMOTOR SALES & REPAIRS

24 HOUR SERVICE62 DEVONIAN ST. ESTEVAN, SK.

PH: 637-2180 FAX: 637-2181LOCALLY OWNED & OPERATED

Enform COR Certi ed

OFFICE and DISPATCHOFFICE and DISPATCH306-457-3774306-457-3774

FORGET, SK.FORGET, SK.

Greg Cutler - 577-1950577-1950Ralph French - 577-8553Ralph French - 577-8553

• Clean Fresh Water Tankers Tankers

• Oil & Salt Water • Oil & Salt Water Transfers Transfers

• Service Work• Service Work

[email protected]@yourlink.ca

24 HR. EMERGENCY24 HR. EMERGENCY306-457- 3774306-457- 3774

NOW PROVIDINGNOW PROVIDINGHeater & HeatedHeater & Heated

Frac Water!Frac Water!

SPECIALIZING IN:SPECIALIZING IN:

Estevan - Less than

a year after moving into

its own facility in Este-

van, Fiberspar has ex-

panded its yardspace.

Th e company,

which makes spoolable

pipeline, is increasingly

busy, according to Der-

ek Daku, general man-

ager for their Canadian

operations.

“We rented all the

land to the road,” Daku

said, pointing to the

area to the west of their

building. “We have a

full fi ve acres now.”

Fiberspar’s yard is

on the east side of Es-

tevan, in the RM of Es-

tevan, about a half mile

north of Highway 39.

Th e additional land was

added in September.

Th e yard is fi lled

with spools of pipe, and

it’s all spoken for, ac-

cording to Daku. “We

have about 90 spools

right now. All that pipe

is sold already. I’ve got

six or seven semis com-

ing in today to replen-

ish it.”

Th e pipe comes

from their manufactur-

ing facility in Texas by

road and rail. Th e com-

pany is still considering

a southeast Saskatch-

ewan manufacturing fa-

cility. “I’m guessing next

year,” Daku said of the

timing.

Th e addition of

their own brand new

45-ton picker in March

has been a great boon to

customer service. Daku

said, “If someone calls

at 5 p.m., I can have it

loaded and ready in the

morning.”

Th ey also added

a new Peterbilt truck

for deliveries, bringing

the total to three – two

semis and a two-ton.

“We can haul out six

spools of pipe at any

given time, to diff erent

customers,” Daku said.

Th ey also now have

the ability to respool

smaller orders. A typi-

cal reel of pipe will have

1,700 metres of pipe.

Now they can do short

spools, 400 metres for

example, for less than

full reel orders.

As it stands now,

they are adding staff and

running hard. “Th ey’re

not slowing down for

the winter,” Daku said

of their customers.

“We’re growing so

fast, it’s overwhelming.

But we’re keeping up.

Th e Lloydminster loca-

tion is picking up. Th e

other one that’s picking

up is Shaunavon.”

Indeed, Fibespar

has leased land adjacent

to the railway tracks in

Shaunavon from the

local shortline railway.

When Pipeline News visited Shaunavon in

July, several of the large

distinctive green spools

of pipe could be found

in the railyard.

Cenovus, one of the

most active drillers in

the Shaunavon area, is

the big driver. “We have

approximately 60 miles

of pipeline to go in

there right now,” Daku

said.

Fiberspar has added more yard space, and lled much of it with spools of pipe. All of this pipe has been sold. Photo by Brian Zinchuk

Fiberspar adds yard space

This new 45-ton National Crane unit has been a great bene t to Fiberspar in Estevan.


G. T. & H Holdings Inc.Chad: 421-1896 (cell)Chad: 421-1896 (cell)Chad: 421-1896 (cell)Chad: 421-1896 (cell)Chad: 421-1896 (cell)Garry: 421-0529 (cell)Garry: 421-0529 (cell)Garry: 421-0529 (cell)Garry: 421-0529 (cell)Garry: 421-0529 (cell)

Estevan, Sk

SHOP FOR RENT• 60’ x 120’• 60’ x 120’• 60’ x 120’• 60’ x 120’• 60’ x 120’• 5 Overhead Doors• 5 Overhead Doors• 5 Overhead Doors• 5 Overhead Doors• 5 Overhead Doors• 16’ Ceiling• 16’ Ceiling• 16’ Ceiling• 16’ Ceiling• 16’ Ceiling

Estevan – Doug

Curtis spends a lot of

time with his eyes on gi-

ant spools of green pipe.

He’s the picker operator

for Fiberspar in Estevan.

December will mark

a year for Curtis at Fi-

berspar, after eight years

with L&C Trucking.

At L&C, he started out

as a swamper for three

months, drove truck for

a few more months, then

operated an eight-ton

knuckle boom.

From there he

graduated to crane-style

pickers.

Asked about the dif-

ference between the two,

he noted if a knuckle

boom can’t pick up a

load, it simply won’t. But

a crane style can pick up

a load, and then go over.

Not that that has hap-

pened to him, but that’s

the diff erence in opera-

tion.

He took a crane

course through Southeast

Regional College, and

has a Boom “A” ticket.

“Th e crane course is

tough. We did it in Es-

tevan. It was a week-long

course.”

Much of his work in

his previous job involved

hauling straight pipe.

Now it’s spooled pipe,

which can way around

17,000 pound for a 16-

foot spool, or 20,000

pounds for a 14-foot

spool.

Th e new National

Crane tri-drive 45-tonne

picker is equipped with

load sensors and a real-

time computerized read-

out of the load and the

crane’s capabilities at its

given boom length and

the angle of the boom.

“As you boom out, it

tells you how much your

load [capability] decreas-

es,” Curtis said.

Having an enclosed

cab that rotates 360 de-

grees with the boom is

an added bonus, espe-

cially in cold weather.

Curtis is a local boy.

“I grew up in Bienfait,

and I’ve never left,” the

29-year-old said. He

started in the patch at

age 21, after a few years

working at a local lumber

yard.


For Sale or LeaseBuilding, large wood frame building, steel clad roof, approx.

27,000 sq ft under roof, plus 4500 - 5000 sq ft offi ce area, sales area, bathrooms, conference room, offi ces. Excellent water supply. Suitable for oil fi eld services, construction, trucking location. Situ-

ated adjacent to Pipestone, MB within one half mile of Jct. 2&83 Hwy.

For more information call Gene Parks, 204-729-7118

Doug Curtis runs this new crane for Fiberspar in Estevan.


First a swamper, now a picker operator


Mechanical, Electrical & Instrumentation1-306-634-6877

Proudly serving our customers.Contact us today about your Construction, Fabrication & Maintenance requirements.

1-306-634-6877 www. intenergy.com

Flint is a market leader providing products and services for the energy industry from over 60 operating locations across North America. We’re your trusted partner for:

• Pipeline Construction• Facility Construction• Electrical and Instrumentation Services• Process equipment design and manufacturing• Fabrication and specialized transportation• Infrastructure construction management

Flint also offers Mechanical and Electrical services for:Compressor stations • Pumping stations • Meter stations

• Substations • Gas Plants • Oil batteries • Well Sites • Drill and service rigs • and more

If y

ou can dream it...

...WE CAN BUILD IT!We can design any custom trailer you can imagine!

CPS Belly/Side DumpsCPS Belly/Side Dumps

Any ConfigurationAny Configuration

Load Trail GoosenecksLoad Trail Goosenecks

Any size, spec, many in stockAny size, spec, many in stock

We alsoWe alsoofferoffer

• Open & Enclosed Trailers• Bathroom - Shower Trailers• Complete line of Pickups & SUV’s• Semis• Complete line of heavy duty trailers• Specialty TrailersAuto & Trailer SalesAuto & Trailer Sales

Kenmare, NDKenmare, ND. .

Nore’sNore’sTake advantage of the Canadian exchange rate and save thousands! We are only 30 miles south of the border!701-848-6572 or 701-848-6571701-848-6572 or 701-848-6571

View our complete inventory at www.noresauto.comView our complete inventory at www.noresauto.com

Call 421-3749 for info.

400 - 2000 sq. ft. of

office/retail space

• all utilities included• available now

Lowest price in town per square foot.

Estevan – Dayman Trucking Company Ltd. of

Estevan took delivery of a new, larger crane in mid-

October which will help the company handle ever-

growing loads.

Th e new Linkbelt 86100 hydraulic boom mo-

bile crane becomes the largest in their fl eet of lifting

equipment. Th e 100-ton crane replaces a similar 75-

ton crane acquired three years ago.

Th e “86” in the nomenclature stands for eight-

foot, six-inches wide, the maximum width allowable

on roads without being considered a wide load. It’s

capable of highway speeds, and was driven from the

factory in Lexington, Kentucky.

Equipped with a fi fth outrigger in the front, the

crane has a 360 degree load chart.

A mechanic from Edmonton spent a week with

Dayman Trucking, going through the new machine

with the operators, Bill Dayman and Todd Folkerts.

Dayman operates three pickers as well, ranging

from 30 to 42 tons. Th ey are a mix of QMC, DFI

and Weldco units.

“We could use two more, but you can’t fi nd op-

erators,” said Kip Dayman, who dispatches, drives,

and runs picker for the family company.

“Th e older one was only three year old,” he said,

explaining the purpose of the new unit, to handle

larger coiled tubing reels. “Th ey’re getting to be big-

ger reels for deepers zones. Some of these coils were

58,000 pounds, and we were fi ne with a 75-ton crane.

Now they are up to 75,000 to 80,000 pounds.”

Dayman projects even larger coils are on the

horizon. “In two years, it might not be big enough.

We’re hoping it is, but who knows?”

Th e crane will probably see about 20 per cent

of its usage in moving coiled tubing. Th e remainder

of the work is moving things like tanks and treater

packages.

“Everything is getting bigger. You just have to

keep up with it,” Dayman said. “We started with a

used 50-ton out of New Brunswick in ’92.”

Patriach passesLorne Dayman, who founded Dayman Truck-

ing with his wife Iris in 1956, passed away Oct. 8. He

was predeceased by Iris 12 years ago.

Crane upgrade for larger loads

Dayman Trucking's brand-new 100-ton Link-belt cranes hoists a coil of pipe, loading it into a Technicoil coiled tubing unit. This was one of the rst lifts for the newly delivered machine. Bill Dayman is at the controls.



KEEP THE THIRST TO BUILD, CREATE AND MAKE.

THE WAY CAM WORKS:

CAM MARSHALLPresident and CEO, Global Flow Inc.

BUSINESS BANKING IS ABOUT A SHARED PERSPECTIVE.At Canadian Western Bank, we see the world the same way as our customers. As a result, we take the time to understand your industry and provide banking solutions suited to your business needs. Discover insights and learn more at theworkingbank.ca.


Curly’s Picker Service Ltd.Curly’s Picker Service Ltd.Mark T. (Curly) Hirsch

1595 Dieppe Cres.Estevan, Sask.S4A 1W8

Secor Certi edCell: (306) 461-5898Fax: (306) 634-6690

GOUDY TRANSPORT INCGOUDY TRANSPORT INCStoughton, SK

Offi ce (306) 457-2785Email: [email protected]

Cell (306) 457-7692www.goudytransport.sasktelwebhosting.com

Rock, Gravel, Sand Clay Supply & DeliveryOil and Salt Water TransferContaminate Hauling & Service WorkEnd and Belly Dump TrucksSteamer/Vac Truck

COR Cer tif iedCOR Cer tif iedIRP 16IRP 16

Registered withRegistered withISNET WorldISNET World

COMPLY WORKSCOMPLY WORKS

HAULIN’ ACID INC.INC.

- 11 years accident free- COR Certi ed

Estevan, SK • 306-461-4000 Red Deer, AB • 403-304-6643

Member of:

• acid trucks• pressure pump

• shower truck• uid hauling

REDRIVER LUMBER LTD.REDRIVER LUMBER LTD.481 Devonian St. • Ph: 634-2114 or 634-2143

IN STOCK 3” x 12”3” x 12”10’ • 12’ 10’ • 12’

& 16’ long& 16’ long

We Deliver

To The

Rigsite

Weekdays 7:00 a.m. - 5:30 p.m.; Sat. 7:30 a.m. - 5:00 p.m. • After Hours Call CHAD 634-0195 or cell 421-1896

FOIL FACE INSULATION

Estevan – A little

over a year ago, Border

Insulators Inc. of Este-

van moved into a new,

much larger home. It’s

allowed the company to

spread out and grow.

Th e company got its

start in 1983, when com-

pany founder and presi-

dent Robert Saxon saw

an opportunity at home.

He was tired of working

all over the place, and

had been working at the

Key Lake uranium mine

when the new company

came together.

“I was an insulator

by trade. I saw an op-

portunity to start my

own operation,” he said.

“I got tired of trav-

elling.”

Around the same

time, Robert’s wife Car-

oline started a hair salon

in Estevan, which is still

in operation.

Border Insulators

work is in the oilfi eld,

industrial and commer-

cial work. “My fi rst job

was for Dome Petro-

leum, at the Steelman

Gas Plant,” Robert re-

called. Th at project was

miscellaneous repair

work, bringing it up to

standards.

Much of the ini-

tial work was wrapping

pipe, insulating and

metal-cladding vessels.

Raymond Lukye

was employee No. 1,

and is still with the fi rm,

looking after buildings.

After a year or so,

Saxon added a few more

employees. By 2010,

that number had grown

to 20 to 30 people, de-

pending on the time of

year. With that many

people, however, things

were getting cramped at

their old location in the

centre of Estevan.

“It was congested,

but we all fi t in,” Saxon

said.

Th ere’s a lot more

room in the new loca-

tion, going from a quar-

ter of an acre to fi ve

acres. But remarkably,

much of that space has

found usage. Along the

north fence, there’s a

row of completed pre-

fabricated buildings, al-

ready bought and paid

for. Th e main building

is on the east end, and

a second shop, added

recently, is on the west

end.

All of the Saxon

children are currently

involved with the com-

pany. Ryan works in

management; Robin

works in administra-

tion; Devin insulates

and constructs build-

ings; Mellissa builds

prefab buildings. How-

ever, their father notes,

they are treated like ev-

ery other employee.

Pre-fab buildings

“We started putting

up pre-fab buildings 20

years ago,” Saxon said. It

has been a growing part

of the business.

Prior to the use of

“sandwich board,” foam

insulation between alu-

minum sheets, compa-

nies would use wood

and clad it in metal.

Page C18

Dwayne Ludlow takes the door off a 400-bbl. tank.

Border Insulators spreads out


2008 D8T

1,200 hours MS RipperAngle Blade SU & Full U Blades

AvailableADTs • COMPACTION • CRAWLERS • EXCAVATORS • MOTOR GRADERS ADTs • COMPACTION • CRAWLERS • EXCAVATORS • MOTOR GRADERS

MOTOR SCRAPERS • TOOL CARRIERS • WHEEL LOADERS MOTOR SCRAPERS • TOOL CARRIERS • WHEEL LOADERS

CAT • KOMATSU • HITACHI • FIAT ALLISCAT • KOMATSU • HITACHI • FIAT ALLISKOBELCO • BELL • TEREX • SAMSUNGKOBELCO • BELL • TEREX • SAMSUNG #306 Wicklow Centre - 1133-4th Street, Estevan, SK#306 Wicklow Centre - 1133-4th Street, Estevan, SK

SUN VALLEY LAND LTD.

306-634-6684

www.sunvalleyland.ca • [email protected]

Estevan, SK 634-7276Estevan, SK 634-7276

Located off Located off Hwy 39 West, Hwy 39 West,

Lamoro St.Lamoro St.

Engineered Quality

Control

• CSA Approved Concrete • CSA Approved Concrete • Demolitions • Excavations • Demolitions • Excavations

• Sand and Gravel • Site Preparations • Sand and Gravel • Site Preparations • Water & Sewer• Water & Sewer

FULL CONSTRUCTION SERVICES FULL CONSTRUCTION SERVICES

INCLUDING:INCLUDING:

Page C17

“We were introduced to these

panels by a supplier. We said we’d give

it a whirl,” Saxon said.

During the rough patches, he

said they managed to pull through by

watching spending and hoping for the

best. Th e second rough period, in the

1990s, meant selling off some equip-

ment at 50 cents on the dollar.

Th e last 10 years have been in-

creasingly busy. Even in 2009, when

much of the oilpatch slowed down,

they didn’t, because infrastructure still

had to be completed.

Ryan Saxon explained they usually

operate in the fi eld with crews of three.

“You’re insulating lines to keep them

from freezing up.

“It is a must. If they don’t insulate

the lines, they’re out there with the

steamer.”

Typical locations include wellsites,

batteries and gas plants. Th ey have

eight service trucks for fi eld work.

It’s common now for electricians

to precede the insulators, applying heat

tracing (wire heaters) to piping before

the insulation is applied.

Insulating vessels keeps the heat in,

resulting in better separation of emul-

sion into its component parts. Th is is

often done by surrounding the vessel

in a pre-fabricated building.

About half of their work is piping,

the other half is buildings.

“To do a proper job, you have to

have both ends of the business,” Ryan

said.

Th e company also builds master

control centres, doghouses, site trailers

and offi ce trailers.

Border Insulators is in the fi nal

stages of receiving its Certifi cate of

Recognition, or COR.

A recent addition to Border Insulators work has been tank and equipment

rentals. Th e side venture is called R&R Tank and Equipment Rentals.

Ryan Saxon said, “We saw the opportunity with the shortage of tanks. We

started manufacturing our own tanks and got into the sales end, too.”

Th ey can build tanks with capacities varying from 100-bbl. to 2,000-bbl.

About 70 per cent are the common 400-bbl. test/production tanks, the majority

of which are equipped with an L-skid.

“Th ey can be used for frac tanks to production tanks,” he said. “We’ve got 36

rental tanks now.”

Th e company will soon be receiving a new roller and break sheer to assist in

the manufacturing of the tanks. Before they were using pre-rolled sheets.

Th e company also rents out telehandlers, manlifts and light towers.

R&R was another impetus for building a new, larger shop.

“We’re talking about expanding this shop already,” Saxon said. An addition

would have an overhead crane, allowing for easier assembly.

R&R Tank and Equipment Rentals

Several types of buildings offered

Mellissa Sax-on contructs a pre-fab build-ing. She most recently was working on CO2 capture research at International Test Centre at the University of Regina.

Right: R&R Tank and Equipment Rentals is a new side business for Border Insulators. They now build, rent and sell tanks, as well as provide other equip-ment rentals.

Resources Resources GuideGuide


JUSTIN WAPPEL - Division Manager

401 Hwy. #4 S. Biggar, SaskatchewanPO Box 879 S0K 0M0Ph (306) 948-5262 Fax (306) 948-5263Cell (306) 441-4402 Toll Free 1-800-746-6646Email: [email protected]

a l t u s g e o m a t i c s . c o m

Specializing in well site and pipeline surveys

Yorkton

306.783.4100

Weyburn

306.842.6060

Regina

800.667.3546

Swift Current

306.773.7733

Lloydminster

780.875.6130

Medicine Hat

403.528.4215

Edmonton

800.465.6233

Calgary

866.234.7599

Grande Prairie

780.532.6793

Lloyd Lavigne • Kirk ClarksonOwners/Managers

6506 - 50th AvenueLloydminster, AB

Phone: (780) 875-6880

5315 - 37th StreetProvost, AB T0B 3S0

Phone: (780) 753-6449

Fax: (780) 875-7076

24 Hour ServiceSpecializing in Industrial & Oilfield Motors

[email protected]

Aspen Custom Trailers

6017-84th Street S.E.

Calgary, AB T2C 4S1

[T] 403 236 2244[F] 403 236 8829[C] 403 813 6319[Toll Free] 877 236 2244

Lance WotherspoonRegional Sales Manager

LECLAIRTRANSPORT

Lyle LeclairCell: 306-421-7060

General Oilfi eld Hauling

Box 208 Estevan, SK S4A 2A3

461-8471 • 461-8472 • 461-8473

Call: Clinton Gibbons

Cordell JanssenCordell JanssenDistrict ManagerDistrict Manager

DownholeDownhole

93 Panteluk Street, Kensington Avenue N93 Panteluk Street, Kensington Avenue NEstevan, SaskatchewanEstevan, Saskatchewan

PHONE:PHONE: 306-634-8828 • 306-634-8828 • FAX:FAX: 306-634-7747 [email protected] • www.nov.com

NorseStar Ventures Inc.

Light Oil eld Hot ShotSteam Truck Services

(306) 621-7621(306) 457-8283

YOUR WORK BOOT HEADQUARTERS

1210 4TH STESTEVAN634-8232

202 MAINCARLYLE453-6167

112 2ND ST.WEYBURN842-3006

THE WORK WEAR STORE LTD.THE WORK WEAR STORE LTD.RON'SRON'S

RICK CORMIERManager

Box 609 Bus: (306) 634-8084Carlyle, SK Cell: (306) 577-8833S0C 0R0 Fax: (306) 453-6075www.truetorq.ca [email protected]

Ironhorse focuses on Pembina, Leon LakeIronhorse Oil & Gas

Inc. has entered into an

agreement to sell its 50

per cent working inter-

est in its gas property at

Shackleton, Saskatch-

ewan, for cash consid-

eration of $10.2 million

eff ective Aug. 1, 2011.

Th e anticipated closing

date was Oct. 26.

Pursuant to the

terms of the agreement,

the purchaser has placed

a cash deposit, equal to

10 per cent of the pur-

chase price, in trust with

their legal advisers.

“Th e sale of our nat-

ural gas property gives

us running room to pur-

sue our opportunity-rich

oil prospects,” said Larry

Parks, Ironhorse’s presi-

dent & CEO.

“Th is disposition al-

lows us to complete the

transition to an oil-based

production and reserves

growth platform.”

Ironhorse estimates

its daily production rate

after closing the sale of

Shackleton property will

be 75 boepd.

Net proceeds from

the sale of the Shackle-

ton property will be used

to pay down the com-

pany’s outstanding bank

debt, which is approxi-

mately $14.5 million.

Subsequent to the

sale of the Shackleton

property, the company’s

lender has agreed to a

$10.2 million credit fa-

cility comprised of a

$6.1 million primary

revolving facility and a

$4.1 million bridge fa-

cility.

Ironhorse intends

on further development

of the company’s proven

oil reserves at Pembina,

Alberta, as well as the

drilling of new oil op-

portunities at Leon

Lake, Saskatchewan.

At Leon Lake, the

company continued to

develop its oil resource

play with the drilling of

two (1.5 net) oil wells

in September. Th e two

wells were cased for Up-

per and Lower Shau-

navon oil and will be

completed later this fall.

Ironhorse worked

on a 3D seismic pro-

gram over the balance of

its lands at Leon Lake.

Results from the seismic

program are expected to

be interpreted by De-

cember.


Do you want to work for a progressive company that takes safety seriously and uses today’s newest technologically advanced equipment? If your answer is “yes”, we are interested in talking to you!We are currently seeking to fi ll the following positions in the Provost, Consort and Lloydminster areas.

Well Servicing Division

All applicants must have a valid driver’s license, as well as all of the required industry training for the position they are applying for. We offer higher than industry standard wages, an exceptional employee benefi ts package, several employee incentive programs and unlimited opportunity for advancement.

If you want to grow with a company where you are known by your name and not your employee number, please forward your resume to:

is an industry leader in Safety Services and is currently seeking

Safety Personnelto keep up with increasing customer demands.

If you are interested in becoming part of the TargetTeam and enjoying our growth with us, let us know!

Employment Opportunity

Please forward resume with copies of tickets to:

[email protected] or fax to780-870-5359

Experienced Oilfi eld Picker Operators

in Northern Alberta

• excellent hourly wages

• guaranteed monthly wage

• December, January, February, March

• camp supplied

• 3 weeks in, 1 week out

Call: 780-986-6235

OpportunitiesOpportunities

CareerCareer

Platinum Pumpjack Services Corp. has grown to be the largest Pumpjack sales and service company in Canada with operations in Lloydminster, Provost, Drayton Valley, Medicine Hat, and Kindersley. We are currently recruiting a motivated individual to work as:

FIELD FOREMAN FIELD FOREMAN (Lloydminster Facility)

Duties would include: Direct supervision of eld personnel. Scheduling, organizing and dispatching trucks to meet customer requests. Generating repair quotes for customers, and performing site visits to our large customer base. The successful candidate must be capable of working in a high paced environment, while keeping a well-organized work load. They should work well with people, be capable of organizing multiple customer orders at once, and have a good understanding of Microsoft Excel, and Word. We offer competitive salaries with bene ts package. Only the selected applicants will be contacted for an interview.

Résumés, including references, can be sent to:

Platinum Energy Services Corp.PO Box 10207Lloydminster, AB T9V 3A3

Fax: (780) 875-7149Email: aoracheski @platinumenergy.net

PUMPING UNITS

Invicta Energy Corp. has drilled, completed and

placed on production eight gross (4.4 net) horizontal

wells over the past couple of months at Kindersley,

Saskatchewan.

Of the eight wells drilled, six wells are still fl ow-

ing and two wells are pumping. Initial 30 day aver-

age gross production rates ranged from 20 barrels of

oil per day to 80 bpd with an average of 40 bpd.

Th e peak gross production rates from several in-

dividual wells exceeded 100 bpd during the fi rst 30

to 45 days. Th e best well reached a gross peak rate

of 150 bpd during a 48 hour production test. Th ese

rates do not include the solution gas which is cur-

rently being tied in and which should add another

100 boepd to 120 boepd of gross production. Peak

gross oil production from the property exceeded 350

bpd without the solution gas during August.

Invicta said it is confi dent that the Kindersley

property will provide drilling opportunities for the

next several years based on this past summer's drill-

ing results which have established over 100 drilling

locations. Of these, 15 locations at Kindersley are

being surveyed to be licensed and ready to drill in

the next few quarters.

Invicta's current net production is 245 boepd

(90 per cent light oil). Net production is expected to

increase to over 300 boepd in October with the tie-

in of the Kindersley solution gas.

Th e company's credit facility has doubled to $6

million from $3 million, based primarily on a review

of the production results from the recently com-

pleted drilling program at Kindersley. “We are very

pleased that our lender is supportive of our vision of

developing our Viking resource play in Kindersley,

Sask.,” Gordon Reese, Invicta president and chief

executive offi cer, said in a news release.

Th e company plans to spend approximately $4.8

million of capital in the fourth quarter to drill six

gross (3.75 net) wells at Kindersley, shoot two seis-

mic programs and participate in Crown land sales.

Total capital spending for 2011 is forecast to be $11

million to $12 million with exit production ranging

from 350 boepd to 400 boepd compared to a 2010

exit of 150.

Invicta drills at Kindersley

Heavy loadBetts Drilling Rig 1 is coming together. Here the derrick arrived in Estevan on Oct. 4.



CareerCareer


sanjel.com

Sanjel has current openings for experienced Driver/Operators, Supervisors and Coordinators in ALL of our Districts! ALL Class 1 & 3 Drivers with a mechanical aptitude and a keen interest in the Oil & Gas Services industry are encouraged to apply!

What’s in it for you??

Rotations that fit your lifestyle, comprehensive benefits, competitive total compensation packages… and that’s just the start! Enjoy continued personal and professional growth in a highly sought after working environment… all here at Sanjel.

Call us today, to speak to our Recruiters and see how YOU can be a part of the Sanjel team. Or for full position descriptions please visit our careers page at www.sanjel.com/careers/can.cfm

Be a part of the NEW ENERGY here at Sanjel!

** APPLY TODAY ** Build your career with Sanjel – Canada's largest privately-owned global oilfield services company. With the right people and the right solutions approach to maximizing our clients' well production, Sanjel is committed to: empowering our employees to be innovators; proactively providing a safe working environment that exceeds industry standards.

Please forward your resume to Sanjel: E: [email protected] F: 403.716.0333 Career Line: 1.800.9SANJEL

Looking to Put a New Energy into Your Career?

There’s a New Energy Here.

Acidizing Cementing Coiled Tubing Fracturing Nitrogen

Canada USA International

Lynco Construction LtdMidale, SK

Positions Include:• Maintenance Foreman

• Backhoe/Trackhoe Operators• Labourers

• Must have valid drivers licence• Must have safety tickets

(H2S and rst aid)

CAREER OPPORTUNITIESCAREER OPPORTUNITIES

Benefit package &

Benefit package &

Competitive wages

Competitive wages

EMAIL RESUME TO:EMAIL RESUME TO:

edwin. [email protected]. [email protected] fax to (306) 458•2297or fax to (306) 458•2297

REQUIRESREQUIRES

• Farm Laborers• Tractor Operators

• Back-hoe Operators• Mulcher Operators

• Class 1 Drivers• Journeyman Mechanic

Fax: 780-875-6334Fax: 780-875-6334email: [email protected]: [email protected]

Two Skylift Services cranes lifted the cover over a new cold storage facility for TS&M in Estevan on Sept. 29. Photos by Brian Zinchuk

The cover goes up and overThe cover goes up and over

CareerCareerOpportunities


Baker Hughes serves the worldwide oil and natural gas industry with reservoir consulting and products and services for drilling, formation evaluation, completion and production. We are leading provider for high-performance technology that creates value from oil and gas reservoirs. Virtually every product and service we provide is designed to lower costs, reduce risk or improve productivity during activities directly related to hydrocarbon extraction, advancing reservoir performance. Baker Hughes operates in over 90 countries serving independent, international and national oil companies. Our service network is organized into 23 Geomarkets operating in 9 regions and 2 hemispheres. Region and Geomarket management teams work to understand customer needs and coordinate delivery of individual products and comprehensive service solutions that include the right Baker Hughes technologies for the project.Baker Hughes offers opportunities for quali ed people who want to grow in our high performance organization. We are currently recruiting for an experienced Equipment Specialist to join the Baker Hughes team in Estevan, Saskatchewan.

The responsibilities of the position include, but are not limited to:Under direct supervision, develops and applies basic knowledge of standardized procedures, performs routine maintenance on tools, units, guns, and support equipment.Replaces expendable part, gaskets, seals, lines, ttings, explosives, radio-active supplies, etc.May pick up equipment at the rig site, test or re t equipment off the shelf. Conduct all business activities in accordance with Baker Hughes Health Safety and Environmental policies, Legal Compliance requirements and Baker Hughes Core Values.

Successful applicants will possess the following:Skill/KnowledgeMechanical aptitudeGood verbal and written communication skills

Education/Experience/TrainingHigh School Diploma or equivalentEntry level

At Baker Hughes we make a commitment to the success of each individual team member. We offer bene ts to chart your career path such as training, specialty assignments, cross-functional team projects, and much more. Additionally, Baker Hughes offers you the exibility - and opportunities - you need to achieve your career goals.Interested applicants are encouraged to please visit our website at www.bakerhughes.com/careers and explore one of the many other opportunities that we have to offer in other locations that you may be eligible for.

EQUIPMENT SPECIALIST

Fax or Email ResumeAttention Jerry or JoshFax: 306•636•[email protected] Devonian St. ~ Estevan, SK

Lloydminster Estevan

Apply online today at: www.frontierpeterbilt.com

While Frontier Peterbilt appreciates all applications received, we advise that only candidates under consideration will be contacted. Thank you for your interest for employment with Frontier Peterbilt Sales.

Frontier Peterbilt Sales Ltd. is an enterprising truck dealership with operations in Saskatoon, Regina Lloydminster and Estevan. Our ongoing development and phenomenal growth in the Truck Sales industry are evidence of the company's commitment to offering customers a comprehensive range of products which perform at optimum efficiency and provide valuable benefits.

We have built a high level of customer trust and satisfaction through our new and used truck inventory and parts availability and reliability, strong geographic presence, premium service, and unparalleled value. We have a strong mandate to continue to grow in the marketplace and to provide quality service for sales, repairs, and maintenance.

Frontier Peterbilt Sales Ltd. continually offer opportunities for our employees' career development, we have created an organization and a working environment aimed to attract, empower, reward, and retain the most dedicated, talented, and passionate individuals.

These positions offer a competitive and comprehensive compensation package.

Estevan •Heavy Duty/Truck & Transport

Technician •Used Truck Representative

•Service Manager •New Truck Sales Representative

•Lot Attendant

Lloydminster •Heavy Duty Technician

ConstructionSupervisors!!!

Jerry Mainil Ltd is an oil eld construction company that services Southeast Saskatchewan, and is currently

looking for aCONSTRUCTION SUPERVISOR

We are looking for a team oriented employee who has a clear understanding of facility construction and/or pipelining.This employee would be responsible for:- Leading a team of crews, operators, and labourers- Liaising with customers to determine their needs and requirements- Ensuring our employees adhere to company and customer rules, policies, and procedures- Ensure all work is performed safely and Regulations are being adhered toThe successful candidate would have:- Experience in pipeline construction and/or facility construction/maintenance- Strong organizational skills to align manpower, tools, equipment, and project resources- The ability to multi-task.- Understanding of the Saskatchewan Boiler Branch regulations and Z662 would be an asset.

We will offer a wage based upon experience and ability, a charge out bonus, as well as a group bene ts package and pension plan. You will also be home every night, along with a rotating weekend schedule.

If you’re interested in applying for this position, please email your resume to [email protected], or fax (306) 842-6560.

You can check out our website at www.jerrymainilltd.com

OPERATIONS MANAGERTurnbull Excavating requires the services of an Operations Manager. Turnbull Excavating requires the services of an Operations Manager. Reporting to the President, the Operations Manager will work with Reporting to the President, the Operations Manager will work with senior management overseeing and managing the corporate affairs of senior management overseeing and managing the corporate affairs of the construction and concrete divisions of the company.the construction and concrete divisions of the company.

Persons interested in this position must be capable of managing growth Persons interested in this position must be capable of managing growth and be a key component in developing, promoting, and planning for and be a key component in developing, promoting, and planning for future expansion.future expansion.

In addition the operations manager will work with managers andIn addition the operations manager will work with managers and employees on day to day functions plus direct human resources, employees on day to day functions plus direct human resources, recruiting, and Safety activities.recruiting, and Safety activities.

Candidates should have a broad base of education and training in Candidates should have a broad base of education and training in nance, marketing and administration duties. Sales and purchasing nance, marketing and administration duties. Sales and purchasing

experience would also be a de nite asset.experience would also be a de nite asset.

A relevant combination of experience and training will also be seriouslyA relevant combination of experience and training will also be seriously considered.considered.

Compensation package to commensurate with experience.Compensation package to commensurate with experience.

Turnbull Excavating Ltd. is a privately owned Estevan company Turnbull Excavating Ltd. is a privately owned Estevan company operating since 1984 and currently employs 50 plus people in various operating since 1984 and currently employs 50 plus people in various construction activities construction activities

Please forward resume to:Please forward resume to: Turnbull Excavating Ltd. Turnbull Excavating Ltd. Attention: Patrick Boyle Attention: Patrick Boyle Box 788, Estevan, SK, S4A 2A6 Box 788, Estevan, SK, S4A 2A6

or email to or email to [email protected]@sasktel.net

CareerCareer OpportunitiesOpportunities


Hydrovac Operators and Swampers

• Offering excellent wages• Excellent bene t package available

• Willing to train if necessary• Safety tickets an asset

• Operators must possess class 3A driver’s license• Living accommodation available

For more information call: Trevor at: 306-483-7777 or Kim at: 306-483-7722 Email resumes to: [email protected] or fax to: 306-483-2082

Labourers Required• Class 5 drivers licensed and safety

tickets preferred.

Tubular Repair Operator• Class 1A drivers a must

• Competitive wages and excellence bene t package available.

Interested individuals can fax resume to (306) 634-8025

Oil eld Labourers Required

To assist with oil eld tubular inspection in plant and on location.

Applicants must possess a valid class 5 drivers licence.

Oil eld experience preferred but not necessary. Training will be provided to

successful applicants. Please mail, email, fax or drop off resume to:

341 Imperial AvenueEstevan, Saskatchewan S4A 2H8Fax: 306-634-2606Email: [email protected]

No phone calls please.

L & C Trucking“Serving the Oil Patch for 54 Years”

DRIVERS

SWAMPERSCompetitive wages, health plan,

safety tickets an asset, but will

train. You will be home every night.

Over time paid after eight hours

Apply with resume in person, fax, mail or email to:24 Hwy 39 E., EstevanAttention: Norm MackBox 73 Estevan, SK S4A 2A2Email: [email protected]: 634-8699APPLICATIONS HELD IN STRICT CONFIDENCE

Journeymen Electriciansand Apprentices

PowerTech Industries Ltd. in Estevan is seeking

Journeymen Electricians and Apprentices for work

in the Southeast Saskatchewan Oil & Gas Industry.

Experience: 1 year (preferred) Safety Certifi cates

are needed. 1st Aid/CPR, H2S, WHMIS. Applicants

must have a valid driver’s license. Oilfi eld

background preferred. Full benefi ts packages and

RSP plan.

Duties: Day to day electrical construction and

maintenance in the oilfi eld.

Wage/Salary Info: Depending on experience &

qualifi cations.

To Apply: Fax: (306) 637-2181, e-mail

sschoff [email protected] or drop off resume to

62 Devonian Street, Estevan, SK.

Precision Well ServicingAs Canada’s largest well servicing contractor with 199 service rigs, Precision Well Servicing (PWS) provides customers with quality staff and equipment to provide a full slate of services including; completions, workovers, abandonments, well maintenance, high-pressure and

critical sour-well work and re-entry preparation.In Estevan we are looking for the following positions:

Shipper/ReceiverHeavy Duty Mechanic

Precision offers competitive wages, plus a comprehensive bene ts package. If you are interested in further information about Precision and the above opportunities please apply by:

Sending your resume to [email protected], by fax to

306-634-6053 or call 306-634-8886 or in person to 421 Mississippian Drive in Estevan.

Precision appreciates you interest in these career opportunities and thanks all applicants. Future correspondence will be limited to candidates selected

for interviews only.TSX: PD NYSE:PDS

Call John or Ginette 1-888-875-8111

orSend Resume to

Fax: 780-846-0005Email:

[email protected]

Location: Middle EastFor the following positions:

Field Supervisors, TMX Operators, & Flushby Operators

Minimum Quali cationsField Supervisor:• 10 Years Well-Servicing Experience• 5 Years Coiled Rod Experience• Strong computer skills – MS Of ce

Flush-By Operators:• 5 Years experience of hands on PCP and reciprocating arti cial lift systems• 2 years in a supervisory or lead role• Good mechanical aptitude• Strong computer Skills – MS Of ce

TMX Operators:• 2 years coiled rod experience • 5years Oil eld Service experience

All positions: • Require & possess a valid passport• Willing to work rotation in a isolated environment• Able to adapt in a multi-cultural environment

Rotation: 28 days in/ 28 days outSalary: Dependant on experience

Contact: [email protected]

Only those contacted for an interview will be considered

International Employment

Is hiring for the following positions at our Weyburn SK location:

Coil OperatorsCoil Helpers

Essential Coil & Stimulation Services is a company recog-nized for safety and excellence within the oil & gas industry. We currently provide services throughout Alberta & South-ern Saskatchewan. Class 1 driver’s license is preferred, but all class of drivers are welcome to apply. Previous oil eld

experience & valid tickets are an asset.

Essential offers above average wages, job bonuses, em-ployee savings plan, group bene t plan, scheduled days off

& training will be provided for the right candidates.

Great employees are Essential…come see what we have to offer!

Fax, email or drop off your resume & current drivers abstract

[email protected]: 403-580-8906

A vibrant & growing company


Calfrac has grown from a small oilfield services company to an international leader in fracturing and coiled tubing well services.

Rotational OpportunitiesWe’re hiring rotational employees for our Western Canada operations.

3-weeks-in, 2-weeks-out field positions:

2-weeks-in, 2-weeks-out maintenance positions:

Call us: Fax us: Apply online:

NOW HIRINGNOW HIRINGALL POSITIONSALL POSITIONS

Apply by email to:[email protected]

or fax: 780.955.2008est. 1980

780.955.5537Offering 2 Range III Top Drive Single Rigs and 5 Conventional Range II Single Rigs


CareerCareerPIPELINE NEWS November 2011 C25

We have been awarded the opportunity to supply a number of Inspectors to upcoming Main

Line Pipeline Projects.

We are looking for all levels of Facility and Pipeline Inspectors. Please email your resume to: [email protected] We are currently looking for

Construction Management Inspection

Safety

Office: 403.263.3929 Fax: 403.258.0444 Email: [email protected]

TIR Canada Inc. Suite 501 - 5920 Macleod Trail SW Calgary , AB T2H 0K2

INSPECTORS NEEDED

- Chief Inspectors - Senior Inspectors - Coating Inspectors - Utility Inspectors

- Welding Inspector - Civil Inspectors - Electrical and Instrumentation Inspectors

OVER 50 YEARS STRONG IN OILFIELD CONSTRUCTIONARNETT & BURGESS Oilfield Construction LimitedOiOiOiOilflflfieieieieldldldld CCCCononononststststrururuructctctctioioioion nn LiLiLimimimiteteteteddddddRRNENETTTT && BBURURGEGESSSS OiOiO lflfieieldld CCononststruructctioionn LiLimimitetedd

NOWNOW HiringCOME JOIN OUR TEAM! We’re hiring for various Pipeline construction

projects in the Regina area.Over 50 years strong, Arnett & Burgess Oilfi eld Construction Limited safely provides quality pipeline construction, facility installation, pipeline integrity, custom fabrication, maintenance and related contruction

services to the energy industry.

All positions require previous experience in Pipeline Construction. Previous experience on Pipeline Integrity projects is an asset.

• PIPELINE LABOURERS • PIPELINE FOREMAN• SUPERINTENDENTS

• HEAVY EQUIPMENT OPERATORS• WELDERS HELPERS

• WELDERS WITH B PRESSURE• PIPE FITTERS

Compensation:Highly Competitive wages

Overtime Daily Subsistence

Preferred Certifi cationsH2S Alive

Standard First Aid & CPR

Required Certifi cations Driver’s License

Ground Disturbance – Heavy Equipment Operators only

For more details and other career opportunities please visit:www.abpipeliners.com

For Inquiries please call: 403.290.7800

Please submit your resume to :[email protected]

CONSTRUCTION LTD.EXCAVATING, SAND AND GRAVEL • REDI-MIX CONCRETE

Glen Peterson Construction Ltd.314 - 6th Street, Estevan, SK S4A-2V7

Ph: 306•634•2741 Fax: 306•634•4643

Glen Peterson Construction, SK leader in aggregate, trucking concrete construction and sewer and water in-stallations, is growing. Immediate openings for:

Safety Coordinator:Must have COR safety program and all safety quali cations for Sewer and Water, Concrete construction and aggregate operations. Full time position. Fax resume to 634-4643 or phone Tyler at 421-3474

Technical Engineer:2 years experience. Must be able to run lieca survey equip-ment. Full time. Wages depend on experience. Fax resume to 634-4643 or phone Tyler at 421-3474

Of ce Dispatcher:Must be able to coordinate trucks, maintenance program of equipment, etc. Full time position. Fax resume to 634-4643 or phone Tyler at 421-3474

Sewer & Water Labourers, 4 Openings:$15 -$17/hour depending on experience. Phone Tyler at 421-3474

Equipment Operator:Experience in operating loaders, hoes, dozers, and crusher a de nite plus. Must be dependable. Full time position. Wage depending on experience. Fax resume to 634-4643 or phone Tyler at 421-3474

Diesel Mechanic:50-80K depending on experience. Must have tools. Experi-ence in diesel, hydraulics, electrical systems. Welding ability preferred. Fax resume to Tyler 634-4643 or phone 421-3474

Concrete Foreman, 2 Openings:2 years experience in all phases of concrete work. Wage depending on experience. Fax resume to 634-4643 or phone Sam at 421-1168

Concrete Labourers, 3 Openings:Must have reliable transportation, Wage $15 - $17/hour de-pending on experience. Fax resume to 634-4643 or phone Sam at 421-1168

Driver, 2 positions:Experience with tandems, belly dumps, loaders, A-Train, and B-Train. 1- licence required. Looking for a long term oppor-tunity? Fax resume to 634-4643 or phone Sam at 421-1168

Concrete Truck Driver, 2 Openings:Must have 3-A Licence, Wage $22 - $24/hour depending on experience. Fax resume to 634-4643 or phone Ken at 421-7119

Glen Peterson Construction Ltd. is an equal opportunity employer dedicated to a safe, drug-free workplace. We offer excellent wages and bene ts, plus overtime, incen-tives and bonus.

Fax: (780) 872-5239

Brady Oilfield Services LP.

1A, 3A Drivers/Owner Operators

Weyburn, Halbrite and surrounding area.Oil eld Safety Certi cates an asset but not

necessary. Bene ts package available.

Forward Resume and Drivers Abstract P.O. Box 271 Midale, Sask. S0C 1S0

Fax: (306) [email protected] [email protected]

(A Division of Total Energy Services Ltd.)

Total Oil eld Rentals in Midale and Carlyle is now hiring

-Picker Operators -Bed Truck Drivers

• Top wages offered, bene ts availableInterested individuals can fax resume to:

MidalePhone: 458-2811

Fax: 458-2813

CarlylePhone: 453-4401

Fax: 453-4402

Career Career OpportunitiesOpportunitiesC26 PIPELINE NEWS November 2011

Choose a CAREERwith us in the

vibrant oil industry! • Accepting applications.

• Always focused on safe work.

• Wages well above industry standard.

• Health benefi t plan (paid for by IWS).

• Steady work with scheduled days off .

• Room for advancement.

TO JOIN OUR TEAMEmail your resume to [email protected]

Fax (306) 634-2607 - Ph (306) 634-2336

Box 490 (477 Devonian St.) Estevan, SK S4A 2A5

www.independentwellservicing.com

•

•

• •

• • •

We thank all applicants for their interest; however, only those considered for an

interview will be contacted.

HEATER OPERATORSHEATER OPERATORSNeeded for high volume frac uid heating company.

Competitive base salary, job bonus and living allowance.

Clean driver’s abstact, H2S and First Aid required

Class 1A or 3A License required

Please phone John (306) 861-6065or Fax resume to (306) 842-1251

We are First Choice Energy Services, part of the First Choice Business Group, one of thefastest growing companies in Western Canada o ering oil eld services, wastemanagement and equipment rentals in Alberta and North Dakota. We are opening ano ce in Southeast Saskatchewan and we are looking for 2 key managers:

Produc on Tes ng Manager You will be responsible for hiring & training tes ng sta . You have the contacts todevelop business for mul ple tanks as well as related equipment and services.

Vacuum & Water Truck Manager & Dispatcher You will be responsible for business development, hiring & training and ensuring themaintenance of the eet.

We o er great salaries, bene ts and pro t sharing. Please forward your resume [email protected] or fax to 780-665-7108

Some of the many benefi ts to consider when applying for

a position at Bert Baxter Transport in Estevan:

• Full time, permanent employment • Full benefi ts packages available • Clean, safe work environment

Interested applicants can fax to: 306-634-4258 or email: [email protected]

JOURNEYMAN WELDERExperience in mig, tig and air arc welding preferred.


Over Over 28,00028,000 circulation circulationtargeting the Oil and Gas Sector!targeting the Oil and Gas Sector! YOUR ADVERTISING TEAMYOUR ADVERTISING TEAM

SW Sask - for all of your advertising needs contact:

Ph: 306.773.8260Fax: 306.773.0504

Doug EvjenSales Manager

[email protected]

Stacey [email protected]

NW Sask - for all of your advertising needs contact: Ph: 780.875.6685 Fax: 780.875.6682

Email: [email protected] ToblerSales Manager

SE Sask and SW Manitoba - for all of your advertising needs contact:Ph: 306.634.2654 Fax: 306.634.3934


SEISMICSEISMICDecember 2011 Focus Contact your Sales Rep to be a part of the focus edition

Cindy BeaulieuSales Manager

[email protected]

Glenys [email protected]

Deanna [email protected]

Kristen O’[email protected]

Teresa [email protected]

PIPELINE NEWSNEWSSaskatchewan’s Petroleum Monthly


Sales & Service we provide:

• Industrial & Hydraulic Hose

and Fittings • Pumps & Motors

• Valves • Cylinders

• Pneumatic Controls • Winches

• Pipe Handling Equipment

o Kelly Spinner o Pipe Spinner

o Rod Tongs o Tubing Tongs

“Your Drilling Rig Hydraulic Specialists”“Your Drilling Rig Hydraulic Specialists”

Website: www.wil-tech.ca

EstevanPhone: (306)634-6743

Address: 69 Escana Street, Estevan, Sask. S4A 2H7

Contact Information:

ReginaPhone: (306)721-1559

Address: 259 McDonald St. N., Regina, Sask. S4N 5W2

Services we provide:• Parker Store

• Full Machine Shop and

Fabrication

• 24 Hour Mobile Repairs and

Testing

• Complete System Design

• Hydraulic Crane Repairs

• Preventative Maintenance

• Power Unit Fabrication

pipeline news november 2011

Documents

cube acro alum

tontri drive

service rigs

cubehutchinson tc406

coil tubing

vac trailers

nal person remained

red crane